RNAi nano-preparation, preparation method thereof and application thereof in TMV prevention and control

11608502 · 2023-03-21

Assignee

Inventors

Cpc classification

International classification

Abstract

The invention belongs to the field of genetic engineering technology and application thereof, and in order to solve the problems of lack of high efficient TMV-resistant RNAi nano-preparation at present, complicated preparation process of medicament, poor stability and delivery efficiency of dsRNA, the invention provides an RNAi nano-preparation, preparation method thereof and application thereof in TMV prevention and control. The RNAi nano-preparation is prepared from dsRNA and chitosan nano materials, wherein, dsRNA is a highly TMV-resistant RdRP3 gene with a length of 313 bp obtained from screening, with nucleotide sequence shown in SEQ ID NO.1, and the volume ratio of the chitosan to 1 μg/μl dsRNA is 10:(1-6). The RNAi nano-preparation provided by the invention has the advantages of stronger stability and better durability of dsRNA, good biocompatibility, good biodegradability, no harm to crops, environmental friendliness and the like, and has a good application prospect in the field of TMV virus prevention and control.

Claims

1. An RNAi nano-preparation comprising double stranded RNA (dsRNA) of SEQ ID NO: 1 and chitosan, with volume ratio of chitosan to 1 μg/μl dsRNA of 10:1-6.

2. A method of preparing the RNAi nano-preparation of claim 1, comprising dropwise adding dsRNA solution into chitosan non material solution in proportion, uniformly mixing, slowly adding the dsRNA-containing chitosan solution into a 1% SDS solution at a ratio of 2:1, shaking for 10 minutes and wrapping the dsRNA inside the chitosan to form spheroids with a diameter of 100-200 nm; wherein the concentration of the dsRNA solution is 1 μg/μl; chitosan nano material solution is prepared by dissolving chitosan in glacial acetic acid and the final concentration of the chitosan nano material solution is 2 μg/μl.

3. A method of tobacco mosaic virus prevention comprising uniformly spreading or spraying a solution of claim 1 on plant leaves.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 is a image showing agarose gel electrophoresis results of cDNA of a target gene containing a T7 promoter provided in Example 1 of the present invention, wherein, lanes from left to right are the cDNA of Marker, CP, MP, P126, RdRP2, RdRP3 and RdRP4 genes, which are about 480 bp, 333 bp, 641 bp, 388 bp, 313 bp and 746 bp, respectively, which are consistent with the size of the target gene;

(2) FIG. 2 is a image of agarose gel electrophoresis results of in vitro transcriptionally synthesized dsRNA provided in Example 1 of the present invention, wherein, lanes from left to right are Marker, CP dsRNA, MP dsRNA, P126 dsRNA, RdRP2 dsRNA, RdRP3 dsRNA and RdRP4 dsRNA, respectively;

(3) FIG. 3 is a graph showing the effect of different dsRNA treatments on the expression level of wild-type TMV;

(4) FIG. 4 shows the results of Western Blot on tobacco leaves after dsRNA treatment for each group;

(5) FIG. 5 is a photograph of real-time fluorescence quantitative detection 3d and 5d after exposure of tobacco leaves to virus;

(6) FIG. 6 shows the effect of different dsRNA treatments for 5 days on TMV-30b expression level;

(7) FIG. 7 is an agarose gel electrophoresis image of dsRNA provided by the invention fused with chitosan in different proportions, wherein: lanes from left to right are Marker, RdRP3 dsRNA, respectively: chitosan 1:2, 1:5, 1:10, 1:20, 1:30, 1:40, RdRP3 dsRNA;

(8) FIG. 8 is an agarose gel electrophoresis image of a nano-preparation provided in the present invention after 10 d of storage, wherein, lanes from left to right are Marker, RdRP3 dsRNA, respectively: chitosan 1:2, 1:5, 1:10, 1:20, 1:30, 1:40;

(9) FIG. 9 is a photograph showing necrotic lesion of tobacum samsan after being sprayed with the nano-preparation provided by the invention for 3 d;

DETAILED DESCRIPTION OF THE INVENTION

(10) Hereinafter, the technical scheme of the present invention will be clearly and completely described. It is to be understood that the described embodiments are only a few, but not all, embodiments of the invention. Based on the embodiments of the present invention, all other embodiments obtained by a person of ordinary skill in the art without involving any inventive effort are within the scope of the present invention.

(11) Example 1: the embodiment provides a method for screening high-efficiency action fragments and application thereof. After six groups of candidate gene fragments are selected and dsRNA is synthesized in vitro, the antiviral capacity of the candidate gene fragments is evaluated by a biological method, and the dsRNA for efficiently degrading TMV target nucleic acid is screened. The six groups of candidate gene fragments of TMV are CP, MP, P126, RdRP2, RdRP3 and RdRP4, and the gene sequences thereof are as shown in sequences: SEQ ID NOs.4, 5, 6, 7, 1 and 8.

(12) The screening method for dsRNA for efficiently preventing and controlling TMV specifically comprises the following steps of:

(13) S1: extracting total RNA of TMV infected tobacco leaves. Carrying out reverse transcription with the extracted total RNA as a template to obtain cDNA of TMV;

(14) S2: designing specific amplification primers of six sequences of CP, MP, P126, RdRP2, RdRP3 and RdRP4 by taking cDNA as a template, and amplifying a target gene fragment by using the specific primers;

(15) S3: synthesizing dsRNA in vitro by using specific amplification products as templates.

(16) In order to more clearly describe the method for screening highly effective acting fragments provided by the embodiment of the present invention in detail, the following description will be made.

(17) (S1): the total RNA extraction kit is used for extracting the total RNA of the plant leaves, and the specific steps are as follows:

(18) S1-1: collecting fresh tobacco leaves infected with TMV and immediately placing in liquid nitrogen.

(19) S1-2: pre-cooling the mortar by liquid nitrogen until the mortar cannot be held by hands, placing tobacco leaves on the mortar until the tobacco leaves were ground into powder, and continuously adding liquid nitrogen in the mortar.

(20) S1-3: taking 100 mg of the powder into a 1.5 ml centrifuge tube, adding 1 ml RNAiso Plus (Takara) immediately, shaking and uniformly mixing until no macroscopic particles exist, and standing at room temperature for 5 min.

(21) S1-4: centrifuging at 12,000 g, 4° C. for 10 min. Carefully aspirating the supernatant (without aspirating the precipitate) and transferring to a new 1.5 mL centrifuge tube.

(22) S1-5: adding 200 μL chloroform, capping the centrifuge tube, shaking and mixing until being milky white Standing at room temperature for 5 min.

(23) S1-6: centrifuging at 12,000 g, 4° C. for 15 min. The homogenate comprises three layers: the colorless supernatant (containing RNA), the middle white protein layer (mostly DNA), and the colored lower organic phase.

(24) S1-7: carefully aspirating the supernatant (without aspirating the middle white protein layer) and transferring to another new 1.5 mL centrifuge tube.

(25) S1-8: adding 500 μL isopropanol, gently inverting 5 times up and down, and standing at room temperature for 10 min.

(26) S1-9: centrifuging at 12,000 g, 4° C. for 10 min.

(27) S1-10: carefully discarding the supernatant, adding 1 mL 75% ethanol, gently inverting the centrifuging tube, centrifuging at 7,500 g, 4° C. for 5 min, and discarding the supernatant (without touching the precipitate). Repeating once.

(28) S1-11: opening the centrifuge tube cap, drying at room temperature for 5 min, and adding 100 μL RNase-free H.sub.2O to dissolve the precipitate.

(29) Finally, detecting the extracted RNA by 1.0% agarose gel electrophoresis, detection results as shown in FIG. 1, and then storing the extracted RNA in −80° C.

(30) (S2): synthesizing TMV genome cDNA, and in the reaction, carrying out reverse transcription process by utilizing Hiscrit® IIIRT RuperMix for qPCR (+gDNA wiper) kit of Vazyme.

(31) S2-1: thawing 4×gDNA wiper Mix, 5×HiScripT III qRT SuperMix, RNA Template, RNase-Free H.sub.2O on ice, then the following steps were completed on ice;

(32) S2-2: preparing a reaction mixed solution system for removing genome DNA, wherein the specific system comprises: 4×gDNA wiper Mix 4 μl, RNA Template 1 μl (1 μg), RNase-Free H.sub.2O to 16 μl;

(33) S2-3: lightly blowing the pipette and centrifuging for a short time, so that the solution on the tube wall is collected at the bottom of the tube;

(34) S2-4: incubating for 2 min at 42° C.;

(35) S2-5: after the reaction is finished, obtaining a reaction solution I, centrifuging shortly, and cooling on ice;

(36) S2-6: preparing a reverse transcription system mixed solution system, wherein the specific system is: the above reaction solution I 16 μl, 5×HiScript III qRT SuperMix 4 μl;

(37) S2-7: uniformly mixing and centrifuging for a short time, so that the solution on the tube wall is collected at the bottom of the tube;

(38) S2-8: incubating at 37° C. for 15 min, 85° C. for 5 s;

(39) S2-9: after the reaction was complete, storing at −20° C.

(40) (S3): Amplification of Six Genes

(41) S3-1: designing primers of six kinds of genes according to sequence information, the primer sequences are shown in Table 1:

(42) TABLE-US-00001 TABLE 1 Gene amplification primers and  corresponding sequences Gene Primers Sequence (5′-3′) CP McpP 5′-attctctagaagcttaatacgactcact (SEQ ID NO. 9) atagggatgtcttacagtatcactactcc TMVCP-R 5′-attctctagaagcttaatacgactcact (SEQ ID NO. 10) atagggagttgcaggaccagagg MP TMVMP-F 5′-attctctagaagcttaatacgactcact (SEQ ID NO. 11) atagggggaaagagccgacgag TMVMP-R 5′-attctctagaagcttaatacgactcact (SEQ ID NO. 12) ataggggcaagcctgattgacata P126 TMVP/26-P 5′-attctctagaagcttaatacgactcact (SEQ ID NO. 13) atagggtcttaccgtcgatgttt TMVP126-R 5′-attctctagaagcttaatacgactcact (SEQ ID NO. 14) ataggggttcttgttcggcact RdRP2 TMVRdRP-F 5′-attctctagaagcttaatacgactcact (SEQ ID NO. 15) atagggcttacttcccggcctcta TMRdRP-R 5′-attctctagaagcttaatacgactcact (SEQ ID NO. 16) ataggggctttcgcctggtatgtt RdRP3 TMVRdRP-F 5′-attctctagaagcttaatacgactcact (SEQ ID NO. 2) atagggatttcgctggcgtttg TMVRARP-R 5′-attctctagaagcttaatacgactcact (SEQ ID NO. 3) atagggctgccgtcattgggtc RdRP4 TMWRF-F 5′-attctctagaagcttaatacgactcact (SEQ ID NO. 17) atagggtgaccttccacgacaga TMRdRP-R 5′-attctctagaagcttaatacgactcact (SEQ ID NO. 18) atagggagcgccacatgatactt actin actin-F 5′-caaggaaatcaccgctttgg (SEQ ID NO. 19) actin-R 5′-aagggatgcgaggatgga (SEQ ID NO. 20) TMV TMV-F 5′-caaggaaatcaccgctttgg (SEQ ID NO. 21) TMV-R 5′-aagggatgcgaggatgga (SEQ ID NO. 22)

(43) S3-2: carrying out a PCR amplification reaction on the TMV genome with cDNA as a template by using primers specifically containing a T7 promoter as shown in table 1 to obtain amplification products of TMV CP, MP, P126, RdRP2, RdRP3 and RdRP4 genes containing the T7 promoter; in the reaction, carrying out reverse transcription process by utilizing Hiscrit® IIIRT SuperMix for qPCR (+gDNA wiper) kit of Vazyme.

(44) The PCR reaction system specifically comprises: 2×Phanta Max Master Mix 25 μl; template DNA 1 μl; primer F 2 μl; primer R 2 μl; H.sub.2O to 50 μl;

(45) PCR amplification conditions are as follows: pre-denaturing for 3 min at 95° C.; denaturing for 15 s at 95° C., annealing for 30 s at T.sub.m, extending for 30 s at 72° C., a total of 35 cycles; final extending for 5 min at 72° C., at last insulating at 8° C.

(46) (S4): preparing dsRNA of six kinds of genes through in-vitro transcription, and carrying out in-vitro transcription preparation according to instructions of an In vitro Transcription T7 Kit (for siRNA Synthesis) kit of TaKaRa, and the specific operations are as follows:

(47) S4-1: preparation of dsRNA: preparing a 40 μl reaction system by taking 15 μl PCR amplification products, wherein the reaction system is as follows: 10× Transcription Buffer 4 μl, ATP Solution 4 GTP Solution 4 μl, CTP Solution 4 μl, UTP Solution 4 μl, RNase Inhibitor 1 μl, T7 RNA Polymerase 4 μl and linear template DNA 15 μl;

(48) S4-2: uniformly mixing the solution, slightly centrifuging, collecting the transcription reaction solution at the bottom of a reaction tube, and reacting at 42° C. for 2 hours;

(49) S4-3: adding 6 μl RNase free DNase I into the above solution after the transcription reaction, and uniformly mixing;

(50) S4-4: reacting at 37° C. for 30 min.

(51) S4-5: purifying dsRNA: when the reaction liquid volume was 40 μl, adding 60 μl RNase free H.sub.2O to make up to 100 μl.

(52) (1) adding an equal volume of phenol (pH 4.5)/chloroform/isoamyl alcohol (25:24:1), stirring well and centrifuging at 12,000 rpm for 2 min at room temperature.

(53) (2) transferring the upper layer (aqueous layer) to a new centrifuge tube and adding an equal volume of chloroform/isoamyl alcohol (24:1), stirring and centrifuging at 12,000 rpm for 2 min at room temperature.

(54) (3) transferring the upper layer (aqueous layer) to a new centrifuge tube and adding 1/10 volume of 3 M glacial sodium acetate, an equal volume of isopropanol and mixing well.

(55) (4) standing for 5 min at room temperature, centrifuging at 15,000 rpm for 5 min at room temperature.

(56) (5) removing the supernatant and washing the precipitate with 80% ethanol.

(57) (6) adding 40 μl A RNase free H.sub.2O after drying to dissolve the precipitate and storing at −20° C.

(58) S4-6: detection of dsRNA: taking 2 μl dsRNA product to mix with 6× loading buffer and detecting by agarose gel electrophoresis, observing whether the bands are single and bright or not, and the electrophoresis detection result is shown in FIG. 2; determining the concentration of dsRNA by using a micro-spectrophotometer.

(59) (S5) screening of highly effective disease-resistant specific dsRNA.

(60) S5-1: plantation and transplantation of laboratory tobacco: scattering a nicotiana benthamian seed in a tray and covering a film, transferring tobacco seedlings to a disposable plastic cup after seeds germinating for about one week and growing to the size suitable for transplanting, culturing for about one month, and growing tobacco plants to the size suitable for processing.

(61) S5-2: injection of dsRNA with inoculation of TMV: the method of injecting dsRNA first and inoculating TMV virus 24 h later was adopted in this experiment. Selecting uniformly-sized nicotiana benthamian leaves in advance, and marking Dissolving 200 μg dsRNA in 0.7 ml H.sub.2O and injecting into the leaves, but injecting only 0.7 ml H.sub.2O into the control leaves. 24 h later, inoculating virus, weighing a small amount of TMV poison source leaves, grinding into juice in a mortar, adding 100 times of volume of PBS buffer solution (pH 6.8) and uniformly mixing, scattering a layer of 100-mesh quartz sand on uniformly-sized nicotiana benthamian leaves, dipping the poison source juice with a cotton swab to lightly spread on the leaves to cause micro wounds to infect viruses, and ensuring consistent virus inoculation amount and uniform force as far as possible. 24 h, 48 h and 72 h after virus inoculation, cutting the inoculated leaves and freezing in liquid nitrogen respectively, three biological replicates were taken every day and storing at −80° C. for real-time RT-PCR and Western Blot.

(62) S5-3: extracting RNA from the sample leaves for real-time RT-PCR.

(63) mRNA relative expression level of Actin was measured by Actin-F/R and mRNA relative expression level of TMV CP were measured by TMV-F/R. Primer sequences are shown in Table 1. Carrying out the real-time RT-PCR according to the instruction of the ChamQ™ Universal SYBR qPCR Master Mix kit of Vazyme, and the specific operation was as follows:

(64) (1) obtaining cDNA: obtaining cDNA from dsRNA of H.sub.2O, CP, MP, P126, RdRP2, RdRP3 and RdRP4-treated infected leaves with reference to S1 and S2 of embodiment 1.

(65) (2) taking a 96-well reaction plate MicroAmp Fast Optical 96-Well Reaction Plate with Barcode (ABI), and configuring a real-time RT-PCR system, wherein the specific system is as follows: 2×ChamQ Universal SYBR qPCR Master Mix 10 μl, Primer F 0.4 μl; primer R 0.4 μl; cDNA 1 μl, H.sub.2O 8.2 μl.

(66) (3) lightly flipping tube wall, uniformly mixing, and centrifuging shortly by using a 96-hole reaction plate to avoid bubbles.

(67) (4) finishing real-time RT-PCR reaction in an Applied Biosystems 7500 Fast Real-Time PCR System. The reaction procedure was 95° C. for 30 s; 95° C. for 10 s, 60° C. for 30 s, 40 cycles; 95° C. for 15 s, 60° C. for 1 min, 95° C. for 15 s, the reaction was completed and the results were analyzed. The results are shown in FIG. 3, from which it can be seen that: on the third day, the relative expression of virus in the plants treated by MP, RdRP3 and RdRP4 was lower, and the antiviral effect was more obvious.

(68) S5-4: extracting total protein from the sample leaves. Using the Plant Protein Extraction Kit reagent of Cowin Bio. to extract protein from sample leaves, and the specific operation is as follows:

(69) (1) taking out the Plant Protein Extraction Reagent required by the experiment before protein extraction for precooling.

(70) (2) weighing the test plant tissue. Adding 5 ml of Plant Protein Extraction Reagent (adding Protease Inhibitor Cocktail added at a ratio of 1:99 before protein extraction) to 1 g tissue.

(71) (3) incubating on ice for 30 min after homogenization.

(72) (4) at 4° C. 13,400×g, centrifuging for 20 min.

(73) (5) collecting soluble proteins in the supernatant and storing at −80° C. ready for further analysis.

(74) S5-5: Western Blot detection.

(75) (1) taking supernatant protein solution 8 μl for mixing and adding 2×SDS loading buffer with equal volume of 8 μl into PCR tube. After boiling in boiling water for 5 min, loading 15 μL six kinds of treated protein CP, MP, P126, RdRP2, RdRP3 and RdRP4 into sample well respectively, adding 8 μL Blue Plus II protein maker into sample well. Carrying out electrophoresis at 180 V for 35 min until the loading buffer dye was transferred to the bottom of the gel.

(76) (2) removing the glass plate and pry it with a doctor-bar, removing the gel, removing the stacking gel, and soaking the separation gel in the transfer buffer.

(77) (3) soaking the sponge pad and the thick filter paper with a transfer buffer, cutting a PVDF membrane with proper size, soaking in methanol for 10 s, sequentially installing the sponge pad, the thick filter paper, the separation gel and the PVDF membrane, and removing bubbles between the separation gel and the PVDF membrane. Putting an ice boxes in the transfer buffer and transferring membranes at 100 V for 90 min.

(78) (4) after finishing the membrane transfer, dyeing the separation gel with a Coomassie brilliant blue protein gel fast dyeing solution, decoloring and taking photo by using a chemiluminescence imager.

(79) (5) washing the PVDF membrane three times with TBST buffer for 10 min each time.

(80) (6) blocking PVDF membranes in blocking solution (0.5 g BSA in 10 mL TB ST) at 45 rpm for 1 h at room temperature.

(81) (7) taking PVDF membrane out and placing in TB ST containing primary antibody (diluted 2000-fold, Abcam) at 4° C. overnight.

(82) (8) washing the PVDF membrane three times with TB ST for 10 min each time.

(83) (9) placing in TB ST containing secondary antibody (diluted 5000-fold, Abcam), shaking at 45 rpm for 1 h.

(84) (10) washing the PVDF membrane three times in TBST for 10 min each time.

(85) (11) preparing a luminescent liquid by using an eECL Western Blot Kit, smearing on a membrane, and taking photo by using a chemiluminescence imager. The results of Western Blot on tobacco leaves after dsRNA treatment for each group are shown in FIG. 4. The results of Western Blot showed that the expression level of CP protein of TMV virus decreased in different degrees after injection of dsRNA, which indicated that dsRNA could inhibit the replication and infection of TMV.

(86) Example 2: the application of the high-efficiency dsRNA further screened in Example 1 in the prevention of TMV virus, the specific application methods are as follows:

(87) S1: planting and transplanting laboratory tobacco: procedure referring to S5-1 of Example 1, growing tobacco plants an appropriate size.

(88) S2: injection of dsRNA with inoculation of TMV-30b: the method of injecting dsRNA first and inoculating TMV-30b virus 24 h later was adopted in this experiment. Selecting uniformly-sized nicotiana benthamian leaves in advance, and marking Dissolving 200 μl dsRNA of MP, RdRP3 in 0.7 ml H.sub.2O and injecting into the leaves, but injecting only 0.7 ml H.sub.2O into the control leaves. 24 h later, inoculating virus, weighing a small amount of TMV-30b poison source leaves, grinding into juice in a mortar, adding 40 times of volume of PBS buffer solution (pH 6.8) and uniformly mixing, scattering a layer of 100-mesh quartz sand on uniformly-sized nicotiana benthamian leaves, dipping the poison source juice with a cotton swab to lightly spread on the leaves to cause micro wounds to infect viruses, and ensuring consistent virus inoculation amount and uniform force as far as possible. 3 d and 5 d after virus inoculation, observing fluorescence and taking photos under ultraviolet light, cutting the inoculated leaves and freezing in liquid nitrogen respectively, three biological replicates were taken every day and storing at −80° C. for real-time RT-PCR.

(89) S3: real-time RT-PCR procedure referring to S5-3 of Example 1, carrying out fluorescent quantitative detection. Fluorescence photos are shown in FIG. 5, from which it can be seen that the leaves of nicotiana benthamian treated with RdRP3 dsRNA have less fluorescence and can significantly prolong the withering time of the leaves. The effect of different dsRNA treatments for 5 days on the expression level of TMV-30b, the experimental results are shown in FIG. 6, it can be seen from the figure that the virus expression level of RdRP3 on the fifth day is lower, and the antiviral effect is relatively more obvious. In combination with the above experimental results, RdRP3 was finally selected as the target dsRNA.

(90) In order to more clearly describe the RNAi nano-preparation for TMV prevention and control and the preparation method thereof provided by the present invention, a description will be given below with reference to specific examples.

(91) Example 3: a preparation method of the nano RNAi preparation for TMV prevention and control, comprises the following steps of:

(92) (S1) binding the chitosan nano material with dsRNA, the specific operation steps are as follows:

(93) S1-1: dissolving chitosan in glacial acetic acid to prepare a chitosan solution A with a final concentration of 2 μg/μl;

(94) S1-2: slowly adding a TMV dsRNA solution with the concentration of 1 μg/μl into a chitosan solution A, wherein the volume ratio of chitosan to dsRNA is 10:(1-6). If the mass ratio is too low, many dsRNA will not bind to chitosan, so that the prevention and control effect of TMV virus is finally influenced, and if the ratio is too high, many chitosan nano materials are not attached with dsRNA, resulting in unnecessary waste.

(95) The dsRNA of the RdRP3 gene is respectively provided with six mixing ratios, the volume ratio of chitosan glacial acetic acid solution:dsRNA was 10:1, 10:2, 10:3, 10:4, 10:5 and 10:6, respectively;

(96) S1-3: mixing a chitosan solution of dsRNA and a 1% SDS solution in a volume ratio of 2:1, and performing vortex shaking for 5 min;

(97) S1-4: 5 μl mixed solution was added to 1 μl 6×DNA loading buffer, and observing the results after agarose gel electrophoresis. If no bands were present and bright bands appeared around the wells, it was confirmed that the chitosan dsRNA was stable and successfully bound, and the results of fusion of dsRNA with different chitosans are shown in FIG. 7.

(98) S1-5: keeping the nano-preparations of dsRNA fused with chitosan with different proportions at room temperature for 10 d, taking 5 μl mixed solution to add into 1 μl 6×DNA loading buffer, and the agarose gel electrophoresis observation results are shown in FIG. 8, testing the stability of the preparations. As shown in the figure, the electrophoresis results are similar to those of S1-4, indicating that the nano-preparation is strong in stability and not easy to degrade.

(99) Wherein: the concentration of dsRNA is 1-2 μg/μl; the concentration of dsRNA is preferably: 1, 1.5, 2 μg/μl, etc.

(100) The RNAi nano-preparation is prepared from dsRNA and chitosan nano materials, the dsRNA is prepared from RNA-dependent RNA polymerase, namely RdRP3 gene, and the gene plays a key role in TMV replication in plants. The specific silencing of the functional gene by RNAi technology is significant for the prevention and control of TMV virus.

(101) Example 4: the application of the prepared RNAi nano-preparation, the method of use is to uniformly smear or spray the finished solution on the plant leaves. The specific application method comprises the following steps of:

(102) S1: plantation and transplantation of laboratory tobacco: scattering a tobacum samsan seed in a tray and covering a film, transferring tobacco seedlings to a disposable plastic cup after seeds germinating for about one week and growing to the size suitable for transplanting, culturing for about one month, and growing tobacco plants to the size suitable for processing.

(103) S2: spraying nano medicine and inoculating wild type TMV: in this experiment, the wild type TMV virus was inoculated 12 h after spraying the drug. Selecting uniformly-sized tobacum samsan leaves in advance, and marking. The nano-drugs were uniformly sprayed on the leaves, and only H.sub.2O was sprayed on the leaves of the control group. 12 h later, inoculating virus, weighing a small amount of wild type TMV poison source leaves, grinding into juice in a mortar, adding 100 times of volume of PBS buffer solution (pH 6.8) and uniformly mixing, scattering a layer of 100-mesh quartz sand on uniformly-sized tobacum samsan leaves, dipping the poison source juice with a cotton swab to lightly spread on the leaves to cause micro wounds to infect viruses, and ensuring consistent virus inoculation amount and uniform force as far as possible. After 3 d of virus inoculation, the number of necrotic lesions was observed and photographed. As shown in FIG. 9, only a small number of necrotic lesion appeared on the leaves of the tobacco plants treated with the nano-drug, while a large number of necrotic lesion appeared on the leaves of the tobacco plants treated with the water in the control group and the symptoms of wilting appeared, indicating that the efficacy of the nano-drug is obvious.

SEQUENCE LISTING

(104) <110> Tobacco Research Institute of Chinese Academy of Agricultural Scicnces; Sichuan Brunch of China Tobacco; Liangshan Branch of Sichuan Tobacco <120> RNAi nano-preparation, preparation method thereof and application thereof in TMV prevention and control <130> U.S. Ser. No. 16/998,957 <140> U.S. Ser. No. 16/998,957 <141> 2020-08-20 <160> 22 <170> PatentIn version 3.5 <210> 1 <211> 313 <212> DNA <213> Artificial Sequence <220> <223> Synthesized <400> 1 atttcgctgg cgtttgggaa cgcatttccc tccgtgaaag agaggctctt gaacaggaaa 60 cttatcagag tggcaggcga cgcattagag atcagggtgc ctgatctata tgtgaccttc 120 cacgacagat tagtgactga gtacaaggcc tctgtggaca tgcctgcgct tgacattagg 180 aagaagatgg aagaaacgga agtgatgtac aatgcacttt cagagttatc ggtgttaagg 240 gagtctgaca aatttgatgt tgatgttttt tcccagatgt gccaatatt ggaagttgac 300 ccaatgacgg cag 313 <210>2 <211>50 <212> DNA <213> Artificial Sequence <220> <223> Synthesized <400> 2 attctctaga agcttaatac gactcactat agggatttcg ctggcgtttg 50 <210> 3 <211> 50 <212> DNA <2137> Artificial Sequence <220> <223> Synthesized <400> 3 attctctaga agcttaatac gactcactat agggctgccg tcattgggtc 50 <210> 4 <211> 477 <212> DNA <213> Artificial Sequence <220> <223> Synthesized <400> 4 atgtcttaca gtatcactac tccatctcag ttcgtgttct tgtcatcagc gtgggccgac 60 ccaatagagt taattaattt: atgtactaat gctttaggaa atcagtttca aacacaacaa 120 gctcgaactg tcgttcaaag acaattcagt gaggtgtgga aaccttcacc acaagtaact 180 gttaggttcc ctgacagtga ctttaaggtg tacaggtaca atgcggtatt agacccgcta 240 gtcacagcac tgttaggtgc attcgacact agaaatagaa taatagaagt tgaaaatcag 300 gcgaacccca cgactgccga aacgttagat gctactcgta gagtagacga cgcaacggtg 360 gccataagga gcgcgataaa taatttaata gtagaattga tcagaggaac cggatcttat 420 aatcggagct ctttcgagag ctcttctggt ttggtttgga cctctggtcc tgcaact 477 <210> 5 <211> 333 <212> DNA <213> Artificial Sequence <220> <223> Synthesized <400> 5 ggaaagagcc gacgaggcca cictcggatc ttactacaca gcagctgcaa agaaaagatt: 60 tcagttcaag gtcgttccca attatgctat aaccacccag gacgcgatga aaaacgtctg 120 gcaagtttta gttaatatta gaaatgtgaa gatgtcagcg ggtttctgtc cgctttctct 180 ggagtttgtg tcggtgtgta ttgtttatag aaataatata aaattaggtt tgagagagaa 240 gattacaaac gtgagagacg gagggccc it ggaacttaca gaagaagtcg ttgatgagtt 300 catggaagat gtccctatgt caatcaggct tgc 333 <210> 6 <211> 641 <212> DNA <213> Artificial Sequence <220> <223> Synthesized <400> 6 tcttaccgtc gatgtnacc cctgtaaaga gtgttatgtg ttccaaagtt gataaaataa 60 tggttcatga gaatgagtca ngtcagagg tgaaccttct taaaggagtt aagcttaag 120 atagtggata cgtctgtita gccggtttgg tcgtcacggg cgaatggaac ngcctgaca 180 attgcagagg aggtgtgagc gtgtgtctgg tggacaaaag gatggaaaga gccgacgagg 240 ccactctcgg atcttactac acagcagctg caaagaaaag atttcagttc aaggtcgttc 300 ccaattatgc tataaccacc caggacgcga tgaaaaacgt ctggcaagtt ttagttaata 360 ttagaaatgt gaagatgtca gcgggtttct gtccgctttc tctgg agttt gtgtcggtgt 420 gtattgttta tagaaataat ataaaattag gtttgagaga gaagattaca aacgtgagag 480 acggagggcc catggaactt acagaagaag tcgttgatga gttcatggaa gatgtcccta 540 tgtcaatcag gcttgcaaag tttcgatctc ggaccggaaa aaagagtgat gtccgtaaag 600 ggaaaaatag tagtagtgat cggtcagtgc cgaacaagaa c 641 <210> 7 <211> 388 <212> DNA <213> Artificial Sequence <220> <223> Synthesized <400> 7 cttacttccc ggcctctaat agagaggttt acatgaagga gtttttagtc accagagtta 60 atacctggtt ttgtaagttt tctagaatag atacttttct tttgtacaaa ggtgtggccc 120 ataaaagtgt agatagtgag cagttttata ctgcaatgga agacgcgtgg cattacaaaa 180 agactcttgc aatgtgcaac agcgagagaa tcctccttga ggattcatca tcagtcaatt 240 actggtttcc caaaatgagg gatatggtca tcgtaccatt attcgacatt tctttggaga 300 ctagtaagag gacgcgcaag gaagtcttag tgtccaagga tttcgtgttt acagtgctta 360 accacattcg aacataccag gcgaaagc 388 <210> 8 <211> 757 <212> DNA <213> Artificial Sequence <220> <223> Synthesized <400> 8 tgaccttcca cgacagatta gtgactgagt acaaggcctc tgtggacatg cctgcgcttg 60 acattaggaa gaagatggaa gaaacggaag tgatgtacaa tgcactttca gagttatcgg 120 tgttaaggga gtctgacaaa tttgatgttg atgttttttc ccagatgtgc caatctttgg 180 aagttgaccc aatgacggca gcgaaggtta tagtcgcggn catgagcaat gagagcggtc 240 tgactctcac ttttgaacga cctactgagg cgaatgttgc gctagcttta caggatcaag 300 agaaggcttc agaaggtgct ttggtagtta cctcaagaga agtigaagaa ccgtccatga 360 agggttcgat ggccagagga gagttacaat tagctggtct tgctggagat catccggagt 420 cgtcctattc taagaacgag gagatagagt ctttagagca gtttcatatg gcaacggcag 480 attcgttaat tcgtaagcag atgβgctcga ttgtgtacac gggtccgatt aaagttcagc 540 aaatgaaaaa ctttatcgat agcctggtag catcactatc tgctgcggtg tcgaatctcg 600 tcaagatcct caaagataca gctgctattg accttgaaac ccgtcaaaag tttggagtct 660 tgfatgttgc atctaggaag tggttaatca aaccaacggc caagagtcat gcatggggtg 720 ttgttgaaac ccacgcgagg aagtatcatg tggcgct 757 <210> 9 <211> 57 <212> DNA <213> Artificial Sequence <220> <223> Synthesized <400> 9 attctctaga agcttaatac gactcactat agggatgtct tacagtatca ctactcc 57 <210> 10 <211> 51 <212> DNA <2137> Artificial Sequence <220> <223> Synthesized <400> 10 attctctaga agcttaatac gactcactat agggagttgc aggaccagag g 51 <210> 11 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> Synthesized <400> 11 attctctaga agcttaatac gactcactat agggggaaag agccgacgag 50 <210> 12 <211> 52 <212> DNA <213> Artificial Sequence <220> <223> Synthesized <400> 12 attctctaga agcttaatac gactcactat aggggcaagc ctgattgaca ta 52 <210> 13 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> Synthesized <400> 13 attctctaga agcttaatac gactcactat agggtcttac cgtcgatgtt t 51 <210> 14 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> Synthesized <400> 14 attctctaga agcttaatac gactcactat aggggttctt gttcggcact 50 <210> 15 <211> 52 <212> DNA <213> Artificial Sequence <220> <223> Synthesized <400>15 attctctaga agcttaatac gactcactat agggcttact tcccggcctc to 52 <210> 16 <211> 52 <212> DNA <2137> Artificial Sequence <220> <223> Synthesized <400>16 attctctaga agcttaatac gactcactat aggggctttc gcctggtatg tt 52 <210> 17 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> Synthesized <400> 17 attctctaga agcttaatac gactcactat agggtgacct tccacgacag a 51 <210>18 <211>51 <212> DNA <213> Artificial Sequence <220> <223> Synthesized <400> 18 attctctaga agcttaatac gactcactat agggagcgcc acatgatact t 51 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthesized <400> 19 caaggaaatc accgctttgg 20 <110> 20 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Synthesized <400> 20 aagggatgcg aggatgga 18 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthesized <400> 21 caaggaaatc accgctttgg 20 <210> 22 <211> 113 <212> DNA <213> Artificial Sequence <220> <223> Synthesized <400> 22 aagggatgcg aggatgga 18