USE OF FANA ANTISENSE OLIGONUCLEOTIDES FOR THE PREVENTION AND MANAGEMENT OF HUANGLONGBING AND ZEBRA CHIP DISEASES
20250027079 ยท 2025-01-23
Inventors
- Veenu Aishwarya (Philadelphia, PA, US)
- Brian Wayne HUNTER (Port St. Lucie, FL, US)
- Kirsten Stelinski (Winter Haven, FL, US)
Cpc classification
C12Y599/01003
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
International classification
C12N15/113
CHEMISTRY; METALLURGY
Abstract
The present invention is based on the seminal discovery that FANA antisense oligonucleotides inhibit the growth of bacteria harbored within plant-feeding insects, wherein the insect is chewing or feeding from the xylem, phloem, or mesophyll. Specifically, the use of FANA antisense oligonucleotides decreases the expression of target RNA or DNA and inhibits growth of CLas within the psyllid D. citri, which then prevents the transmission of CLas from D. citri to a citrus tree, or of CLso within the psyllid Bactericera cockerelli which prevents the transmission of CLso from Bactericera cockerelli to a Solanaceous plant. Specifically, the use of FANA antisense oligonucleotides decreases the expression of target RNA or DNA and inhibits growth of CLas within the host plant, citrus or Solanaceous, which then prevents the transmission of CLas from D. citri to a citrus tree, or which prevents the transmission of CLso from Bactericera cockerelli to a Solanaceous plant.
Claims
1. A method of decreasing target RNA or DNA expression in a plant-chewing or piercing-sucking plant-feeding insect, comprising providing an antisense oligonucleotide to the insect, or a member of its microbiome, wherein the oligonucleotide comprises at least one 2-deoxy-2-fluoroarabinonucleotide (2F-ANA)-modified nucleotide and at least one 2-deoxyribonucleotide.
2. The method of claim 1, wherein the target RNA is insect RNA, viral RNA, or bacterial RNA, and wherein the bacterial RNA is DNA Gyrase, subunit-A; NAD-dependent DNA Ligase-A, DnaB-Helicase C terminal domain, D-Ribulose A (riboflavin), Ribulose A, Ribulose B (3,4-dihydroxy-2-butanone-4-phosphate synthase), Acetoacetyl-[acyl-carrier protein], Acetylcholinesterase, Amidophosphoribosyltransferase, Acetyl-CoA carboxylase biotin carboxylase subunit, Biotin Ligase, Biotin-(acetyl-CoA carboxylase)-Ligase, Malonyl Coenzyme A, wsp, or 16SrRNA, thereby decreasing target RNA expression.
3. The method of claim 1, wherein the bacterial RNA is from Candidatus Liberibacter asiaticus (CLas) or from Candidatus Liberibacter solanacearum (CLso).
4. The method of claim 1, wherein the insect is Diaphorina citri (D. citri) or Bactericera cockerelli.
5. The method of claim 1, wherein the oligonucleotide is selected from the group consisting of SEQ ID NOs: 5-77.
6. The method of claim 5, wherein 2F-ANA modified nucleotides are positioned within the oligonucleotide according to any of Formula 1-16.
7. The method of claim 1, wherein the insect feeds from plant vascular (xylem or phloem), mesophyll, root, flower, fruit, seed, or leave.
8. The method of claim 1, wherein the insect ingests the oligonucleotide by consuming plant material containing the oligonucleotide.
9. The method of claim 8, wherein the plant material comprises leaf tissue, root tissue, stem tissue, flower tissue, fruit, sap, xylem, phloem, mesophyll or a combination thereof.
10. The method of claim 8, wherein the plant is a citrus plant or a Solanaceous plant.
11. The method of claim 10, wherein the citrus plant is selected from the group consisting of orange, lemon, clementine, lime, grapefruit, pomelo, citron, mandarin, tangelo, trifoliate, rootstock and ornamental citrus relative.
12. The method of claim 10, wherein the Solanaceous plant is selected from the group consisting of nightshade, potato, tomato, tomatillo, eggplant, bell pepper and capsicum pepper.
13. The method of claim 8, wherein the oligonucleotide is: (i) applied to a plant by topical foliar spray, soil applied solution, or irrigation; and/or (ii) bound to an absorbent, bound to a peptide, or bound to a synthetic or natural gel, agar, clay, cellulose, or other material, for application, spreading, mixing with soil, and/or for being applied to soil in solution or in water for root uptake or root soaking.
14. The method of claim 1, wherein the oligonucleotide sequence is a complement to the sequence of the target insect or bacterial RNA, and wherein the oligonucleotide sequence has at least 80%, 85%, 90%, 95%, 98%, 99%, or more sequence identity to the complementary sequence of the target RNA.
15. The method of claim 1, wherein the target RNA or DNA is prokaryotic or eukaryotic.
16. The method of claim 1, wherein the target RNA or DNA is selected from the group consisting of messenger RNA (mRNA), microRNA (miRNA), small interfering RNA (siRNA), antisense RNA (aRNA), short hairpin RNA (shRNA), transfer RNA (tRNA), ribosomal RNA (rRNA),small nuclear RNA (snRNA), double-stranded RNA (dsRNA), locked nucleic acid (LNA), transfer-messenger RNA (tmRNA), viral RNA, viral DNA, Polynucleic acids circular ssDNA, and circular DNA.
17. The method of claim 1, wherein the oligonucleotide sequence has at least 80%, 85%, 90%, 95%, 98%, 99%, or more sequence identity to the complementary RNA or DNA sequence.
18. A method of inhibiting bacterial growth in a plant-chewing or piercing-sucking plant-feeding insect comprising providing an antisense oligonucleotide to the insect or to its microbiome, wherein the oligonucleotide comprises at least one 2-deoxy-2-fluoroarabinonucleotide (2F-ANA)-modified nucleotide and at least one 2-deoxyribonucleotide, wherein the oligonucleotide binds to a target RNA or DNA, wherein the target RNA is important for bacterial replication or survival, and wherein the target is DNA Gyrase subunit-A, NAD-dependent DNA Ligase-A, DnaB Helicase C terminal domain, D-Ribulose A (riboflavin), Ribulose A, Ribulose B (3,4-dihydroxy-2-butanone-4-phosphate synthase), Acetoacetyl-[acyl-carrier protein], Acetylcholinesterase, Amidophosphoribosyltransferase, Acetyl-CoA carboxylase biotin carboxylase subunit, Biotin Ligase, Biotin-(acetyl-CoA carboxylase)-Ligase, Malonyl Coenzyme A, wsp, or 16SrRNA, thereby inhibiting bacterial growth.
19. The method of claim 18, wherein the RNA is from gram negative or gram positive bacteria, wherein the RNA is from E. coli or from Serratia marcescens, or insect endosymbionts, wherein the RNA is from Carsonella rudii, or Profftella armigera, or Wolbachia-Diaphorina, or Wolbachia-Drosophila, or Candidatus Liberibacter asiaticus (CLas) or from Candidatus Liberibacter solanacearum (CLso).
20. The method of claim 18, wherein the insect is Diaphorina citri (D. citri) or Bactericera cockerelli, and wherein the oligonucleotide is selected from the group consisting of SEQ ID NOs: 5-77.
21. (canceled)
22. (canceled)
23. (canceled)
24. (canceled)
25. (canceled)
26. (canceled)
27. (canceled)
28. A method of preventing and/or managing of huanglongbing disease in a citrus tree or plant or preventing and/or managing a Liberibacter zebra chip disease in Solanaceous plant comprising providing an antisense oligonucleotide to a plant chewing or piercing-sucking plant-feeding insect or to its microbiome, wherein the oligonucleotide binds to a target RNA or DNA, wherein the oligonucleotide comprises at least one 2-deoxy-2-fluoroarabinonucleotide (2F-ANA)-modified nucleotide and at least one 2-deoxyribonucleotide, and wherein the target RNA is DNA Gyrase subunit-A, NAD-dependent DNA Ligase-A, DnaB-Helicase C terminal domain, D-Ribulose A (riboflavin), Ribulose A, Ribulose B (3,4-dihydroxy-2-butanone-4-phosphate synthase), Acetoacetyl-[acyl-carrier protein], Acetylcholinesterase, Amidophosphoribosyltransferase, Acetyl-CoA carboxylase biotin carboxylase subunit, Biotin Ligase, Biotin-(acetyl-CoA carboxylase)-Ligase, Malonyl Coenzyme A, wsp, or 16SrRNA, thereby improving plant survival, or yield, or preventing and/or managing huanglongbing disease.
29. (canceled)
30. (canceled)
31. (canceled)
32. (canceled)
33. (canceled)
34. (canceled)
35. (canceled)
36. (canceled)
37. (canceled)
38. (canceled)
39. (canceled)
40. (canceled)
41. (canceled)
42. (canceled)
43. (canceled)
44. (canceled)
48. (canceled)
46. (canceled)
47. (canceled)
48. (canceled)
49. (canceled)
50. (canceled)
51. (canceled)
52. (canceled)
53. (canceled)
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
DETAILED DESCRIPTION
[0029] The present invention is based on the seminal discovery that FANA antisense oligonucleotides inhibit the growth of bacteria harbored within plant-chewing or piercing-sucking plant-feeding insects. Specifically, the use of FANA antisense oligonucleotides decreases the expression of target RNA and inhibits growth of CLas within D. citri, which then prevents the transmission of CLas from D. citri to a citrus tree.
[0030] Before the present compositions and methods are described, it is to be understood that this invention is not limited to particular compositions, methods, and experimental conditions described, as such compositions, methods, and conditions may vary. It is also to be understood that the terminology used herein is for purposes of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention will be limited only in the appended claims.
[0031] As used in this specification and the appended claims, the singular forms a, an, and the include plural references unless the context clearly dictates otherwise. Thus, for example, references to the method includes one or more methods, and/or steps of the type described herein which will become apparent to those persons skilled in the art upon reading this disclosure and so forth.
[0032] Citrus as used herein refers to any species of tree producing any variety of citrus fruit, such as oranges, tangerines, clementines, lemons, limes, and the like, or wildtype citrus relatives which may also be used as ornamental plants.
[0033] Solanaceae or Solanaceous plant refers to the family of flowering plants (Order: Solanales), which include 102 genera and nearly 2,500 species. Examples of Solanaceous plant include, but are not limited to, potato, tomato, eggplant, pepper and nightshade.
[0034] For the purpose of the invention, the complement of a nucleotide sequence X is the nucleotide sequence which would be capable of forming a double-stranded DNA or RNA molecule with the represented nucleotide sequence, and which can be derived from the represented nucleotide sequence by replacing the nucleotides by their complementary nucleotide according to Chargaff's rules (A< >T; G< >C; A< >U) and reading in the 5 to 3 direction, i.e., in opposite direction of the represented nucleotide sequence. In the context of the present disclosure, this term also includes synthetic analogs of DNA/RNA (e.g., 2F-ANA oligos).
[0035] The term effective amount of a composition provided herein refers to the amount of the composition capable of performing the specified function for which an effective amount is expressed. The exact amount required can vary from composition to composition and from function to function, depending on recognized variables such as the compositions and processes involved. An effective amount can be delivered in one or more applications. Thus, it is not possible to specify an exact amount, however, an appropriate effective amount can be determined by the skilled artisan via routine experimentation.
[0036] Insect or insect pest as used herein means any variety of insects that may cause harm to plants, trees, fruits, or nuts or products produced thereby or therefrom. In exemplary embodiments, such pests include leaf-eating and sap-feeding arthropods, such as the Asian citrus psyllid.
[0037] Microbiome or insect microbiome as used herein refers to the community of microorganismssuch as bacteria, archaea, fungi, as well as virusesthat inhabit the insect ecosystem. In the soil for example, microbes are essential for supporting plant life by mediating uptake and entry of nutrients into the food chain, cycling carbon and nitrogen, breaking down pollutants and much more. By affecting an insect microbiome, one can also affect said insect; as such the oligonucleotides of the present invention may be provided to the insect directly, or indirectly through delivery of the oligonucleotide to its microbiome.
[0038] The term plant includes whole plants, plant organs, progeny of whole plants or plant organs, embryos, somatic embryos, embryo-like structures, protocorms, protocorm-like bodies (PLBs), and suspensions of plant cells. Plant organs include, e.g., shoot vegetative organs/structures (e.g., leaves, stems and tubers), roots, flowers and floral organs/structures (e.g., bracts, sepals, petals, stamens, carpels, anthers and ovules), seeds (including embryo, endosperm, and seed coat) and fruit (the mature ovary), plant tissue (e.g., vascular tissue, ground tissue, and the like) and cells (e.g., guard cells, egg cells, trichomes and the like).
[0039] As used herein, preventing a disease refers to inhibiting the full development of a disease.
[0040] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.
[0041] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the invention, it will be understood that modifications and variations are encompassed within the spirit and scope of the instant disclosure. The preferred methods and materials are now described.
[0042] In one embodiment the present invention provides a method of decreasing target RNA or DNA expression in a plant-chewing or piercing-sucking plant-feeding insect including providing an antisense oligonucleotide to the insect or to its microbiome, wherein the oligonucleotide includes at least one 2-deoxy-2-fluoroarabinonucleotide (2F-ANA)-modified nucleotide and at least one 2-deoxyribonucleotide, thereby decreasing target RNA or DNA expression. In one aspect the target RNA is insect RNA, viral RNA, or bacterial RNA. In some aspects, the target RNA is bacterial RNA from Candidatus Liberibacter asiaticus (CLas). In certain aspects the target RNA is Gyrase subunit-A, NAD-dependent DNA Ligase-A (Ligase A); DnaB-like helicase C terminal domain (DnaB), D-Ribulose A (riboflavin), Ribulose A, B, Acetoacetyl-[acyl-carrier protein], Acetylcholinesterase, Amidophosphoribosyltransferase, Acetyl-CoA carboxylase biotin carboxylase subunit, Biotin Ligase, Biotin-(acetyl-CoA carboxylase)-Ligase, Malonyl Coenzyme A, wsp or 16S rRNA. In an additional aspect, the insect is Diaphorina citri (D. citri) or Bactericera cockerelli. In certain aspects, the oligonucleotide has the sequence of SEQ ID NOs: 5-77. In a further aspect, the 2F-ANA modified nucleotides are positioned within the oligonucleotide according to any of Formula 1-16. In some aspects, the insect feeds from plant vascular (xylem or phloem), mesophyll, root, flower, fruit or leave. In certain aspects, the insect ingests the oligonucleotide by consuming plant material containing the oligonucleotide. In an additional aspect, the plant material includes leaf tissue, root tissue, stem tissue, flower tissue, phloem, or a combination thereof. In specific aspects, the plant is a citrus plant or a Solanaceae plant. In a further aspect, the may be any citrus plant or relative such as orange, lemon, clementine, lime, grapefruit, pomelo, citron, mandarin, tangelo, or any trifoliate, or rootstock, or ornamental citrus relative. In an additional aspect, the Solanaceae plant is nightshade, potato, tomato, tomatillo, eggplant, bell pepper or capsicum pepper, family of flowering plants (Order: Solanales). In one aspect, the oligonucleotide is: applied to a plant by topical foliar spray, soil applied solution, or irrigation; and/or bound to an absorbent, bound to a peptide, or bound to a synthetic or natural gel, agar, clay, cellulose or other material, for application, spreading, soil amendment and/or for being applied in solution or in water for root uptake or root soaking.
[0043] Antisense oligonucleotides of the present invention are single-stranded deoxyribonucleotides complementary to a targeted mRNA or DNA. Hybridization of an ASO to its target mRNA via Watson-Crick base pairing can result in specific inhibition of gene expression by various mechanisms, depending on the chemical make-up of the ASO and location of hybridization, resulting in reduced levels of translation of the target transcript (Crooke 2004). ASOs of the present invention typically encompass oligonucleotides having at least one sugar-modified nucleoside (e.g., 2F-ANA) as well as naturally-occurring 2-deoxy-nucleosides (see, e.g., U.S. Pat. No. 8,278,103 which is specifically incorporated by reference). ASO-induced protein knockdown is usually achieved by induction of RNase H endonuclease activity. When activated, the RNAse H cleaves the RNA-DNA heteroduplex leading to the degradation of the target mRNA. This leaves the ASO intact so that it can function again (Wu et al, J. Biol. Chem. (2004) 279:181-9).
[0044] As provided herein, ASOs can be utilized by environmental application (e.g., root soak, foliar spray) to plants in horticultural and agricultural settings. ASOs solve the problems encountered with topically applied nucleotide-based strategies (e.g., dsRNA) which are subject to environmental degradation. The ASO technology provides greater stability due to modifications of the backbone of the single-stranded RNA/DNA hybrid molecule, and increases resistance to degradation by using synthetic nucleotides in the structure.
[0045] While there are many types of ASO's, the main discoveries in ASO development included two main chemical modifications. These modifications include the 2-fluoro (2-F) substitutions and the phosphorothioate chemistry. These two modifications constitute synthetic analogs of naturally occurring nucleic acids, but which have greater stability and activity. Thus, some embodiments of the present invention use 2-F substitutions, and modification of the sugar backbone with phosphorothioate chemistry to produce ASOs containing 2-deoxy-2-fluoro--D-arabinonucleic acid (2F-ANA), termed FANA antisense oligonucleotides (FANA-ASO). The stability, specificity and non-toxicity of FANA-ASO oligonucleotides make them good candidates for difficult to control pathogens involving microbes and insects.
[0046] As detailed further herein, FANA-ASO can be applied to plants as topical spray applications to foliage, soils, or in baits or inert carriers, and results in suppression of RNA targets in bacterial pathogens of plants, and insects, and the endosymbionts in arthropods that feed on treated plants or baits. These results demonstrate that for chewing insect pests, topical applications of ASO are effective in targeting Lepidoptera and Coleoptera pests. As for plant-feeding hemipterans, like sap-sucking insectspsyllids, aphids, leafhoppers, whitefly, planthoppers and other Hemipterathe FANA-ASOs are delivered into, and move systemically through the vascular tissues of plants allowing for these insects to ingest the FANA-ASO when they feed. Our results demonstrate that, similarly to other small nucleic acids that are topically applied to foliage as a spray, or the soil root zone of plants, the FANA-ASOs of the present invention are absorbed through leaves and roots and then move systemically throughout the plant within hours.
[0047] As described herein, plant delivery strategies, using exogenously-applied FANA-ASO, is applicable for diverse plant species (citrus, grapevines, woody ornamentals, sunflowers, basil, okra) and insects from several arthropod Orders: Hemiptera, Coleoptera, Lepidoptera, Diptera. Together, this data indicates that the novel approaches described herein can be utilized to target many Arthropods and that a wide variety of plants are broadly amenable to the novel treatment methodologies with ASO products described herein. As used herein modified antisense oligonucleotide refers to synthetic antisense oligonucleotides (AONs) containing modified sugar. AONs are single stranded oligonucleotides that recognize nucleic acid sequences via Watson-Crick base pairing and cause pre- or post-transcriptional gene silencing. The AON binds to its target mRNA, and forms a duplex that is recognized by RNase H, which in turn induces the cleavage of the mRNA, the steric blocking of translation machinery, or the prevention of necessary RNA interactions, or modification of natural interactions.
FANA Antisense Oligonucleotides
[0048] The chemistry and construction of 2F-ANA oligonucleotides (also termed FANA or FANA-ASO) has been described elsewhere in detail (See, e.g., U.S. Pat. Nos. 8,278,103 and 9,902,953). The FANA-ASOs and methods of using them disclosed herein contemplate any FANA chemistries known in the art. In some embodiments, a FANA-ASO includes an internucleoside linkage including a phosphate, thereby being an oligonucleotide. In some embodiments, the sugar-modified nucleosides and/or 2-deoxynucleosides include a phosphate, thereby being sugar-modified nucleotides and/or 2-deoxynucleotides. In some embodiments, a FANA-ASO includes an internucleoside linkage including a phosphorothioate. In some embodiments, the internucleoside linkage is selected from phosphorothioate, phosphorodithioate, methylphosphorothioate, Rp-phosphorothioate, Sp-phosphorothioate. In some embodiments, the a FANA-ASO includes one or more internucleotide linkages selected from: (a) phosphodiester; (b) phosphotriester; (c) phosphorothioate; (d) phosphorodithioate; (e) Rp-phosphorothioate; (f) Sp-phosphorothioate; (g) boranophosphate; (h) methylene (methylimino) (3CH.sub.2N(CH.sub.3)O5); (i) 3-thioformacetal (3'S CH.sub.2O5); (j) amide (3CH.sub.2 C(O)NH-5); (k) methylphosphonate; (1) phosphoramidate (3-OP(O.sub.2)N5); and (m) any combination of (a) to (1).
[0049] In some embodiments, FANA-ASOs including alternating segments or units of sugar-modified nucleotides (e.g., arabinonucleotide analogues [e.g., 2F-ANA]) and 2-deoxyribonucleotides (DNA) are utilized. In some embodiments, a FANA-ASO disclosed herein includes at least 2 of each of sugar-modified nucleotide and 2-deoxynucleotide segments, thereby having at least 4 alternating segments overall. Each alternating segment or unit may independently contain 1 or a plurality of nucleotides. In some embodiments, each alternating segment or unit may independently contain 1 or 2 nucleotides. In some embodiments, the segments each include 1 nucleotide. In some embodiments, the segments each include 2 nucleotides. In some embodiments, the plurality of nucleotides may consist of 2, 3, 4, 5 or 6 nucleotides. A FANA-ASO may contain an odd or even number of alternating segments or units and may commence and/or terminate with a segment containing sugar-modified nucleotide residues or DNA residues. Thus, a FANA-ASO may be represented as follows:
A.sub.1-D.sub.1-A.sub.2-D.sub.2-A.sub.3-D.sub.3 . . . A.sub.z-D.sub.z
[0050] Where each of A.sub.1, A.sub.2, etc. represents a unit of one or more (e.g., 1 or 2) sugar-modified nucleotide residues (e.g., 2F-ANA) and each of D.sub.1, D.sub.2, etc. represents a unit of one or more (e.g., 1 or 2) DNA residues. The number of residues within each unit may be the same or variable from one unit to another. The oligonucleotide may have an odd or an even number of units. The oligonucleotide may start (i.e. at its 5 end) with either a sugar-modified nucleotide-containing unit (e.g., a 2F-ANA-containing unit) or a DNA-containing unit. The oligonucleotide may terminate (i.e. at its 3 end) with either a sugar-modified nucleotide-containing unit or a DNA-containing unit. The total number of units may be as few as 4 (i.e. at least 2 of each type).
[0051] In some embodiments, a FANA-ASO disclosed herein includes alternating segments or units of arabinonucleotides and 2-deoxynucleotides, wherein the segments or units each independently include at least one arabinonucleotide or 2-deoxynucleotide, respectively. In some embodiments, the segments each independently include 1 to 2 arabinonucleotides or 2-deoxynucleotides. In some embodiments, the segments each independently include 2 to 5 or 3 to 4 arabinonucleotides or 2-deoxynucleotides. In some embodiments, a FANA-ASO disclosed herein includes alternating segments or units of arabinonucleotides and 2-deoxynucleotides, wherein the segments or units each include one arabinonucleotide or 2-deoxynucleotide, respectively. In some embodiments, the segments each independently include about 3 arabinonucleotides or 2-deoxynucleotides. In some embodiments, a FANA-ASO disclosed herein includes alternating segments or units of arabinonucleotides and 2-deoxynucleotides, wherein the segments or units each include one arabinonucleotide or 2-deoxynucleotide, respectively. In some embodiments, a FANA-ASO disclosed herein includes alternating segments or units of arabinonucleotides and 2-deoxynucleotides, wherein said segments or units each include two arabinonucleotides or 2-deoxynucleotides, respectively.
[0052] In some embodiments, a FANA-ASO disclosed herein has a structure selected from:
a)(A.sub.x-D.sub.y).sub.nI
b)(D.sub.y-A.sub.x).sub.nII
c)(A.sub.x-D.sub.y).sub.m-A.sub.x-D.sub.y-A.sub.xIII
d) (D.sub.y-A.sub.x).sub.m-D.sub.y-A.sub.x-D.sub.yIV
wherein each of m, x and y are each independently an integer greater than or equal to 1, n is an integer greater than or equal to 2, A is a sugar-modified nucleotide and D is a 2-deoxyribonucleotide. For example, a FANA-ASO disclosed herein has structure I wherein x=1, y=1 and n=10, thereby having a structure:
A-D-A-D-A-D-A-D-A-D-A-D-A-D-A-D-A-D-A-D.
[0053] In another example, a FANA-ASO disclosed herein has structure II wherein x=1, y=1 and n=10, thereby having a structure:
D-A-D-A-D-A-D-A-D-A-D-A-D-A-D-A-D-A-D-A.
[0054] In another example, a FANA-ASO disclosed herein has structure III wherein x=1, y=1 and n=9, thereby having a structure:
A-D-A-D-A-D-A-D-A-D-A-D-A-D-A-D-A-D-A-D-A.
[0055] In another example, a FANA-ASO disclosed herein has structure IV wherein x=1, y=1 and n=9, thereby having a structure:
D-A-D-A-D-A-D-A-D-A-D-A-D-A-D-A-D-A-D-A-D.
[0056] In another example, a FANA-ASO disclosed herein has structure I wherein x=2, y=2 and n=5, thereby having a structure:
A-A-D-D-A-A-D-D-A-A-D-D-A-A-D-D-A-A-D-D.
[0057] In another example, a FANA-ASO disclosed herein has structure II wherein x=2, y=2 and n=5, thereby having a structure:
D-D-A-A-D-D-A-A-D-D-A-A-D-D-A-A-D-D-A-A.
[0058] In another example, a FANA-ASO disclosed herein has structure III wherein x=2, y=2 and m=4, thereby having a structure:
A-A-D-D-A-A-D-D-A-A-D-D-A-A-D-D-A-A-D-D-A-A.
[0059] In another example, a FANA-ASO disclosed herein has structure IV wherein x=2, y=2 and m=4, thereby having a structure:
D-D-A-A-D-D-A-A-D-D-A-A-D-D-A-A-D-D-A-A-D-D.
[0060] Specific examples of modified synthetic FANA-ASOs described herein include the FANA-ASOs shown in Tables 1 and 5 below:
TABLE-US-00001 TABLE1 FANAssequences FANA Descriptor Sequence SEQIDNO: SC-ASO-1 ACTGGGATACGACAAGGATAT SEQIDNO:1 SC-ASO-2 TCTTGGAACAGCATAGGGACA SEQIDNO:2 SC-ASO-3 ATATCCTTGTCGTATCCCAGT SEQIDNO:3 SC-ASO-4 AUAUCCTTGTCGTATCCCAGU SEQIDNO:4 >X57174.1E.coli E.colibacteria gyrAgeneforDNA DNAgyrasesubunitA gyrasesubunitA ECol_GyrA_1 ATGAGCGACCTTGCGAGAGAA SEQIDNO:5 ECol_GyrA_2 ATTCTCGCTGCGTTATATGCT SEQIDNO:6 ECol_GyrA_3 GCGGCAATGCGTTATACGGAA SEQIDNO:7 Ecol_GyrA_4 CGACTGCTGGTGGCGAACACT SEQIDNO:8 >NZ_HG326223.1: c2820748-2818106 Serratiamarcescens Serratiamarcescens subsp.marcescens DNAgyrasesubunitA Db11 Smarc_GyrA_1 ATGAGCGACCTTGCCAGAGAA SEQIDNO:9 Smarc_GyrA_2 GTTTTCACTGCGCTACATGCT SEQIDNO:10 Smarc_GyrA_3 GCGGCGATGCGTTATACCGAA SEQIDNO:11 Smarc_GyrA_4 CGCCTGCTGGTGGCCAACACC SEQIDNO:12 Liberibacterasiaticus DNAgyrasesubunitA bacteria GyraseA. CLas-GYRA-1 TGAAGGACAAGGAAATTTTGG SEQIDNO:13 CLas,GyrA-2 GAAGGACAGGGAAAATTTTTG SEQIDNO:14 CLso-1Gyrase-A L.solanacearum infectedPotato L.solanacearum GATTGAAGGGCAGGGGAATTC SEQIDNO:15 CLso-1Gyrase-A hostPotato L.solanacearumCLso2 GAAGAACGGGCGAACTTTTTG SEQIDNO:16 -GyrAhostPotato CLso-1GyrA-Ext-1 AATAAACGCAATGACCAATCC SEQIDNO:17 hostPotato CLso-2Gyr-Ext-2 ATAACCTTGACGATCTGATTC SEQIDNO:18 CLso-2Gyr-Ext-4 TTCTATCAGGGTAAATCGCTC SEQIDNO:19 L.asiaticus, D-ribulose inCitrusRibulose CLasRibuloseBgene Liberibacterasiaticus- GTCGTTAGATGAACGATATAT SEQIDNO:20 CLIBRIB-1 Liberibacterasiaticus- CCAAGATCTAATTGCTTGGCG SEQIDNO:21 CLIBRIB-2 Liberibacterasiaticus- GCTGACTTAGTACTTGCCGCC SEQIDNO:22 CLIBRIB-3 Liberibacterasiaticus- CTCCGATAGCGGTTATTTGCG SEQIDNO:23 CLIBRIB-4 Wolbachia-Diaphorina PsyllidEndosymbiont endosymbiont AUM-C1-Wdi-aCoA-2 ACUUUCCTAAAACAAGAGGCC SEQIDNO:24 AUM-C1-Wdi-aCoA-3 GUUCCAUAGGTAATCCUGAAU SEQIDNO:25 AUM-C1-Wdi-aCoA-4 AAGAGUGCAGCTTAUCGUUGU SEQIDNO:26 -Wolbachia-Diaphorina- PsyllidEndosymbiont Amidophosphoribosyl- Amidophosphoribosyl- transferase transferase AUM-C1-WDil GCGTAGTAACCAGTAACAACG SEQIDNO:27 AUM-C1-WDi2 GGCCTCTTGTTTTAGGAAAGT SEQIDNO:28 AUM-C1-WDi3 ATTCAGGATTACCTATGGAAC SEQIDNO:29 AUM-C1-WDi4 ACAACGATAAGCTGCACTCTT SEQIDNO:30 AUM-C1-WDi5 GTTCTTACGTTCTTGCATCTGA SEQIDNO:31 Acteylcholinesterase Wolbachia-Diaphorina below AUM-C1-WDi-aCoA-1 CGUUGUUACTGGTTACUACGC SEQIDNO:32 AUM-C1-WDi-aCoA-2 ACUUUCCTAAAACAAGAGGCC SEQIDNO:33 AUM-C1-WDi-aCoA-3 GUUCCAUAGGTAATCCUGAAU SEQIDNO:34 AUM-C1-WDi-aCoA-4 AAGAGUGCAGCTTAUCGUUGU SEQIDNO:35 AUM-C1-WDi-aCoA-5 UCAGAUGCAAGAACGUAAGAAC SEQIDNO:36 TARGETSEQUENCE(TS)5-3 Wolb-Dcendosymbiont Wolbachia-Diaphorina DNAgyrasesubunitA AUM_WLBDC-GyrA1 TGATGGGCAAGGTAACTTTGG SEQIDNO:37 AUM_WLBDC-GyrA2 TGGTATGGCAACCAATATTCC SEQIDNO:38 AUM_WLBDC-GyrA3 GGTGTTGCAGTTGGTATGGCA SEQIDNO:39 AUM_WLBDC-GyrA4 CCAGGGCCGGATTTTCCAACG SEQIDNO:40 Wolb-Dc-GyraseA-1. CATTCAAGAAGGACAAGGAAA SEQIDNO:41 Wolbachiaendosymbiont FLY Wolbachia-Drosophila ofDrosophila simulans(FruitFly) simulansWLB-Ds>WP_015589386.1 Amido- amidophosphoribosyl-transferase Phosphoribosyltransferase [Wolbachiaendosymbiont Wolb-Ds+WLBDS ofDrosophilasimulans] AUM-WLBDS-1 CGATAAGCTGCACTCTTATCA SEQIDNO:42 AUM-WLBDS-2 GGTGCTTATTCTTTTGTTGCA SEQIDNO:43 AUM-WLBDS-3 TAGCCTCAATGTTTCCTTTCC SEQIDNO:44 AUM-WLBDS-4 GGATATGCAAAGCATTCAGGA SEQIDNO:45 Carsonellaruddii D.citri,PsyllidEndosymbiont Psyllidendosymbiont Gyrase-A AUM-DCRUDD1 CAATTAATGGGAAAATTTCCC SEQIDNO:46 AUM-DCRUDD2 GTTTGTAGGAACATAAATTTCC SEQIDNO:47 AUM-DCRUDD3 CAACAATTGTATCATATAAAGG SEQIDNO:48 AUM-DCRUDD4 CTTTAATAAAATAATATTCGA SEQIDNO:49 Profftellaarmatura Psyllidendosymbiont- DiaphorinacitriPsyllid Gyrase-A EndosymbiontGyrase-A Profftellaarmatura-CPFF1 GCTGCGGCAATGCGTTATACT SEQIDNO:50 Profftellaarmatura- CCAACAGCAGGTATTATTTATG SEQIDNO:51 CPFF2 Profftellaarmatura- CCTTTTGTAAAATGTGCACGA SEQIDNO:52 CPFF3 Profftellaarmatura- CATGAAATGAATAATTTATGG SEQIDNO:53 CPFF4 Profftellaarmatura, ATTAGTAGATGGACAAGGTAA SEQIDNO:54 GyrA-5 Profftellaarmatura D.citri,PsyllidEndosymbiont Psyllidendosymbiont D-ribulose(riboflavinsynthesis) Profftellaarmatura- CCAACCTGGACACATTTTTCC SEQIDNO:55 CPFFRIB-1 Profftellaarmatura- GAGGAGTATTAATACGAGGAG SEQIDNO:56 CPFFRIB-2 Profftellaarmatura- GAGGAGGTCATACTGAAGCTG SEQIDNO:57 CPFFRIB-3 Profftellaarmatura- GAAGGAGATATTATATTATCT SEQIDNO:58 CPFFRIB-4 Profftellaarmatura- GAAGGAGATATTATATTATCT SEQIDNO:59 CPFFRIB-5 Liberibacterasiaticus CLas,DnaB-HelicaseC DnaB-HelicaseC inCitrus CLASDNAB_1 CTATCCTTGTGAATAATGAGGC SEQIDNO:60 CLASDNAB_2 GCTTCCGAAGCAGTTTCAATAA SEQIDNO:61 CLASDNAB_3 GGCTGGACAAGCGTTTAATCG SEQIDNO:62 CLASDNAB_4 TATTCTTGCTTATACAAAGTG SEQIDNO:63 Liberibacter solanacearum CLso- CLsoDnaB-HelicaseC DnaB-HelicaseC inPotato CLsoDNAB-1 GCATCATTATTCACTAGGATAG SEQIDNO:64 CLsoDNAB-2 TATGGAAACAGCCTCAGATGC SEQIDNO:65 CLsoDNAB-3 CGATTAAAAGCTTGTCCAGCC SEQIDNO:66 CLsoDNAB-4 CATTTTGTATATGCGAGGACA SEQIDNO:67 CLsoDnaB-5 TTGTCCAGCCATATCAATAGC SEQIDNO:68 CLsoDnaB-6 TAGTTCCGATTTGTATGCATC SEQIDNO:69 CLso-DnaB-7 TGTATATGCGAGGACATCGTC SEQIDNO:70 Liberibacterasiaticus, CLas NAD-dependentDNA Ligase-A NAD-dependentDNALigase-A CLas-LigA-1 CGGCACAGCAATTAGAACGTC SEQIDNO:71 CLas-LigA-2 GGAAGGGATATTCGTGTAGG SEQIDNO:72 CLas-LigA-3 CGGAGAGGATGTTAGTGCTTGT SEQIDNO:73 CLas-Liga-4 CCTGATTTAGCACGCTCTGAG SEQIDNO:74 Liberibacter solanacearum CLSO, CLso,GyraseA CLso-2Gyr-Ext-3 TATTACGATAGATCCTCGACC SEQIDNO:75 CLso-2Gyr CAAATCAGGTATAGCACGGCC SEQIDNO:76 CLso-4Gyr GGGAATATTCGTCGCCATACC SEQIDNO:77
[0061] The formulas shown in Table 2 may be applied to any of SEQ ID NOs: 1-77, or a portion thereof, wherein X represents a nucleotide (A, C, G, T, or U), and wherein bold and underlined nucleotides represent sugar-modified or 2F-ANA-modified nucleotide with backbone phosphorothioate linkages.
TABLE-US-00002 TABLE 2 Exemplary 2F-ANA nucleoside placement within 21-mer FANA-ASOs 21 nucleotides Formula Formula 1 XXXXXXXXXXXXXXXXXXXXX Formula 2 XXXXXXXXXXXXXXXXXXXXX Formula 3 XXXXXXXXXXXXXXXXXXXXX Formula 4 XXXXXXXXXXXXXXXXXXXXX Formula 5 XXXXXXXXXXXXXXXXXXXXX Formula 6 XXXXXXXXXXXXXXXXXXXXX Formula 7 XXXXXXXXXXXXXXXXXXXXX Formula 8 XXXXXXXXXXXXXXXXXXXXX Formula 9 XXXXXXXXXXXXXXXXXXXXX Formula 10 XXXXXXXXXXXXXXXXXXXXX Formula 11 XXXXXXXXXXXXXXXXXXXXX Formula 12 XXXXXXXXXXXXXXXXXXXXX Formula 13 XXXXXXXXXXXXXXXXXXXXX Formula 14 XXXXXXXXXXXXXXXXXXXXX Formula 15 XXXXXXXXXXXXXXXXXXXXX Formula 16 XXXXXXXXXXXXXXXXXXXXX
FANA-ASO Compositions
[0062] In particular embodiments, the present invention provides a composition having an inhibitory FANA-ASO represented by one or more of SEQ ID NOs. 1-77, and having 2F-ANA placement within the FANA-AS O as shown in any of Formulas 1-16 (Table 3) and specific for a target mRNA or fragment thereof. Other placements of 2F-ANA oligonucleo sides within a FANA-ASO are also contemplated, as are FANA-ASOs of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more bases in length. Typically, FANA-ASOs of the present invention are provided to a target recipient (e.g., plant, insect or bacteria) in an amount sufficient to induce RNA silencing, thereby inhibiting production of the polypeptide encoded by one or more of the full-length genes targeted by SEQ ID NOs: 5-77. For example, a FANA-ASO of the present invention is applied to a plant topically, allowing for uptake of the FANA-ASO by the plant. The FANA-ASO can control a bacterial pathogen currently infecting the plant. Additionally, when a plant pest (e.g., D. citri) is feeding on a treated plant, the insect can ingest a sufficient level of the FANA-ASO to control or kill bacteria harbored by the insect pest and/or control or kill the insect pest itself.
[0063] In addition to a FANA-ASO of the present invention, compositions of the present invention intended to be applied to a plant can be formulated so as to contain one or more phagostimulants, pesticides, fungicides, or combinations thereof. The composition can be formulated to be coated on a plant, plant part, plant tissue (e.g., root or leaf), or seed. In certain aspects the FANA-ASO is combined with one or more excipients, buffering agents, carriers, etc. Such components are well known in the art and readily chosen for various applications by one skilled in the art.
[0064] Typically, a FANA-ASO of the present invention is provided to a target insect pest, target plant in need of treatment, or target microbe in an amount sufficient to inhibit production of the polypeptide encoded by one or more of the full-length genes targeted by FANA-ASOs. For example, when an insect pest is feeding on FANA-ASO-laden plant material (e.g., leaf), the insect ingests a sufficient level of FANA-ASO to result in a phenotypic effect on a bacterium harbored in its gut. In some embodiments, a combination of two or more FANA-ASOs can be combined in a single plant. In embodiments where two or more FANA-ASOs are combined in a single plant, the FANA-ASOs can target different genes or different portions of the same gene from the same or different targets. Thus, in one embodiment, a single plant material can be used to deliver multiple, different FANA-ASOs targeting the production of one or more proteins made by the treated plant, the insect pest, and/or a microbe present in the plant or in the insect. Where two or more FANA-ASOs are taken up and distributed throughout the plant material, the FANA-ASOs can be provided to the plant in a single solution, or in multiple, sequentially-applied solutions.
[0065] In addition to FANA-ASOs, compositions of the present invention that are intended to be applied to a plant can also include one or more chemoattractants, phagostimulants, visual attractants, insecticides, pheromones, fungicides, or combinations thereof. Such additional components are well known in the art and are readily chosen to complement compositions of the present invention, but are not specifically integral to the present invention. These additional components can be formulated to be coated on a plant, plant part, leaf, fruit, vegetable, stem or other plant structure. In certain aspects the additional component(s) are combined with one or more excipients, buffering agents, carriers, etc. that are also well known in the art.
[0066] Where additional components are applied in a coating, the coating can be formulated as a spray or dip so that the additional non-FANA-ASO components remain on the exterior of the plant material. For example, a leaf having a FANA-ASO distributed through at least part of its vascular system can be coated with a composition including one or more chemoattractants, phagostimulants, visual attractants, insecticides, pheromones, fungicides, or combinations thereof. Alternately, the additional component can be mixed with an aqueous solution containing the FANA-ASO(s) to be taken up and distributed via vascular action of the plant material, or osmosis through the plant material, thus distributing the FANA-ASO(s) and the additional component(s) throughout at least part of the plant material.
Application to Target Plants
[0067] Compositions of the invention disclosed herein can be applied to soil, fruits, vegetables, crops, and any other desired target using any delivery methodology known to those of skill in the art. For example, FANA-ASO-containing compositions can be applied to the desired locale via methods and forms including, but not limited to, shank injection, sprays, granules, flood/furrow methods, sprinklers, fumigation, root soaking and drip irrigation. In embodiments of the invention where the compositions are sprayed onto a desired locale, the compositions can be delivered as a liquid suspension, emulsion, microemulsion or powder. In other embodiments, granules or microcapsules can be used to deliver the compositions of the invention. The compositions of the invention might be applied with traditional agricultural methods, as topical foliar sprays, soil applied solutions, irrigation, or as bound to absorbent, or clay for spreading applications, and root soaking as in hydroponic systems.
[0068] The compositions of the present invention can be applied to plants and/or crops by any convenient method, for example, by using a fixed application system such as a center pivot irrigation system. Preferably, application to fields of plants and/or crops is made by air spraying, i.e., from an airplane or helicopter, or by land spraying. For example, land spraying may be carried out by using a high flotation applicator equipped with a boom, by a back-pack sprayer or by nurse trucks or tanks. One of skill in the art will recognize that these application methodologies are provided by way of example and that any applicable methods known in the art or developed in the future can be utilized.
[0069] This study demonstrated the efficacy of FANA ASOs in reducing the amount of bacterial mRNA, in both in vitro and in vivo experiments, causing a deleterious effect in bacterial density. Specifically, it was shown that the titer of Candidatus Liberibacter asiaticus was decreased, inside D. citri adults, after an orally ingested FANA ASO silenced the expression of CLas LigA gene. This result evidenced the potential of FANA oligos as an environment-friendly alternative for the management of HLB, different than RNAi. Both FANA ASOs and RNAi are post-transcriptional gene silencing technologies that involve the binding of complementary oligonucleotides to target RNA through base paring. However, there are intrinsic characteristics of FANA ASOs that may position them as a better choice than RNAi for controlling HLB. Double stranded RNA (dsRNA) persistency has been a major challenge in RNAi-based pest control. For example, degradation of dsRNA has been reported in hemipteran species such as Lygus lineolaris (Palisot de Beauvois) (Hemiptera: Miridae) and Acyrthosiphon pisum (Harris) (Hemiptera: Aphididae), where the gut pH conditions or possible nuclease enzymes in the saliva and hemolymph digested the exogenous ribonucleic acid. On the other hand, the stability of FANA ASOs to hydrolysis, under acidic and basic conditions, has been shown to be higher than that of DNA or RNA. In addition, previous studies have observed an improved resistance of FANA oligonucleotides to the action of both endo and exonucleases, which was attributed to the chemical modifications in the phosphate backbone and ribose sugar of the oligos. The resistance to degradation of FANA ASOs may lead to a more effective silencing.
[0070] In this study, it was demonstrated that a fluorescently labeled FANA oligonucleotide is able to penetrate Drosophila S2 cells, infected with wDi. No transfection agent or molecular conjugation was required for the oligo to enter the insect cells. In a subsequent in vitro experiment, the downregulation of the wDi gyrA gene, by a complementary FANA ASO, indicated that the oligonucleotide penetrated the bacterial cells as well. Self-delivery of FANA ASOs has been previously reported. Souleimanian and colleagues (2012), using a human prostate cancer cell line, observed that FANA ASOs effectively silenced the expression of the Bcl-2 protein, in the absence of any carriers or conjugation. The self-delivery property of FANA oligos may be explained by the phosphorothioate modification in their backbone, which can have a very high affinity for proteins commonly occurring on the cell surface membrane, therefore promoting adsorptive endocytosis.
[0071] Oral delivery of LigA-FANA into adult ACPs, caused the degradation of CLas LigA mRNA and reduced the density of the bacterium in the psyllids. The effectiveness of the treatment may be associated with CLas localization inside D. citri. By using qPCR and fluorescence in situ hybridization, Ammar and colleagues (2011) detected the presence of CLas in the alimentary canal (filter chamber and midgut), Malpighian tubules, haemolymph, ovaries, salivary glands, muscle, and fat tissues. Nevertheless, the relative copy number of CLas genomes was significantly higher in the alimentary canal compared with that in the rest of the insect body, suggesting that CLas may replicate or accumulate in the digestive tract of D. citri; Ghanim and colleagues (2017) further demonstrated the bacterium accumulation in the psyllid gut, inside endoplasmic reticulum associated vacuoles. Having CLas concentrated in D. citri digestive tract, could facilitates bacterial penetration and binding to a homologous mRNA by an ingested FANA ASO.
[0072] The recommended control strategy for HLB involves the use of insecticides to reduce D. citri populations, supplemented with removal of infected trees to impede bacterial acquisition by uninfected psyllids and the creation of pathogen-free nurseries. Nevertheless, insecticide resistance is a major problem for this approach. Although novel tactics have been successful under greenhouse and field settings, such as thermotherapy, graft-based antibiotics applications or trunk injections of plant activators, there is a pressing need to find better alternatives to boost the in planta HLB control arsenal. Delivery of LigA FANA into infected Citrus trees, through root infusions, caused a significant reduction of CLas titer that persisted for 30 days. Being able to decrease the bacterial pathogen quantity in both its host and vector, demonstrates the potential of FANA ASOs as an alternative method for the management of HLB.
[0073] In some aspects, the oligonucleotide sequence is a complement to the sequence of the target insect or bacterial RNA, and the oligonucleotide sequence has at least 80%, 85%, 90%, 95%, 98%, 99%, or more sequence identity to the complementary sequence of the target RNA.
[0074] As used herein, the terms complementary or complementarity are used in reference to polynucleotides (i.e., a sequence of nucleotides) related by the base-pairing rules. For example, the sequence 5-A-G-T-3, is complementary to the sequence -T-C-A-5. Complementarity may be partial, in which only some of the nucleic acids' bases are matched according to the base pairing rules. Or, there may be complete or total complementarity between the nucleic acids. The degree of complementarity between nucleic acid strands has significant effects on the efficiency and strength of hybridization between nucleic acid strands. As such, a complement sequence, as used herein refers to an oligonucleotide sequence have some complementarity to a target RNA or DNA sequence. The complementarity between the target RNA or DNA and the oligonucleotide can be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%.
[0075] The term homology or identity refers to a degree of complementarity. There may be partial homology or complete sequence identity between the oligonucleotide sequence and the complement sequence of the target RNA or DNA. A partially identical sequence is an oligonucleotide that at least partially hybrids to the target RNA or DNA, leading to the formation of partial heteroduplex, and to partial or total degradation of the target RNA or DNA. A completely identical sequence is an oligonucleotide that completely hybrids to the target RNA or DNA, leading to the formation of complete heteroduplex, and to partial or total degradation of the target RNA or DNA.
[0076] In many aspects, the target RNA or DNA is prokaryotic or eukaryotic.
[0077] In various aspects, the target RNA or DNA is selected from the group consisting of messenger RNA (mRNA), microRNA (miRNA), small interfering (siRNA), antisense RNA (aRNA), short hairpin RNA (shRNA), transfer RNA (tRNA), ribosomal RNA (rRNA), small nuclear RNA (snRNA), double-stranded RNA (dsRNA), locked nucleic acid (LNA), Transfer-messenger RNA (tmRNA), viral RNA, viral DNA, polynucleic acids circular ssDNA, and circular DNA.
[0078] As used herein, the term nucleic acid refers to polynucleotides such as deoxyribonucleic acid (DNA) or ribonucleic acid (RNA), with RNA being prepared or obtained by the transcription a DNA template. According to the invention, a nucleic acid may be present as a single-stranded or double-stranded and linear or covalently circularly closed molecule.
[0079] As used herein, messenger RNA (mRNA) refers to RNA molecules that convey genetic information from DNA to the ribosome, where they specify the amino acid sequence of the protein products of gene expression. In mRNA genetic information is arranged into codons consisting of three base pairs each. Each codon encodes for a specific amino acid, except the stop codons, which terminate protein synthesis. This process of translation of codons into amino acids requires two other types of RNA: Transfer RNA (tRNA) that mediates recognition of the codon and provides the corresponding amino acid, and ribosomal RNA (rRNA), that is the central component of the ribosome's protein-manufacturing machinery.
[0080] RNA interference (RNAi) is the phenomenon of gene-specific post-transcriptional silencing by double-stranded RNA oligomers (Elbashir et al., Nature 411: 494-498 (2001); and Caplen et al., Proc. Natl. Acad. Sci. U.S.A. 98: 9742-9747 (2001)). Small inhibitory RNAs (siRNAs), like antisense oligonucleic acids and ribozymes, have the potential to serve as therapeutic agents by reducing the expression of harmful proteins. The double-stranded siRNA is recognized by a protein complex (the RNA induced silencing complex), which strips away one of the strands, facilitates hybridization of the remaining strand to the target mRNA, and then cleaves the target strand. DNA-based vectors capable of generating siRNA within cells are also of interest for the same reason, as are short hairpin RNAs (shRNA) that are efficiently processed to form siRNAs within cells. siRNAs capable of specifically targeting endogenously and exogenously expressed genes have been described (see for example Paddison et al., Proc. Natl. Acad. Sci. U.S.A. 99:1443-1448 (2002); Paddison et al., Genes & Dev. 16: 948-958 (2002); Sui et al., Proc. Natl. Acad. Sci. U.S.A. 8:5515-5520 (2002); and Brummelkamp et al., Science 296: 550-553 (2002)). As used herein, the term RNAi construct is a generic term including siRNA, hairpin RNA, and other RNA species which can be cleaved in vivo to form siRNAs. RNAi constructs herein also include expression vectors (also referred to as RNAi expression vectors) capable of giving rise to transcripts which form dsRNAs or hairpin RNAs in cells, and/or transcripts which can be converted into siRNAs in vivo.
[0081] microRNA or miRNA refers a small non-coding RNA molecule (containing about 22 nucleotides) found in plants, animals and some viruses, that functions in RNA silencing and post-transcriptional regulation of gene expression. miRNAs function via base-pairing with complementary sequences within mRNA molecules, resulting in the silencing of the target mRNA molecules by cleavage of the mRNA strand into two pieces, by destabilization of the mRNA through shortening of its poly(A) tail, or by rendering less efficient the translation of the mRNA into proteins by ribosomes. miRNAs resemble the small interfering RNAs (siRNAs) of the RNA interference (RNAi) pathway, except miRNAs derive from regions of RNA transcripts that fold back on themselves to form short hairpins, whereas siRNAs derive from longer regions of double-stranded RNA.
[0082] As used herein, aRNA, antisense RNA, asRNA and the like refer to single stranded RNA that is complementary to a protein coding mRNA with which it hybridizes, and thereby blocks its translation into protein. asRNAs (which occur naturally) are found in both prokaryotes and eukaryotes and can be classified into short (<200 nucleotides) and long (>200 nucleotides) non-coding RNAs (ncRNAs). The primary function of asRNA is regulating gene expression. asRNAs may also be produced synthetically and have found wide spread use as research tools for gene knockdown. They may also have therapeutic applications.
[0083] snRNA (small nuclear RNA), is a class of small RNA molecules that are found within the splicing speckles and Cajal bodies of the cell nucleus in eukaryotic cells. The length of an average snRNA is approximately 150 nucleotides. They are transcribed by either RNA polymerase II or RNA polymerase III. Their primary function is in the processing of pre-messenger RNA (hnRNA) in the nucleus, and they also aid in the regulation of transcription factors (7SK RNA) or RNA polymerase II (B2 RNA), and maintaining the telomeres.
[0084] Double-stranded RNA or dsRNA refers to RNA with two complementary strands, similar to the DNA found in all cells, but with the replacement of thymine by uracil. dsRNA forms the genetic material of some viruses (double-stranded RNA viruses). Double-stranded RNA, such as viral RNA or siRNA, can trigger RNA interference in eukaryotes, as well as interferon response in vertebrates.
[0085] The term LNA or locked nucleic acid also referred to as inaccessible RNA, is a modified RNA nucleotide in which the ribose moiety is modified with an extra bridge connecting the 2 oxygen and 4 carbon. The bridge locks the ribose in the 3-endo (North) conformation, which is often found in the A-form duplexes. LNA nucleotides can be mixed with DNA or RNA residues in the oligonucleotide whenever desired and hybridize with DNA or RNA according to Watson-Crick base-pairing rules. The locked ribose conformation enhances base stacking and backbone pre-organization. This significantly increases the hybridization properties (melting temperature) of oligonucleotides.
[0086] As used herein, tmRNA or transfer-messenger RNA refers to a bacterial RNA molecule with dual tRNA-like and messenger RNA-like properties. The tmRNA forms a ribonucleoprotein complex (tmRNP) together with Small Protein B (SmpB), Elongation Factor Tu (EF-Tu), and ribosomal protein S1. In trans-translation, tmRNA and its associated proteins bind to bacterial ribosomes which have stalled in the middle of protein biosynthesis, for example when reaching the end of a messenger RNA which has lost its stop codon. The tmRNA is remarkably versatile: it recycles the stalled ribosome, adds a proteolysis-inducing tag to the unfinished polypeptide, and facilitates the degradation of the aberrant messenger RNA. In the majority of bacteria these functions are carried out by standard one-piece tmRNAs. In other bacterial species, a permuted ssrA gene produces a two-piece tmRNA in which two separate RNA chains are joined by base-pairing.
[0087] Viruses are small infectious agents that replicates only inside the living cells of an organism. Viruses have either a DNA or an RNA genome and are called DNA virus or RNA virus, respectively. The genome can also either be single-stranded or double-stranded, leading to single-stranded RNA (ssRNA), single-stranded DNA (ssDNA), double-stranded DNA (dsDNA), or double-stranded RNA (dsRNA); with each individually being able to be either linear or circular. Single-stranded DNA (ssDNA) is usually expanded to double-stranded in infected cells.
[0088] In other aspects, the oligonucleotide sequence has at least 80%, 85%, 90%, 95%, 98%, 99%, or more sequence identity to the complementary RNA or DNA sequence.
[0089] In an additional embodiment, the present invention provides a method of inhibiting bacterial growth in a plant-chewing or piercing-sucking plant-feeding insect including providing an antisense oligonucleotide to the insect or to its microbiome, wherein the oligonucleotide includes at least one 2-deoxy-2-fluoroarabinonucleotide (2F-ANA)-modified nucleotide and at least one 2-deoxyribonucleotide, thereby inhibiting bacterial growth.
[0090] In a further embodiment, the present invention provides a method of preventing and/or managing of huanglongbing disease in a citrus tree or plant including providing an antisense oligonucleotide to a plant-chewing or piercing-sucking plant-feeding insect or to its microbiome, wherein the oligonucleotide binds to a target RNA or DNA, wherein the oligonucleotide includes at least one 2-deoxy-2-fluoroarabinonucleotide (2F-ANA)-modified nucleotide and at least one 2-deoxyribonucleotide, and wherein, the target RNA is DNA Gyrase subunit-A, NAD-dependent DNA Ligase-A, DNA-B Helicase C terminal domain, D-Ribulose A (riboflavin), Ribulose A, B, Acetoacetyl-[acyl-carrier protein], Acetylcholinesterase, Amidophosphoribosyltransferase, Acetyl-CoA carboxylase biotin carboxylase subunit, Biotin Ligase, Biotin-(acetyl-CoA carboxylase)-Ligase, Malonyl Coenzyme A, wsp or 16SrRNA, thereby preventing and/or managing huanglongbing disease. In one aspect, the insect harbors of Candidatus Liberibacter asiaticus (CLas). In another aspect, the oligonucleotide inhibits the growth of CLas. In an additional aspect, inhibiting the growth of CLas prevents the transmission of CLas from the insect to the citrus tree or plant.
[0091] In a further embodiment, the present invention provides a method of preventing and/or managing of a Liberibacter zebra chip disease in a Solanaceous plant including providing an antisense oligonucleotide to a plant-chewing or piercing-sucking plant-feeding insect or to its microbiome, wherein the oligonucleotide binds to a target RNA or DNA, wherein the oligonucleotide includes at least one 2-deoxy-2-fluoroarabinonucleotide (2F-ANA)-modified nucleotide and at least one 2-deoxyribonucleotide, and wherein the target RNA is DNA Gyrase subunit-A, NAD-dependent DNA Ligase-A, DNA-B, D-Ribulose A (riboflavin), Ribulose A, B, Acetoacetyl-[acyl-carrier protein], Acetylcholinesterase, Amidophosphoribosyltransferase, Acetyl-CoA carboxylase biotin carboxylase subunit, Biotin Ligase, Biotin-(acetyl-CoA carboxylase)-Ligase, Malonyl Coenzyme A, wsp or 16SrRNA, thereby preventing and/or managing Liberibacter zebra chip disease. In one aspect, the insect harbors of Candidatus Liberibacter solanacearum (CLso). In another aspect, the oligonucleotide inhibits the growth of CLso. In an additional aspect, inhibiting the growth of CLso prevents the transmission of CLso from the insect to the Solanaceous plant.
[0092] In one embodiment, the present invention provides an oligonucleotide including at least one 2-deoxy-2-fluoroarabinonucleotide (2F-ANA)-modified nucleotide and at least one 2-deoxyribonucleotide and having a sequence of SEQ ID NOs: 5-77. In one aspect, the 2F-ANA-modified nucleotides are positioned according to any of Formulas 1-16. In an additional aspect, the 2F-ANA-modified nucleotides include internucleotide linkages between nucleotides are phosphodiester bonds, phosphotriester bonds, phosphorothioate bonds (5OP(S)O-3O, 5'SP(O)O-3-O, and 5OP(O)O-3'S), phosphorodithioate bonds, Rp-phosphorothioate bonds, Sp-phosphorothioate bonds, boranophosphate bonds, methylene bonds(methylimino), amide bonds(3-CH.sub.2CONH-5 and 3-CH.sub.2NHCO-5), methylphosphonate bonds, 3-thioformacetal bonds, (3'SCH.sub.2O5), amide bonds (3CH.sub.2C(O)NH-5), phosphoramidate groups, or a combination thereof. In various aspects, the oligonucleotide is for use in baits, diets, liquids, to target insects, by attraction, or feeding, leading to reduced fitness, fecundity or health of pests, or for the reduction of pathogens, to suppress transmission, or to improve survival of insects considered beneficial to plant health.
[0093] The following examples are provided to further illustrate the embodiments of the present invention, but are not intended to limit the scope of the invention. While they are typical of those that might be used, other procedures, methodologies, or techniques known to those skilled in the art may alternatively be used.
EXAMPLES
Example 1
Materials and Methods
[0094] FANA ASOs. FANA antisense oligonucleotides were synthesized by AUM Biotech (Philadelphia, PA). For in vitro experiments, a FANA ASO was designed to be complementary to the Wolbachia-Diaphorina, wDi DNA gyrase subunit A gene (gyrA). The CLas NAD-dependent DNA Ligase gene (LigA), was selected as the target gene in the in vivo experiments. wDi was targeted in the in vitro experiments, due to CLas being a fastidious bacterium that cannot be cultured. The sequences of FANA ASOs used in this study are described in Table 1.
[0095] Cell culture. Drosophila Schneider 2 (S2) cells were cultured in Schneider's Drosophila medium (Thermo Fisher Scientific, Waltham, MA) supplemented with 10% heat-inactivated fetal bovine serum (FBS; Thermo Fisher Scientific) and 1% penicillin (50U/mL)/streptomycin (50 g/mL) at 28 C. in a non-humidified incubator. The cells were subcultured to a final density of approximately 110.sup.6 cell/mL every three days. Infection of S2 cells with wDi (S2-wDi cells) was accomplished as described in Bonilla et al., 2018.
[0096] Psyllid cultures. Diaphorina citri used in this study were obtained from a culture reared at the University of Florida Citrus Research and Education Center (CREC) (Lake Alfred, FL). The culture was established in 2005 from a field population collected in Polk Co., FL (28.0 N, 81.9 W), before the detection of HLB in the state. Psyllids not harboring CLas were maintained on uninfected Pineapple sweet orange [Citrus sinensis (L.) Osb. (Rutaceae)] plants in a greenhouse not exposed to insecticides. Insects infected with CLas were collected from a subset of the uninfected D. citri culture but reared instead in CLas-positive Pineapple sweet orange plants at a secure quarantine facility. Both psyllid colonies were maintained at 261 C., 60-80% relative humidity and a photoperiod of 16:8 (L:D) h. To confirm the absence/presence of the bacterium in the colonies, random subsamples of both plants and insects were tested monthly using a quantitative real-time polymerase chain reaction procedure, previously described (Pelz-Stelinski et al., 2010).
[0097] Localization of fluorescently labeled FANA ASOs in S2-wDi cells and D. citri adults. S2-wDi cells were diluted from a density of 8-1010.sup.6 cells/mL and 90% viability to a density of 2.7510.sup.5 cells/mL. The cells were incubated with 10 M of a FANA ASO, designed with a scramble sequence and conjugated to Alexa Fluor 647 at its 5 end, at 28 C. After 24 h, 15 L of S2-wDi cell suspension was applied into a coverslip previously covered with concanavalin A (Vector Labs, Burlingame, CA) and allowed to attach for one hour. The cells were fixed with 4% paraformaldehyde (Electron Microscopy Sciences, Hatfield, PA) during 45 min, followed by three washes with PBS (Fisher Scientific, Fair Lawn, NJ) of five min each at room temperature. The cells were mounted in microscope slides with VECTASHIELD with DAPI (Vector Labs, Burlingame, CA) and viewed under a confocal microscope (Leica SP8 laser-scanning Confocal).
[0098] Leaves of Pineapple sweet orange trees grafted on Swingle citrumelo rootstocks [Citrus paradisi MacFadenPoncirus trifoliate (L.) Raf.] were excised and placed in lidless PCR tubes with 200 L of a FANA ASO solution in water, at a 5 M concentration, designed with a scramble sequence and tagged with Alexa Fluor 594 at its 5 end. The leaves were left in the solution for 24 h before placing them inside a 50 mL Falcon tube (Fisher Scientific, Fair Lawn, NJ) with five D. citri adults. After 48 h, the digestive tracts of the psyllids were dissected in PBS, placed on a microscope slide and viewed under a fluorescent microscope (Olympus BX61 Epifluorescence microscope).
Silencing of Bacterial Genes
[0099] Cell culture assays. S2 cells infected with Wolbachia-Diaphorina, wDi, were seeded at a density of 2.7510.sup.5 cells/mL, in 24-well culture dishes (Thermo Fisher Scientific), 24 h prior to the treatment with the FANA ASOs. The cells were incubated with 5 M of either the oligo designed to target the wDi gyrA gene or a scramble sequence oligo, which was used as a negative control. The insect cells were incubated with the FANA ASOs for 7 days at 28 C. Each treatment (wDi gyrA-FANA, [SEQ ID NO: 38], scramble control-FANA [SEQ ID NO: 4], and untreated control) was replicated three times.
[0100] Psyllid assays. Leaves (leaf blade and petiole) were collected from uninfected C. paradisiP. trifoliate trees, washed in 1% bleach for 10 min and rinsed for 5 min by submersion in autoclaved water. The leaves were placed in lidless PCR tubes with 200 L of either the FANA oligo targeting the [SEQ ID NO: 71], CLas DNA Ligase gen (LigA) or a scramble sequence oligo (negative control). The working concentration of the FANA ASOs solution was 5 PM. After wrapping the tubes tops with Parafilm (American National Can, Neenah, WI), the leaves were placed under artificial light at 28 C., a light dark cycle of 16:8 h and 75% relative humidity, in order to stimulate the absorption of the FANA ASOs solutions. The tubes were filled with nuclease-free water (Thermo Fisher Scientific), after the entire FANA ASO solution was absorbed by the leaves. Treated and untreated leaves were placed inside 50 mL Falcon tubes (Fisher Scientific, Fair Lawn, NJ) and exposed to CLas-infected, three days old, D. citri adults (eight males, eight females) for seven days. Each treatment (LigA-FANA [SEQ ID NO: 71], scramble control-FANA [SEQ ID NO: 4] and untreated control) was replicated three times
[0101] Analysis of gene expression. Total RNA extraction from untreated and treated samples (S2-wDi cells or D. citri adults) was performed using Direct-Zol RNA MiniPrep (Zymo Research, Irvine, CA), following the manufacturer's instructions. The concentration and quality of RNA were measured by spectrophotometry (Nanodrop 2000; Thermo Scientific). cDNA was synthesized from total RNA (1 g) using the High Capacity cDNA Reverse Transcription kit (Thermo Fisher Scientific). Quantitative PCR assays were conducted using a QuantStudio 6 Flex Real-Time PCR Instrument (Thermo Fisher Scientific) and the Syber Green PCR Master Mix (Thermos Fisher Scientific). The data was analyzed using the comparative critical threshold (AACt) method (Livak & Schmittgen, 2001), in which the expression level of the target mRNA in FANA-treated samples was compared to its expression in untreated samples. The wDi gene wsp, which codes for a surface protein, and the CLas 16S ribosomal RNA gene were used as an internal control for cell culture and insect bioassays, respectively. Pairs of primers were designed for the target and the reference genes using Primer3 v. 0.4.0 software (Untergrasser et al., 2012). PCR efficiencies of target and reference genes were confirmed to be within the range of 90-110% for all qPCR assays.
[0102] The Shapiro-Wilk normality test and the Levene test of homogeneity of variances were employed to determine the type of distribution for the data obtained in each treatment. T-tests for independent samples or Mann-Whitney U-tests, depending on data distribution, were used to test for significant differences in expression levels (Ct values) of the target genes between the experimental and control conditions. P-values less than 0.05 were considered to be statistically significant. The software STATISTICA 13.3 (TIBCO Software Inc, Palo Alto, CA) was used for the data analysis.
[0103] Wolbachia-Diaphorina, wDi, viability assay. wDi cells were isolated from S2 cells following the protocol described in Gamston and Rasgon (2007). In brief, the S2 cells were lysed by vortexing the samples with sterile 3 mm borosilicate glass beads at room temperature. The supernatant was centrifuged at 2,500g (10 min at 4 C.), passed through a filter of 5 m and centrifuged again at 18,000g (10 min at 4 C.). The wDi pellet was resuspended in S2 complete media and finally purified using a 2.7 m filter. Extracted wDi cells were seeded in 96-well culture dishes (Corning Incorporated, Corning, NY), at a density of 300,000 cells/mL, and incubated with 5 M of either the FANA oligo complementary to the wDi gryA gene [SEQ ID NO: 38] or the scramble control [SEQ ID NO: 4]. Four days after treatment, 800 L of cell suspension was split into two equivalent samples. One of them was kept untreated and the other one was added with 100 L of PMA Enhancer for Gram Negative Bacteria (Biotium, Hayward, CA), followed by 5 L of 2.5 mM propidium monoazide (PMAxx; Biotium). The samples were covered in aluminum foil and incubated for 10 min on a rocker at room temperature. Subsequently, the samples were exposed to intense visible light for 15 min in order to crosslink the propidium monoazide with the bacterial dsDNA (PMA-Lite; Biotium). The bacterial cells were pelleted by centrifugation at 5,000g for 10 min and used for DNA isolation (DNeasy Blood & Tissue Kit; QUIAGEN, Valencia, CA). For dead cell control samples, 800 L of untreated wDi suspension was heat inactivated at 95 C. for 5 min and processed as previously described.
[0104] For absolute quantification of the wDi copy number, a 250 bp DNA fragment from the wDi gyrA gene was amplified and purified. Ten-fold serial dilution of this fragment were used in qPCR reactions to generate standard curves that allowed conversion of delta threshold cycle values (Ct with PMACt without PMA) into an estimate of alive wDi genome copy number. Quantitative PCR assays were conducted using a QuantStudio 6 Flex Real-Time PCR Instrument (Thermo Fisher Scientific) and the Syber Green PCR Master Mix (Thermo Fisher Scientific). The standard curve obtained for wDi was (y=3.594x+3.796; R.sup.2=0.99). One-way analysis of variance (ANOVA) was used to evaluate the dissimilarities in wDi copy number between the treatments. Means were separated by Tukey's honest significant difference test. P-values less than 0.05 were considered statistically significant.
[0105] CLas quantification in psyllids. A group of infected D. citri teneral adults (eight males, eight females) were fed an artificial diet solution, consisting of 17% (w:v) sucrose in autoclaved distilled water and 0.5% green food dye (McCormick & Company, Baltimore, MD). The FANA oligo [SEQ ID NO: 71] targeting the CLas LigA gene was diluted into the artificial diet to a final concentration of 5 M. The artificial feeding system consisted in a bottomless petri dish (35 mm10 mm), two pieces of thinly stretched Parafilm (American National Can) and a filter paper disc (Russell and Pelz-Stelinski, 2015); the artificial diet (300 L) was dispensed on the filter paper located between the Parafilm layers. Feeding assays were held for seven days, in an environmental incubator at 16:8 h light:dark cycle, 272 C., and 60-65% relative humidity. The FANA scramble control, at the same final concentration in feeding solution, was used as a negative control. Untreated psyllids were exposed to only sucrose solution. Three replicates were conducted for each treatment.
[0106] DNA was extracted from each sample using the DNeasy Blood and Tissue Kit (QIAGEN) and its concentration quantified by spectrophotometry (Nanodrop 2000; Thermo Fisher Scientific). DNA samples were diluted to 50 ng L.sup.1 for subsequent qPCR analysis. A multiplex TaqMan qPCR assay was performed using probe and primers targeting CLas 16S rRNA gene and D. citri wingless (Wg) gene (Table S1). All qPCR reactions were performed on a QuantStudio 6 Flex Real-Time PCR Instrument (Thermo Fisher Scientific) using the PerfeCta qPCR ToughMix, Low ROX (Quanta BioSciences, Gaithersburg, MD). Absolute quantification of CLas copy number was calculated using dilution series of a plasmid containing the target region of the CLas 16S rRNA gene, as described in Chu et al. (2016). The standard curve obtained for CLas was (y=3.286x+10.338; R.sup.2=0.99). CLas copy number was divided by the Wg gene copy number in the same sample. One-way analysis of variance (ANOVA) was used to evaluate the differences in CLas copy number between the treatments. Means were separated by Tukey's honest significant difference test. P-values less than 0.05 were considered statistically significant.
[0107] FANA ASO root infusions and CLas quantification in planta. Two to three years-old Citrus paradisiPoncirus trifoliate, not treated with systemic insecticides, were used for plant assays. The trees were inoculated with CLas by exposing them to infected ACPs for a month. After the inoculation access period, all developmental stages of ACP were eliminated from the trees by an insecticide treatment. The plants were maintained in a greenhouse for four months to allow for systemic infection.
[0108] The initial CLas titer (TO) of each tree was calculated by collecting three leaves per plant and extracting their genomic DNA, followed by quantitative real-time PCR. The Citrus trees were then treated with the [SEQ ID NO: 1] LigA FANA ASO by root infusion. For root infusions, the main root system of the trees was gently scraped under water with a razor blade and fitted into a PVC tube (1 m long, 6 mm diameter). The tubes were filled with 5 mL of either a 5 M FANA ASO solution, a 5 mg/mL streptomycin sulfate solution (Thermo Fisher Scientific) or water (untreated control). Tubes were filled with water 24 hrs post treatment. From each tree, three leaves were removed from similar locations as the T0 samples at two, seven, 14 and 30 days post treatment, to monitor the effect of the FANA ASO on the plants CLas titer. Five trees were used per treatment.
[0109] Leaf DNA was extracted as described in Pelz-Stelinski et al. (2010) and diluted to 15 ng L.sup.1. A multiplex TaqMan qPCR assay was performed as stated before, using probe and primers targeting CLas 16S rRNA gene and the citrus mitochondrial cytochrome oxidase gene (Cox) as internal control for DNA extractions. CLas copy number was quantified as previously reported (Chu et al., 2016). The standard curve obtained for CLas in the plant experiments was (y=3.312x+11.763; R.sup.2=0.99). The treatments effect was expressed as percent change in CLas titer [(mean titer after treatmentmean titer prior to treatment)/mean titer prior to treatment]100 (Hu et al., 2018). One-way analysis of variance (ANOVA) was used to compare the plants initial and final CLas copy number within the treatments. Means were separated by Fisher's least significant difference (LSD) test, considering P-values equal or less than 0.05 as statistically significant.
TABLE-US-00003 TABLE3 qPCRprimers TARGET TARGET PRIMER/PROBE SPECIES GENE SEQUENCE(5-3) Wolbachia gyrA ACTAACATCATGCCGCTTCC (SEQIDNO:78) ATTGACGCACATCGCTTACA (SEQIDNO:79) Wolbachia wsp AGGGCTTTACTCAAAATTGG (SEQIDNO:80) CACCAACGTATGGAGTGATAGG (SEQIDNO:81) Candidatus LigA ATTCCAATCGAGGCATTGAG Liberibacter (SEQIDNO:82) asiaticus TCAGAGCGTGCTAAATCAGG (SEQIDNO:83) Candidatus 16SrRNA TCGAGCGCGTATGCAATACG Liberibacter (SEQIDNO:84) asiaticus GCGTTATCCCGTAGAAAAAGGTAG (SEQIDNO:85) AGACGGGTGAGTAACGCG (SEQIDNO:86) Diaphorina Wingless GCTCTCAAAGATCGGTTTGACGG citri (Wg) (SEQIDNO:87) GCTGCCACGAACGTTACCTTC (SEQIDNO:88) TTACTGACCATCACTCTGGACGC (SEQIDNO:89) Citrusspp Cox GTATGCCACGTCGCATTCCAGA (SEQIDNO:90) GCCAAAACTGCTAAGGGCATTC (SEQIDNO:91) ATCCAGATGCTTACGCTGG (SEQIDNO:92)
TABLE-US-00004 TABLE4 Gene Sequences (SEQIDNO:93) QXDO01000001.1: ATGAAAAAACGTCAATTGATTCCAATCGAGGCATTGAGTATCGAACAAGCTAGAAAAG c1165055-1162860 AATTATCGTCTCTTGAACAAGAGATATCATATCATGATGATTGTTATTATCAGTATTC Candidatus AAAACCTATAATCTTAGATTCTGAATATGACGCATTAAAAAGACGTTGTGATGCTATT Liberibacter GCACATGCTTTTCCTGATTTAGCACGCTCTGAGGATCCTAATGGGCCTCTGAATAAAA asiaticusstrain TAGGGGGAGAAATGAACCTCTCCTTATTTAAAGTGACTCATTCTATCCCAACATTATC YNJS7Ccontig1, ATTAGAAAAGATTTGGAATATCGAAGATCTTCGTAAGTTCATCACTAGAATTTATCGT wholegenome TTTTGGCAAAAAAAAGATGATAACAGCATTTTTTTTACTCTGGAGCCTAAAATTGATG shotgunsequence GGACAATGATTACTATACGATATGAAAAAGGAAAGTTTGTTTATGCTGCTTTGCGTGG NAD-dependent TGACGGTCATAGCGGAGAGGATGTTAGTGCTTGTATTCGTGCTATTCCGACAATTCCT DNAligaseA CGTGTTTTATCATTGAATATTCCAGAAATTATAGAAGTGCGTGGTGAAGTTTACATCT CAAAAAATGATTTTCTTGCGCTTAATGATGAAATGATTGCAGTCGGCCGAAAACCCTA TGCTAATCCTAGAAACGCTGCTTCTGGCATATTACGTCGTTTAAATCCTACGGATATT ACTCGGTATTTGAATTTTTTTGTGCATGGATTAGGAAAAACATCTGAGATATTCGCAA AAGGTCAGTATGAAATGCTACAAAAAATGCGTTGTCTAGGCTTTCCTGTTAATAACGG AGTTCGACAAGCGAATACTTTTCACGGTATCGTATCCTATTATAATGAAATGAAATCA ATACGTTCTACTCTTCCATATGATATAGATGGATTGGTATATAAGGTCGATGAATTTT CITTACAAAAACAATTAGGAGAACGAGCTCGAAGCCCACGTTGGATGATATCGCATAA ATTTGCAGAGAAACAAGCATCTACGCGTCTTTTAGATATTGATATTCAAATTGGTCGT ACTGGTATTCTCACGCCGGTAGCTCGTCTTGAACCTGTTAACATAGGAGGTGCTTTAA TCACTAATGCAACATTGCATAATGAAGATTACATCAAAGGATTGGATGCATCTGGTAA AGTAATGCGTGGAGGAAGGGATATTCGTGTAGGGGATAGGGTCTTGGTCAAAAGAGCC GGAGAGGTGATTCCTAAAGTIGTGGATATTATTGTCAATGAAAGACATCCTGATGCTC AACCGTTTTCTTTTCCTTCTTTTTGTCCTATCTGTCAGAGTCGAGTAGTGCGTGATTT AAATCCGAAAACAGGAAAACTTGTTGCTGCCCATCGTTGTACGGGAGGACTTGCGTGC
Example 2
Transfection of FANA ASOs into Cultured Insect Cells
[0110] To assess the ability of FANA ASOs to penetrate insect cells, a suspension of S2-wDi cells was incubated with a fluorescently labeled FANA oligo for 24 h. An aliquot was added to a coverslip coated with the lectin concanavalin A, which induced the cells to spread and adhere to the glass (Buster et al., 2010). The cells were fixed, mounted and finally imaged. Confocal microscopy revealed that the oligo could be readily detected inside S2-wDi cells, within one day post-treatment and without using any transfection agent. No signal was detected in untreated S2-wDi cells.
Example 3
Localization of FANA ASOs in D. Citri Alimentary Canal
[0111] The capability of D. citri adults to ingest FANA ASOs from the vascular system of Citrus plants was evaluated. Adult psyllids were allowed to feed on Pineapple sweet orange leaves, which had previously absorbed a solution containing a fluorophore-tagged FANA oligo control [SEQ ID NO: 1 and SEQ ID NO: 2]. After 48 h the psyllids alimentary canals were dissected and imaged. Fluorescent microscopy demonstrated that the FANA ASO was delivered to the insects through the Citrus leaves vascular tissues; the oligo was detected mainly in the psyllid esophagus, filter chamber and anterior midgut (
Example 4
Silencing of wDi gyrA in Cell Culture
[0112] To examine the competence of FANA ASOs to mediate the degradation of specific bacterial genes in cultured insect cells, S2-wDi cells were incubated with 5 M of a FANA oligo complementary to the mRNA of Wolbachia-Diaphorina, wDi gyrA gene (gyrA-FANA) [SEQ ID NO: 38]. As a negative control, a group of cells were exposed to a FANA oligo designed with a scramble sequence not targeting any wDi gene (scramble control FANA) [SEQ ID NO: 4]. Total RNA was extracted seven days post-treatment and analyzed by qRT-PCR, using primers specific to the wDi gyrA gene. Compared to untreated cells, the gyrA-FANA treatment resulted in a significant 30% reduction in the amount of the target mRNA [t (16)=2.60, p=0.019] (
Example 5
Silencing of CLas Ligase-A in D. Citri
[0113] The competence of FANA ASOs in silencing bacterial genes inside D. citri was evaluated. A FANA antisense oligo was designed to target the CLas NAD-dependent DNA Ligase A gene [SEQ ID NO: 71] (LigA-FANA), by making it complementary to its mRNA. The oligo was delivered to D. citri adults through the vascular system of excised Citrus leaves, that had taken up a 5 M FANA solution. The scramble control FANA was used as a non-target control. Seven days post-treatment, total RNA was extracted from the psyllids and analyzed by qRT-PCR, using primers specific to the CLas LigA gene. Feeding D. citri adults with LigA-FANA significantly decreased the expression of the bacterial target gene by 75%, when compared to untreated psyllids [t (16)=3.18, p=0.006] (
Example 6
Effect of gyrA-FANA on the Viability of wDi Cells
[0114] wDi was isolated from Drosophila S2 cells and incubated with gyrA-FANA, [SEQ ID NO: 38] for four days. The cells were collected and treated with propidium monoazide (PMA) before quantifying the bacterial copy number by qPCR. Propidium monoazide is a membrane-impermeant dye that selectively penetrates cells with compromised membranes (dead cells). PMA covalently links to DNA, which inhibits PCR amplification, (Nocker et al., 2007); therefore, only DNA from live cells was amplified. The number of viable wDi cells was greatly reduced in the [SEQ ID NO: 38] Wolb-gyrA-FANA treatment, as compared with wDi cells that were untreated or incubated with the scramble control FANA [SEQ ID NO: 4] (
Example 7
Effect of Lig-A-FANA on CLas Quantification in D. CITRI and Citrus PLANTS
[0115] D. citri adults were fed an artificial diet containing NAD-dependent DNA ligase, LigA-FANA, [SEQ ID NO: 71, or SEQ ID NOs: 72-74] at a concentation that significantly reduced the expression of the CLas LigA gene. Seven days post-treatment, quantitative PCR was used to estimate CLas copy number in the psyllids, by targeting the bacterium 16S rRNA gene. CLas density was significantly lower in the psyllids that ingested LigA-FANA, compared to untreated psyllids or insects fed with the scramble control-FANA [SEQ ID NO: 4] (
[0116] Delivering DNA ligase, LigA FANA [SEQ ID NO: 71] through root infusion to CLas-infected Citrus trees, significantly reduced the quantity of the bacterium (
Inoculation Efficiency Assays
[0117] To test the capacity of FANA ASOs in reducing CLas transmission, infected psyllids were treated with CLas LigA-FANA. Infected adult psyllids (3 days old) were placed in feeding arenas where they were exposed to a FANA ASO solution or a 17% (w:v) sucrose solution. Seven days post-treatment the psyllids were transferred to uninfected Citrus macrophylla seedlings, six to nine months old, for an inoculation access period where they were allowed to feed of 15 days. Twenty adult psyllids (10 males and 10 females) were caged with individual seedlings. Five plants were used per treatment. CLas-free psyllids were caged with healthy Citrus macrophylla seedlings as negative control. After the inoculation access period, every psyllid developmental stage was removed from the seedlings and the adults were collected in 80% ethanol for subsequent qPCR bacterial detection. The seedlings were sprayed with insecticides (to eliminate any remaining psyllid) and moved to a greenhouse. Three months later, the CLas copy number of each seedling was quantified by collecting three leaves and detecting the titer of the bacterium as described before. As illustrated in
Example 8
Effect of Gyrase-a, GyrA-Fana Treatment on CLso Infected Potato
[0118] Candidatus Liberibacter solanacearum (CLso) is an economically important pathogen of Solanaceous crops and the putative causal agent of zebra chip disease of potato (Solanum tuberosum L.). This pathogen is transmitted to Solanaceous species by the potato psyllid, Bactericera cockerelli (Slc). (Sengoda et al, 2014; Crosslin et al, 2011; Munyaneza, J. E. 2015).
[0119] FANA treatments of CLso-infected potato plants included (scramble F-ANA blank Control [SEQ ID NO: 3] infected plants, and CLso GyrA-FANA's, [SEQ ID NOs: 15, 16, 17, 18, 19 and SEQ ID NOs: 75, 76, 77,] and [SEQ ID NO: 46-70] CLso-DnaB-FANA's and were compared to uninfected potato for growth and symptom severity. Five potted potato plants (Russet Burbank cultivar) in one gallon pots (five per treatment) were inoculated by psyllid transmission with the Zebra chip pathogen (haplotype B) by confining three Liberibacter-infected psyllids to a single leaf for one week. Control plants were not challenged with potato psyllids (B. cockerelli). Following a 1-week inoculation access period, the psyllids were removed and confirmed to harbor the zebra chip pathogen using PCR (Crosslin et al. 2011). Three leaflets from three separate leaves will also be collected from each plant to quantify titers of the zebra chip pathogen using quantitative PCR (Sengoda et al. 2014). Each plant was then treated with 100 mM FANA solution (one of five target sequences or non-target control) or water (untreated controls) using a 100 ml solutions as soil applied drench. Two weeks (-14 days) following the initial treatment, second doses of treatments were applied in the same manner as described. At that time three leaflets from separate leaves were collected from each plant to quantify pathogen titers. Each plant height was measured every two weeks post treatments for growth (
[0120] CLso infected Potato plants treated with CLso-GyrA-FANA's, [SEQ ID NOs: 16, 17, 18, 19] as a soil applied drench to soil in one gallon potted plants, resulted in improved growth (ave. 51 centimeters height) compared to CLso infected untreated control plants (ave. 39 centimeters height), while uninfected healthy potatoes average 66 cm in height (
[0121] Development of foliar symptoms was monitored and photo-documented each every 2 weeks, and was ranked from 0 (no symptoms) to 3 (severe). Foliar symptom scores were summed for all plants in each treatment at three timepoints post inoculation by psyllids, for timepoints on days 35, 46, 52 (
[0122] Foliar Symptom Scores resulted in a total summed score that was half that of the symptom severity in the untreated CLso infected controls (
[0123] In general CLso titers were numerically reduced in treated plants compared with CLso infected control two weeks after treatment (
[0124] As illustrated in
[0125] Tuber disease symptoms evaluation included the attribution of a symptom score: [0126] 0=none, [0127] 1=two to three leaves slight yellow, [0128] 2=five or more leaves yellowing, [0129] 3=most leaves yellow, with curling; [0130] and the assessment of tuber symptoms, which is the browning aspect observed when a potato is sliced into chips and fried in oil (the browning is due to excess starches and sugars post infection by bacteria).
[0131] There was no significant difference observed in plant growth between the control plants and treated-infected plants at eight weeks. Foliar disease symptoms were significantly reduced by all products (F-ASO) [SEQ ID NO: 15, 16, 17, 18, 19; 64, 65, 66, 67, 68, 69, 70; 75, 76, 77], with the most symptom reduction observed from treatments with CLsoDNAB-1[SEQ ID NO: 64] and Gyrase-Ext-2 [SEQ ID NO:18]; as observed by the reduction in foliar symptom ranking. Tuber disease symptoms were significantly reduced compared to CLso infected Control tubers, in treatments with F-ANA Products: CLso-DNAB-2 [SEQ ID NO: 65] and DNAB4, [SEQ ID NO:67] and CLso-2Gyr-EXT-4, [SEQ ID NO:19] as observed by the reduction in the proportion of symptomatic tubers.
[0132] Although the invention has been described with reference to the above examples, it will be understood that modifications and variations are encompassed within the spirit and scope of the invention. Accordingly, the invention is limited only by the following claims.