Anti-TIM-3 antibodies

12202894 ยท 2025-01-21

Assignee

Inventors

Cpc classification

International classification

Abstract

The present disclosure provides anti-TIM-3 antibodies or antigen-binding fragments thereof, isolated polynucleotides encoding the same, pharmaceutical compositions comprising the same, and the uses thereof.

Claims

1. An anti-TIM-3 antibody or antigen-binding fragment thereof, comprising: a heavy chain variable region CDR1 comprising the amino acid sequence of SEQ ID NO:1, a heavy chain variable region CDR2 comprising the amino acid sequence of SEQ ID NO: 3, a heavy chain variable region CDR3 comprising the amino acid sequence of SEQ ID NO: 5, a light chain variable region CDR1 comprising the amino acid sequence of SEQ ID NO: 2, a light chain CDR2 variable region comprising the amino acid sequence of SEQ ID NO: 4, and a light chain variable region CDR3 comprising the amino acid sequence of SEQ ID NO: 6.

2. The antibody or antigen-binding fragment thereof of claim 1, comprising a heavy chain variable region selected from the group consisting of SEQ ID NO: 7, SEQ ID NO: 11, and a homologous sequence thereof having at least 80% sequence identity to SEQ ID NO: 7 or SEQ ID NO: 11, yet retaining specific binding affinity to TIM-3; and/or comprising a light chain variable region selected from the group consisting of SEQ ID NO: 9, SEQ ID NO: 13, and a homologous sequence thereof having at least 80% sequence identity to SEQ ID NO: 9 or SEQ ID NO: 13, yet retaining specific binding affinity to TIM-3.

3. The antibody or antigen-binding fragment thereof of claim 1, comprising a heavy chain variable region comprising SEQ ID NO: 7 and a light chain variable region comprising SEQ ID NO: 9.

4. The antibody or antigen-binding fragment thereof of claim 1, comprising a heavy chain variable region comprising SEQ ID NO: 11 and a light chain variable region comprising SEQ ID NO: 13.

5. The antibody or antigen-binding fragment thereof of claim 1, further comprising an immunoglobulin constant region.

6. The antibody or antigen-binding fragment thereof of claim 1, further comprising a human IgG4 constant region or a human IgG1 constant region.

7. The antibody or antigen-binding fragment thereof of claim 1, wherein the antibody or antigen-binding fragment thereof is a humanized antibody, a single domain antibody, a diabody, a scFv, a scFv dimer, a BsFv, a dsFv, a (dsFv).sub.2, a Fv fragment, a Fab, a Fab, a F(ab).sub.2, a ds diabody, a nanobody, a scFv-Fc antibody, or a bivalent antibody.

8. The antibody or antigen-binding fragment thereof of claim 1, wherein the antibody or antigen-binding fragment thereof is capable of specifically binding to human TIM-3 at a K.sub.D value of no more than 510.sup.9M as measured by surface plasmon resonance, and/or wherein the antibody or antigen-binding fragment thereof is capable of specifically binding to human TIM-3 expressed on a cell surface at an EC.sub.50 of no more than 5 nM as measured by flow cytometry.

9. The antibody or antigen-binding fragment thereof of claim 1, wherein the antibody or antigen-binding fragment thereof is capable of specifically binding to cynomolgus monkey TIM-3.

10. The antibody or antigen-binding fragment thereof of claim 1, wherein the antibody or antigen-binding fragment thereof is linked to one or more conjugate moieties, wherein the one or more conjugate moieties comprise a clearance-modifying agent, a toxin, a detectable label, a chemotherapeutic agent, or a purification moiety.

11. A pharmaceutical composition comprising the antibody or antigen-binding fragment thereof of claim 1, and a pharmaceutically acceptable carrier.

12. A polynucleotide encoding the anti-TIM-3 antibody or antigen-binding fragment thereof of claim 1.

13. A vector comprising the polynucleotide of claim 12.

14. A host cell comprising the vector of claim 13.

15. A method of expressing an antibody or antigen-binding fragment thereof, comprising culturing the host cell of claim 14.

16. A method of inhibiting TIM-3 signaling pathway activity in a TIM-3-expressing cell, comprising exposing the TIM-3-expressing cell to the antibody or antigen-binding fragment thereof of claim 1.

17. A method of detecting the presence or the amount of TIM-3 in a sample, comprising: a) contacting the sample with the antibody or antigen-binding fragment thereof of claim 1; and b) determining the presence or the amount of TIM-3 in the sample.

18. A kit comprising the antibody or antigen-binding fragment thereof of claim 1.

19. An antibody or antigen-binding fragment thereof that binds to TIM-3, comprising a heavy chain variable region (VH) comprising VH CDR1, VH CDR2, and VH CDR3 that are identical to VH CDR1, VH CDR2, and VH CDR3 present in SEQ ID NO: 7 or 11; and a light chain variable region (VL) comprising VL CDR1, VL CDR2, and VL CDR3 that are identical to VL CDR1, VL CDR2, and VL CDR3 present in SEQ ID NO: 9 or 13.

20. The antibody or antigen-binding fragment thereof of claim 6, wherein the human IgG4 constant region comprises the amino acid substitution S228P.

21. The antibody or antigen-binding fragment thereof of claim 6, wherein the human IgG1 constant region (1) comprises one or more amino acid substitutions selected from L234F, L235E and P331S; or (2) comprises the amino acid substitution L328R and an arginine inserted after position 236.

22. A method of treating cancer in a subject, comprising administering to the subject in need thereof a therapeutically effective amount of the antibody or antigen-binding fragment thereof of claim 1.

23. The method of claim 22, further comprising administering an anti-PD-1 antibody to the subject.

Description

BRIEF DESCRIPTION OF FIGURES

(1) FIG. 1 shows binding of W3402-z3 to cell surface human TIM-3 (FIG. 1A) and cynomolgus monkey TIM-3 (FIG. 1B).

(2) FIG. 2 shows the result of W3402-z3 binding to activated, but not resting CD4.sup.+ T cells. FIG. 2A shows the binding histogram of W3402-z3 on activated or non-activated CD4.sup.+ T cells. The binding curve of W3402-z3 binding on to activated CD4.sup.+ T cells is shown in FIG. 2B.

(3) FIG. 3 shows the result of cross-family test. W3402-z3 binds specifically to human TIM-3 (FIG. 3A), with no cross-reactive binding to human TIM-1 (FIG. 3B) or TIM-4 (FIG. 3C).

(4) FIG. 4 shows the results of epitope binning assay suggesting that W3402-z3 is in the same or close epitope bin as benchmark W340-BMK4 (FIG. 4B); but not W340-BMK6 (FIG. 4A).

(5) FIG. 5 shows the results of reporter gene assay indicating that W3402-z3 can counteract the effect of TIM-3 and modulate TIM-3.sup.+ Jurkat post activation.

(6) FIG. 6 shows the results of human allogeneic MLR demonstrating that W3402-z3 can enhance the IFN production of human CD4.sup.+ T cell in a dose dependent manner.

(7) FIG. 7 shows the results of human antigen-specific MLR demonstrating that W3402-z3 can enhance the IL-2 production (FIG. 7A) of human CD4.sup.+ T cells in a dose-dependent manner, W3402-z3 can enhance the IFN production (FIG. 7B) as well as the proliferation (FIG. 7C) of human CD4.sup.+ T cells.

(8) FIG. 8 demonstrates that W3402-z3 can partially block the suppressive function of Tregs in regulating CD4.sup.+ T cell proliferation. FIG. 8A shows the CD4.sup.+ T cell proliferation in the presence of W3402-z3 alone or with Treg cells. FIG. 8B shows the percentage of inhibitory effect mediated by Treg in the presence of W3402-z3 or isotype control.

(9) FIG. 9 shows the result of ADCC test demonstrating W3402-z3 does not mediate ADCC activity on activated CD4.sup.+ T cells. Herceptin-induced BT474 cell lysis was used as positive control for the assay system.

(10) FIG. 10 shows the result of CDC test demonstrating W3402-z3 does not mediate CDC activity on activated CD4.sup.+ T cells. Rittman-induced Raji cell lysis was used as positive control for the assay system.

(11) FIG. 11 suggests that the W3402-z3 is stable in human serum at 37 C. for at least 14 days.

(12) FIG. 12 shows that W3402-z3 demonstrates a dose-dependent blockade of PtdSer-TIM-3 interaction with an IC.sub.50 of 35.47 nM.

(13) FIG. 13 shows that remarkable dose-dependent hTIM-3 down-regulation from the surface was detected as early as 4 hours post addition of the W3402-z3 into the cell culture.

DETAILED DESCRIPTION OF THE INVENTION

(14) The following description of the disclosure is merely intended to illustrate various embodiments of the disclosure. As such, the specific modifications discussed are not to be construed as limitations on the scope of the disclosure. It will be apparent to one skilled in the art that various equivalents, changes, and modifications may be made without departing from the scope of the disclosure, and it is understood that such equivalent embodiments are to be included herein. All references cited herein, including publications, patents and patent applications are incorporated herein by reference in their entirety.

Definitions

(15) The term antibody as used herein includes any immunoglobulin, monoclonal antibody, polyclonal antibody, multivalent antibody, bivalent antibody, or monovalent antibody that binds to a specific antigen. A native intact antibody comprises two heavy (H) chains and two light (L) chains. Mammalian heavy chains are classified as alpha, delta, epsilon, gamma, and mu, each heavy chain consists of a variable region (V.sub.H) and a first, second, and third constant region (C.sub.H1, C.sub.H2, C.sub.H3, respectively); mammalian light chains are classified as or , while each light chain consists of a variable region (V.sub.L) and a constant region. The antibody has a Y shape, with the stem of the Y consisting of the second and third constant regions of two heavy chains bound together via disulfide bonding. Each arm of the Y includes the variable region and first constant region of a single heavy chain bound to the variable and constant regions of a single light chain. The variable regions of the light and heavy chains are responsible for antigen binding. The variable regions in both chains generally contain three highly variable loops called the complementarity determining regions (CDRs) (light chain CDRs including LCDR1, LCDR2, and LCDR3, heavy chain CDRs including HCDR1, HCDR2, HCDR3). CDR boundaries for the antibodies and antigen-binding fragments disclosed herein may be defined or identified by the conventions of Kabat, IMGT, Chothia, or Al-Lazikani (Al-Lazikani, B., Chothia, C., Lesk, A. M., J. Mol. Biol., 273(4), 927 (1997); Chothia, C. et al., J Mol Biol. December 5; 186(3):651-63 (1985); Chothia, C. and Lesk, A. M., J. Mol. Biol., 196,901 (1987); Chothia, C. et al., Nature. December 21-28; 342(6252):877-83 (1989); Kabat E. A. et al., National Institutes of Health, Bethesda, Md. (1991); Marie-Paule Lefranc et al, Developmental and Comparative Immunology, 27: 55-77 (2003); Marie-Paule Lefranc et al, Immunome Research, 1(3), (2005); Marie-Paule Lefranc, Molecular Biology of B cells (second edition), chapter 26, 481-514, (2015)). The three CDRs are interposed between flanking stretches known as framework regions (FRs), which are more highly conserved than the CDRs and form a scaffold to support the hypervariable loops. The constant regions of the heavy and light chains are not involved in antigen-binding, but exhibit various effector functions. Antibodies are assigned to classes based on the amino acid sequence of the constant region of their heavy chain. The five major classes or isotypes of antibodies are IgA, IgD, IgE, IgG, and IgM, which are characterized by the presence of alpha, delta, epsilon, gamma, and mu heavy chains, respectively. Several of the major antibody classes are divided into subclasses such as IgG1 (gamma1 heavy chain), IgG2 (gamma2 heavy chain), IgG3 (gamma3 heavy chain), IgG4 (gamma4 heavy chain), IgA1 (alpha1 heavy chain), or IgA2 (alpha2 heavy chain).

(16) The term bivalent as used herein refers to an antibody or an antigen-binding fragment having two antigen-binding sites; the term monovalent refers to an antibody or an antigen-binding fragment having only one single antigen-binding site; and the term multivalent refers to an antibody or an antigen-binding fragment having multiple antigen-binding sites. In some embodiments, the antibody or antigen-binding fragment thereof is bivalent.

(17) The term antigen-binding fragment as used herein refers to an antibody fragment formed from a portion of an antibody comprising one or more CDRs, or any other antibody fragment that binds to an antigen but does not comprise an intact native antibody structure. Examples of antigen-binding fragment include, without limitation, a diabody, a Fab, a Fab, a F(ab).sub.2, an Fv fragment, a disulfide stabilized Fv fragment (dsFv), a (dsFv).sub.2, a disulfide stabilized diabody (ds diabody), a single-chain antibody molecule (scFv), an scFv dimer (bivalent diabody), a camelized single domain antibody, a nanobody, a domain antibody, and a bivalent domain antibody. An antigen-binding fragment is capable of binding to the same antigen to which the parent antibody binds.

(18) Fab with regard to an antibody refers to that portion of the antibody consisting of a single light chain (both variable and constant regions) bound to the variable region and first constant region of a single heavy chain by a disulfide bond.

(19) Fab refers to a Fab fragment that includes a portion of the hinge region.

(20) F(ab).sub.2 refers to a dimer of Fab. Fv with regard to an antibody refers to the smallest fragment of the antibody to bear the complete antigen-binding site. An Fv fragment consists of the variable region of a single light chain bound to the variable region of a single heavy chain.

(21) A dsFv refers to a disulfide-stabilized Fv fragment that the linkage between the variable region of a single light chain and the variable region of a single heavy chain is a disulfide bond. In some embodiments, a (dsFv).sub.2 comprises three peptide chains: two V.sub.H moieties linked by a peptide linker (e.g., a long flexible linker) and bound to two V.sub.L moieties, respectively, via disulfide bridges.

(22) Single-chain Fv antibody or scFv refers to an engineered antibody consisting of a light chain variable region and a heavy chain variable region connected to one another directly or via a peptide linker sequence (Huston J S et al. Proc Natl Acad Sci USA, 85:5879(1988)).

(23) Fc with regard to an antibody refers to that portion of the antibody consisting of the second and third constant regions of a first heavy chain bound to the second and third constant regions of a second heavy chain via disulfide bonding. The Fc portion of the antibody is responsible for various effector functions such as antibody-dependent cell-mediated cytotoxicity (ADCC), and complement dependent cytotoxicity (CDC), but does not function in antigen binding.

(24) Single-chain Fv-Fc antibody or scFv-Fc refers to an engineered antibody consisting of a scFv connected to the Fc region of an antibody.

(25) Camelized single domain antibody, heavy chain antibody, or HCAb refers to an antibody that contains two V.sub.H domains and no light chains (Riechmann L. and Muyldermans S., J Immunol Methods. December 10; 231(1-2):25-38 (1999); Muyldermans S., J Biotechnol. June; 74(4):277-302 (2001); WO94/04678; WO94/25591; U.S. Pat. No. 6,005,079). Heavy chain antibodies were originally derived from Camelidae (camels, dromedaries, and llamas). Although devoid of light chains, camelized antibodies have an authentic antigen-binding repertoire (Hamers-Casterman C. et al., Nature. June 3; 363(6428):446-8 (1993); Nguyen V K. et al. Heavy-chain antibodies in Camelidae; a case of evolutionary innovation, Immunogenetics. April; 54(1):39-47 (2002); Nguyen V K. et al. Immunology. May; 109(1):93-101 (2003)). The variable domain of a heavy chain antibody (VHH domain) represents the smallest known antigen-binding unit generated by adaptive immune responses (Koch-Nolte F. et al., FASEB J. November; 21(13):3490-8. Epub 2007 Jun. 15 (2007)).

(26) A nanobody refers to an antibody fragment that consists of a VHH domain from a heavy chain antibody and two constant domains, CH2 and CH3.

(27) Diabodies or dAbs includes small antibody fragments with two antigen-binding sites, wherein the fragments comprise a V.sub.H domain connected to a V.sub.L domain in the same polypeptide chain (V.sub.H-V.sub.L or V.sub.L-V.sub.H) (see, e.g., Holliger P. et al., Proc Natl Acad Sci USA. July 15; 90(14):6444-8 (1993); EP404097; WO93/11161). By using a linker that is too short to allow pairing between the two domains on the same chain, the domains are forced to pair with the complementary domains of another chain, thereby creating two antigen-binding sites. In certain embodiments, an scFv dimer is a bivalent diabody or bivalent ScFv (BsFv) comprising V.sub.H-V.sub.L (linked by a peptide linker) dimerized with another V.sub.H-V.sub.L moiety such that V.sub.H's of one moiety coordinate with the V.sub.L's of the other moiety and form two binding sites which can target the same antigen (or epitope).

(28) A domain antibody refers to an antibody fragment containing only the variable region of a heavy chain or the variable region of a light chain. In certain instances, two or more V.sub.H domains are covalently joined with a peptide linker to create a bivalent or multivalent domain antibody. The two V.sub.H domains of a bivalent domain antibody may target the same antigen.

(29) The term chimeric as used herein, means an antibody or antigen-binding fragment, having a portion of heavy and/or light chain derived from one species, and the rest of the heavy and/or light chain derived from a different species. In an illustrative example, a chimeric antibody may comprise a constant region derived from human and a variable region from a non-human animal, such as from mouse. In some embodiments, the non-human animal is a mammal, for example, a mouse, a rat, a rabbit, a goat, a sheep, a guinea pig, or a hamster.

(30) The term humanized as used herein means that the antibody or antigen-binding fragment comprises CDRs derived from non-human animals, FR regions derived from human, and when applicable, the constant regions derived from human.

(31) TIM-3 as used herein, is derived from any vertebrate source, including mammals such as primates (e.g. humans, monkeys) and rodents (e.g., mice and rats). Exemplary sequence of human TIM-3 includes human TIM-3 protein (NCBI accession number GI: 18182535). Exemplary sequence of TIM-3 includes Mus musculus (mouse) TIM-3 protein (NCBI accession number GI: 18182531), Rattus norvegicus (rat) TIM-3 protein (NCBI accession number GI 39725405), and Macaca fascicularis (monkey) TIM-3 protein (NCBI accession number GI: 355750365).

(32) The term TIM-3 as used herein is intended to encompass any form of TIM-3, for example, 1) native unprocessed TIM-3 molecule, full-length TIM-3 chain or naturally occurring variants of TIM-3, including, for example, splice variants or allelic variants; 2) any form of TIM-3 that results from processing in the cell; or 3) full length, a fragment (e.g., a truncated form, an extracellular/transmembrane domain) or a modified form (e.g. a mutated form, a glycosylated/PEGylated, a His-tag/immunofluorescence fused form) of TIM-3 subunit generated through recombinant method.

(33) The term anti-TIM-3 antibody refers to an antibody that is capable of specific binding TIM-3 (e.g. human or monkey TIM-3).

(34) The term specific binding or specifically binds as used herein refers to a non-random binding reaction between two molecules, such as for example between an antibody and an antigen. In certain embodiments, the antibodies or antigen-binding fragments provided herein specifically bind to human and/or TIM-3 with a binding affinity (K.sub.D) of 10.sup.6 M (e.g., 510.sup.7M, 210.sup.7M, 10.sup.7M, 510.sup.8M, 210.sup.8M, 10.sup.8 M, 510.sup.9M, 410.sup.9M, 310.sup.9M, 210.sup.9 M, 10.sup.9 M, 510.sup.10M, or 510.sup.11M). K.sub.D used herein refers to the ratio of the dissociation rate to the association rate (k.sub.off/k.sub.on), which may be determined by using any conventional method known in the art, including but are not limited to surface plasmon resonance method, microscale thermophoresis method, HPLC-MS method and flow cytometry (such as FACS) method. In certain embodiments, the K.sub.D value can be appropriately determined by using flow cytometry.

(35) The ability to block binding or compete for the same epitope as used herein refers to the ability of an antibody or antigen-binding fragment to inhibit the binding interaction between two molecules (e.g. human TIM-3 and an anti-TIM-3 antibody) to any detectable degree. In certain embodiments, an antibody or antigen-binding fragment that blocks binding between two molecules inhibits the binding interaction between the two molecules by at least 85%, or at least 90%. In certain embodiments, this inhibition may be greater than 85%, or greater than 90%.

(36) The term epitope as used herein refers to the specific group of atoms or amino acids on an antigen to which an antibody binds. Two antibodies may bind the same or a closely related epitope within an antigen if they exhibit competitive binding for the antigen. For example, if an antibody or antigen-binding fragment blocks binding of a reference antibody to the antigen by at least 85%, or at least 90%, or at least 95%, then the antibody or antigen-binding fragment may be considered to bind the same/closely related epitope as the reference antibody.

(37) Those skilled in the art will recognize that it is possible to determine, without undue experimentation, if a given antibody binds to the same epitope as the antibody of present disclosure (e.g., rat monoclonal antibody W3402-2.131.17 (also referred to as W3402 in the present disclosure), and humanized antibody W3402-2.131.17-z3 (also referred to as W3402-z3 in the present disclosure) by ascertaining whether the former prevents the latter from binding to a TIM-3 antigen polypeptide. If the given antibody competes with the antibody of present disclosure, as shown by a decrease in binding by the antibody of present disclosure to the TIM-3 antigen polypeptide, then the two antibodies bind to the same, or a closely related, epitope. Or if the binding of a given antibody to the TIM-3 antigen polypeptide was inhibited by the antibody of present disclosure, then the two antibodies bind to the same, or a closely related, epitope.

(38) A conservative substitution with reference to amino acid sequence refers to replacing an amino acid residue with a different amino acid residue having a side chain with similar physiochemical properties. For example, conservative substitutions can be made among amino acid residues with hydrophobic side chains (e.g. Met, Ala, Val, Leu, and Ile), among residues with neutral hydrophilic side chains (e.g. Cys, Ser, Thr, Asn and Gln), among residues with acidic side chains (e.g. Asp, Glu), among amino acids with basic side chains (e.g. His, Lys, and Arg), or among residues with aromatic side chains (e.g. Trp, Tyr, and Phe). As known in the art, conservative substitution usually does not cause significant change in the protein conformational structure, and therefore could retain the biological activity of a protein.

(39) The term homologue and homologous as used herein are interchangeable and refer to nucleic acid sequences (or its complementary strand) or amino acid sequences that have sequence identity of at least 80% (e.g., at least 85%, 88%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%) to another sequences when optimally aligned.

(40) Percent (%) sequence identity with respect to amino acid sequence (or nucleic acid sequence) is defined as the percentage of amino acid (or nucleic acid) residues in a candidate sequence that are identical to the amino acid (or nucleic acid) residues in a reference sequence, after aligning the sequences and, if necessary, introducing gaps, to achieve the maximum number of identical amino acids (or nucleic acids). Conservative substitution of the amino acid residues may or may not be considered as identical residues. Alignment for purposes of determining percent amino acid (or nucleic acid) sequence identity can be achieved, for example, using publicly available tools such as BLASTN, BLASTp (available on the website of U.S. National Center for Biotechnology Information (NCBI), see also, Altschul S. F. et al, J. Mol. Biol., 215:403-410 (1990); Stephen F. et al, Nucleic Acids Res., 25:3389-3402 (1997)), ClustalW2 (available on the website of European Bioinformatics Institute, see also, Higgins D. G. et al, Methods in Enzymology, 266:383-402 (1996); Larkin M. A. et al, Bioinformatics (Oxford, England), 23(21): 2947-8 (2007)), and ALIGN or Megalign (DNASTAR) software. Those skilled in the art may use the default parameters provided by the tool, or may customize the parameters as appropriate for the alignment, such as for example, by selecting a suitable algorithm.

(41) Effector functions as used herein refer to biological activities attributable to the binding of Fc region of an antibody to its effectors such as C1 complex and Fc receptor. Exemplary effector functions include: complement dependent cytotoxicity (CDC) induced by interaction of antibodies and C1q on the C1 complex; antibody-dependent cell-mediated cytotoxicity (ADCC) induced by binding of Fc region of an antibody to Fc receptor on an effector cell; and phagocytosis.

(42) Treating or treatment of a condition as used herein includes preventing or alleviating a condition, slowing the onset or rate of development of a condition, reducing the risk of developing a condition, preventing or delaying the development of symptoms associated with a condition, reducing or ending symptoms associated with a condition, generating a complete or partial regression of a condition, curing a condition, or some combination thereof.

(43) An isolated substance has been altered by the hand of man from the natural state. If an isolated composition or substance occurs in nature, it has been changed or removed from its original environment, or both. For example, a polynucleotide or a polypeptide naturally present in a living animal is not isolated, but the same polynucleotide or polypeptide is isolated if it has been sufficiently separated from the coexisting materials of its natural state so as to exist in a substantially pure state. An isolated nucleic acid sequence refers to the sequence of an isolated nucleic acid molecule. In certain embodiments, an isolated antibody or antigen-binding fragment thereof refers to the antibody or antigen-binding fragments having a purity of at least 60%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% as determined by electrophoretic methods (such as SDS-PAGE, isoelectric focusing, capillary electrophoresis), or chromatographic methods (such as ion exchange chromatography or reverse phase HPLC).

(44) The term vector as used herein refers to a vehicle into which a polynucleotide encoding a protein may be operably inserted so as to bring about the expression of that protein. A vector may be used to transform, transduce, or transfect a host cell so as to bring about expression of the genetic element it carries within the host cell. Examples of vectors include plasmids, phagemids, cosmids, artificial chromosomes such as yeast artificial chromosome (YAC), bacterial artificial chromosome (BAC), or P1-derived artificial chromosome (PAC), bacteriophages such as lambda phage or M13 phage, and animal viruses. Categories of animal viruses used as vectors include retrovirus (including lentivirus), adenovirus, adeno-associated virus, herpesvirus (e.g., herpes simplex virus), poxvirus, baculovirus, papillomavirus, and papovavirus (e.g., SV40). A vector may contain a variety of elements for controlling expression, including promoter sequences, transcription initiation sequences, enhancer sequences, selectable elements, and reporter genes. In addition, the vector may contain an origin of replication. A vector may also include materials to aid in its entry into the cell, including but not limited to a viral particle, a liposome, or a protein coating. A vector can be an expression vector or a cloning vector. The present disclosure provides vectors (e.g., expression vectors) containing the nucleic acid sequence provided herein encoding the antibody or antigen-binding fragment thereof, at least one promoter (e.g., SV40, CMV, EF-1) operably linked to the nucleic acid sequence, and at least one selection marker. Examples of vectors include, but are not limited to, retrovirus (including lentivirus), adenovirus, adeno-associated virus, herpesvirus (e.g., herpes simplex virus), poxvirus, baculovirus, papillomavirus, papovavirus (e.g., SV40), lambda phage, and M13 phage, plasmid pcDNA3.3, pMD18-T, pOptivec, pCMV, pEGFP, pIRES, pQD-Hyg-GSeu, pALTER, pBAD, pcDNA, pCal, pL, pET, pGEMEX, pGEX, pCI, pEGFT, pSV2, pFUSE, pVITRO, pVIVO, pMAL, pMONO, pSELECT, pUNO, pDUO, Psg5L, pBABE, pWPXL, pBI, p15TV-L, pPro18, pTD, pRS10, pLexA, pACT2.2, pCMV-SCRIPT, pCDM8, pCDNA1.1/amp, pcDNA3.1, pRc/RSV, PCR 2.1, pEF-1, pFB, pSG5, pXT1, pCDEF3, pSVSPORT, pEF-Bos etc.

(45) The phrase host cell as used herein refers to a cell into which an exogenous polynucleotide and/or a vector has been introduced.

(46) A TIM-3-related disease or condition as used herein refers to any disease or condition caused by, exacerbated by, or otherwise linked to increased or decreased expression or activities of TIM-3. In some embodiments, the TIM-3 related condition is immune-related disorder, such as, for example, cancer, autoimmune disease, inflammatory disease or infectious disease.

(47) Cancer as used herein refers to any medical condition characterized by malignant cell growth or neoplasm, abnormal proliferation, infiltration or metastasis, and includes both solid tumors and non-solid cancers (hematologic malignancies) such as leukemia. As used herein solid tumor refers to a solid mass of neoplastic and/or malignant cells. Examples of cancer or tumors include hematological malignancies, oral carcinomas (for example of the lip, tongue or pharynx), digestive organs (for example esophagus, stomach, small intestine, colon, large intestine, or rectum), peritoneum, liver and biliary passages, pancreas, respiratory system such as larynx or lung (small cell and non-small cell), bone, connective tissue, skin (e.g., melanoma), breast, reproductive organs (fallopian tube, uterus, cervix, testicles, ovary, or prostate), urinary tract (e.g., bladder or kidney), brain and endocrine glands such as the thyroid. In certain embodiments, the cancer is selected from ovarian cancer, breast cancer, head and neck cancer, renal cancer, bladder cancer, hepatocellular cancer, and colorectal cancer. In certain embodiments, the cancer is selected from a lymphoma, Hodgkin's lymphoma, non-Hodgkin's lymphoma and B-cell lymphoma.

(48) The term pharmaceutically acceptable indicates that the designated carrier, vehicle, diluent, excipient(s), and/or salt is generally chemically and/or physically compatible with the other ingredients comprising the formulation, and physiologically compatible with the recipient thereof.

(49) Anti-TIM-3 Antibody

(50) The present disclosure provides anti-TIM-3 antibodies and antigen-binding fragments thereof comprising one or more (e.g. 1, 2, 3, 4, 5, or 6) CDR sequences of an anti-TIM-3 antibody W3402-2.131.17 (also referred to as W3402 in the present disclosure).

(51) W3402 as used herein refers to a rat monoclonal antibody having a heavy chain variable region of SEQ ID NO: 7, and a kappa light chain variable region of SEQ ID NO: 9.

(52) W3402-z3 as used herein refers to a humanized monoclonal antibody having a heavy chain variable region of SEQ ID NO: 11, and a kappa light chain variable region of SEQ ID NO: 13.

(53) Table 1 shows the CDR sequences of these 2 anti-TIM-3 antibodies. The heavy chain and light chain variable region sequences are also provided below in Table 2 and Table 3.

(54) TABLE-US-00001 TABLE1 CDRaminoacidsequences CDR1 CDR2 CDR3 W3402 HCDR SEQIDNO:1 SEQIDNO:3 SEQIDNO:5 and GFSLTNYGVG IMTSGGSTYYN DGTTVETLFDY W3402- SALRA z3 LCDR SEQIDNO:2 SEQIDNO:4 SEQIDNO:6 RSSQSLSDSAGIT LASNLGS MQGIHVPLT YLY

(55) TABLE-US-00002 TABLE2 Variableregionaminoacidsequences VH VL W3402 SEQIDNO:7 SEQIDNO:9 QVQLKESGPGLVQSSQTLSL DVVLTQTPSTLSAIIGQSVSIS TCTVSGFSLTNYGVGWIRQP CRSSQSLSDSAGITYLYWYLQR PGKGLEWIAIMTSGGSTYYN PGQSPQLLIYLASNLGSGVPNR SALRARLNINRDTSKSQVFL FSGSGSGTDFTLKISGVEPEDL EVNSLHTEDTATYFCTRDGT GVYHCMQGIHVPLTFGSGTKLE TVETLFDYWGQGLMVTVSS IK W3402- SEQIDNO:11 SEQIDNO:13 z3 QVQLQESGPGLVKPSETLSL DIVMTQTPLSLSVTPGQPASIS TCTVSGFSLTNYGVGWIRQP CRSSQSLSDSAGITYLYWYLQK PGKGLEWIGIMTSGGSTYYN PGQSPQLLIYLASNLGSGVPDR SALRARVTINRDTSKNQFSL FSGSGSGTDFTLKISRVEAEDV KLSSVTAADTAVYYCTRDG GVYYCMQGIHVPLTFGQGTKLE TTVETLFDYWGQGTMVTVS IK S

(56) TABLE-US-00003 TABLE3 Variableregionnucleotidesequences VHnu VLnu W3402 SEQIDNO:8 SEQIDNO:10 caggtgcagctgaaagagtcaggacctggt gatgttgtgctgacccagactccatccacattatcg ctggtgcagtcctcacagactctgtctctcac gctattattggacaatcggtctccatctcttgcaggt ctgcactgtctctggattctcattaaccaacta caagtcagagtctctcagatagtgctggaatcacct tggtgtagggtggattcgccagcctccagg atttgtattggtatctacagaggcctggccaatctcc gaagggtctggagtggattgcaataatgaca acagcttctaatttatctggcatccaacctgggatct agtggtggaagcacatattacaattcagctct ggggtccccaacaggttcagtggcagtgggtcag cagagcccgactgaacatcaacagggaca gaactgatttcacactcaaaatcagtggagtggag cctccaagagccaagttttcttagaagtgaac cctgaggatttgggagtttatcactgcatgcaagga agtctgcacactgaagacacagccacttact atccatgttccgctcacgttcggttctgggaccaag tctgtaccagggatgggactacggtagaaa ctggagatcaaa ccctctttgattactggggccaaggactcatg gtcacagtctcctca W3402-z3 SEQIDNO:12 SEQIDNO:14 caggtgcagctgcaggagagcggccctgg gacatcgtgatgacccagacccctctgtccctgtcc actggtgaagcccagcgagaccctgtccct gtgacccctggacagcccgctagcatctcctgcag gacctgcaccgtgtccggcttctccctgacc gtcctcccagtccctgtccgattccgccggcatcac aactacggcgtgggctggatcaggcagcct ctacctgtactggtacctgcagaagcctggccagt cctggaaagggcctggagtggatcggcatc ccccccagctgctgatctacctggcttccaacctgg atgacctccggcggctccacctactacaact gctccggcgtgcctgacaggttctccggatccgg ccgccctgagggccagggtgaccatcaac ctccggcaccgacttcaccctgaagatctccaggg agggacacctccaagaaccagttctccctga tggaggccgaggatgtgggcgtgtactactgcat agctgtcctccgtgaccgctgccgataccgc gcagggcatccacgtgcccctgaccttcggccag cgtgtactactgcaccagggacggcaccac ggcaccaagctggagatcaag cgtggagaccctgttcgactactggggcca gggcaccatggtgaccgtgtcctcc

(57) CDRs are known to be responsible for antigen binding, however, it has been found that not all of the 6 CDRs are indispensable or unchangeable. In other words, it is possible to replace or change or modify one or more CDRs in SEQ ID NOs: 1-6, yet substantially retain the specific binding affinity to TIM-3.

(58) In certain embodiments, the anti-TIM-3 antibodies and the antigen-binding fragments provided herein comprise a heavy chain CDR3 sequence of SEQ ID NO: 5. Heavy chain CDR3 regions are located at the center of the antigen-binding site, and therefore are believed to make the most contact with antigen and provide the most free energy to the affinity of antibody to antigen. It is also believed that the heavy chain CDR3 is by far the most diverse CDR of the antigen-binding site in terms of length, amino acid composition and conformation by multiple diversification mechanisms (Tonegawa S. Nature. 302:575-81). The diversity in the heavy chain CDR3 is sufficient to produce most antibody specificities (Xu J L, Davis M M. Immunity. 13:37-45) as well as desirable antigen-binding affinity (Schier R, etc. J Mol Biol. 263:551-67).

(59) In certain embodiments, the antibodies and antigen-binding fragments thereof provided herein comprise suitable framework region (FR) sequences, as long as the antibodies and antigen-binding fragments thereof can specifically bind to TIM-3. The CDR sequences provided in Table 1 are obtained from rat antibodies, but they can be grafted to any suitable FR sequences of any suitable species such as mouse, human, rat, rabbit, among others, using suitable methods known in the art such as recombinant techniques.

(60) In certain embodiments, the antibodies and antigen-binding fragments thereof provided herein are humanized. A humanized antibody or antigen-binding fragment is desirable in its reduced immunogenicity in human. A humanized antibody is chimeric in its variable regions, as non-human CDR sequences are grafted to human or substantially human FR sequences. Humanization of an antibody or antigen-binding fragment can be essentially performed by substituting the non-human (such as murine) CDR genes for the corresponding human CDR genes in a human immunoglobulin gene (see, for example, Jones et al. (1986) Nature 321:522-525; Riechmann et al. (1988) Nature 332:323-327; Verhoeyen et al. (1988) Science 239:1534-1536).

(61) Suitable human heavy chain and light chain variable domains can be selected to achieve this purpose using methods known in the art. In an illustrative example, best-fit approach can be used, where a non-human (e.g. rodent) antibody variable domain sequence is screened or BLASTed against a database of known human variable domain sequences, and the human sequence closest to the non-human query sequence is identified and used as the human scaffold for grafting the non-human CDR sequences (see, for example, Sims et al, (1993) J. Immunol. 151:2296; Chothia et al. (1987) J. Mot. Biol. 196:901). Alternatively, a framework derived from the consensus sequence of all human antibodies may be used for the grafting of the non-human CDRs (see, for example, Carter et at. (1992) Proc. Natl. Acad. Sci. USA, 89:4285; Presta et al. (1993) J. Immunol., 151:2623).

(62) In certain embodiments, the humanized antibodies or antigen-binding fragments provided herein are composed of substantially all human sequences except for the CDR sequences which are non-human. In some embodiments, the variable region FRs, and constant regions if present, are entirely or substantially from human immunoglobulin sequences. The human FR sequences and human constant region sequences may be derived different human immunoglobulin genes, for example, FR sequences derived from one human antibody and constant region from another human antibody. In some embodiments, the humanized antibody or antigen-binding fragment comprise human FR1-4.

(63) In certain embodiments, the humanized antibodies and antigen-binding fragment thereof provided herein comprise one or more FR sequences of W3402-z3.

(64) The exemplary humanized anti-TIM-3 antibody W3402-z3 retains the specific binding affinity to TIM-3-expressing cell, and are at least comparable to, or even better than, the parent rat antibodies in that aspect. The exemplary humanized antibody retained its functional interaction with TIM-3-expressing cell, such as CD4.sup.+ T cells, in that it can trigger activated CD4.sup.+ T cell cytokine release of IFNgamma and IL-2, and partially block the suppressive function of Tregs in regulating CD4.sup.+ T cell proliferation.

(65) In some embodiments, the FR regions derived from human may comprise the same amino acid sequence as the human immunoglobulin from which it is derived. In some embodiments, one or more amino acid residues of the human FR are substituted with the corresponding residues from the parent non-human antibody. This may be desirable in certain embodiments to make the humanized antibody or its fragment closely approximate the non-human parent antibody structure. In certain embodiments, the humanized antibody or antigen-binding fragment provided herein comprises no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 amino acid residue substitutions in each of the human FR sequences, or no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 amino acid residue substitutions in all the FRs of a heavy or a light chain variable domain. In some embodiments, such change in amino acid residue could be present in heavy chain FR regions only, in light chain FR regions only, or in both chains.

(66) In certain embodiments, the antibodies and antigen-binding fragments thereof provided herein comprise a heavy chain variable domain sequence selected from the group consisting of SEQ ID NO: 7 or SEQ ID NO: 11. In certain embodiments, the antibodies and antigen-binding fragments thereof provided herein comprise a light chain variable domain sequence selected from the group consisting of SEQ ID NO: 9 or SEQ ID NO: 13.

(67) In some embodiments, the anti-TIM-3 antibodies and the antigen-binding fragments provided herein comprise all or a portion of the heavy chain variable domain and/or all or a portion of the light chain variable domain. In one embodiment, the anti-TIM-3 antibodies and the antigen-binding fragments provided herein is a single domain antibody which consists of all or a portion of the heavy chain variable domain provided herein. More information of such a single domain antibody is available in the art (see, e.g., U.S. Pat. No. 6,248,516).

(68) In certain embodiments, the anti-TIM-3 antibodies and the fragments thereof provided herein further comprise an immunoglobulin constant region. In some embodiments, an immunoglobulin constant region comprises a heavy chain and/or a light chain constant region. The heavy chain constant region comprises CH1, hinge, and/or CH2-CH3 regions. In certain embodiments, the heavy chain constant region comprises an Fc region. In certain embodiments, the light chain constant region comprises C or C.

(69) In some embodiments, the anti-TIM3 antibodies and antigen-binding fragments thereof provided herein have a constant region of an immunoglobulin (Ig), optionally a human Ig, optionally a human IgG. In certain embodiments, the anti-TIM3 antibodies and antigen-binding fragments thereof provided herein comprises a constant region of IgG1 isotype, which could induce ADCC or CDC, or a constant region of IgG4 or IgG2 isotype, which has reduced or depleted effector function. Effector functions can be evaluated using various assays such as Fc receptor binding assay, C1q binding assay, and cell lysis assay.

(70) Binding affinity of the antibody and antigen-binding fragment provided herein can be represented by K.sub.D value, which represents the ratio of dissociation rate to association rate (k.sub.off/k.sub.on) when the binding between the antigen and antigen-binding molecule reaches equilibrium. The antigen-binding affinity (e.g. K.sub.D) can be appropriately determined using suitable methods known in the art, including, for example, flow cytometry assay. In some embodiments, binding of the antibody to the antigen at different concentrations can be determined by flow cytometry, the determined mean fluorescence intensity (MFI) can be firstly plotted against antibody concentration, K.sub.D value can then be calculated by fitting the dependence of specific binding fluorescence intensity (Y) and the concentration of antibodies (X) into the one site saturation equation: Y=B.sub.max*X/(K.sub.D+X) using Prism version 5 (GraphPad Software, San Diego, CA), wherein B.sub.max refers to the maximum specific binding of the tested antibody to the antigen.

(71) In some embodiments, the anti-TIM-3 antibodies and antigen-binding fragments thereof provided herein are capable of specifically binding to human TIM-3 with a binding affinity (K.sub.D) of no more than 510.sup.9M, no more than 410.sup.9M, no more than 310.sup.9M, no more than 210.sup.9M, no more than 10.sup.9M, no more than 510.sup.10 M, no more than 410.sup.10 M, no more than 310.sup.10M, no more than 210.sup.10M, no more than 10.sup.10 M, no more than 510.sup.11 M, or no more than 410.sup.11 M as measured by surface plasmon resonance (SPR).

(72) In certain embodiments, the anti-TIM-3 antibodies and antigen-binding fragments thereof provided herein cross-react with cynomolgus monkey TIM-3.

(73) Binding of the antibodies to human TIM-3 can also be represented by half maximal effective concentration (EC.sub.50) value, which refers to the concentration of an antibody where 50% of its maximal effect (e.g., binding or inhibition etc.) is observed. The EC.sub.50 value can be measured by methods known in the art, for example, sandwich assay such as ELISA, Western Blot, flow cytometry assay, and other binding assay. In certain embodiments, the antibodies and the fragments thereof provided herein specifically bind to human TIM-3 at an EC.sub.50 (i.e. 50% binding concentration) of no more than 0.25 nM, no more than 0.3 nM, no more than 0.35 nM, no more than 0.4 nM no more than 0.45 nM, no more than 0.5 nM, no more than 0.6 nM, no more than 0.7 nM, no more than 0.8 nM no more than 0.9 nM, no more than 1 nM, no more than 1.5 nM, no more than 2 nM, no more than 2.5 nM no more than 5 nM by flow cytometry.

(74) In certain embodiments, the antibodies and antigen-binding fragments thereof bind to cynomolgus monkey TIM-3 with a binding affinity similar to that of human TIM-3. For example, binding of the exemplary antibody W3402-z3 to cynomolgus monkey TIM-3 is at a similar EC.sub.50 value to that of human TIM-3.

(75) In certain embodiments, the antibodies and the fragments thereof provided herein specifically bind to cynomolgus monkey TIM-3 with an EC.sub.50 of no more than 0.35 nM, no more than 0.4 nM, no more than 0.45 nM, no more than 0.5 nM, no more than 0.6 nM, no more than 0.7 nM, no more than 0.8 nM no more than 0.9 nM, no more than 1 nM, no more than 1.5 nM, no more than 2 nM, no more than 2.5 nM no more than 5 nM by flow cytometery assay.

(76) In certain embodiments, the antibodies and the fragments thereof provided herein have a specific binding affinity to human TIM-3 which is sufficient to provide for diagnostic and/or therapeutic use.

(77) In certain embodiments, the antibodies and the fragments thereof provided herein inhibit binding of TIM-3 to its ligand and thereby providing biological activity including, for example, inducing cytokine production from the activated T cells (such as CD4.sup.+ T cells and CD8.sup.+ T cells), inducing proliferation of activated T cells (such as CD4.sup.+ T cells and CD8.sup.+ T cells), and reversing T reg's suppressive function. Exemplary cytokines include IL-2 and IFN. The term IL-2 refers to interleukin 2, a type of cytokine signaling molecule in the immune system that regulates the activities of white blood cells (e.g. leukocytes). The term Interferon gamma (IFN) is a cytokine that is produced by natural killer (NK), NK T cells, CD4.sup.+ and CD8.sup.+ T cells, which is a critical activator of macrophages and inducer of major histocompatibility complex (MHC) molecule expression. The cytokine production can be determined using methods known in the art, for example, by ELISA. Methods can also be used to detect proliferation of T cells, including [.sup.3H] thymidine incorporation assay.

(78) The antibodies or antigen-binding fragments thereof provided herein can be a monoclonal antibody, polyclonal antibody, humanized antibody, chimeric antibody, recombinant antibody, labeled antibody, bivalent antibody, or anti-idiotypic antibody. A recombinant antibody is an antibody prepared in vitro using recombinant methods rather than in animals.

(79) Antibody Variants

(80) The antibodies and antigen-binding fragments thereof provided herein also encompass various variants thereof. In certain embodiments, the antibodies and antigen-binding fragments thereof encompasses various types of variants of an exemplary antibody provided herein, i.e., W3402 and W3402-z3.

(81) In certain embodiments, the antibody variants comprise one or more modifications or substitutions in one or more CDR sequences as provided in Table 1, one or more variable region sequences (but not in any of the CDR sequences) provided in Table 2, and/or the constant region (e.g. Fc region). Such variants retain specific binding affinity to TIM-3 of their parent antibodies, but have one or more desirable properties conferred by the modification(s) or substitution(s). For example, the antibody variants may have improved antigen-binding affinity, improved productivity, improved stability, improved glycosylation pattern, reduced risk of glycosylation, reduced deamination, reduced or depleted effector function(s), improved FcRn receptor binding, increased pharmacokinetic half-life, pH sensitivity, and/or compatibility to conjugation (e.g. one or more introduced cysteine residues).

(82) The parent antibody sequence may be screened to identify suitable or preferred residues to be modified or substituted, using methods known in the art, for example alanine scanning mutagenesis (see, for example, Cunningham and Wells (1989) Science, 244:1081-1085). Briefly, target residues (e.g., charged residues such as Arg, Asp, His, Lys, and Glu) can be identified and replaced by a neutral or negatively charged amino acid (e.g., alanine or polyalanine), and the modified antibodies are produced and screened for the interested property. If substitution at a particular amino acid location demonstrates an interested functional change, then the position can be identified as a potential residue for modification or substitution. The potential residues may be further assessed by substituting with a different type of residue (e.g. cysteine residue, positively charged residue, etc.).

(83) Affinity Variant

(84) Affinity variant may contain modifications or substitutions in one or more CDR sequences as provided in Table 1, one or more FR sequences, or the heavy or light chain variable region sequences provided in Table 2. FR sequences can be readily identified by a skilled person in the art based on the CDR sequences in Table 1 and variable region sequences in Table 2, as it is well-known in the art that a CDR region is flanked by two FR regions in the variable region. The affinity variants retain specific binding affinity to TIM-3 of the parent antibody, or even have improved TIM-3 specific binding affinity over the parent antibody. In certain embodiments, at least one (or all) of the substitution(s) in the CDR sequences, FR sequences, or variable region sequences comprises a conservative substitution.

(85) A skilled artisan will understand that in the CDR sequences and variable region sequences provided in Table 1 and Table 2, one or more amino acid residues may be substituted yet the resulting antibody or antigen-binding fragment still retain the binding affinity to TIM-3, or even have an improved binding affinity. Various methods known in the art can be used to achieve this purpose. For example, a library of antibody variants (such as Fab or scFv variants) can be generated and expressed with phage display technology, and then screened for the binding affinity to human TIM-3. For another example, computer software can be used to virtually simulate the binding of the antibodies to human TIM-3, and identify the amino acid residues on the antibodies which form the binding interface. Such residues may be either avoided in the substitution so as to prevent reduction in binding affinity, or targeted for substitution to provide for a stronger binding.

(86) In certain embodiments, the affinity variant provided herein comprises one or more amino acid residue substitutions in one or more CDR sequences, and/or one or more FR sequences. In certain embodiments, an affinity variant comprises no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 substitutions in the CDR sequences and/or FR sequences in total.

(87) In certain embodiments, the anti-TIM-3 antibodies and antigen-binding fragments thereof comprise 1, 2, or 3 CDR sequences having at least 80% (e.g. at least 85%, 88%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%) sequence identity to that (or those) listed in Table 1, and in the meantime retain the binding affinity to TIM-3 at a level similar to or even higher than its parent antibody.

(88) In certain embodiments, the anti-TIM-3 antibodies and antigen-binding fragments thereof comprise one or more variable region sequences having at least 80% (e.g. at least 85%, 88%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%) sequence identity to that (or those) listed in Table 2, and in the meantime retain the binding affinity to TIM-3 at a level similar to or even higher than its parent antibody. In some embodiments, a total of 1 to 10 amino acids have been substituted, inserted, or deleted in a variable region sequence listed in Table 2. In some embodiments, the substitutions, insertions, or deletions occur in regions outside the CDRs (e.g., in the FRs).

(89) Glycosylation Variant

(90) The anti-TIM-3 antibodies and antigen-binding fragments provided herein also encompass a glycosylation variant, which can be obtained to either increase or decrease the extent of glycosylation of the antibody or antigen binding fragment.

(91) The antibody or antigen binding fragment thereof may comprise one or more amino acid residues with a side chain to which a carbohydrate moiety (e.g. an oligosaccharide structure) can be attached. Glycosylation of antibodies is typically either N-linked or O-linked. N-linked refers to the attachment of the carbohydrate moiety to the side chain of an asparagine residue, for example, an asparagine residue in a tripeptide sequence such as asparagine-X-serine and asparagine-X-threonine, where X is any amino acid except proline. O-linked glycosylation refers to the attachment of one of the sugars N-aceylgalactosamine, galactose, or xylose to a hydroxyamino acid, most commonly to serine or threonine. Removal of a native glycosylation site can be conveniently accomplished, for example, by altering the amino acid sequence such that one of the above-described tripeptide sequences (for N-linked glycosylation sites) or serine or threonine residues (for O-linked glycosylation sites) present in the sequence in the is substituted. A new glycosylation site can be created in a similar way by introducing such a tripeptide sequence or serine or threonine residue.

(92) Cysteine-Engineered Variant

(93) The anti-TIM-3 antibodies and antigen-binding fragments provided herein also encompass a cysteine-engineered variant, which comprises one or more introduced free cysteine amino acid residues.

(94) A free cysteine residue is one which is not part of a disulfide bridge. A cysteine-engineered variant is useful for conjugation with for example, a cytotoxic and/or imaging compound, a label, or a radioisoptype among others, at the site of the engineered cysteine, through for example a maleimide or haloacetyl. Methods for engineering antibodies or antigen-binding fragments to introduce free cysteine residues are known in the art, see, for example, WO2006/034488.

(95) Fe Variant

(96) The anti-TIM-3 antibodies and antigen-binding fragments provided herein also encompass an Fc variant, which comprises one or more amino acid residue modifications or substitutions at its Fc region and/or hinge region.

(97) In certain embodiments, the anti-TIM-3 antibodies or antigen-binding fragments comprise one or more amino acid substitution(s) that improves pH-dependent binding to neonatal Fc receptor (FcRn). Such a variant can have an extended pharmacokinetic half-life, as it binds to FcRn at acidic pH which allows it to escape from degradation in the lysosome and then be translocated and released out of the cell. Methods of engineering an antibody and antigen-binding fragment thereof to improve binding affinity with FcRn are well-known in the art, see, for example, Vaughn, D. et al, Structure, 6(1): 63-73, 1998; Kontermann, R. et al, Antibody Engineering, Volume 1, Chapter 27: Engineering of the Fc region for improved PK, published by Springer, 2010; Yeung, Y. et al, Cancer Research, 70: 3269-3277 (2010); and Hinton, P. et al, J. Immunology, 176:346-356 (2006).

(98) In certain embodiments, the anti-TIM-3 antibodies or antigen-binding fragments comprise one or more amino acid substitution(s) that alters the antibody-dependent cellular cytotoxicity (ADCC). Certain amino acid residues at the Fc region (e.g. at the lower hinge and/or CH2 domain) can be substituted to provide for altered (e.g. enhanced or diminished or depleted) ADCC activity. Alternatively or additionally, carbohydrate structures on the antibody can be changed to alter (e.g. enhance, diminish or deplete) ADCC activity. Methods of altering ADCC activity by antibody engineering have been described in the art, see for example, Shields R L. et al., J Biol Chem. 2001. 276(9): 6591-604; Idusogie E E. et al., J Immunol. 2000.164(8):4178-84; Steurer W. et al., J Immunol. 1995, 155(3): 1165-74; Idusogie E E. et al., J Immunol. 2001, 166(4): 2571-5; Lazar G A. et al., PNAS, 2006, 103(11): 4005-4010; Ryan M C. et al., Mol. Cancer Ther., 2007, 6: 3009-3018; Richards J O. et al., Mol Cancer Ther. 2008, 7(8): 2517-27; Shields R. L. et al, J. Biol. Chem, 2002, 277: 26733-26740; Shinkawa T. et al, J. Biol. Chem, 2003, 278: 3466-3473; and Oganesyan V. et al, Acta Crystallogr D Biol Crystallogr. 2008, 64: 700-704; Chu S Y. et al, Mol Immunol. 2008, 45: 3926-3933.

(99) Different sets of substitutions may be employed to eliminate the IgG1 effector function. For example, L234F/L235E/P331S can dramatically decrease the binding between IgG1-Fc to C1q, CD64, CD32A and CD16 (Oganesyan V. et al, Acta Crystallogr D Biol Crystallogr. 2008, 64: 700-704). Also, IgG1-Fc carries the {circumflex over ()}236R/L238R modification, which has an Arg inserted after position 236 along with L328R, showed profound decrease in binding activity of IgG1-Fc to the Fc gamma receptors (Chu S Y. et al, Mol Immunol. 2008, 45: 3926-3933).

(100) In certain embodiments, the anti-TIM-3 antibodies or antigen-binding fragments comprise one or more amino acid substitution(s) that alters Complement Dependent Cytotoxicity (CDC), for example, by improving or diminishing C1q binding and/or CDC (see, for example, WO99/51642; Duncan & Winter Nature 322:738-40 (1988); U.S. Pat. Nos. 5,648,260; 5,624,821); and WO94/29351 concerning other examples of Fc region variants.

(101) In certain embodiments, the anti-TIM-3 antibodies or antigen-binding fragments comprise a human IgG4 constant region in which the 228.sup.th amino acid residue is altered, for example from Ser228Pro (S228P, which may prevent or reduce strand exchange), and/or the 235.sup.th amino acid residue is altered, for example from Leu235Glu (L235E, which may alter Fc receptor interactions.

(102) In certain embodiments, the anti-TIM-3 antibodies or antigen-binding fragments comprise a human IgG1 constant region in which the 234.sup.th, 235.sup.th, or 331.sup.st amino acid residue is altered, for example, to introduce one or more amino acid substation of L234F, L235E and/or P331S. In certain embodiments, the anti-TIM-3 antibodies or antigen-binding fragments comprise a human IgG1 constant region in which Arg inserted after position 236 along with L328R.

(103) In certain embodiments, the anti-TIM-3 antibodies or antigen-binding fragments comprise one or more amino acid substitution(s) in the interface of the Fc region to facilitate and/or promote heterodimerization. These modifications comprise introduction of a protuberance into a first Fc polypeptide and a cavity into a second Fc polypeptide, wherein the protuberance can be positioned in the cavity so as to promote interaction of the first and second Fc polypeptides to form a heterodimer or a complex. Methods of generating antibodies with these modifications are known in the art, e.g., as described in U.S. Pat. No. 5,731,168.

(104) Antigen-Binding Fragments

(105) Provided herein are also anti-TIM-3 antigen-binding fragments. Various types of antigen-binding fragments are known in the art and can be developed based on the anti-TIM-3 antibodies provided herein, including for example, the exemplary antibodies whose CDR and variable sequences are shown in Tables 1 and 2, and their different variants (such as affinity variants, glycosylation variants, Fc variants, cysteine-engineered variants and so on).

(106) In certain embodiments, an anti-TIM-3 antigen-binding fragment provided herein is a camelid single domain antibody, a diabody, a single chain Fv fragment (scFv), an scFv dimer, a BsFv, a dsFv, a (dsFv).sub.2, an Fv fragment, a Fab, a Fab, a F(ab).sub.2, a ds diabody, a nanobody, a domain antibody, a single domain antibody, or a bivalent domain antibody.

(107) Various techniques can be used for the production of such antigen-binding fragments. Illustrative methods include, enzymatic digestion of intact antibodies (see, e.g., Morimoto et al., Journal of Biochemical and Biophysical Methods 24:107-117 (1992); and Brennan et al., Science, 229:81 (1985)), recombinant expression by host cells such as E. Coli (e.g. for Fab, Fv and ScFv antibody fragments), screening from a phage display library as discussed above (e.g. for ScFv), and chemical coupling of two Fab-SH fragments to form F(ab).sub.2 fragments (Carter et al., Bio/Technology 10:163-167 (1992)). Other techniques for the production of antibody fragments will be apparent to a skilled practitioner.

(108) In certain embodiments, the antigen-binding fragment is a scFv. Generation of scFv is described in, for example, WO 93/16185; U.S. Pat. Nos. 5,571,894; and 5,587,458. scFv may be fused to an effector protein at either the amino or the carboxyl terminus to provide for a fusion protein (see, for example, Antibody Engineering, ed. Borrebaeck).

(109) Conjugates

(110) In some embodiments, the anti-TIM-3 antibodies and antigen-binding fragments thereof further comprise a conjugate moiety. The conjugate moiety can be linked to the antibodies and antigen-binding fragments thereof. A conjugate moiety is a non-proteinaceous moiety that can be attached to the antibody or antigen-binding fragment thereof. It is contemplated that a variety of conjugate moieties may be linked to the antibodies or antigen-binding fragments provided herein (see, for example, Conjugate Vaccines, Contributions to Microbiology and Immunology, J. M. Cruse and R. E. Lewis, Jr. (eds.), Carger Press, New York, (1989)). These conjugate moieties may be linked to the antibodies or antigen-binding fragments by covalent binding, affinity binding, intercalation, coordinate binding, complexation, association, blending, or addition, among other methods.

(111) In certain embodiments, the antibodies and antigen-binding fragments disclosed herein may be engineered to contain specific sites outside the epitope binding portion that may be utilized for binding to one or more conjugate moieties. For example, such a site may include one or more reactive amino acid residues, such as for example cysteine or histidine residues, to facilitate covalent linkage to a conjugate moiety.

(112) In certain embodiments, the antibodies may be linked to a conjugate moiety indirectly, or through another conjugate moiety. For example, the antibody or antigen-binding fragments may be conjugated to biotin, then indirectly conjugated to a second conjugate moiety that is conjugated to avidin. The conjugate moiety can be a clearance-modifying agent, a toxin (e.g., a chemotherapeutic agent), a detectable label (e.g., a radioactive isotope, a lanthanide, a luminescent label, a fluorescent label, or an enzyme-substrate label), or purification moiety.

(113) A toxin can be any agent that is detrimental to cells or that can damage or kill cells. Examples of toxin include, without limitation, taxol, cytochalasin B, gramicidin D, ethidium bromide, emetine, mitomycin, etoposide, tenoposide, vincristine, MMAE, MMAF, DM1, vinblastine, colchicin, doxorubicin, daunorubicin, dihydroxy anthracin dione, mitoxantrone, mithramycin, actinomycin D, 1-dehydrotestosterone, glucocorticoids, procaine, tetracaine, lidocaine, propranolol, puromycin and analogs thereof, antimetabolites (e.g., methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, 5-fluorouracil decarbazine), alkylating agents (e.g., mechlorethamine, thioepa chlorambucil, melphalan, carmustine (BSNU) and lomustine (CCNU), cyclothosphamide, busulfan, dibromomannitol, streptozotocin, mitomycin C, and cis-dichlorodiamine platinum (II) (DDP) cisplatin), anthracyclines (e.g., daunorubicin (formerly daunomycin) and doxorubicin), antibiotics (e.g., dactinomycin (formerly actinomycin), bleomycin, mithramycin, and anthramycin (AMC)), anti-mitotic agents (e.g., vincristine and vinblastine), a topoisomerase inhibitor, and a tubulin-binders.

(114) Examples of detectable label may include a fluorescent labels (e.g. fluorescein, rhodamine, dansyl, phycoerythrin, or Texas Red), enzyme-substrate labels (e.g. horseradish peroxidase, alkaline phosphatase, luceriferases, glucoamylase, lysozyme, saccharide oxidases or -D-galactosidase), radioisotopes (e.g. .sup.123I, .sup.124I, .sup.125I, .sup.131I, .sup.35S, .sup.3H, .sup.111In, .sup.112In, .sup.14C, .sup.64Cu, .sup.67Cu, .sup.86Y, .sup.88Y, .sup.90Y, .sup.177Lu, .sup.211At, .sup.186Re, .sup.188Re, .sup.153Sm, .sup.212Bi, and .sup.32P, other lanthanides), luminescent labels, chromophoric moiety, digoxigenin, biotin/avidin, a DNA molecule or gold for detection.

(115) In certain embodiments, the conjugate moiety can be a clearance-modifying agent which helps increase half-life of the antibody. Illustrative example include water-soluble polymers, such as PEG, carboxymethylcellulose, dextran, polyvinyl alcohol, polyvinyl pyrrolidone, copolymers of ethylene glycol/propylene glycol, and the like. The polymer may be of any molecular weight, and may be branched or unbranched. The number of polymers attached to the antibody may vary, and if more than one polymer are attached, they can be the same or different molecules.

(116) In certain embodiments, the conjugate moiety can be a purification moiety such as a magnetic bead.

(117) In certain embodiments, the antibodies and antigen-binding fragments thereof provided herein is used for a base for a conjugate moiety.

(118) Polynucleotides and Recombinant Methods

(119) The present disclosure provides isolated polynucleotides that encode the anti-TIM-3 antibodies and antigen-binding fragments thereof.

(120) The term nucleic acid or polynucleotide as used herein refers to deoxyribonucleic acids (DNA) or ribonucleic acids (RNA) and polymers thereof in either single- or double-stranded form. Unless specifically limited, the term encompasses polynucleotides containing known analogues of natural nucleotides that have similar binding properties as the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise indicated, a particular polynucleotide sequence also implicitly encompasses conservatively modified variants thereof (e.g., degenerate codon substitutions), alleles, orthologs, SNPs, and complementary sequences as well as the sequence explicitly indicated. Specifically, degenerate codon substitutions may be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and/or deoxyinosine residues (see Batzer et al., Nucleic Acid Res. 19:5081 (1991); Ohtsuka et al., J. Biol. Chem. 260:2605-2608 (1985); and Rossolini et al., Mol. Cell. Probes 8:91-98 (1994)).

(121) In certain embodiments, the isolated polynucleotides comprise one or more nucleotide sequences as shown in SEQ ID NO: 8, 10, 12, and/or 14, and/or a homologous sequence thereof having at least 80% (e.g. at least 85%, 88%, 90%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity, and/or a variant thereof having only degenerate substitutions, and encodes the variable region of the exemplary antibodies provided herein. DNA encoding the monoclonal antibody is readily isolated and sequenced using conventional procedures (e.g., by using oligonucleotide probes that are capable of binding specifically to genes encoding the heavy and light chains of the antibody). The encoding DNA may also be obtained by synthetic methods.

(122) The isolated polynucleotide that encodes the anti-TIM-3 antibodies and antigen-binding fragments thereof (e.g. including the sequences as shown in Table 3) can be inserted into a vector for further cloning (amplification of the DNA) or for expression, using recombinant techniques known in the art. Many vectors are available. The vector components generally include, but are not limited to, one or more of the following: a signal sequence, an origin of replication, one or more marker genes, an enhancer element, a promoter (e.g. SV40, CMV, EF-1), and a transcription termination sequence.

(123) The present disclosure provides vectors (e.g., expression vectors) containing the nucleic acid sequence provided herein encoding the antibodies or antigen-binding fragments, at least one promoter (e.g., SV40, CMV, EF-1a) operably linked to the nucleic acid sequence, and at least one selection marker. Examples of vectors include, but are not limited to, retrovirus (including lentivirus), adenovirus, adeno-associated virus, herpesvirus (e.g., herpes simplex virus), poxvirus, baculovirus, papillomavirus, papovavirus (e.g., SV40), lambda phage, and M13 phage, plasmid pcDNA3.3, pMD18-T, pOptivec, pCMV, pEGFP, pIRES, pQD-Hyg-GSeu, pALTER, pBAD, pcDNA, pCal, pL, pET, pGEMEX, pGEX, pCI, pEGFT, pSV2, pFUSE, pVITRO, pVIVO, pMAL, pMONO, pSELECT, pUNO, pDUO, Psg5L, pBABE, pWPXL, pBI, p15TV-L, pPro18, pTD, pRS10, pLexA, pACT2.2, pCMV-SCRIPT, pCDM8, pCDNA1.1/amp, pcDNA3.1, pRc/RSV, PCR 2.1, pEF-1, pFB, pSG5, pXT1, pCDEF3, pSVSPORT, pEF-Bos etc.

(124) Vectors comprising the polynucleotide sequence encoding the antibody or antigen-binding fragment can be introduced to a host cell for cloning or gene expression. Suitable host cells for cloning or expressing the DNA in the vectors herein are the prokaryote, yeast, or higher eukaryote cells described above. Suitable prokaryotes for this purpose include eubacteria, such as Gram-negative or Gram-positive organisms, for example, Enterobacteriaceae such as Escherichia, e.g., E. coli, Enterobacter, Erwinia, Klebsiella, Proteus, Salmonella, e.g., Salmonella typhimurium, Serratia, e.g., Serratia marcescans, and Shigella, as well as Bacilli such as B. subtilis and B. licheniformis, Pseudomonas such as P. aeruginosa, and Streptomyces.

(125) In addition to prokaryotes, eukaryotic microbes such as filamentous fungi or yeast are suitable cloning or expression hosts for anti-TIM-3 antibody-encoding vectors. Saccharomyces cerevisiae, or common baker's yeast, is the most commonly used among lower eukaryotic host microorganisms. However, a number of other genera, species, and strains are commonly available and useful herein, such as Schizosaccharomyces pombe; Kluyveromyces hosts such as, e.g., K. lactis, K. fragilis (ATCC 12,424), K. bulgaricus (ATCC 16,045), K. wickeramii (ATCC 24,178), K. waltii (ATCC 56,500), K. drosophilarum (ATCC 36,906), K. thermotolerans, and K. marxianus; yarrowia (EP 402,226); Pichia pastoris (EP 183,070); Candida; Trichoderma reesia (EP 244,234); Neurospora crassa; Schwanniomyces such as Schwanniomyces occidentalis; and filamentous fungi such as, e.g., Neurospora, Penicillium, Tolypocladium, and Aspergillus hosts such as A. nidulans and A. niger.

(126) Suitable host cells for the expression of glycosylated antibodies or antigen-fragment provided here are derived from multicellular organisms. Examples of invertebrate cells include plant and insect cells. Numerous baculoviral strains and variants and corresponding permissive insect host cells from hosts such as Spodoptera frugiperda (caterpillar), Aedes aegypti (mosquito), Aedes albopictus (mosquito), Drosophila melanogaster (fruiffly), and Bombyx mori have been identified. A variety of viral strains for transfection are publicly available, e.g., the L-1 variant of Autographa californica NPV and the Bm-5 strain of Bombyx mori NPV, and such viruses may be used as the virus herein according to the present invention, particularly for transfection of Spodoptera frugiperda cells. Plant cell cultures of cotton, corn, potato, soybean, petunia, tomato, and tobacco can also be utilized as hosts.

(127) However, interest has been greatest in vertebrate cells, and propagation of vertebrate cells in culture (tissue culture) has become a routine procedure. Examples of useful mammalian host cell lines are monkey kidney CV1 line transformed by SV40 (COS-7, ATCC CRL 1651); human embryonic kidney line (293 or 293 cells subcloned for growth in suspension culture, Graham et al., J. Gen Virol. 36:59 (1977)); baby hamster kidney cells (BHK, ATCC CCL 10); Chinese hamster ovary cells/-DHFR (CHO, Urlaub et al., Proc. Natl. Acad. Sci. USA 77:4216 (1980)); mouse sertoli cells (TM4, Mather, Biol. Reprod. 23:243-251 (1980)); monkey kidney cells (CV1 ATCC CCL 70); African green monkey kidney cells (VERO-76, ATCC CRL-1587); human cervical carcinoma cells (HELA, ATCC CCL 2); canine kidney cells (MDCK, ATCC CCL 34); buffalo rat liver cells (BRL 3A, ATCC CRL 1442); human lung cells (W138, ATCC CCL 75); human liver cells (Hep G2, HB 8065); mouse mammary tumor (MMT 060562, ATCC CCL51); TRI cells (Mather et al., Annals N.Y. Acad. Sci. 383:44-68 (1982)); MRC 5 cells; FS4 cells; and a human hepatoma line (Hep G2). In some preferable embodiments, the host cell is 293F cell.

(128) Host cells are transformed with the above-described expression or cloning vectors for anti-TIM-3 antibody production and cultured in conventional nutrient media modified as appropriate for inducing promoters, selecting transformants, or amplifying the genes encoding the desired sequences. In another embodiment, the antibody may be produced by homologous recombination known in the art.

(129) The host cells used to produce the antibodies or antigen-binding fragments provided herein may be cultured in a variety of media. Commercially available media such as Ham's F10 (Sigma), Minimal Essential Medium (MEM), (Sigma), RPMI-1640 (Sigma), and Dulbecco's Modified Eagle's Medium (DMEM), Sigma) are suitable for culturing the host cells. In addition, any of the media described in Ham et al., Meth. Enz. 58:44 (1979), Barnes et al., Anal. Biochem. 102:255 (1980), U.S. Pat. Nos. 4,767,704; 4,657,866; 4,927,762; 4,560,655; or 5,122,469; WO 90/03430; WO 87/00195; or U.S. Pat. Re. 30,985 may be used as culture media for the host cells. Any of these media may be supplemented as necessary with hormones and/or other growth factors (such as insulin, transferrin, or epidermal growth factor), salts (such as sodium chloride, calcium, magnesium, and phosphate), buffers (such as HEPES), nucleotides (such as adenosine and thymidine), antibiotics (such as GENTAMYCIN drug), trace elements (defined as inorganic compounds usually present at final concentrations in the micromolar range), and glucose or an equivalent energy source. Any other necessary supplements may also be included at appropriate concentrations that would be known to those skilled in the art. The culture conditions, such as temperature, pH, and the like, are those previously used with the host cell selected for expression, and will be apparent to the ordinarily skilled artisan.

(130) When using recombinant techniques, the antibody can be produced intracellularly, in the periplasmic space, or directly secreted into the medium. If the antibody is produced intracellularly, as a first step, the particulate debris, either host cells or lysed fragments, is removed, for example, by centrifugation or ultrafiltration. Carter et al., Bio/Technology 10:163-167 (1992) describe a procedure for isolating antibodies which are secreted to the periplasmic space of E. coli. Briefly, cell paste is thawed in the presence of sodium acetate (pH 3.5), EDTA, and phenylmethylsulfonylfluoride (PMSF) over about 30 min. Cell debris can be removed by centrifugation. Where the antibody is secreted into the medium, supernatants from such expression systems are generally first concentrated using a commercially available protein concentration filter, for example, an Amicon or Millipore Pellicon ultrafiltration unit. A protease inhibitor such as PMSF may be included in any of the foregoing steps to inhibit proteolysis and antibiotics may be included to prevent the growth of adventitious contaminants.

(131) The anti-TIM-3 antibodies and antigen-binding fragments thereof prepared from the cells can be purified using, for example, hydroxylapatite chromatography, gel electrophoresis, dialysis, DEAE-cellulose ion exchange chromatography, ammonium sulfate precipitation, salting out, and affinity chromatography, with affinity chromatography being the preferred purification technique.

(132) In certain embodiments, Protein A immobilized on a solid phase is used for immunoaffinity purification of the antibody and antigen-binding fragment thereof. The suitability of protein A as an affinity ligand depends on the species and isotype of any immunoglobulin Fc domain that is present in the antibody. Protein A can be used to purify antibodies that are based on human gamma1, gamma2, or gamma4 heavy chains (Lindmark et al., J. Immunol. Meth. 62:1-13 (1983)). Protein G is recommended for all mouse isotypes and for human gamma3 (Guss et al., EMBO J. 5:1567 1575 (1986)). The matrix to which the affinity ligand is attached is most often agarose, but other matrices are available. Mechanically stable matrices such as controlled pore glass or poly(styrenedivinyl)benzene allow for faster flow rates and shorter processing times than can be achieved with agarose. Where the antibody comprises a CH3 domain, the Bakerbond ABX resin (J. T. Baker, Phillipsburg, N.J.) is useful for purification. Other techniques for protein purification such as fractionation on an ion-exchange column, ethanol precipitation, Reverse Phase HPLC, chromatography on silica, chromatography on heparin SEPHAROSE chromatography on an anion or cation exchange resin (such as a polyaspartic acid column), chromatofocusing, SDS-PAGE, and ammonium sulfate precipitation are also available depending on the antibody to be recovered.

(133) Following any preliminary purification step(s), the mixture comprising the antibody of interest and contaminants may be subjected to low pH hydrophobic interaction chromatography using an elution buffer at a pH between about 2.5-4.5, preferably performed at low salt concentrations (e.g., from about 0-0.25M salt).

(134) Pharmaceutical Composition

(135) The present disclosure further provides pharmaceutical compositions comprising the anti-TIM-3 antibodies or antigen-binding fragments thereof and one or more pharmaceutically acceptable carriers.

(136) Pharmaceutical acceptable carriers for use in the pharmaceutical compositions disclosed herein may include, for example, pharmaceutically acceptable liquid, gel, or solid carriers, aqueous vehicles, nonaqueous vehicles, antimicrobial agents, isotonic agents, buffers, antioxidants, anesthetics, suspending/dispending agents, sequestering or chelating agents, diluents, adjuvants, excipients, or non-toxic auxiliary substances, other components known in the art, or various combinations thereof.

(137) Suitable components may include, for example, antioxidants, fillers, binders, disintegrants, buffers, preservatives, lubricants, flavorings, thickeners, coloring agents, emulsifiers or stabilizers such as sugars and cyclodextrins. Suitable antioxidants may include, for example, methionine, ascorbic acid, EDTA, sodium thiosulfate, platinum, catalase, citric acid, cysteine, thioglycerol, thioglycolic acid, thiosorbitol, butylated hydroxanisol, butylated hydroxytoluene, and/or propyl gallate. As disclosed herein, inclusion of one or more antioxidants such as methionine in a composition comprising an antibody or antigen-binding fragment and conjugates as provided herein decreases oxidation of the antibody or antigen-binding fragment. This reduction in oxidation prevents or reduces loss of binding affinity, thereby improving antibody stability and maximizing shelf-life. Therefore, in certain embodiments compositions are provided that comprise one or more antibodies or antigen-binding fragments as disclosed herein and one or more antioxidants such as methionine. Further provided are methods for preventing oxidation of, extending the shelf-life of, and/or improving the efficacy of an antibody or antigen-binding fragment as provided herein by mixing the antibody or antigen-binding fragment with one or more antioxidants such as methionine.

(138) To further illustrate, pharmaceutical acceptable carriers may include, for example, aqueous vehicles such as sodium chloride injection, Ringer's injection, isotonic dextrose injection, sterile water injection, or dextrose and lactated Ringer's injection, nonaqueous vehicles such as fixed oils of vegetable origin, cottonseed oil, corn oil, sesame oil, or peanut oil, antimicrobial agents at bacteriostatic or fungistatic concentrations, isotonic agents such as sodium chloride or dextrose, buffers such as phosphate or citrate buffers, antioxidants such as sodium bisulfate, local anesthetics such as procaine hydrochloride, suspending and dispersing agents such as sodium carboxymethylcelluose, hydroxypropyl methylcellulose, or polyvinylpyrrolidone, emulsifying agents such as Polysorbate 80 (TWEEN-80), sequestering or chelating agents such as EDTA (ethylenediaminetetraacetic acid) or EGTA (ethylene glycol tetraacetic acid), ethyl alcohol, polyethylene glycol, propylene glycol, sodium hydroxide, hydrochloric acid, citric acid, or lactic acid. Antimicrobial agents utilized as carriers may be added to pharmaceutical compositions in multiple-dose containers that include phenols or cresols, mercurials, benzyl alcohol, chlorobutanol, methyl and propyl p-hydroxybenzoic acid esters, thimerosal, benzalkonium chloride and benzethonium chloride. Suitable excipients may include, for example, water, saline, dextrose, glycerol, or ethanol. Suitable non-toxic auxiliary substances may include, for example, wetting or emulsifying agents, pH buffering agents, stabilizers, solubility enhancers, or agents such as sodium acetate, sorbitan monolaurate, triethanolamine oleate, or cyclodextrin.

(139) The pharmaceutical compositions can be a liquid solution, suspension, emulsion, pill, capsule, tablet, sustained release formulation, or powder. Oral formulations can include standard carriers such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, polyvinyl pyrollidone, sodium saccharine, cellulose, magnesium carbonate, etc.

(140) In certain embodiments, the pharmaceutical compositions are formulated into an injectable composition. The injectable pharmaceutical compositions may be prepared in any conventional form, such as for example liquid solution, suspension, emulsion, or solid forms suitable for generating liquid solution, suspension, or emulsion. Preparations for injection may include sterile and/or non-pyretic solutions ready for injection, sterile dry soluble products, such as lyophilized powders, ready to be combined with a solvent just prior to use, including hypodermic tablets, sterile suspensions ready for injection, sterile dry insoluble products ready to be combined with a vehicle just prior to use, and sterile and/or non-pyretic emulsions. The solutions may be either aqueous or nonaqueous.

(141) In certain embodiments, unit-dose parenteral preparations are packaged in an ampoule, a vial or a syringe with a needle. All preparations for parenteral administration should be sterile and not pyretic, as is known and practiced in the art.

(142) In certain embodiments, a sterile, lyophilized powder is prepared by dissolving an antibody or antigen-binding fragment as disclosed herein in a suitable solvent. The solvent may contain an excipient which improves the stability or other pharmacological components of the powder or reconstituted solution, prepared from the powder. Excipients that may be used include, but are not limited to, water, dextrose, sorbital, fructose, corn syrup, xylitol, glycerin, glucose, sucrose or other suitable agent. The solvent may contain a buffer, such as citrate, sodium or potassium phosphate or other such buffer known to those of skill in the art at, in one embodiment, about neutral pH. Subsequent sterile filtration of the solution followed by lyophilization under standard conditions known to those of skill in the art provides a desirable formulation. In one embodiment, the resulting solution will be apportioned into vials for lyophilization. Each vial can contain a single dosage or multiple dosages of the anti-TIM-3 antibody or antigen-binding fragment thereof or composition thereof. Overfilling vials with a small amount above that needed for a dose or set of doses (e.g., about 10%) is acceptable so as to facilitate accurate sample withdrawal and accurate dosing. The lyophilized powder can be stored under appropriate conditions, such as at about 4 C. to room temperature.

(143) Reconstitution of a lyophilized powder with water for injection provides a formulation for use in parenteral administration. In one embodiment, for reconstitution the sterile and/or non-pyretic water or other liquid suitable carrier is added to lyophilized powder. The precise amount depends upon the selected therapy being given, and can be empirically determined.

(144) Methods of Use

(145) The present disclosure also provides therapeutic methods comprising: administering a therapeutically effective amount of the antibody or antigen-binding fragment as provided herein to a subject in need thereof, thereby treating or preventing a TIM-3-related condition or a disorder. In some embodiment, the TIM-3-related condition or a disorder is cancer, autoimmune disease, inflammatory disease, or infectious disease. In some embodiment, the TIM-3-related condition or a disorder is solid tumor.

(146) Examples of cancer include but are not limited to, cancer is lymphoma, bladder cancer, bone cancer, brain and central nervous system cancer, breast cancer, uterine or endometrial cancer, rectal cancer, esophageal cancer, head and neck cancer, anal cancer, gastrointestinal cancer, intra-epithelial neoplasm, kidney or renal cancer, leukemia, liver cancer, lung cancer (e.g. non-small cell lung cancer and small cell lung cancer), melanoma, myeloma, pancreatic cancer, prostate cancer, sarcoma, skin cancer, squamous cell cancer, stomach cancer, testicular cancer, vulval cancer, cancer of the endocrine system, cancer of the parathyroid gland, cancer of the adrenal gland, penile carcinoma, solid tumors of childhood, tumor angiogenesis, spinal axis tumor, pituitary adenoma, or epidermoid cancer.

(147) Examples of autoimmune diseases include, but are not limited to, Acquired Immunodeficiency Syndrome (AIDS, which is a viral disease with an autoimmune component), alopecia areata, ankylosing spondylitis, antiphospholipid syndrome, autoimmune Addison's disease, autoimmune hemolytic anemia, autoimmune hepatitis, autoimmune inner ear disease (AIED), autoimmune lymphoproliferative syndrome (ALPS), autoimmune thrombocytopenic purpura (ATP), Behcet's disease, cardiomyopathy, celiac sprue-dermatitis hepetiformis; chronic fatigue immune dysfunction syndrome (CFIDS), chronic inflammatory demyelinating polyneuropathy (CIPD), cicatricial pemphigold, cold agglutinin disease, crest syndrome, Crohn's disease, Degos' disease, dermatomyositis juvenile, discoid lupus, essential mixed cryoglobulinemia, fibromyalgia-fibromyositis, Graves' disease, Guillain-Barre syndrome, Hashimoto's thyroiditis, idiopathic pulmonary fibrosis, idiopathic thrombocytopenia purpura (ITP), IgA nephropathy, insulin-dependent diabetes mellitus, juvenile chronic arthritis (Still's disease), juvenile rheumatoid arthritis, Meniere's disease, mixed connective tissue disease, multiple sclerosis, myasthenia gravis, pemacious anemia, polyarteritis nodosa, polychondritis, polyglandular syndromes, polymyalgia rheumatica, polymyositis and dermatomyositis, primary agammaglobulinemia, primary biliary cirrhosis, psoriasis, psoriatic arthritis, Raynaud's phenomena, Reiter's syndrome, rheumatic fever, rheumatoid arthritis, sarcoidosis, scleroderma (progressive systemic sclerosis (PSS), also known as systemic sclerosis (SS)), Sjogren's syndrome, stiff-man syndrome, systemic lupus erythematosus, Takayasu arteritis, temporal arteritis/giant cell arteritis, ulcerative colitis, uveitis, vitiligo and Wegener's granulomatosis.

(148) Inflammatory disorders, include, for example, chronic and acute inflammatory disorders. Examples of inflammatory disorders include Alzheimer's disease, asthma, atopic allergy, allergy, atherosclerosis, bronchial asthma, eczema, glomerulonephritis, graft vs. host disease, hemolytic anemias, osteoarthritis, sepsis, stroke, transplantation of tissue and organs, vasculitis, diabetic retinopathy and ventilator induced lung injury.

(149) Examples of infectious disease include, but are not limited to, fungus infection, parasite/protozoan infection or chronic viral infection, for example, malaria, coccidioiodmycosis immitis, histoplasmosis, onychomycosis, aspergilosis, blastomycosis, candidiasis albicans, paracoccidioiomycosis, microsporidiosis, Acanthamoeba keratitis, Amoebiasis, Ascariasis, Babesiosis, Balantidiasis, Baylisascariasis, Chagas disease, Clonorchiasis, Cochliomyia, Cryptosporidiosis, Diphyllobothriasis, Dracunculiasis, Echinococcosis, Elephantiasis, Enterobiasis, Fascioliasis, Fasciolopsiasis, Filariasis, Giardiasis, Gnathostomiasis, Hymenolepiasis, Isosporiasis, Katayama fever, Leishmaniasis, Lyme disease, Metagonimiasis, Myiasis, Onchocerciasis, Pediculosis, Scabies, Schistosomiasis, Sleeping sickness, Strongyloidiasis, Taeniasis, Toxocariasis, Toxoplasmosis, Trichinosis, Trichuriasis, Trypanosomiasis, helminth infection, infection of hepatitis B (HBV), hepatitis C (HCV), herpes virus, Epstein-Barr virus, HIV, cytomegalovirus, herpes simplex virus type I, herpes simplex virus type II, human papilloma virus, adenovirus, human immunodeficiency virus I, human immunodeficiency virus II, Kaposi West sarcoma associated herpes virus epidemics, thin ring virus (Torquetenovirus), human T lymphotrophic viruse I, human T lymphotrophic viruse II, varicella zoster, JC virus or BK virus.

(150) The therapeutically effective amount of an antibody or antigen-binding fragment as provided herein will depend on various factors known in the art, such as for example body weight, age, past medical history, present medications, state of health of the subject and potential for cross-reaction, allergies, sensitivities and adverse side-effects, as well as the administration route and extent of disease development. Dosages may be proportionally reduced or increased by one of ordinary skill in the art (e.g., physician or veterinarian) as indicated by these and other circumstances or requirements.

(151) In certain embodiments, the antibody or antigen-binding fragment as provided herein may be administered at a therapeutically effective dosage of about 0.01 mg/kg to about 100 mg/kg. In certain of these embodiments, the antibody or antigen-binding fragment is administered at a dosage of about 50 mg/kg or less, and in certain of these embodiments the dosage is 10 mg/kg or less, 5 mg/kg or less, 3 mg/kg or less, 1 mg/kg or less, 0.5 mg/kg or less, or 0.1 mg/kg or less. In certain embodiments, the administration dosage may change over the course of treatment. For example, in certain embodiments the initial administration dosage may be higher than subsequent administration dosages. In certain embodiments, the administration dosage may vary over the course of treatment depending on the reaction of the subject.

(152) Dosage regimens may be adjusted to provide the optimum desired response (e.g., a therapeutic response). For example, a single dose may be administered, or several divided doses may be administered over time.

(153) The antibodies and antigen-binding fragments disclosed herein may be administered by any route known in the art, such as for example parenteral (e.g., subcutaneous, intraperitoneal, intravenous, including intravenous infusion, intramuscular, or intradermal injection) or non-parenteral (e.g., oral, intranasal, intraocular, sublingual, rectal, or topical) routes.

(154) In some embodiments, the antibodies or antigen-binding fragments disclosed herein may be administered alone or in combination with one or more additional therapeutic means or agents. For example, the antibodies or antigen-binding fragments disclosed herein may be administered in combination with another therapeutic agent, for example, a chemotherapeutic agent or an anti-cancer drug.

(155) In certain of these embodiments, an antibody or antigen-binding fragment as disclosed herein that is administered in combination with one or more additional therapeutic agents may be administered simultaneously with the one or more additional therapeutic agents, and in certain of these embodiments the antibody or antigen-binding fragment and the additional therapeutic agent(s) may be administered as part of the same pharmaceutical composition. However, an antibody or antigen-binding fragment administered in combination with another therapeutic agent does not have to be administered simultaneously with or in the same composition as the agent. An antibody or antigen-binding fragment administered prior to or after another agent is considered to be administered in combination with that agent as the phrase is used herein, even if the antibody or antigen-binding fragment and second agent are administered via different routes. Where possible, additional therapeutic agents administered in combination with the antibodies or antigen-binding fragments disclosed herein are administered according to the schedule listed in the product information sheet of the additional therapeutic agent, or according to the Physicians' Desk Reference 2003 (Physicians' Desk Reference, 57th Ed; Medical Economics Company; ISBN: 1563634457; 57th edition (November 2002)) or protocols well known in the art.

(156) The present disclosure further provides methods of using the anti-TIM-3 antibodies or antigen-binding fragments thereof.

(157) In some embodiments, the present disclosure provides methods of detecting presence or amount of TIM-3 in a sample, comprising contacting the sample with the antibody or antigen-binding fragment thereof, and determining the presence or the amount of TIM-3 in the sample.

(158) In some embodiments, the present disclosure provides methods of diagnosing a TIM-3 related disease or condition in a subject, comprising: a) contacting a sample obtained from the subject with the antibody or antigen-binding fragment thereof provided herein; b) determining presence or amount of TIM-3 in the sample; and c) correlating the existence of the TIM-3 to the TIM-3 related disease or condition in the subject.

(159) In some embodiments, the present disclosure provides kits comprising the antibody or antigen-binding fragment thereof provided herein, optionally conjugated with a detectable moiety. The kits may be useful in detection of TIM-3 or diagnosis of TIM-3 related disease.

(160) In some embodiments, the present disclosure also provides use of the antibody or antigen-binding fragment thereof provided herein in the manufacture of a medicament for treating a TIM-3 related disease or condition in a subject, in the manufacture of a diagnostic reagent for diagnosing a TIM-3 related disease or condition.

Advantages

(161) The antibodies provided herein are advantageous over existing therapies in many aspects. For example, the antibodies provided herein are better than existing TIM3 antibodies, in that the antibodies provided herein showed better in vitro efficacy in regulating T cell function in human MLR assays, specifically binding to human TIM-3 protein without cross-family reactions, and are potent to modulate immune responses.

(162) The following examples are provided to better illustrate the claimed invention and are not to be interpreted as limiting the scope of the invention. All specific compositions, materials, and methods described below, in whole or in part, fall within the scope of the present invention. These specific compositions, materials, and methods are not intended to limit the invention, but merely to illustrate specific embodiments falling within the scope of the invention. One skilled in the art may develop equivalent compositions, materials, and methods without the exercise of inventive capacity and without departing from the scope of the invention. It will be understood that many variations can be made in the procedures herein described while still remaining within the bounds of the present invention. It is the intention of the inventors that such variations are included within the scope of the invention.

EXAMPLES

Example 1: Generation of Hybridoma Antibody

(163) 1. Research Materials Preparation

(164) 1.1 Antigens: DNA sequences encoding truncated (ECD and transmembrane) or full length of human TIM-3 (NM 032782.3), mouse TIM-3 (NM 134250.2) and cynomolgus monkey TIM-3 (EHH54703.1) were synthesized in Sangon Biotech (Shanghai, China), and then subcloned into modified pcDNA3.3 expression vectors with different tag (such as 6his, AVI-6his, human Fc, or mouse Fc) in C-terminal.

(165) Expi293 cells were transfected with the purified expression vector. Cells were cultured for 5 days and supernatant was collected for protein purification using Ni-NTA column, Protein A column or Protein G column. The obtained human TIM-3.ECD.MBPAVIHIS, mouse TIM-3.ECD.mFc were analyzed by SDS-PAGE and SEC, and then stored at 80 C.

(166) 1.2 Benchmark (BMK) antibodies: Existing anti-TIM-3 antibodies were made as benchmark antibodies. These included: W340-BMK4 (disclosed as ABTIM3 in U.S. Pat. No. 9,605,070) and W340-BMK6 (disclosed as mAb15 in US20160200815). DNA sequences encoding the variable region of W340-BMK4 and W340-BMK6 were synthesized in Sangon Biotech (Shanghai, China), and then subcloned into modified pcDNA3.3 expression vectors with the constant region of mouse IgG1 and human IgG4 (S228P), respectively.

(167) The plasmid containing VH and VL gene were co-transfected into Expi293 cells. Cells were cultured for 5 days and supernatant was collected for protein purification using Protein A column or Protein G column. The obtained antibodies were analyzed by SDS-PAGE and SEC, and then stored at 80 C.

(168) 1.3 Stable cell lines: Using Lipofectamine 2000, CHO-K1 or 293F cells were transfected with the expression vector containing gene encoding full length human TIM-3, mouse TIM-3 or cynomolgus monkey TIM-3. Cells were cultured in medium containing proper selection marker. Human TIM-3 high expression stable cell line (W340-CHO-K1.hPro1.G2), lower expression stable cell line (W340-CHO-K1.hPro1.H1) and mouse TIM-3 high expression stable cell line (W340.CHO-K1.mPro1.D3), cynomolgus TIM-3 high expression stable cell line (W3-293F.cynoPro1.FL-17), lower expression stable cell line (W340-293F.cynoPro1.FL-4) were selected after limited dilution.

(169) Jurkat E6-1 cells were transfected with plasmid IL-2P Luc by SE Cell Line 4D-Nucleofector X Kit according to the manufacturer's protocol. 48 hours after transfection, Hygromycin was added to the cell culture to select Jurkat E6-1 cells stably transfected with IL-2P Luc (Jurkat E6-1.IL-2P). The plasmid containing full length hTIM-3 was then transfected to Jurkat E6-1.IL-2P cells using the same method. 48 hours after transfection, Blasticidin S was added to the cell culture to develop the stable cell pool of Jurkat E6-1.IL-2P.hTIM-3. Stable cell lines were obtained by limited dilution.

(170) 2. Hybridoma Generation

(171) 2.1 Immunization: SD rats, 6-8 weeks of age, were immunized weekly by footpad and subcutaneous injections with 25 g/animal of W340-hPro1.ECD.mFc or 25 g/animal of W340-mPro1.ECD.hFc in adjuvant alternately.

(172) 2.2 Serum titer detection: Post the 4.sup.th immunization, serum samples were collected and examined every two weeks. Anti-hTIM-3 and anti-mTIM-3 antibody titers in the serum samples were determined by ELISA. Briefly, the plates coated with hTIM-3.ECD.His or mTIM-3.ECD.His were co-incubated with diluted rat serum (first 1:100, then 3-fold dilution in 2% BSA/PBS) for two hours. Goat anti rat-IgG-Fc-HRP was used as secondary antibody. The color was developed by dispensing 100 L of TMB substrate, and then stopped by 100 L of 2N HCl. The absorbance was read at 450 nM using a microplate spectrophotometer.

(173) 2.3 Hybridoma generation: When the serum antibody titer was sufficiently high, rats were given a final boost with both human and mouse TIM-3 ECD protein in D-PBS without adjuvant. On the day of fusion, lymph nodes and spleen were removed from immunized animal under sterile condition, and prepared into single cell suspension. The isolated cells were then mixed with myeloma cell SP2/0 at a ratio of 1:1. Electro cell fusion was performed using BTX 2001 Electro cell manipulator according to manufacturer's instruction. The cells were then seeded in 96-well plates at the density of 110.sup.4 cells/well, and cultured at 37 C., 5% CO.sub.2, until ready for screening.

(174) 2.4 Antibody screening and subcloning: human TIM-3-expressing cell binding assay by mirrorball was used as first screen method to test the binding of hybridoma supernatants to human TIM-3. Briefly, hybridoma supernatant samples, positive control and negative control were added into the 384-well plates, and co-incubated with human TIM-3 transfectant cells (W340.CHO-K1.hPro1.G2). Goat anti-rat IgG Fc PE antibody was used to determine the binding of anti-hTIM-3 antibody to the cells. Samples that had MFI100 were considered positive hTIM-3 binders (NC:1510).

(175) In order to confirm the initial binding results, the positive hybridoma line was further tested by FACS using W340.CHO-K1.hPro1.G2 as follow: Hybridoma supernatants were added to the cells, and the binding of rat antibodies onto the surface of the cells were detected by Alexa647-labeled goat anti-rat antibody. The MFI was evaluated by a flow cytometer and analyzed by FlowJo. Antibody binding to parental CHO-K1 cells was used as negative control.

(176) Once specific binding was verified through first and confirmation screening, the positive hybridoma cells were subcloned to get monoclonal anti-hTIM-3 antibodies by using semi-solid medium approach. The positive clones were confirmed by binding ELISA and FACS against human TIM-3 as described above. The exhausted supernatant of selected single clones was collected for purification.

(177) 3. Hybridoma Sequencing and Antibody Humanization

(178) 3.1 Hybridoma Cell Sequencing: Total RNAs were isolated from monoclonal hybridoma cells by using RNeasy Plus Mini Kit. First strand cDNA was prepared as follows:

(179) cDNA Amplification Reaction (20 L)

(180) TABLE-US-00004 Component Amount Up to 5 g total RNA 5 L Primer (50 M oligo(dT).sub.20/50 ng/L random hexamers) 1 L/1 L Annealing Buffer 1 L RNase/DNase-free water to 8 L 65 C. for 5 min, then immediately place on ice for at least 1 minute 2X First-Strand Reaction Mix 10 L SuperScript III/RNaseOUT Enzyme Mix 2 L
cDNA Amplification Reaction Condition

(181) TABLE-US-00005 Step 1 Step 2 Step 3 Step 4 Temperature ( C.) 25 50 85 4 Time 10 min 50 min 5 min

(182) Antibody VH and VL genes were amplified from cDNA using 3-constant region degenerated primer and 5-degenerated primer sets, which are complementary to the upstream signal sequence-coding region of Ig variable sequences. The PCR reaction was done as follows:

(183) PCR Reaction System (50 L)

(184) TABLE-US-00006 Component Amount cDNA 2.0 L Premix Ex Taq 25 L 5- degenerated primer sets (10 pM) 2.5 L 3- constant region degenerated 1 L primer (10 pM) ddH.sub.2O 19.5 L
PCR Reaction Condition

(185) TABLE-US-00007 Step 1 Step 2 Step 3 Step 4 Step 5 Temperature 95 94 58 72 72 ( C.) Time 4 min 45 sec 45 sec 1 min 10 min Cycles NA 30 NA

(186) PCR product (10 L) was ligated into pMD18-T vector and 10 L of the ligation product was transformed into Top10 competent cells. Transformed cells were plated on 2-YT+Cab plates and incubated overnight at 37 C. 15 positive clones were randomly picked for sequencing by Biosune.

(187) 3.2 Chimeric Antibody Construction (W3402-x)

(188) The VH and VL of TIM-3 hybridoma antibody were amplified by PCR. The PCR products were purified with PCR clean-up kit. The VL and VH were sequentially cloned into pCI vector containing human IgG4 Fc. The resulting vector expressed chimeric antibody construction W3402-x comprising the variable region of W3402 and the constant region of human IgG4.

(189) Once the sequences of inserted VL and VH were verified by sequencing, the expression vector containing the whole IgG sequence of the chimeric TIM-3 antibody was used for transient production.

(190) 3.3 Humanization

(191) Best Fit approach was used to humanize the light and heavy chains of W3402. The amino acid sequences of VH and VL were blasted against in-house human germline V-gene database. The first sequences of the humanized VH and VL were derived by replacing human CDR sequences in the top hit with the W3402's CDR sequences using Kabat CDR definition. Frameworks were defined using extended CDR definition, where Kabat CDR1 was extended by 5 amino acids at the N-terminus. For heavy chains, sixteen additional sequences were created by adding back mutations based on the first humanized VH sequence.

(192) Humanized genes were back-translated, codon-optimized for mammalian expression, synthesized by GENEWIZ, constructed into WuXi Biologics' proprietary expression vector and expressed using 293F or Expi-293F cells. The binding affinity to hTIM-3 of the humanized variant (see Table 5) was compared to that of the chimeric antibody (see Table 4) by K.sub.off ranking using SPR (Table 6).

(193) Table 4 shows the full kinetic binding affinity of the parental chimeric W3402-x to human TIM-3 by SPR.

(194) TABLE-US-00008 Target Antibody ka (1/Ms) kd (1/s) KD (M) hTIM-3.ECD.his parental chimeric 2.26E+06 2.12E05 9.37E12 W3402-x

(195) Table 5 shows the analysis of humanization score of the humanized variant W3402-z3.

(196) TABLE-US-00009 Huma- nization Lead antibody Germline FR1 FR2 FR3 FR4 score W3402-z3 zVH3 IGHV4-59*02 100% 100% 91% 100% 98.88% zVK1 IGKV2-29*02 100% 100% 100% 100%
3.4 K.sub.off Ranking: the humanized variants, the parental chimeric antibody, as well as negative control were injected to the sensor chip (GLM), which was pre-coated with anti-human IgG. After the chip was washed to obtain a stable baseline, the analyte W340-hPro1.ECD.His was injected to the chips at a flow rate of 100 L/min for an association phase of 100 s, followed by 2400 s dissociation (see Table 6).

(197) Table 6 shows the K.sub.off ranking results of the humanized variant W3402-z3.

(198) TABLE-US-00010 Category Antibody ID kd (1/s) Parental xAb chimeric W3402-x 1.95E06 Humanized variant W3402-z3 <1.00E06
PTM Removal

(199) There is a potential isomerization site DG located in VH-CDR3 of the W3402-z3. PTM removal was performed by introducing direct mutations at the potential PTM site. However, all PTM removed variants showed significant binding affinity loss, suggesting this site is critical for the antibody/antigen interaction.

Example 2: In Vitro Characterization

(200) 1. Full kinetic binding affinity to human TIM-3 tested by surface Plasmon resonance (SPR): W3402-z3 was injected to the sensor chip (CM5), which was pre-coated with anti-human IgG. After the chip was washed to obtain a stable baseline, various concentrations of analyte human TIM-3 and running buffer were injected to the chip at a flow rate of 30 L/min for an association phase of 180 s, followed by 2400 s dissociation. The association and dissociation curve was fit to a 1:1 Langmiur binding model using ProteOn software (see Table 7).

(201) Table 7 shows the full kinetic binding affinity of the humanized variant W3402-z3, to human TIM-3 by SPR, which was selected as final lead for full characterization.

(202) TABLE-US-00011 Target Antibody ka (1/Ms) kd (1/s) KD (M) hTIM-3.ECD.his W3402-z3 2.41E+06 1.01E04 4.21E11

(203) 2. Full kinetic binding affinity to cynomolgus monkey TIM-3 tested by surface Plasmon resonance (SPR): the sensor chip (CM5) was pre-coated with cynomolgus monkey TIM-3.ECD protein. Various concentrations of the W3402-z3 were injected over the sensor chip at a flow rate of 30 L/min for an association phase of 200 s, followed by 2400 s dissociation. The association and dissociation curve was fit to a 1:1 kinetics mode using Biacore 8K software (Table 8).

(204) Table 8 shows the full kinetic binding affinity of W3402-z3 to cynomolgus monkey TIM-3 by SPR.

(205) TABLE-US-00012 Target Antibody ka (1/Ms) kd (1/s) KD (M) W340- W3402-z3 5.61E+06 1.17E04 2.09E11 cynoPro1.ECD.Fc

(206) 3. Human TIM-3 binding (FACS): various concentrations of W3402-z3, positive and negative controls were added to hTIM-3-expressing transfectant cells, and then the binding of antibodies onto the surface of the cells was detected by PE-labeled goat anti-human IgG-Fc antibody. MFI of the cells was measured by a flow cytometer and analyzed by FlowJo.

(207) The binding of humanized W3402-z3 on human TIM-3 transfected cells is shown in FIG. 1A. The antibody can strongly bind to cell surface human TIM-3 with an EC.sub.50 of 0.23 nM.

(208) 4. Cross species binding (FACS): the binding of TIM-3 antibodies to cynomolgus monkey TIM-3 was determined by FACS. Various concentrations of W3402-z3, positive and negative controls were added to cyno TIM-3-expressing transfectant cells, and then the binding of antibodies onto the surface of the cells was detected by PE-labeled goat anti-human IgG-Fc antibody. MFI of the cells was measured by a flow cytometer and analyzed by FlowJo. FIG. 1B indicates that the antibody showed strong binding to cynomolgus monkey TIM-3 with an EC.sub.50 of 0.32 nM.

(209) 5. Resting and activated human CD4 T cells binding: It is known that TIM-3 expression can be induced on human CD4.sup.+ T cells post in vitro activation (Hastings W D, et al. TIM-3 is expressed on activated human CD4.sup.+ T cells and regulates Th1 and Th17 cytokines. Eur J Immunol. 2009; 39:2492-501). To determine whether W3402-z3 can bind to natural human TIM-3, freshly purified human CD4.sup.+ T cells were activated to induce TIM-3 expression. Human peripheral blood mononuclear cells (PBMCs) were freshly isolated from healthy donors using Ficoll-Paque PLUS gradient centrifugation. Human CD4.sup.+ T cells were isolated using Human CD4.sup.+ T Cell Enrichment Kit according to the manufacturer's protocol. Purified human CD4.sup.+ T cells were stimulated with PHA or left unstimulated for three days. Various concentrations of W3402-z3 as well as negative control were added to resting or activated human CD4.sup.+ T cells, and then the binding of antibodies onto the surface of the human CD4.sup.+ T cells was detected by PE-labeled goat anti-human IgG-Fc antibody. MFI of the cells was measured by a flow cytometer and analyzed by FlowJo.

(210) As shown in FIG. 2A-2B, W3402-z3 binds to activated, but not resting CD4.sup.+ T cells. FIG. 2A shows the binding histogram of W3402-z3 to activated and non-activated CD4.sup.+ T cells. The binding curve of W3402-z3 to activated CD4.sup.+ T cells is shown in FIG. 2B.

(211) 6. Paralog/Specificity (ELISA): To test whether it specifically binds to human TIM-3, but not cross-reacts to the other TIM family members, the binding of W3402-z3 to human TIM-1 and TIM-4 was determined by ELISA. W3402-z3, positive and negative control antibodies were added to the plates that were pre-coated with either human TIM-1 or TIM-4. The binding of the antibodies to the plates was detected by corresponding HRP-conjugated 2.sup.nd antibodies (see FIGS. 3A-3C). FIG. 3 shows W3402-z3 binds specifically to human TIM-3 (FIG. 3A), with no cross-reactive binding to human TIM-1 (FIG. 3B) or TIM-4 (FIG. 3C).

(212) 7. Epitope binning with BMK antibodies: Various concentrations of testing antibodies were mixed with certain amount of W340-BMK4.mIgG1 and W340-BMK6.hIgG, respectively. The mixtures were then added to the plates pre-coated with human TIM-3 protein. The binding of the W340-BMK4.mIgG1 and W340-BMK6.hIgG to the plates was detected by HRP-conjugated anti-mFc antibody and SA-HRP, respectively (see FIG. 4). FIGS. 4A and 4B suggest that W3402-z3 is in the same or close epitope bin as benchmark W340-BMK4 (US20150218274) (FIG. 4B); but not W340-BMK6 (US20160200815) (FIG. 4A) for binding to human TIM-3.

(213) 8. In Vitro Functionality Tests

(214) 8.1 Reporter gene assay: To test whether W3402-z3 can functionally counteract the role of TIM-3 in regulating T cell response, we transfected Jurkat cells with TIM-3 and IL-2 luciferase reporter gene. It has been implicated by Ferris et al. that TIM-3 may contribute to T cell exhaustion by enhancing TCR signaling, at least under acute conditions (Ferris R L, Lu B, Kane L P. Too much of a good thing? Tim-3 and TCR signaling in T cell exhaustion. J Immunol. 2014; 193: 1525-30). Consistent with Ferris' finding, the TIM-3 overexpressing Jurkat cells showed increased IL-2 reporter gene signal post anti-CD3/CD28 stimulation.

(215) The TIM-3.sup.+ Jurkat cells were activated by anti-CD28 antibody and anti-CD3 antibody in the presence of various concentrations of testing antibodies overnight at 37 C., 5% CO.sub.2. After incubation, reconstituted luciferase substrate was added and the luciferase intensity was measured by a microplate spectrophotometer.

(216) FIG. 5 shows that W3402-z3 can counteract the effect of TIM-3 and modulate TIM-3.sup.+ Jurkat post activation.

(217) 8.2 Allogeneic mixed lymphocyte reaction (MLR): PBMCs and human CD4.sup.+ T cells were isolated and purified as described above. Monocytes were isolated using CD14 Micro Beads according to the manufacturer's instructions. Cells were cultured in medium containing GM-CSF and IL-4 for 5 to 7 days to generate dendritic cells (DC). Purified CD4.sup.+ T cells were co-cultured with allogeneic mature DCs (mDCs) together with various concentrations of W3402-z3 in 96-well plates. On Day 5, the culture supernatants were harvested for IFN tests.

(218) FIG. 6 demonstrates that W3402-z3 can enhance the IFN production of human CD4.sup.+ T cell in a dose dependent manner.

(219) 8.3 Antigen-specific MLR: PBMCs and iDCs were obtained as described above. PBMCs were treated with CMV-pp65 and IL-2 for 5 days, and then CD4.sup.+ T cells were isolated as described above. Autologous iDCs were pulse stimulated with CMV-pp65. In the presence of autologous iDCs, purified CD4.sup.+ T cells were co-cultured with various concentrations of W3402-z3 in 96-well plates. IL-2 and IFN production was determined on Day 3 and Day 5, respectively. The cells were harvested at Day 5 to measure CD4.sup.+ T cell proliferation by .sup.3H-thymidin incorporation assay.

(220) Human IFN and IL-2 ELISA: the plates were pre-coated with capture antibody specific for human IFN (cat #Pierce-M700A) or IL-2 (cat #R&D-MAB602), respectively. The biotin-conjugated anti-IFN antibody (cat #Pierce-M701B) or anti-IL-2 antibody (cat #R&D-BAF202) was used as detecting antibody.

(221) Proliferation assay: .sup.3H-thymidine (cat #PerkinElmer-NET027001MC) was diluted 1:20 in 0.9% NaCl solution, and added to the cell culture plates at 0.5 uCi/well. The plates were cultured in 5% CO.sub.2 at 37 C. for 16 to 18 hours, before the incorporation of .sup.3H-thymidine into the proliferating cells was determined.

(222) FIGS. 7A-7C demonstrate that W3402-z3 can enhance the IL-2 production (FIG. 7A) of human CD4.sup.+ T cells in a dose-dependent manner, W3402-z3 can enhance the IFN production (FIG. 7B) as well as the proliferation (FIG. 7C) of human CD4.sup.+ T cells.

(223) 8.4 Regulatory T cell inhibition assay: CD4.sup.+ T cells were isolated as described above. CD4.sup.+ T cells were then separated into Treg (CD4+CD25+) and CD4.sup.+CD25.sup.low/ T cells using Human CD4+CD25.sup.high T cell Isolation Kit according to the manufacturer's instructions. Allogeneic DCs, CD4.sup.+CD25.sup. T cells, Treg cells and TIM-3 antibodies were incubated in 96-well plates. The plates were kept at 37 C. in a 5% CO.sub.2 incubator for 5 days. CD4.sup.+CD25.sup. cell proliferation was determined on Day 5 by .sup.3H-thymidine incorporation assay.

(224) FIGS. 8A and 8B demonstrate that W3402-z3 can partially block the suppressive function of Tregs in regulating CD4 T cell proliferation. FIG. 8A shows the CD4 T cell proliferation in the presence of W3402-z3 alone or with Treg cells. FIG. 8B shows the percentage of inhibitory effect mediated by Treg in the presence of W3402-z3 or isotype control.

(225) 9. Antibody-dependent cell-mediated cytotoxicity (ADCC): Human CD4.sup.+ T cells were activated to induce TIM-3 expression as described above. Activated human CD4.sup.+ T cells and various concentrations of testing antibodies were pre-incubated in 96-well plate for 30 minutes, and then PBMCs were added at the effector/target ratio of 50:1. The plate was kept at 37 C. in a 5% CO.sub.2 incubator for 4-6 hours. Target cell lysis was determined by LDH-based cytotoxicity detection kit. Herceptin induced ADCC effect on BT474 cells was used as positive control.

(226) FIG. 9 shows the result of ADCC test demonstrating W3402-z3 does not mediate ADCC activity on activated CD4.sup.+ T cells, which can avoid the potential damage to TIM-3 positive cells while it is used to treat patients.

(227) The IgG1 formats of W3402-z3 (in which the human IgG1 constant region contains amino acid substitution of L234F, L235E and P331S, or having an Arg inserted after position 236 along with L328R) are also tested for ADCC and CDC activities. The IgG1 formats of W3402-z3 show binding activities and blocking activities to TIM-3 at a level comparable or similar to IgG4 format of W3402-z3, and do not mediate ADCC or CDC activity on activated CD4.sup.+ T cells either (data not shown).

(228) 10. Complement dependent cytotoxicity (CDC): human activated CD4.sup.+ T cells and various concentrations of testing antibodies were mixed in 96-well plates. Human complement was added at the dilution of 1:50. The plates were kept at 37 C. in a 5% CO.sub.2 incubator for 2-3 hours. Target cell lysis was determined by CellTiter-Glo. Rituxan-induced Raji cell lysis was used as positive control.

(229) FIG. 10 shows the result of CDC test demonstrating W3402-z3 does not mediate CDC activity on activated CD4.sup.+ T cells.

(230) 11. Serum stability test: W3402-z3 was 1:50 diluted in freshly collected human serum, aliquoted and cultured at 37 C. in a 5% CO.sub.2 incubator. At indicated time point, an aliquot of W3402-z3 was removed from culture, snap frozen, and then kept at 20 C., until ready for binding titration test by FACS as described above.

(231) FIG. 11 shows that the W3402-z3 is stable in human serum at 37 C. for at least 14 days.

(232) 12. PtdSer (Phosphatidylserine) Competition Assay:

(233) It has been suggested by Sabatos-Peyton et al. (Sabatos-Peyton C A, et al. Blockade of Tim-3 binding to phosphatidylserine and CEACAM1 is a shared feature of anti-Tim-3 antibodies that have functional efficacy. Oncoimmunology. 2017; 7: e1385690) that blockade of PtdSer is a shared property of anti-TIM-3 antibodies with demonstrated functional efficacy. To determine whether W3402-z3 can block the binding between human TIM-3 and PtdSer, Jurkat E6-1 cells were treated with Paclitaxel for 2 days to induce apoptosis. Various concentrations of W3402-z3, positive and negative controls were pre-mixed with mFc-tagged human TIM-3, and then added to apoptotic Jurkat cells. The binding of human TIM-3 onto the surface of the apoptotic Jurkat cells was detected by PE-labeled anti-mouse IgG Fc antibodies. As shown in FIG. 12, W3402-z3 demonstrates a dose-dependent blockade of PtdSer-TIM-3 interaction with an IC.sub.50 of 35.47 nM.

(234) 13. Human TIM-3 surface down-regulation (FACS): As reported by Waight J. et al, functional anti-TIM-3 antibody can induce rapid TIM-3 internalization as one of the possible mechanism of action to block the signaling of TIM-3 (Waight J, et al. INCAGN02390, a novel antagonist antibody that targets the co-inhibitory receptor TIM-3. Abstract 3825, AACR Annual Meeting 2018; Apr. 14-18, 2018; Chicago, IL). To determine whether W3402-z3 can induce cell surface hTIM-3 down-regulation, hTIM-3-expressing cells were cultured with W3402-z3 or isotype control antibody. Various concentrations of testing antibodies were added to human TIM-3-expressing transfectant cells, and cultured at 37 C., 5% CO.sub.2. At the different time points, cells were harvested; and the presence of hTIM-3 on the surface of the cells was detected by biotin labeled polyclonal TIM-3 antibody followed by PE labeled SA. MFI of the cells was measured by a flow cytometer and analyzed by FlowJo.

(235) As early as 4 hours post the addition of W3402-z3 into the cell culture, remarkable dose-dependent hTIM-3 down-regulation was detected (FIG. 13). It is known that internalization can be blocked by hypertonic sucrose (Hansen S H, Sandvig K, van Deurs B. Clathrin and HA2 adaptors: effects of potassium depletion, hypertonic medium, and cytosol acidification. J Cell Biol. 1993; 121(1):61-72). The down-regulation of TIM-3 was completely abolished by culturing in the hypertonic medium (complete RPMI 1640 supplemented with 1M sucrose), suggesting the W3402-z3-induced hTIM-3 down-regulation was mediated by internalization, but not shedding (data not shown).

(236) 14. Stress test: Since W3402-z3 contains a potential isomerization PTM site in its VH-CDR3 region, a stress test was performed to evaluate whether the binding affinity of the antibody was effected under the stressed condition for isomerization.

(237) A stressed sample of W3402-z3 was prepared by buffer exchanging W3402-z3 into 20 mM Tris, 150 mM NaCl, pH 8.5 buffer using microcentrifuge desalting column (7K MWCO, Thermo Fisher) and further concentrating to 1 mg/ml using Amicon ultrafiltration filter (30K MWCO, Merck Millipore). The antibody was then incubated at 37 C. for 5 days, to provide the stressed sample of W3402-z3 (W3402-z3-stress). Binding affinities of the stressed antibody and non-stressed antibody to human TIM-3 was measured by SPR as described above.

(238) Table 9 shows that the stressed sample (W3402-z3-stress) had comparable binding affinity to human TIM-3 to that of the non-stressed sample, indicating that the activity of W3402-z3 was not affected by the stress conditions.

(239) TABLE-US-00013 Target Antibody ka (1/Ms) kd (1/s) KD (M) hTIM- W3402-z3 1.07E+06 1.04E04 9.73E11 3.ECD.his W3402-z3-stress 1.08E+06 1.02E04 9.49E11