Nucleic Acid Synthesis and Sequencing Using Tethered Nucleoside Triphosphates
20250027130 ยท 2025-01-23
Assignee
Inventors
- Alanna Schepartz Shrader (Berkeley, CA, US)
- Riley Carson B. Fricke (Berkeley, CA, US)
- Cameron V. Swenson (Berkeley, CA, US)
Cpc classification
C12P19/34
CHEMISTRY; METALLURGY
International classification
Abstract
Methods to generate novel acyl-tRNA species deploy an orthogonal synthetase that accepts -hydroxy acids, -thio acids, N-formyl-L--amino acids, and/or -carboxyl acid monomers (malonic acids) that are formally precursors to polyketide natural products.
Claims
1. A method to generate novel acyl-tRNA species, comprising reacting an orthogonal synthetase with a tRNA and a non-L--amino acid selected from -hydroxy acids, -thio acids, N-formyl-L--amino acids and -carboxyl acid monomers (malonic acids) that are formally precursors to polyketide natural products, to generate the novel acyl-tRNA species.
2. The method of claim 1, wherein the orthogonal synthetase accepts -hydroxy acids, -thio acids, N-formyl-L--amino acids, and -carboxyl acid monomers (malonic acids) that are formally precursors to polyketide natural products.
3. The method of claim 1, wherein the orthogonal synthetase is a pyrrolysyl-tRNA synthetase (PylRS).
4. The method of claim 1, wherein the orthogonal synthetase is a pyrrolysyl-tRNA synthetase (PylRS), and the PylRS is a Methanomethylophilus alvus PylRS (MaPylRS) or a MaPylRS substitution variant.
5. The method of claim 1, wherein the orthogonal synthetase is a pyrrolysyl-tRNA synthetase (PylRS), and the PylRS is a Methanomethylophilus alvus PylRS (MaPylRS) substitution variant comprising substitutions at N166 and V168.
6. The method of claim 1, wherein the orthogonal synthetase is a pyrrolysyl-tRNA synthetase (PylRS), and the PylRS is a Methanomethylophilus alvus PylRS (MaPylRS) substitution variant comprising MaFRS1 (N166A, V168L), MaFRS2 (N166A, V168K), or MaFRSA (N166A, V168A).
7. The method of claim 1, further comprising providing the acyl-tRNA species in a translation system, wherein the non-L--amino acid is incorporated into a protein.
8. The method of claim 1, further comprising providing the acyl-tRNA species in a translation system, wherein the non-L--amino acid is incorporated into a sequence-defined non-protein hetero-polymer.
9. A composition or kit comprising an isolated orthogonal synthetase that accepts -hydroxy acids, -thio acids, N-formyl-L--amino acids or -carboxyl acid monomers (malonic acids) that are formally precursors to polyketide natural products.
10. The composition or kit of claim 9, wherein the orthogonal synthetase accepts -hydroxy acids, -thio acids, N-formyl-L--amino acids, and -carboxyl acid monomers (malonic acids) that are formally precursors to polyketide natural products.
11. The composition or kit of claim 10, wherein the orthogonal synthetase is a pyrrolysyl-tRNA synthetase (PylRS).
12. The composition or kit of claim 11, wherein the PylRS is a Methanomethylophilus alvus PylRS (MaPylRS) or a MaPylRS variant.
13. The composition or kit of claim 12, wherein the PylRS is MaPylRS variant comprising substitutions at N166 and V168.
14. The composition or kit of claim 13, wherein the PylRS is MaPylRS variant MaFRS1 (N166A, V168L), MaFRS2 (N166A, V168K), or MaFRSA (N166A, V168A).
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
DESCRIPTION OF PARTICULAR EMBODIMENTS OF THE INVENTION
[0070] Unless contraindicated or noted otherwise, in these descriptions and throughout this specification, the terms a and an mean one or more, the term or means and/or. It is understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and scope of the appended claims. All publications, patents, and patent applications cited herein, including citations therein, are hereby incorporated by reference in their entirety for all purposes.
Example: Expanding the Substrate Scope of PylRS Enzymes to Include Non--Amino Adds In Vitro and In Vivo
[0071] We hypothesized that the water-mediated -amine recognition employed by MmPylRS could provide sufficient space and flexibility for substrates with less conservative substituents in place of the -amine. Here we disclose that the tolerance of MmPylRS for substrates with multiple alternative substituents in place of the -amine extends to Methanomethylophilus alvus PylRS (MaPylRS).sup.34,35 as well as MaPylRS variants (MaFRS1 and MaFRS2) that recognize diverse L-phenylalanine derivatives.sup.36. More importantly, MaFRS1 and MaFRS2 also accept phenylalanine derivatives with -thio, N-formyl-L--amino, as well as an -carboxyl substituent: 2-benzylmalonic acid. A final variant, MaFRSA.sup.37, is selective for ring-substituted 2-benzylmalonate derivatives over L-Phe.
[0072] Malonates contain a 1,3-dicarbonyl unit that represents the defining backbone element of polyketide natural products, and after decarboxylation have the potential to support Claisen-type condensation within the PTC to form a carbon-carbon bond. Structural analysis of MaFRSA complexed with a meta-substituted 2-benzylmalonate derivative and a non-hydrolyzable ATP analogue reveals how the enzyme uses a novel pattern of hydrogen bonds to differentiate the two pro-chiral carboxylates in the substrate and accommodate the larger size and distinct electrostatics of an -carboxyl substituent. In vitro translation studies confirm that tRNAs carrying -thio, -carboxyl, and N-formyl-L--amino acid monomers are effectively delivered to and accommodated by E. coli ribosomes. In vivo studies using traditional and engineered E. coli strains confirm that MaFRSA supports the biosynthesis of model proteins containing internal, aromatic, -hydroxy acid monomers. This invention provides the first orthogonal aminoacyl-tRNA synthetase that accepts -thio acids and -carboxyl acids that would support carbon-carbon bond formation within the ribosome. These novel activities demonstrate the potential of PylRS as a scaffold for evolving new enzymes that act in synergy with natural or evolved ribosomes to generate diverse sequence-defined non-protein hetero-polymers.
MaPylRS Retains Much of the Promiscuity of MmPylRS
[0073] First we set out to establish whether the novel substrate scope of MmPylRS reported for L-BocK analogs (
[0074] MaPylRS variants retain activity for phenylalanine derivatives with diverse -amine substitutions
[0075] PylRS is a subclass IIc aaRS that evolved from PheRS.sup.46. MmPylRS variants with substitutions at two positions that alter the architecture of the side chain-binding pocket (N346, C348) accept L-phenylalanine and its derivatives in place of pyrrolysine.sup.36,46,25. We integrated the mutations in two variants that accept unsubstituted L-Phe (MmFRS1 and MmFRS2).sup.36 into the MaPylRS sequence to generate MaFRS1 (N166A, V168L) and MaFRS2 (N166A, V168K). We then used RNAse A and intact tRNA mass spectrometry assays to determine if MaFRS1 or MaFRS2 retained activity for L-phenylalanine 7 and analogs in which the L--amino group was substituted by OH (8), H (9), NHCH.sub.3 (10), or D-NH.sub.2 (11) (
[0076] Incubation of L-Phe 7 (10 mM) with purified MaFRS1 or MaFRS2 (2.5 M) and Ma-tRNA.sup.Pyl (25 M) at 37 C. for 2 hours led in both cases to a pair of products whose expected mass (415.17244 Da) corresponds to adenosine nucleoside 12 (Z=L-NH.sub.2,
MaFRS1 & MaFRS2 Process Substrates with Novel -Substituents
[0077] We then began to explore phenylalanine analogs with larger and electrostatically distinct functional groups at the -carbon: -thio acids, N-formyl-L--amino acids, and -carboxyl acids (malonates) (
[0078] We found that L-Phe analogs in which the -amine was substituted with -thiol (13), -carboxyl (14), or N-formyl-L--amine (15) moieties were all substrates for MaFRS1 and MaFRS2 (
[0079] Incubation of N-formyl-L--amine (15) under identical conditions led to the expected adenosine nucleoside 12 (Z=NHCHO) and LC-MS analysis confirmed a 50.0% (MaFRS1) and 31.1% (MaFRS2) yield of acylated tRNA (15-tRNA.sup.Pyl). The -thio L-Phe analog 13 was also a substrate for MaFRS1 and MaFRS2, though higher concentrations of MaFRS1 were necessary to observe the acyl-tRNA product (13-tRNA.sup.Pyl) using intact tRNA LC-MS. These results illustrate that the active site pocket that engages the -amine in PylRS can accommodate substituents with significant differences in mass (NHCHO) and charge (COO.sup.). Despite these differences, 2-benzylmalonate 14 (2-BMA) is an excellent substrate for MaFRS1 and MaFRS2; kinetic analysis using the malachite green assay.sup.52 revealed a rate of adenylation by MaFRS1 that was 66% of the rate observed for L-Phe (
MaFRSA Processes Meta-Substituted 2-Benzylmalonic Acid Substrates and is Orthogonal to L-Phe
[0080] While MaFRS1 and MaFRS2 demonstrated the ability to process substrates with unusual -substituents, they also process L-Phe with comparable efficiency (
Structural Analysis of MaFRSA-Meta-CF.SUB.3.-2-Benzylmalonate Complex Reveals Novel Interactions
[0081] To better understand how 2-benzylmalonate substrates are accommodated by the MaFRSA active site, we solved the crystal structure of MaFRSA bound to both meta-CF.sub.3-2-BMA and the non-hydrolyzable ATP analog adenosine 5-(,-imido)triphosphate (AMP-PNP). The structure was refined at 1.8 with clear substrate density for meta-CF.sub.3-2-BMA visible at 1 in the 2F.sub.o-F.sub.c map. MaFRSA crystallized with two protein chains in the asymmetric unit and an overall architecture resembling published PylRS structures (
[0082] Regardless of orientation, discrete networks of hydrogen bonds are used by MaFRSA to discriminate between the pro-R and pro-S carboxylates of meta-CF.sub.3-2-BMA. In chain A, the pro-S carboxylate accepts a hydrogen bond from the backbone amides of L121 and A122 and the phenolic OH of Y206. A hydrogen bond from the R150 guanidinium positions the pro-R carboxylate for nucleophilic attack with a distance of 2.7 between the carboxyl oxygen and the -phosphorous of AMP-PNP. In chain B, the orientation of meta-CF.sub.3-2-BMA is flipped relative to the conformation bound to chain A (
[0083] As anticipated, the non-reactive, pro-S carboxylate of meta-CF.sub.3-2-BMA is recognized by MaFRSA chain A using interactions that are distinct from those used by MmPylRS to recognize the Pyl -amine. In the MmPylRS:Pyl:AMP-PNP complex (PDB: 2ZCE).sup.33, the Pyl -amine is recognized by water-mediated hydrogen bonds to the backbone amides of L301 and A302 and the side chain carbonyl of N346, rather than by direct hydrogen bonds to the backbone amides of L121 and A122 as seen for recognition of the non-reacting carboxylate of meta-CF.sub.3-2-BMA by both chains of MaFRSA (
[0084] The largest differences between MaFRSA and other reported PylRS structures are localized to a 6-residue loop that straddles -strands 5 and 6 and contains the active site residue Y206. In the the MmPylRS:Pyl:AMP-PNP structure (PDB: 2ZCE).sup.33 and the wild-type MaPylRS apo structure (PDB: 6JP2).sup.56, the 5-6 or corresponding loop is either unstructured or in an open conformation positioning Y206/Y384 away from the active site, respectively. Among wild-type PylRS structures, the Y206/Y384-containing loop exists in the closed conformation only in the structure of MmPylRS bound to the reaction product, Pyl-adenylate (PDB: 2Q7H).sup.57. In this structure, Y384 accepts and donates a hydrogen bond to the Pyl-adenylate -amine and pyrrole nitrogen, respectively, and forms a hydrophobic lid on the active site. In both chains of substrate-bound MaFRSA, the non-reacting carboxylate of meta-CF.sub.3-2-BMA forms similar hydrogen bonds to Y206. These hydrogen bonds effectively close the 5-6 loop to form a hydrophobic lid on the active site, which may contribute to the high acylation activity observed for meta-CF.sub.3-2-BMA with MaFRSA. We note that the 5-6 loop in chain A exhibits lower B-factors than in chain B indicating tighter binding and providing further evidence that chain A represents the more active binding mode of meta-CF.sub.3-2-BMA. The two alternative poses of meta-CF.sub.3-2-BMA in chains A and B correspond to a 120 degree rotation about the C-C bond of the substrate that largely maintains interactions with the meta-CF.sub.3-2-BMA side chain but alters the placement of the reacting carboxylate. This observation emphasizes the dominant stabilizing role of the main chain H-bonds provided by the backbone amides of L121 and A122.
In Vitro Translation Initiation with Novel Monomers Via Codon Skipping
[0085] We performed in vitro translation experiments to verify that the uniquely acylated derivatives of Ma-tRNA.sup.Pyl produced using MaPylRS variants are effectively shuttled to and accommodated by the E. coli ribosome. Whereas the E. coli initiator tRNA.sup.fMet has been engineered into a substrate for MjTyrRS variants to introduce non-canonical L--amino acids at the protein N-terminus.sup.51, Ma-tRNA.sup.Pyl lacks the key sequence elements for recognition by E. coli initiation factors precluding its use for initiation in vivo.sup.35,59. It has been reported.sup.60 that in the absence of methionine, in vitro translation can begin at the second codon of the mRNA template, a phenomenon we refer to as codon skipping. We took advantage of codon skipping and a commercial in vitro translation (IVT) kit to evaluate whether Ma-tRNA.sup.Pyl enzymatically charged with monomers 13-15 would support translation initiation.
[0086] To avoid competition with release factor 1 (RF1) at UAG codons, the anticodon of Ma-tRNA.sup.Pyl was mutated to ACC (Ma-tRNA.sup.Pyl-ACC) to recode a glycine GGT codon at position 2 in the mRNA template. To maximize yields of acyl-tRNA, we increased the aaRS:tRNA ratio to 1:2 (monomers 7, 14, and 15) or 1:1 (monomer 13), extended the incubation time to 3 hours, and used the most active MaFRSx variant for each monomer. These modifications resulted in acyl-tRNA yields of 79% (7, MaFRS1), 13% (13, MaFRS2), 85% (14, MaFRS2), and 82% (15, MaFRS1). The acylated Ma-tRNA.sup.Pyl-ACC was added with a DNA template encoding a short MGV-FLAG peptide (MGVDYKDDDDK) (SEQ ID NO:12) (
In Vivo Translation of Sequence-Defined Ester-Amide Hetero-Polymers
[0087] We next sought to evaluate whether the ability of MaPylRS and MaFRSA to acylate tRNA with novel monomers in vitro would support translation of backbone-modified protein heteropolymers in vivo. As the yields of tRNAs acylated in vitro with N-methyl -amino acids and -thio acids were low (
[0088] First, we modified established pUltra plasmids.sup.61 for aaRS/tRNA expression by adding a lac-operator between the tRNA promoter and coding region to make tRNA expression inducible. The resulting pMega plasmids were more easily propagated than pUltra, perhaps by alleviating toxicity.sup.62 from high uncharged tRNA levels during growth. Initial experiments were performed in E. coli DH10B cells transformed with one of two sfGFP reporter plasmids (pET22b-sfGFP-200TAG or pET22b-sfGFP-151TAG) and a modified pEVOL.sup.63 or pMega expression plasmid encoding Ma-tRNA.sup.Pyl and either MaPylRS or MaFRSA. Growths were supplemented with 1 mM BocK (1), -OH BocK (2), m-trifluoromethyl phenylalanine (20) or -OH m-trifluoromethyl phenylalanine (21) and the emission at 528 nm, near the .sub.max for sfGFP, was assessed after 24 h. Under these conditions, sfGFP production relies on MaPylRS or a variant thereof to charge Ma-tRNA.sup.Pyl with an -OH or -NH.sub.2 acid provided in the growth media followed by ribosomal elongation of the charged monomer. In most cases, DH10B cells harboring a pMega plasmid produced 2-3 fold higher levels of sfGFP fluorescence than those harboring a pEVOL plasmid. In all but one case, -OH monomers led to approximately 1.5-2-fold lower sfGFP fluorescence than -NH.sub.2 monomers. The highest levels of sfGFP fluorescence were observed in cases in which -NH.sub.2 or -OH monomers were encoded at position 200.
[0089] Preparative scale growths were conducted using pET22b-sfGFP-200TAG and pMega-MaPylRS or pMega-MaFRSA, the top-performing plasmids in the plate reader assay, and the sfGFP products were isolated by metal-affinity chromatography. As observed previously with WT MmPylRS, E. coli DH10B cells expressing MaPylRS and grown in the presence of 1 mM BocK (1) or -OH BocK (2) expressed an sfGFP variant whose mass corresponded to the presence of a single BocK side chain (
[0090] Certain -hydroxy acids can be metabolized in E. coli into -amino acids via a two step oxidation/trans-amination process. Indeed, in classic work.sup.19, a DH10B strain lacking the transaminases aspC and tyrB was required to detect cytosolic accumulation of the -OH analog of tyrosine, 4-hydroxyphenyl lactic acid.sup.19. We thus repeated preparative scale growths of DH10B aspC tyrB harboring pET22b-sfGFP-200TAG and pMega-MaFRSA supplemented with 1 mM of m-trifluoromethyl phenylalanine (20) or -OH m-trifluoromethyl phenylalanine (21). For comparison, we also performed growths in DH10B but using a defined media lacking glutamate, the amine donor for aspC and tyrB, in an attempt to minimize transaminase activity. Intact mass analysis of sfGFP isolated from DH10B aspC tyrB growth supplemented with -OH m-trifluoromethyl phenylalanine (21) were again consistent with the expected products. Both strategies improved the fraction of ester product as judged by GluC digestion of intact isolated sfGFP; use of defined media led to a 39:52 ester:amide ratio whereas use of DH10B aspC tyrB led to an ester:amide ratio of 44:52. These studies reveal that while MaFRSA is sufficiently active in vivo to support the biosynthesis of a sequence-defined hetero-oligomer, more complex E. coli strains or alternative organisms.sup.64 may be required to generate ribosomal products containing multiple esters in high yield.
Discussion
[0091] Expanding and reprogramming the genetic code for the templated biosynthesis of sequence-defined hetero-polymers demands orthogonal aminoacyl-tRNA synthetase/tRNA pairs that accept non-L--amino acid substrates. Fahnestock & Rich reported over fifty years ago that the peptidyl transferase center (PTC) of the E. coli ribosome tolerates an -hydroxyl substituent in place of the -amine of phenylalanine and described the in vitro biosynthesis of a polyester.sup.3. More recent in vitro studies have broadened the scope of wild-type PTC reactivity to include diverse nucleophilic heteroatoms in place of the -amine.sup.13-16. However, with the exception of substrates carrying an -hydroxyl substituent.sup.19-21,65, none of these non-L--amino acid monomers are substrates for any known orthogonal aminoacyl-tRNA synthetase. The challenge is that most aminoacyl-tRNA synthetases of known structure simultaneously engage both the substrate -amine and -carboxylate moieties via multiple main-chain and side-chain hydrogen bonds to position the -carboxylate for adenylation and acylation. These well-conserved hydrogen bond networks complicate the engineering of new enzymes that accept substrates with alternative amine/carboxylate orientations or conformations (such as -amino acids or aramids), or those whose -substituents are large and/or electrostatically distinctive (such as malonates, -thio acids, and N-acyl -amino acids).
[0092] Yokoyama and coworkers demonstrated that the water-mediated hydrogen-bond network in the active site of Methanosarcina mazei pyrrolysyl-tRNA synthetase facilitated recognition of substrates with conservative substitutions (-OH, -H, -NHCH.sub.3) of the -amino group.sup.20. Here we expand the scope of monomers recognized and processed by PylRS variants to include -thio acids and N-formyl-L--amino acids as well as those that carry an -carboxyl functional group in place of the -amine: prochiral malonic acids with protein-like side chains. Monomers containing -thio, N-formyl-L--amino and -carboxyl substituents in place of the -amine can be incorporated into polypeptides at the N-terminus by the native E. coli translational apparatus; those with an -hydroxy substitute can be introduced into proteins in vivo, albeit in a side-chain and position-specific manner. Biopolymers produced at scale containing multiple, distinct ester units can serve as the basis for biomaterials that change shape and self-cleave in a pH and/or environment-selective manner.
[0093] Although thioesters and malonic acids are ubiquitous intermediates in polyketide and fatty acid biosynthesis.sup.66,67, as far as we know, aaRS enzymes that act on -thio or -carboxyl acids are unknown and tRNAs acylated with a polyketide precursor represent novel chemical species. Such tRNAs can forge a new link between ribosomal translation and assembly-line polyketide synthases.sup.68, the molecular machines responsible for protein and polyketide biosynthesis, respectively. Combined with synthetic genomes.sup.69,70, ribosomes capable of carbon-carbon bond formation enables template-driven biosynthesis of unique hybrid biomaterials and sequence-defined polyketide-peptide oligomers, such as those produced by PKS-NRPS biosynthetic modules.
Methods
[0094] Expression and purification of MaPylRS, MaFRS1, MaFRS2, and MaFRSA for biochemistry. Plasmids used to express wild-type (WT) MaPylRS (pET32a-MaPylRS) and MaFRS1 (pET32a-MaFRS1) were constructed by inserting synthetic dsDNA fragments (Extended Data Table 1) into the NdeI-NdeI cut sites of a pET32a vector using the Gibson method.sup.71. pET32a-MaFRS2 and pET32a-MaFRSA were constructed from pET32a-MaFRS1 using a Q5 Site-Directed Mutagenesis Kit (NEB). Primers RF31 & RF32, and RF32 & RF33 (Extended Data Table 1) were used to construct pET32a-MaFRS2 and pET32a-MaFRSA, respectively. The sequences of the plasmids spanning the inserted regions were confirmed via Sanger sequencing at the UC Berkeley DNA Sequencing Facility using primers T7 F and T7 R (Extended Data Table 1) and the complete sequence of each plasmid was confirmed by the Massachusetts General Hospital CCIB DNA Core.
[0095] Chemically competent cells were prepared by following a modified published protocol.sup.72. Briefly, 5 mL of LB was inoculated using a freezer stock of BL21-Gold (DE3)pLysS cells. The following day, 50 mL of LB was inoculated with 0.5 mL of the culture from the previous day and incubated at 37 C. with shaking at 200 rpm until the culture reached an OD.sub.600 between 0.3-0.4. The cells were collected by centrifugation at 4303g for 20 min at 4 C. The cell pellet was resuspended in 5 mL of sterile filtered TSS solution (10% w/v polyethylene glycol 8000, 30 mM MgCl.sub.2, 5% v/v DMSO in 25 g/L LB). The chemically competent cells were portioned into 100 L aliquots in 1.5 mL microcentrifuge tubes, flash frozen in liquid N.sub.2, and stored at 80 C. until use. The following protocol was used to transform plasmids into chemically competent cells: 20 L of KCM solution (500 mM KCl, 150 mM CaCl.sub.2, 250 mM MgCl.sub.2) was added to a 100 L aliquot of cells on ice along with approximately 200 ng of the requisite plasmid and water to a final volume of 200 L. The cells were incubated on ice for 30 min and then heat-shocked by placing them for 90 s in a water-bath heated to 42 C. Immediately after heat shock the cells were placed on ice for 2 min, after which 800 L of LB was added. The cells then incubated at 37 C. with shaking at 200 rpm for 60 min. The cells were plated onto LB-agar plates with the appropriate antibiotic and incubated overnight at 37 C.
[0096] Plasmids used to express wild type (WT) MaPylRS, MaFRS1, MaFRS2 and MaFRSA were transformed into BL21-Gold (DE3)pLysS chemically competent cells and plated onto LB agar plates supplemented with 100 g/mL carbenicillin. Colonies were picked the following day and used to inoculate 10 mL of LB supplemented with 100 g/mL carbenicillin. The cultures were incubated overnight at 37 C. with shaking at 200 rpm. The following day the 10 mL cultures were used to inoculate 1 L of LB supplemented with 100 g/mL carbenicillin in 4 L baffled Erlenmeyer flasks. Cultures were incubated at 37 C. with shaking at 200 rpm for 3 h until they reached an OD.sub.600 of 0.6-0.8. At this point, isopropyl -D-1-thiogalactopyranoside (IPTG) was added to a final concentration of 1 mM and incubation was continued for 6 h at 30 C. with shaking at 200 rpm. Cells were harvested by centrifugation at 4303g for 20 min at 4 C. and the cell pellets were stored at 80 C. until the expressed protein was purified as described below.
[0097] The following buffers were used for protein purification: Wash buffer: 50 mM sodium phosphate (pH 7.4), 500 mM NaCl, 20 mM -mercaptoethanol (BME), 25 mM imidazole; Elution buffer: 50 mM sodium phosphate (pH 7.4), 500 mM NaCl, 20 mM -mercaptoethanol (BME), 100 mM imidazole; Storage buffer: 100 mM HEPES-K, pH 7.2, 100 mM NaCl, 10 mM MgCl.sub.2, 4 mM dithiothreitol (DTT), 20% v/v glycerol. 1 cOmplete Mini EDTA-free protease inhibitor tablet was added to Wash and Elution buffers immediately before use. To isolate protein, cell pellets were resuspended in Wash buffer (5 mL/g cells). The resultant cell paste was lysed at 4 C. by sonication (Branson Sonifier 250) over 10 cycles consisting of 30 sec sonication followed by 30 sec manual swirling. The lysate was centrifuged at 4303g for 10 min at 4 C. to separate the soluble and insoluble fractions. The soluble lysate was incubated at 4 C. with 1 mL of Ni-NTA agarose resin (washed with water and equilibrated with Wash buffer) for 2 h. The lysate-resin mixture was added to a 65 g RediSep Disposable Sample Load Cartridge (Teledyne ISCO) and allowed to drain at RT. The protein-bound Ni-NTA agarose resin was then washed with three 10 mL aliquots of Wash buffer. The protein was eluted from Ni-NTA agarose resin by rinsing the resin three times with 10 mL Elution buffer. The elution fractions were pooled and concentrated using a 10 kDa MWCO Amicon Ultra-15 Centrifugal Filter Unit (4303g, 4 C.). The protein was then buffer-exchanged into Storage buffer until the [imidazole] was <5 M using the same centrifugal filter unit. The protein was dispensed into 20 L single-use aliquots and stored at 80 C. for up to 8 months. Protein concentration was measured using the Bradford assay.sup.73. Yields were between 8 and 12 mg/L. Proteins were analyzed by SDS-PAGE using Any kD Mini-PROTEAN TGX Precast Protein Gels (BioRad). The gels were run at 200 V for 30 min.
[0098] Proteins were analyzed by LC-MS to confirm their identities. Samples analyzed by mass spectrometry were resolved using a Poroshell StableBond 300 C8 (2.175 mm, 5 m, Agilent Technologies part #660750-906) using a 1290 Infinity II UHPLC (G7120AR, Agilent). The mobile phases used for separation were (A) 0.1% formic acid in water and (B) 100% acetonitrile, and the flow rate was 0.4 mL/min. After an initial hold at 5% (B) for 0.5 min, proteins were eluted using a linear gradient from 5 to 75% (B) for 9.5 min, a linear gradient from 75 to 100% (B) for 1 min, a hold at 100% (B) for 1 min, a linear gradient 100 to 5% (B) for 3.5 min, and finally a hold at 5% (B) for 4.5 min. Protein masses were analyzed using LC-HRMS with an Agilent 6530 Q-TOF AJS-ESI (G6530BAR). The following parameters were used: gas temperature 300 C., drying gas flow 12 L/min, nebulizer pressure 35 psi, sheath gas temperature 350 C., sheath gas flow 11 L/min, fragmentor voltage 175 V, skimmer voltage 65 V, Oct 1 RF Vpp 750 V, Vcap 3500 V, nozzle voltage 1000 V, 3 spectra/s.
[0099] Analytical size exclusion chromatography was performed on an KTA Pure 25. A flow rate of 0.5 mL/min was used for all steps. A Superdex 75 Increase 10/300 GL column (stored and operated at 4 C.) was washed with 1.5 column volumes (CV) of degassed and sterile filtered MilliQ water. The column equilibrated in 1.5 column volumes of SEC Buffer: 100 mM HEPES (pH 7.2), 100 mM NaCl, 10 mM MgCl.sub.2, 4 mM DTI. Approximately 800 g of protein in 250 L SEC Buffer was loaded into a 500 L capillary loop. The sample loop was washed with 2.0 mL of SEC Buffer as the sample was injected onto the column. The sample was eluted in 1.5 column volumes of SEC Buffer and analyzed by UV absorbance at 280 nm.
[0100] Transcription and purification of tRNAs. The DNA template used for transcribing M. alvus tRNA.sup.Pyl (Ma-tRNA.sup.Pyl).sup.35 was prepared by annealing and extending the ssDNA oligonucleotides Ma-PylT-F and Ma-PylT-R (2 mM, Extended Data Table 1) using OneTaq 2 Master Mix (NEB). The annealing and extension used the following protocol on a thermocycler (BioRad C1000 Touch): 94 C. for 30 s, 30 cycles of [94 C. for 20 s, 53 C. for 30 s, 68 C. for 60 s], 68 C. for 300 s. Following extension, the reaction mixture was supplemented with sodium acetate (pH 5.2) to a final concentration of 300 mM, washed once with 1:1 (v/v) acid phenol:chloroform, twice with chloroform, and the dsDNA product precipitated upon addition of ethanol to a final concentration of 71%. The pellet was resuspended in water and the concentration of dsDNA determined using a NanoDrop ND-1000 (Thermo Scientific). The template begins with a single C preceding the T7 promoter, which increases yields of T7 transcripts.sup.74. The penultimate residue of Ma-PylT-R carries a 2-methoxy modification, which reduces non-templated nucleotide addition by T7 RNA polymerase during in vitro transcription.sup.75.
[0101] Ma-tRNA.sup.Pyl was transcribed in vitro using a modified version of a published procedure.sup.76. Transcription reactions (25 L) contained the following components: 40 mM Tris-HCl (pH 8.0), 100 mM NaCl, 20 mM DTT, 2 mM spermidine, 5 mM adenosine triphosphate (ATP), 5 mM cytidine triphosphate (CTP), 5 mM guanosine triphosphate (GTP), 5 mM uridine triphosphate (UTP), 20 mM guanosine monophosphate (GMP), 0.2 mg/mL bovine serum albumin, 20 mM MgCl.sub.2, 12.5 ng/L DNA template, 0.025 mg/mL T7 RNA polymerase. These reactions were incubated at 37 C. in a thermocycler for 3 h. Four 25 L reactions were pooled, and sodium acetate (pH 5.2) was added to a final concentration of 300 mM in a volume of 200 L. The transcription reactions were extracted once with 1:1 (v/v) acid phenol:chloroform, washed twice with chloroform, and the tRNA product precipitated by adding ethanol to a final concentration of 71%. After precipitation, the tRNA pellet was resuspended in water and incubated with 8 U of RQ1 RNAse-free DNAse (Promega) at 37 C. for 30 min according to the manufacturer's protocol. The tRNA was then washed with phenol:chloroform and chloroform as described above, precipitated, and resuspended in water. To remove small molecules, the tRNA was further purified using a Micro Bio-Spin P-30 Gel Column, Tris Buffer RNase-free (Bio-Rad) after first exchanging the column buffer to water according to the manufacturer's protocol. The tRNA was precipitated once more, resuspended in water, quantified using a NanoDrop ND-1000, aliquoted, and stored at 20 C.
[0102] tRNA was analyzed by Urea-PAGE using a 10% Mini-PROTEAN TBE-Urea Gel (BioRad). The gels were run at 120 V for 30 min then stained with SYBR-Safe gel stain (Thermo-Fisher) for 5 minutes before imaging. Ma-tRNA.sup.Pyl was analyzed by LC-MS to confirm its identity. Samples were resolved on a ACQUITY UPLC BEH C18 Column (130 , 1.7 m, 2.1 mm50 mm, Waters part #186002350, 60 C.) using an ACQUITY UPLC I-Class PLUS (Waters part #186015082). The mobile phases used were (A) 8 mM triethylamine (TEA), 80 mM hexafluoroisopropanol (HFIP), 5 M ethylenediaminetetraacetic acid (EDTA, free acid) in 100% MilliQ water; and (B) 4 mM TEA, 40 mM HFIP, 5 M EDTA (free acid) in 50% MilliQ water/50% methanol. The method used a flow rate of 0.3 mL/min and began with Mobile Phase B at 22% that increased linearly to 40% B over 10 min, followed by a linear gradient from 40 to 60% B for 1 min, a hold at 60% B for 1 min, a linear gradient from 60 to 22% B over 0.1 min, then a hold at 22% B for 2.9 min. The mass of the RNA was analyzed using LC-HRMS with a Waters Xevo G2-XS Tof (Waters part #186010532) in negative ion mode with the following parameters: capillary voltage: 2000 V, sampling cone: 40, source offset: 40, source temperature: 140 C., desolvation temperature: 20 C., cone gas flow: 10 L/h, desolvation gas flow: 800 L/h, 1 spectrum/s. Expected masses of oligonucleotide products were calculated using the AAT Bioquest RNA Molecular Weight Calculator.sup.77. Deconvoluted mass spectra were obtained using the MaxEnt software (Waters Corporation).
[0103] Procedure for RNAse A assays. Reaction mixtures (25 L) used to acylate tRNA contained the following components: 100 mM Hepes-K (pH 7.5), 4 mM DTT, 10 mM MgCl.sub.2, 10 mM ATP, 0-10 mM substrate, 0.1 U E. coli inorganic pyrophosphatase (NEB), 25 M Ma-tRNA.sup.Pyl, and 2.5 M enzyme (MaPylRS, MaFRS1, MaFRS2, or MaFRSA). Reaction mixtures were incubated at 37 C. in a dry-air incubator for 2 h. tRNA samples from enzymatic acylation reactions were quenched with 27.5 L of RNAse A solution (1.5 U/L RNAse A (MilliporeSigma), 200 mM sodium acetate, pH 5.2) and incubated for 5 min at room temperature. Proteins were then precipitated upon addition of 50% trichloroacetic acid (TCA, Sigma-Aldrich) to a final concentration of 5%. After precipitating protein at 80 C. for 30 min, insoluble material was removed by centrifugation at 21,300g for 10 min at 4 C. The soluble fraction was then transferred to autosampler vials, kept on ice until immediately before LC-MS analysis, and returned to ice immediately afterwards.
[0104] Samples analyzed by mass spectrometry were resolved using a Zorbax Eclipse XDB-C18 RRHD column (2.150 mm, 1.8 m, room temperature, Agilent Technologies part #981757-902) fitted with a guard column (Zorbax Eclipse XDB-C18, 2.15 mm 1.8 m, Agilent part #821725-903) using a 1290 Infinity II UHPLC (G7120AR, Agilent). The mobile phases used were (A) 0.1% formic acid in water; and (B) 100% acetonitrile. The method used a flow rate of 0.7 mL/min and began with Mobile Phase B held at 4% for 1.35 min, followed by a linear gradient from 4 to 40% B over 1.25 min, a linear gradient from 40 to 100% B over 0.4 min, a linear gradient from 100 to 4% B over 0.7 min, then finally B held at 4% for 0.8 min. Acylation was confirmed by correctly identifying the exact mass of the 2 and 3 acyl-adenosine product corresponding to the substrate tested in the extracted ion chromatogram by LC-HRMS with an Agilent 6530 Q-TOF AJS-ESI (G6530BAR). The following parameters were used: fragmentor voltage of 175 V, gas temperature of 300 C., gas flow of 12 L/min, sheath gas temperature of 350 C., sheath gas flow of 12 L/min, nebulizer pressure of 35 psi, skimmer voltage of 65 V, Vcap of 3500 V, and collection rate of 3 spectra/s. Expected exact masses of acyl-adenosine nucleosides (Extended Data Table 2) were calculated using ChemDraw 19.0 and extracted from the total ion chromatograms 100 ppm.
[0105] Procedure for determining aminoacylation yields using intact tRNA mass spectrometry. Enzymatic tRNA acylation reactions (25 L) were performed as described in Procedure for RNAse A assays. Sodium acetate (pH 5.2) was added to the acylation reactions to a final concentration of 300 mM in a volume of 200 L. The reactions were then extracted once with a 1:1 (v/v) mixture of acidic phenol (pH 4.5):chloroform and washed twice with chloroform. After extraction, the acylated tRNA was precipitated by adding ethanol to a final concentration of 71% and incubation at 80 C. for 30 min, followed by centrifugation at 21,300g for 30 min at 4 C. After the supernatant was removed, acylated tRNA was resuspended in water and kept on ice for analysis.
[0106] tRNA samples from enzymatic acylation reactions were analyzed by LC-MS as described in Transcription and purification of tRNAs. Because the unacylated tRNA peak in each total ion chromatogram (TIC) contains tRNA species that cannot be enzymatically acylated (primarily tRNAs that lack the 3 terminal adenosine.sup.78), simple integration of the acylated and non-acylated peaks in the A.sub.260 chromatogram does not accurately quantify the acylation yield. To accurately quantify acylation yield, we used the following procedure. For each sample, the mass data was collected between 500 and 2000 m/z. A subset of the mass data collected defined as the raw MS deconvolution range was used to produce the deconvoluted mass spectra. The raw MS deconvolution range of each macromolecule species contains multiple peaks that correspond to different charge states of that macromolecule. Within the raw mass spectrum deconvolution range we identified the most abundant charge state peak in the raw mass spectrum of each tRNA species (unacylated tRNA, monoacylated tRNA, and diacylated tRNA). To quantify the relative abundance of each species, the exact mass of the major ions 0.3000 Da was extracted from the TIC to produce extracted ion chromatograms (EICs). The EICs were integrated and the areas of the peaks that aligned with the correct peaks in the TIC (as determined from the deconvoluted mass spectrum) were used for quantification of yields (Extended Data Table 3). For malonic acid substrates, the integrated peak areas for the EICs from both the malonic acid product and the decarboxylation product are added together to determine the overall acylation yield. Each sample was injected 3 times; chromatograms and spectra are representative, yields shown in Extended Data Table 3 are an average of the 3 injections. Expected masses of oligonucleotide products were calculated using the AAT Bioquest RNA Molecular Weight Calculator.sup.77 and the molecular weights of the small molecules added to them were calculated using ChemDraw 19.0. All masses identified in the mass spectra are summarized in Extended Data Data.
[0107] Malachite green assay to monitor adenylation. Enzymatic adenylation reactions were monitored using malachite green using a previous protocol with modifications.sup.52. Each adenylation reaction (60 L) contained the following components: 200 mM HEPES-K (pH 7.5), 4 mM DTT, 10 mM MgCl.sub.2, 0.2 mM ATP, 0-10 mM substrate, 4 U/mL E. coli inorganic pyrophosphatase (NEB), and 2.5 M enzyme (MaFRS1 or MaFRSA). Adenylation reactions were incubated at 37 C. in a dry-air incubator. Aliquots (10 L) were withdrawn after 0, 5, 10, 20, and 30 min and quenched upon addition to an equal volume of 20 mM EDTA (pH 8.0) on ice. Once all aliquots were withdrawn, 80 L of Malachite Green Solution (Echelon Biosciences) was added to each aliquot and the mixture incubated at RT for 30 min. After shaking for 30 sec to remove bubbles, the absorbance at 620 nm was measured on a Synergy HTX plate reader (BioTek). The absorbance was then converted to phosphate concentration using a phosphate standard curve (0-100 M) and plotted over time to determine turnover numbers.
[0108] Structure determination. The following synthetic dsDNA sequence was cloned upstream of MaFRSA (MaPylRS N166A:V168A) into pET32a-MaFRSA by Gibson assembly.sup.71 and used for subsequent crystallographic studies: GSS linker-6His-SSG linker-thrombin site-MaFRSA (Extended Data Table 1). The sequence of the pET32a-6His-thrombin-MaFRSA plasmid was confirmed with Sanger sequencing from Genewiz using primers T7 F and T7 R (Extended Data Table 1). The procedure used to express and purify MaFRSA for crystallography using pET32a-6His-thrombin-MaFRSA was adapted from a reported protocol used to express and purify wild-type M. alvus PylRS by Seki et al..sup.56. BL21(DE3) Gold competent cells (Agilent Technologies) were transformed with pET32a-6His-thrombin-MaFRSA and grown in TB media at 37 C. Protein expression was induced at an OD.sub.600 reading of 1.2 with 1 mM isopropyl -D-1-thiogalactopyranoside (IPTG). The temperature was lowered to 20 C. and growth continued overnight. Cells were pelleted for 1 h at 4,300g and resuspended in Lysis Buffer (50 mM potassium phosphate (pH 7.4), 25 mM imidazole, 500 mM sodium chloride, 5 mM -mercaptoethanol, 1 cOmplete Mini EDTA-free protease inhibitor tablet). Cells were lysed by homogenization (Avestin Emulsiflex C3). After centrifugation for 1 h at 10,000g, the clarified lysate was bound to TALON Metal Affinity Resin (Takara Bio) for 1 h at 4 C., washed with additional lysis buffer, and eluted with Elution Buffer (50 mM potassium phosphate (pH 7.4), 500 mM imidazole, 500 mM sodium chloride, 5 mM -mercaptoethanol). The eluate was dialyzed overnight at 4 C. into Cleavage Buffer (40 mM potassium phosphate (pH 7.4), 100 mM NaCl, 1 mM dithiothreitol (DTT)) then incubated overnight at room temperature with thrombin protease on a solid agarose support (MilliporeSigma). Following cleavage, the protein was passed over additional TALON resin to remove the 6His tag and dialyzed overnight at 4 C. into Sizing buffer (30 mM potassium phosphate (pH 7.4), 200 mM NaCl, 1 mM DTT). The protein was concentrated and loaded onto a HiLoad 16/600 Superdex 200 pg column (Cytiva Life Sciences) equilibrated with Sizing buffer on an KTA Pure 25 fast-liquid chromatography machine. Purified MaFRSA was dialyzed into Storage Buffer (10 mM Tris-HCl (pH 8.0), 150 mM NaCl, 10 mM MgCl2, 10 mM -mercaptoethanol), concentrated to 20 mg/mL, aliquoted, and flash-frozen for crystallography.
[0109] Initial crystallization screening conditions were adapted from Seki et al..sup.56. Crystals were grown by hanging drop vapor-diffusion in 24-well plates. 25 L of 100 mM meta-trifluoromethyl-2-benzylmalonate (meta-CF.sub.3-2-BMA) pH 7 was added to 1.5 mL microcentrifuge tubes and the water was removed by evaporation. The dried aliquots were then resuspended at a concentration of 100 mM with MaFRSA in Storage Buffer at three concentrations (6.9, 12.3, and 19.2 mg/mL) and 10 mM adenosine 5-(,-imido)triphosphate lithium salt hydrate (AMP-PNP). The protein/substrate solution (1 L) was mixed in a 1:1 ratio with the reservoir solution (1 L) containing 10 mM Tris-HCl pH 7.4 and 26% polyethylene glycol 3350 and incubated over 1 mL of reservoir solution at 18 C. Crystals with an octahedral shape appeared within one week. Crystals were plunged into liquid nitrogen to freeze with no cryoprotectant.
[0110] Data were collected at the Advanced Light Source beamline 8.3.1 at 100 K with a wavelength of 1.11583 . Data collection and refinement statistics are presented in Extended Data Table 4. Diffraction data were indexed and integrated with XDS.sup.79, then merged and scaled with Pointless.sup.80 and Aimless.sup.81. The crystals were in the space group I4, and the unit cell dimensions were 108.958, 108.958, and 112.26 . The structure was solved by molecular replacement with Phaser.sup.82 using a single chain of the wild-type apo structure of M. alvus PylRS (PDB code: 6JP2).sup.56 as the search model. There were two copies of MaFRSA in the asymmetric unit. The model was improved with iterative cycles of manual model building in COOT.sup.83 alternating with refinement in Phenix.sup.84,85 using data up to 1.8 resolution. Structural analysis and figures were generated using Pymol version 2.4.2.sup.86.
[0111] In vitro translation initiation. The Ma-tRNA.sup.Pyl-ACC dsDNA template was prepared as described in Transcription and purification of tRNAs using the primers Ma-PylT-ACC F and Ma-PylT-ACC R (Extended Data Table 1). Ma-tRNA.sup.Pyl-ACC was also transcribed, purified, and analyzed as described previously. Enzymatic tRNA acylation reactions (150 L) were performed as described in Procedure for RNAse A assays with slight modifications. The enzyme concentration was increased to 12.5 M (monomers 7, 14, and 15) or 25 M (monomer 13) and the incubation time was increased to 3 hours at 37 C. Sodium acetate (pH 5.2) was added to the acylation reactions to a final concentration of 300 mM in a volume of 200 L. The reactions were then extracted once with a 1:1 (v/v) mixture of acidic phenol (pH 4.5):chloroform and washed twice with chloroform. After extraction, the acylated tRNA was precipitated by adding ethanol to a final concentration of 71% and incubation at 80 C. for 30 min followed by centrifugation at 21,300g for 30 min at 4 C. Acylated tRNAs were resuspended in water to a concentration of 307 M immediately before in vitro translation.
[0112] Templates for expression of MGVDYKDDDDK (SEQ ID NO:12) were prepared by annealing and extending the oligonucleotides MGVflag-1 and MGVflag-2 using Q5 High-Fidelity 2 Master Mix (NEB) (Extended Data Table 1). The annealing and extension used the following protocol on a thermocycler (BioRad C1000 Touch): 98 C. for 30 s, 10 cycles of [98 C. for 10 s, 55 C. for 30 s, 72 C. for 45 s], 10 cycles of [98 C. for 10 s, 67 C. for 30 s, 72 C. for 45 s], and 72 C. for 300 s. Following extension, the reaction mixture was supplemented with sodium acetate (pH 5.2) to a final concentration of 300 mM, extracted once with a 1:1 (v/v) mixture of basic phenol (pH 8.0):chloroform, and washed twice with chloroform. The dsDNA product was precipitated upon addition of ethanol to a final concentration of 71% and incubation at 80 C. for 30 min followed by centrifugation at 21,300g for 30 min at 4 C. The dsDNA pellets were washed once with 70% (v/v) ethanol and resuspended in 10 mM Tris-HCl pH 8.0 to a concentration of 500 ng/L and stored at 20 C. until use in translation.
[0113] In vitro transcription/translation by codon skipping of the short FLAG tag-containing peptides X-Val-Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys (XV-Flag) (SEQ ID NO:1) where X=7, 13, 14, or 15 was carried out using the PURExpress (aa, tRNA) Kit (New England Biolabs, E6840S) based on a previous protocol with slight modifications.sup.16. The XV-Flag peptides were produced with the following reactions (12.5 L): Solution A (tRNA, aa; 2.5 L), amino acid stock mix (1.25 L; 33 mM L-valine, 33 mM L-aspartic acid, 33 mM L-tyrosine, 33 mM L-lysine), tRNA solution (1.25 L), Solution B (3.75 L), 250 ng dsDNA MGVDYKDDDDK (SEQ ID NO:12) template (0.5 L), and Ma-tRNA.sup.Pyl-ACC acylated with 7, 13, 14, or 15 (3.25 L). The reactions were incubated in a thermocycler (BioRad C1000 Touch) at 37 C. for 2 hours and quenched by placement on ice.
[0114] Translated peptides were purified from in vitro translation reactions by enrichment using Anti-FLAG M2 Magnetic Beads (Millipore Sigma) according to the manufacturer's protocol with slight modifications. For each peptide, 10 L of a 50% (v/v) suspension of magnetic beads was used. The supernatant was pipetted from the beads on a magnetic manifold. The beads were then washed twice by incubating with 100 L of TBS (150 mM NaCl, 50 mM Tris-HCl, pH 7.6) for 10 min at room temperature then removing the supernatant each time with a magnetic manifold. The in vitro translation reactions were added to the beads and incubated at RT for 30 min with periodic agitation. The beads were washed again three times with 100 L of TBS as described above. Peptides were eluted by incubation with 12.5 L of 0.1 M glycine-HCl pH 2.8 for 10 minutes. The supernatant was transferred to vials and kept on ice for analysis.
[0115] The purified peptides were analyzed based on a previous protocol.sup.16. The supernatant was analyzed on an ZORBAX Eclipse XDB-C18 column (1.8 m, 2.150 mm, room temperature, Agilent) using an 1290 Infinity II UHPLC (G7120AR, Agilent). The following method was used for separation: an initial hold at 95% Solvent A (0.1% formic acid in water) and 5% Solvent B (acetonitrile) for 0.5 min followed by a linear gradient from 5 to 50% Solvent B over 4.5 min at flow rate of 0.7 mL/min. Peptides were identified using LC-HRMS with an Agilent 6530 Q-TOF AJS-ESI (G6230BAR). The following parameters were used: a fragmentor voltage of 175 V, gas temperature of 300 C., gas flow rate of 12 L/min, sheath gas temperature of 350 C., sheath gas flow rate of 11 L/min, nebulizer pressure of 35 psi, skimmer voltage of 75 V, Vcap of 3500 V, and collection rate of 3 spectra/s. Expected exact masses of the major charge state for each peptide were calculated using ChemDraw 19.0 and extracted from the total ion chromatograms 100 ppm.
[0116] Plasmids used for in vivo studies. The plasmids used to express wild-type (WT) sfGFP (pET22b-T5/lac-sfGFP) and 151TAG-sfGFP (pET22b-T5/lac-sfGFP-151TAG) in E. coli have been described.sup.87. pET22b-T5/lac-sfGFP-200TAG was constructed from pET22b-T5/lac-sfGFP using a Q5 Site-Directed Mutagenesis Kit (NEB) with primers CS43 and CS44 (Extended Data Table 1). The synthetase/tRNA plasmid for WT MaPylRS (pMega-MaPylRS) was constructed by inserting a synthetic dsDNA fragment (pMega MaPylRS) (Extended Data Table 1) into the NotI-XhoI cut sites of a pUltra vector.sup.61 using the Gibson method.sup.88. pMega-MaFRSA was constructed by inserting a synthetic dsDNA fragment (made by annealing primers RF48 and RF49) following inverse PCR of pMega-MaPylRS with primers RF61 and RF62 (Extended Data Table 1) using the Gibson method.sup.88. The sequences of the plasmids spanning the inserted regions were confirmed via Sanger sequencing at the UC Berkeley DNA Sequencing Facility using primers T7 F and T7 R (Extended Data Table 1) and the complete sequence of each plasmid was confirmed by full-plasmid sequencing with Primordium Labs.
[0117] Plate reader analysis of sfGFP expression. E. coli DH10B chemically competent cells were transformed with pET22b-T5/lac-sfGFP-200TAG and either pMega-MaPylRS or pMega-MaFRSA. Colonies were picked and grown overnight in LB with the appropriate antibiotics. The following day, the OD.sub.600 of the overnight culture was measured, and all cultures were diluted with LB to an OD.sub.600 of 0.10 to generate a seed culture. A monomer cocktail was prepared in LB supplemented with 2 mM IPTG, 2 mM monomer 1, 2, 20, or 21, and the appropriate antibiotics at 2 final concentration (200 g/mL carbenicillin and 100 g/mL spectinomycin). In a 96-well plate (Corning 3904), 100 L of the seed culture was combined with 100 L of each monomer cocktail to bring the starting OD.sub.600 to 0.05 and halve the concentration of the monomer cocktail. A Breathe Easy sealing membrane (Sigma-Aldrich) was applied to the top of the 96-well plate to seal it, and the plates were loaded into a Synergy HTX plate reader (BioTek). The plate was incubated at 37 C. for 24 hours with continuous shaking. At 10 minute intervals two readings were made: the absorbance at 600 nm to measure cell density, and sfGFP fluorescence with excitation at 485 nm and emission at 528 nm.
[0118] Expression and purification of sfGFP variants. Plasmids used to express sfGFP-wt and sfGFP-200TAG were co-transformed with pMega-MaPylRS or pMega-MaFRSA into DH10B or DH10B aspC tyrB chemically competent cells and plated onto LB agar plates supplemented with 100 g/mL carbenicillin and 100 g/mL spectinomycin. Colonies were picked the following day and used to inoculate 10 mL of LB supplemented with 100 g/mL carbenicillin and 100 g/mL spectinomycin. The cultures were incubated overnight at 37 C. with shaking at 200 rpm. The following day the 1 mL of each culture was used to inoculate 100 mL of TB or defined media (adapted from a published protocol.sup.51 with glutamate excluded and 19 other amino acids at 200 g/mL) supplemented with 100 g/mL carbenicillin and 100 g/mL spectinomycin in 250 mL baffled Erlenmeyer flasks. Cultures were incubated at 37 C. with shaking at 200 rpm for 4 h until they reached an OD.sub.600 of 1.0-1.2. At this point, IPTG was added to a final concentration of 1 mM and incubation was continued overnight at 37 C. with shaking at 200 rpm. Cells were harvested by centrifugation at 4303g for 20 min at 4 C.
[0119] sfGFP variants were purified according to a published protocol.sup.64. The following buffers were used for protein purification: Lysis/wash buffer: 50 mM sodium phosphate (pH 8), 300 mM NaCl, 20 mM imidazole; Elution buffer: 50 mM sodium phosphate (pH 8), 250 mM imidazole; Storage buffer: 50 mM sodium phosphate (pH 7), 250 mM NaCl, 1 mM DTT. 1 cOmplete Mini EDTA-free protease inhibitor tablet was added to Wash and Elution buffers immediately before use. To isolate protein, cell pellets were resuspended in 10 mL Wash buffer. The resultant cell paste was lysed at 4 C. by homogenization (Avestin Emulsiflex C3) for 5 min at 15,000-20,000 psi. The lysate was centrifuged at 4303g for 15 min at 4 C. to separate the soluble and insoluble fractions. The soluble lysate was incubated at 4 C. with 1 mL of TALON resin (washed with water and equilibrated with Wash buffer) for 1 h. The lysate-resin mixture was centrifuged at 4303g for 5 min to pellet. The supernatant was removed and the protein-bound Ni-NTA agarose resin was then washed with three 5 mL aliquots of Lysis/wash buffer centrifuging between washes to pellet. The protein was eluted from Ni-NTA agarose resin by rinsing the resin five times with 1 mL Elution buffer. The elution fractions were pooled and dialyzed overnight at 4 C. into Storage buffer using 12,000-14,000 molecular weight cutoff dialysis tubing. Protein concentration was measured using the Pierce assay (CITE). Protein samples were concentrated as needed with a 110 kDa MWCO Amicon Ultra-15 Centrifugal Filter Unit (4303g, 4 C.) to reach a concentration of 0.22 mg/mL. The protein was stored at 4 C. for later analysis. Yields were between 24 and 324 mg/L when expressed in TB, and between 3.6 and 3.7 mg/L when expressed in the defined media described above. Proteins were analyzed by LC-MS as described above.
[0120] Protease digestion and fragment identification by MS. Each isolated sfGFP sample (10 to 25 g) was denatured with 6 M guanidine in a 0.15 M Tris buffer at pH 7.5, followed by disulfide reduction with 8 mM dithiothreitol (DTT) at 37 C. for 30 min. The reduced sfGFP was alkylated in the presence of 14 mM iodoacetamide at 25 C. for 25 min, followed by quenching using 6 mM DTT. The reduced/alkylated protein was exchanged into 40 L of 0.1 M Tris buffer at pH 7.5 using a Microcon 10-kDa membrane, followed by addition of 2.5 g endoproteinase Glu-C (in a 0.25 g/L solution) directly to the membrane to achieve an enzyme-to-substrate ratio of at least 1:10. After 3 hours at 37 C., the digestion was quenched with an equal volume of 0.25 M acetate buffer (pH 4.8) containing 6 M guanidine. Peptide fragments were collected by spinning down through the membrane and subjected to LC-MS/MS analysis.
[0121] LC-MS/MS analysis was performed on an Agilent 1290-II HPLC directly connected to a Thermo Fisher Q Exactive HF high-resolution mass spectrometer. Peptides were separated on a Waters HSS T3 reversed-phase column (2.1150 mm) at 50 C. with a 70 min acetonitrile gradient (0.5% to 35%) containing 0.1% formic acid in the mobile phase, and a total flow rate of 0.25 mL/min. The MS data were collected at 120 k resolution setting, followed by data-dependent higher-energy collision dissociation (HCD) MS/MS at a normalized collision energy of 25%.
[0122] Proteolytic peptides were identified and quantified on MassAnalyzer, an in-house developed program.sup.89 (available in Biopharma Finder from Thermo Fisher). The program performs feature extraction, peptide identification, retention time alignment.sup.90, and peak integration in an automated fashion.
REFERENCES
[0123] 1. Lutz, J., Ouchi, M., Liu, D. & Sawamoto, M. Sequence-Controlled Polymers. Science 341, 628-+ (2013). [0124] 2. Barnes, J. et al. Iterative exponential growth of stereo- and sequence-controlled polymers. Nat. Chem. 7, 810-815 (2015). [0125] 3. Fahnestock, S. & Rich, A. Ribosome-catalyzed polyester formation. Science 173, 340-343 (1971). [0126] 4. Ohta, A., Murakami, H., Higashimura, E. & Suga, H. Synthesis of polyester by means of genetic code reprogramming. Chem. Biol. 14, 1315-1322 (2007). [0127] 5. Katoh, T., Iwane, Y. & Suga, H. Logical engineering of D-arm and T-stem of tRNA that enhances d-amino acid incorporation. Nucleic Acids Res. 45, 12601-12610 (2017). [0128] 6. Fujino, T., Goto, Y., Suga, H. & Murakami, H. Ribosomal Synthesis of Peptides with Multiple -Amino Acids. J. Am. Chem. Soc. 138, 1962-1969 (2016). [0129] 7. Katoh, T. & Suga, H. Ribosomal Incorporation of Consecutive -Amino Acids. J. Am. Chem. Soc. 140, 12159-12167 (2018). [0130] 8. Adaligil, E., Song, A., Hallenbeck, K. K., Cunningham, C. N. & Fairbrother, W. J. Ribosomal Synthesis of Macrocyclic Peptides with .sup.2- and .sup.2,3-Homo-Amino Acids for the Development of Natural Product-Like Combinatorial Libraries. ACS Chem. Biol. 16, 1011-1018 (2021). [0131] 9. Katoh, T., Sengoku, T., Hirata, K., Ogata, K. & Suga, H. Ribosomal synthesis and de novo discovery of bioactive foldamer peptides containing cyclic -amino acids. Nat. Chem. 12, 1081-1088 (2020). [0132] 10. Katoh, T. & Suga, H. Ribosomal Elongation of Cyclic -Amino Acids using a Reprogrammed Genetic Code. J. Am. Chem. Soc. 142, 4965-4969 (2020). [0133] 11. Adaligil, E., Song, A., Cunningham, C. N. & Fairbrother, W. J. Ribosomal Synthesis of Macrocyclic Peptides with Linear .sup.4- and -Hydroxy-.sup.4-amino Acids. ACS Chem. Biol. 16, 1325-1331 (2021). [0134] 12. Lee, J., Schwarz, K. J., Kim, D. S., Moore, J. S. & Jewett, M. C. Ribosome-mediated polymerization of long chain carbon and cyclic amino acids into peptides in vitro. Nat. Commun. 11, 4304 (2020). [0135] 13. Katoh, T. & Suga, H. Consecutive Ribosomal Incorporation of -Aminoxy/-Hydrazino Acids with 1/d-Configurations into Nascent Peptide Chains. J. Am. Chem. Soc. 143, 18844-18848 (2021). [0136] 14. Takatsuji, R. et al. Ribosomal Synthesis of Backbone-Cyclic Peptides Compatible with In Vitro Display. J. Am. Chem. Soc. 141, 2279-2287 (2019). [0137] 15. Katoh, T. & Suga, H. Ribosomal Elongation of Aminobenzoic Acid Derivatives. J. Am. Chem. Soc. 142, 16518-16522 (2020). [0138] 16. Ad, O. et al. Translation of Diverse Aramid- and 1,3-Dicarbonyl-peptides by Wild Type Ribosomes in Vitro. ACS Cent. Sci. 5, 1289-1294 (2019). [0139] 17. Sievers, A., Beringer, M., Rodnina, M. V. & Wolfenden, R. The ribosome as an entropy trap. Proc. Natl. Acad. Sci. U.S.A. 101, 7897 (2004). [0140] 18. England, P. M., Zhang, Y., Dougherty, D. A. & Lester, H. A. Backbone Mutations in Transmembrane Domains of a Ligand-Gated Ion Channel: Implications for the Mechanism of Gating. Cell 96, 89-98 (1999). [0141] 19. Guo, J., Wang, J., Anderson, J. C. & Schultz, P. G. Addition of an -Hydroxy Acid to the Genetic Code of Bacteria. Angew. Chem. 120, 734-737 (2008). [0142] 20. Kobayashi, T., Yanagisawa, T., Sakamoto, K. & Yokoyama, S. Recognition of Non--amino Substrates by Pyrrolysyl-tRNA Synthetase. J. Mol. Biol. 385, 1352-1360 (2009). [0143] 21. Li, Y.-M. et al. Ligation of Expressed Protein -Hydrazides via Genetic Incorporation of an -Hydroxy Acid. ACS Chem. Biol. 7, 1015-1022 (2012). [0144] 22. Melo Czekster, C., Robertson, W. E., Walker, A. S., Sll, D. & Schepartz, A. In Vivo Biosynthesis of a -Amino Acid-Containing Protein. J. Am. Chem. Soc. 138, 5194-5197 (2016). [0145] 23. Chen, S., Ji, X., Gao, M., Dedkova, L. M. & Hecht, S. M. In Cellulo Synthesis of Proteins Containing a Fluorescent Oxazole Amino Acid. J. Am. Chem. Soc. 141, 5597-5601 (2019). [0146] 24. Liu, C. C. & Schultz, P. G. Adding New Chemistries to the Genetic Code. Annu. Rev. Biochem. 79, 413-444 (2010). [0147] 25. Wan, W., Tharp, J. M. & Liu, W. R. Pyrrolysyl-tRNA synthetase: An ordinary enzyme but an outstanding genetic code expansion tool. Biochim. Biophys. Acta BBAProteins Proteomics 1844, 1059-1070 (2014). [0148] 26. Vargas-Rodriguez, O., Sevostyanova, A., Soil, D. & Crnkovi, A. Upgrading aminoacyl-tRNA synthetases for genetic code expansion. Curr. Opin. Chem. Biol. 46, 115-122 (2018). [0149] 27. Italia, J. S. et al. Mutually Orthogonal Nonsense-Suppression Systems and Conjugation Chemistries for Precise Protein Labeling at up to Three Distinct Sites. J. Am. Chem. Soc. 141, 6204-6212 (2019). [0150] 28. Chin, J. W. Expanding and reprogramming the genetic code. Nature 550, 53-60 (2017). [0151] 29. Srinivasan Gayathri, James Carey M., & Krzycki Joseph A. Pyrrolysine Encoded by UAG in Archaea: Charging of a UAG-Decoding Specialized tRNA. Science 296, 1459-1462 (2002). [0152] 30. Ambrogelly, A., Palioura, S. & Soll, D. Natural expansion of the genetic code. Nat. Chem. Biol. 3, 29-35 (2007). [0153] 31. Wang, L., Brock, A., Herberich, B. & Schultz, P. G. Expanding the Genetic Code of Escherichia coli. Science 292, 498-500 (2001). [0154] 32. Kobayashi, T. et al. Structural basis for orthogonal tRNA specificities of tyrosyl-tRNA synthetases for genetic code expansion. Nat. Struct. Biol. 10, 8 (2003). [0155] 33. Yanagisawa, T. et al. Crystallographic Studies on Multiple Conformational States of Active-site Loops in Pyrrolysyl-tRNA Synthetase. J. Mol. Biol. 378, 634-652 (2008). [0156] 34. Borrel, G. et al. Genome Sequence of Candidatus Methanomethylophilus alvus Mx1201, a Methanogenic Archaeon from the Human Gut Belonging to a Seventh Order of Methanogens. J. Bacteriol. 194, 6944-6945 (2012). [0157] 35. Willis, J. C. W. & Chin, J. W. Mutually orthogonal pyrrolysyl-tRNA synthetase/tRNA pairs. Nat. Chem. 10, 831-837 (2018). [0158] 36. Wang, Y.-S. et al. The de novo engineering of pyrrolysyl-tRNA synthetase for genetic incorporation of l-phenylalanine and its derivatives. Mol. Biosyst. 7, 714 (2011). [0159] 37. Wang, Y.-S., Fang, X., Wallace, A. L., Wu, B. & Liu, W. R. A Rationally Designed Pyrrolysyl-tRNA Synthetase Mutant with a Broad Substrate Spectrum. J. Am. Chem. Soc. 134, 2950-2953 (2012). [0160] 38. Herring, S. et al. The amino-terminal domain of pyrrolysyl-tRNA synthetase is dispensable in vitro but required for in vivo activity. FEBS Lett. 581, 3197-3203 (2007). [0161] 39. McMurry, J. L. & Chang, M. C. Y. Fluorothreonyl-tRNA deacylase prevents mistranslation in the organofluorine producer Streptomyces cattleya. Proc. Natl. Acad. Sci. 114, 11920-11925 (2017). [0162] 40. Findly, D., Herries, D. G., Mathias, A. P., Rabin, B. R. & Ross, C. A. The Active Site and Mechanism of Action of Bovine Pancreatic Ribonuclease. Nature 190, 781-784 (1961). [0163] 41. Griffin, B. E., Jarman, M., Reese, C. B., Sulston, J. E. & Trentham, D. R. Some Observations Relating to Acyl Mobility in Aminoacyl Soluble Ribonucleic Acids*. Biochemistry 5, 3638-3649 (1966). [0164] 42. Gottfried-Lee, I., Perona, J. J., Karplus, P. A., Mehl, R. A. & Cooley, R. B. Structures of Methanomethylophilus alvus Pyrrolysine tRNA-Synthetases Support the Need for De Novo Selections When Altering the Substrate Specificity. ACS Chem. Biol. (2022) doi:10.1021/acschembio.2c00640. [0165] 43. Stepanov, V. G., Moor, N. A., Ankilova, V. N. & Lavrik, O. I. Phenylalanyl-tRNA synthetase from Thermus thermophilus can attach two molecules of phenylalanine to tRNA.sup.Phe. FEBS Lett. 311, 192-194 (1992). [0166] 44. Wang, B., Zhou, J., Lodder, M., Anderson, R. D. & Hecht, S. M. Tandemly Activated tRNAs as Participants in Protein Synthesis. J. Biol. Chem. 281, 13865-13868 (2006). [0167] 45. Englert, M. et al. Aminoacylation of tRNA 2- or 3-hydroxyl by phosphoseryl- and pyrrolysyl-tRNA synthetases. FEBS Lett. 587, 3360-3364 (2013). [0168] 46. Ko, J. et al. Pyrrolysyl-tRNA synthetase variants reveal ancestral aminoacylation function. FEBS Lett. 587, 3243-3248 (2013). [0169] 47. Xuan, W. et al. Site-Specific Incorporation of a Thioester Containing Amino Acid into Proteins. ACS Chem. Biol. 13, 578-581 (2018). [0170] 48. Hwang, S., Lee, N., Cho, S., Palsson, B. & Cho, B.-K. Repurposing Modular Polyketide Synthases and Non-ribosomal Peptide Synthetases for Novel Chemical Biosynthesis. Front. Mol. Biosci. 7, (2020). [0171] 49. Muir, T., Sondhi, D. & Cole, P. Expressed protein ligation: A general method for protein engineering. Proc. Natl. Acad. Sci. U.S.A. 95, 6705-6710 (1998). [0172] 50. Varshney, U., Lee, C. P., Seong, B. L. & RajBhandary, U. L. Mutants of initiator tRNA that function both as initiators and elongators. J. Biol. Chem. 266, 18018-18024 (1991). [0173] 51. Tharp, J. M. et al. Initiation of Protein Synthesis with Non-Canonical Amino Acids In Vivo. Angew. Chem. Int. Ed. 59, 3122-3126 (2020). [0174] 52. Cestari, I. & Stuart, K. A Spectrophotometric Assay for Quantitative Measurement of Aminoacyl-tRNA Synthetase Activity. J. Biomol. Screen. 18, 490-497 (2013). [0175] 53. Wang, Y.-S. et al. Genetic Incorporation of Twelve meta-Substituted Phenylalanine Derivatives Using a Single Pyrrolysyl-tRNA Synthetase Mutant. ACS Chem. Biol. 8, 405-415 (2013). [0176] 54. Guo, L.-T. et al. Polyspecific pyrrolysyl-tRNA synthetases from directed evolution. Proc. Natl. Acad. Sci. 111, 16724-16729 (2014). [0177] 55. Tharp, J. M., Wang, Y.-S., Lee, Y.-J., Yang, Y. & Liu, W. R. Genetic Incorporation of Seven ortho-Substituted Phenylalanine Derivatives. ACS Chem. Biol. 9, 884-890 (2014). [0178] 56. Seki, E., Yanagisawa, T., Kuratani, M., Sakamoto, K. & Yokoyama, S. Fully Productive Cell-Free Genetic Code Expansion by Structure-Based Engineering of Methanomethylophilus alvus Pyrrolysyl-tRNA Synthetase. ACS Synth. Biol. 9, 718-732 (2020). [0179] 57. Kavran, J. M. et al. Structure of pyrrolysyl-tRNA synthetase, an archaeal enzyme for genetic code innovation. Proc. Natl. Acad. Sci. 104, 11268-11273 (2007). [0180] 58. Englert, M. et al. Probing the active site tryptophan of Staphylococcus aureus thioredoxin with an analog. Nucleic Acids Res. 43, 11061-11067 (2015). [0181] 59. Laursen, B. S., Srensen, H. P., Mortensen, K. K. & Sperling-Petersen, H. U. Initiation of Protein Synthesis in Bacteria. Microbiol. Mol. Biol. Rev. 69, 101-123 (2005). [0182] 60. Lee, J. et al. Expanding the limits of the second genetic code with ribozymes. Nat. Commun. 10, 5097 (2019). [0183] 61. Chatterjee, A., Sun, S. B., Furman, J. L., Xiao, H. & Schultz, P. G. A Versatile Platform for Single- and Multiple-Unnatural Amino Acid Mutagenesis in Escherichia coli. Biochemistry 52, 1828-1837 (2013). [0184] 62. Goldman, E. & Jakubowski, H. Uncharged tRNA, protein synthesis, and the bacterial stringent response. Mol. Microbiol. 4, 2035-2040 (1990). [0185] 63. Young, T. S., Ahmad, I., Yin, J. A. & Schultz, P. G. An Enhanced System for Unnatural Amino Acid Mutagenesis in E. coli. J. Mol. Biol. 395, 361-374 (2010). [0186] 64. Gonzlez, S. S. et al. Genetic Code Expansion in the Engineered Organism Vmax X2: High Yield and Exceptional Fidelity. ACS Cent. Sci. 7, 1500-1507 (2021). [0187] 65. Bindman, N. A., Bobeica, S. C., Liu, W. R. & van der Donk, W. A. Facile Removal of Leader Peptides from Lanthipeptides by Incorporation of a Hydroxy Acid. J. Am. Chem. Soc. 137, 6975-6978 (2015). [0188] 66. Nivina, A., Yuet, K., Hsu, J. & Khosla, C. Evolution and Diversity of Assembly-Line Polyketide Synthases. Chem. Rev. 119, 12524-12547 (2019). [0189] 67. Tsai, S. The Structural Enzymology of Iterative Aromatic Polyketide Synthases: A Critical Comparison with Fatty Acid Synthases. in Annual Review of Biochemistry (ed. Kornberg, R.) vol. 87 503-531 (2018). [0190] 68. Walsh, C. T., O'Brien, R. V. & Khosla, C. Nonproteinogenic amino acid building blocks for nonribosomal peptide and hybrid polyketide scaffolds. Angew. Chem. Int. Ed. 52, 7098-7124 (2013). [0191] 69. Ostrov, N. et al. Design, synthesis, and testing toward a 57-codon genome. Science 353, 819-822 (2016). [0192] 70. Fredens, J. et al. Total synthesis of Escherichia coli with a recoded genome. Nature 569, 514-518 (2019). [0193] 71. Gibson, D. G. et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat. Methods 6, 343-345 (2009). [0194] 72. Chung, C. T., Niemela, S. L. & Miller, R. H. One-step preparation of competent Escherichia coli: transformation and storage of bacterial cells in the same solution. Proc. Natl. Acad. Sci. 86, 2172-2175 (1989). [0195] 73. Bradford, M. M. A Rapid and Sensitive Method for the Quantitation of Microgram Quantities of Protein Utilizing the Principle of Protein-Dye Binding. 7. [0196] 74. Baklanov, M. Effect on DNA transcription of nucleotide sequences upstream to T7 promoter. Nucleic Acids Res. 24, 3659-3660 (1996). [0197] 75. Kao, C., Zheng, M. & Rdisser, S. A simple and efficient method to reduce nontemplated nucleotide addition at the 3 terminus of RNAs transcribed by T7 RNA polymerase. RNA 5, 1268-1272 (1999). [0198] 76. Noncanonical Amino Acids: Methods and Protocols. vol. 1728 (Springer New York, 2018). [0199] 77. RNA Molecular Weight Calculator|AAT Bioquest. https://www.aatbio.com/tools/calculate-RNA-molecular-weight-mw/. [0200] 78. Sprinzl, M. & Cramer, F. The -C-C-A End of tRNA and Its Role in Protein Biosynthesis. in Progress in Nucleic Acid Research and Molecular Biology vol. 22 1-69 (Elsevier, 1979). [0201] 79. Kabsch, W. XDS. Acta Crystallogr. D Biol. Crystallogr. 66, 125-132 (2010). [0202] 80. Evans, P. R. An introduction to data reduction: space-group determination, scaling and intensity statistics. Acta Crystallogr. D Biol. Crystallogr. 67, 282-292 (2011). [0203] 81. Evans, P. R. & Murshudov, G. N. How good are my data and what is the resolution? Acta Crystallogr. D Biol. Crystallogr. 69, 1204-1214 (2013). [0204] 82. Bunkczi, G. et al. Phaser.MRage: automated molecular replacement. Acta Crystallogr. D Biol. Crystallogr. 69, 2276-2286 (2013). [0205] 83. Emsley, P., Lohkamp, B., Scott, W. G. & Cowtan, K. Features and development of Coot. Acta Crystallogr. D Biol. Crystallogr. 66, 486-501 (2010). [0206] 84. Adams, P. D. et al. PHENIX: a comprehensive Python-based system for macromolecular structure solution. Acta Crystallogr. D Biol. Crystallogr. 66, 213-221 (2010). [0207] 85. Liebschner, D. et al. Macromolecular structure determination using X-rays, neutrons and electrons: recent developments in Phenix. Acta Crystallogr. Sect. Struct. Biol. 75, 861-877 (2019). [0208] 86. Schrdinger, LLC. The PyMOL Molecular Graphics System, Version 1.8. (2015). [0209] 87. Grasso, K. T. et al. A Facile Platform to Engineer Escherichia coli Tyrosyl-tRNA Synthetase Adds New Chemistries to the Eukaryotic Genetic Code, Including a Phosphotyrosine Mimic. ACS Cent. Sci. 8, 483-492 (2022). [0210] 88. Gibson, D. G. et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat. Methods 6, 343-345 (2009). [0211] 89. Zhang, Z. Large-Scale Identification and Quantification of Covalent Modifications in Therapeutic Proteins. Anal. Chem. 81, 8354-8364 (2009). [0212] 90. Zhang, Z. Retention Time Alignment of LC/MS Data by a Divide-and-Conquer Algorithm. J. Am. Soc. Mass Spectrom. 23, 764-772 (2012). [0213] 91. Herold, S., Bafaluy, D. & Muiz, K. Anodic benzylic C(sp3)-H amination: unified access to pyrrolidines and piperidines. Green Chem. 20, 3191-3196 (2018). [0214] 92. Matveeva, E. D. et al. Syntheses of Compounds Active toward Glutamate Receptors: II. Synthesis of Spiro Hydantoins of the Indan Series. Russ. J. Org. Chem. 38, 1769-1774 (2002). [0215] 93. Madeira, F. et al. The EMBL-EBI search and sequence analysis tools APIs in 2019. Nucleic Acids Res. 47, W636-W641 (2019).
Supplementary Data Information
Materials
[0216] Materials were sourced from the following suppliers: Agilent Technologies (Santa Clara, CA): BL21-Gold (DE3) Competent Cells; Alfa Aesar (Ward Hill, MA): N()-Boc-L-lysine (L-BocK), N()-Boc-D-lysine (D-BocK), 3-Methylbenzyl bromide, 3-(Trifluoromethyl)benzyl bromide, 3-Bromobenzyl bromide, L-lysine monohydrochloride; AmericanBio (Canton, MA): carbenicillin, glycerol, isopropyl -D-1-thiogalactopyranoside (IPTG), HEPES, magnesium chloride (1 M solution), sodium acetate buffer (3 M, pH 5.2), EDTA-Na (0.5 M solution, pH 8.0); BACHEM (Torrance, CA): N-methyl-L-phenylalanine, N-formyl-L-phenylalanine; BioRad (Hercules, CA): Any kD Mini-PROTEAN TGX Precast Protein Gels (product 4569033), 10% Mini-PROTEAN TBE-Urea Gel (product 4566036), Micro Bio-Spin P-30 Gel Columns, Tris Buffer RNase-free (product 7326250), Precision Plus Protein Dual Color Standards (product 1610374); BioWorld (Dublin, OH): Luria-Bertani broth (LB), Terrific broth (TB); Cayman Chemical (Ann Arbor, MI): -mercapto-benzenepropanoic acid; Cytiva Life Sciences (Marlborough, MA): Superdex 75 Increase 10/300 GL column, HiLoad 16/600 Superdex 200 pg column; Decon Labs (King of Prussia, PA): 200 proof ethanol; Echelon Biosciences (Salt Lake City, UT): malachite green solution; Fisher Scientific (Pittsburgh, PA): Agar, sodium hydroxide, potassium hydroxide, sodium chloride, potassium chloride, calcium chloride, dithiothreitol (DTT), 50% polyethylene glycol 3350 solution, acetonitrile Optima LC/MS Grade, Tris base, ethylenediaminetetraacetic acid (free acid); Frontier Scientific (Logan, UT): L-phenylalanine, L-aspartic acid, L-valine, L-tyrosine; Honeywell (Charlotte, NC): 1,1,1,3,3,3-Hexafluoro-2-propanol, LC-MS Grade (HFIP); Integrated DNA Technologies (Coralville, IA): RF31, RF32, RF33, Ma-PylT-F, Ma-PylT-R; Invitrogen (Waltham, MA): SYBR Safe DNA Gel Stain; J. T. BakerAvantor (Radnor, PA): sodium phosphate, chloroform, boric acid, hydrochloric acid, dimethylsulfoxide (DMSO); MilliporeSigma (Burlington, MA): -mercaptoethanol (BME), imidazole, cesium chloride, adenosine 5-(,-imido)triphosphate lithium salt hydrate (AMP-PNP), ribonuclease A from bovine pancrease (RNAse A), acidic phenol (Phenol Saturated Citrate Buffered pH 4.5), ethanol, spermidine, guanosine monophosphate (GMP), bovine serum albumin (BSA), polyethylene glycol 8000, 6-(Boc-amino)hexanoic acid (BocAhx), (S)-()-3-phenyllactic acid (3-PLA), 2-benzylmalonic acid (2-BMA), 4-(Boc-amino)butyl bromide, diethyl malonate, tetrahydrofuran anhydrous, sodium hydride 60% dispersion in mineral oil, sodium sulfate anhydrous, diethylether, Thrombin CleanCleave Kit, 10 kDa MWCO Amicon Ultra-15 Centrifugal Filter Unit, Anti-FLAG M2 Magnetic Beads, basic phenol (Phenol solution equilibrated with 10 mM Tris HCl, pH 8.0, 1 mM EDTA); MP Biomedicals (Irvine, CA): D-phenylalanine, glycine hydrochloride; New England BioLabs (Ipswich, MA): NdeI restriction enzyme, OneTaq Quick-Load 2 Master Mix, nucleotide triphosphate solutions, Low Range ssRNA Ladder, PURExpress (aa, tRNA) Kit, Q5 High-Fidelity 2 Master Mix; PepTech (Bedford, MA): 3-Trifluoromethyl-L-phenylalanine; Promega (Madison, WI): RQ1 RNase-Free DNase Qiagen (Germantown, MD): Ni-NTA Agarose resin; Ricca Chemical Company (Arlington, TX): formic acid LCMS grade, triethylamine (TEA) LCMS grade; Roche (Basel, Switzerland): cOmplete Mini EDTA-free Protease Inhibitor Cocktail; Takara Bio (San Jose, CA): TALON Metal Affinity Resin; Teledyne ISCO (Lincoln, NE): 65 g RediSep Disposable Sample Load Cartridge; Tokyo Chemical Industry (Portland, OR): 3-phenylpropanoic acid (3-PLA).
Synthesis Notes
[0217] Synthesis of meta-substituted 2-benzylmalonates 17-19 and malonate 16.
[0218] General. Alkylation reactions to synthesize 20-23 as well as hydrolysis reactions to synthesize 16-19 were based on published methods.sup.91,92. All reagents and solvents were used as received from commercial suppliers, unless indicated otherwise. Alkylation reactions were carried out with exclusion of air and moisture. Room temperature is considered 20-23 C. Stirring was achieved with Teflon-coated magnetic stir bars. TLC was performed on glass-backed silica gel plates (median pore size 60 ) and visualized using UV light at 254 nm or staining with iodine. Column chromatography was performed on an Isco Teledyne Combiflash Nextgen 300+ instrument using pre-packed Redi-sep Gold silica gel cartridges (particle diameter 20-40 M, pore diameter 60 ). The eluents are given in brackets. Mass spectrometry was performed on an LTQ FT-ICR mass spectrometer equipped with an electrospray ionization source (Finnigan LTQ FT, Thermo Fisher Scientific, Waltham, MA) operated in either positive or negative ion mode. .sup.1H NMR spectra NMR data were acquired at 298 K using a 500 MHz Bruker Avance Neo NMR spectrometer that was equipped with a 5 mm iProbe or a 400 MHz Bruker Avance I spectrometer equipped with a 5 mm BBO Smart Probe. The experiments were conducted using the default Bruker NMR parameters and data was time-averaged until a sufficient level of sensitivity was achieved. .sup.1H NMR data was calibrated by using the residual peak of the solvent as the internal standard (CDCl.sub.3: .sub.H=7.26 ppm; CD.sub.3OD: .sub.H=3.31 ppm). All coupling constants are recorded in Hz. NMR spectra were processed with MestReNova v14.1.2-25024 software using the baseline and phasing correction features. Multiplicities and coupling constants were calculated using the multiplet analysis feature with manual intervention as necessary.
[0219] Diethyl 2-(3-methylbenzyl)malonate (20) Diethyl malonate (500.57 mg, 3.125 mmol, 1.05 equiv.) was added dropwise to a suspension of 60% NaH on mineral oil (125 mg, 3.125 mmol, 1.05 equiv.) in 6 mL dry THF at 0 C. After 20 min, 3-methylbenzyl bromide (550.86 mg, 2.97 mmol, 1 equiv.) was added in one portion and the reaction mixture was refluxed overnight. The next day, the reaction was cooled and quenched by the addition of H.sub.2O. Et.sub.2O was added and the aqueous layer was extracted three times with Et.sub.2O. The combined organic layers were dried over Na.sub.2SO.sub.4 then evaporated to dryness under reduced pressure. The crude product was purified by flash chromatography on SiO.sub.2 [eluent: EtOAc/hexane (5% then 10% then 15% then 20%)] to obtain pure diethyl 2-(3-methylbenzyl)malonate 20 as a clear liquid. Yield 20.6%. .sup.1H NMR (500 MHz, CDCl.sub.3) 7.19 (t, J=7.8 Hz, 1H), 7.07-7.00 (m, 3H), 4.19 (qd, J=7.1, 2.8 Hz, 4H), 3.65 (t, J=7.8 Hz, 1H), 3.20 (d, J=7.8 Hz, 2H), 2.34 (s, 3H), 1.24 (t, J=7.1 Hz, 6H). HR-EI-MS [M+H]+: calculated for C15H21O4+, m/z 265.1434, found m/z 265.1395.
##STR00001## ##STR00002##
[0220] 2-(3-methylbenzyl)malonic acid (17) Diethyl 2-(3-methylbenzyl)malonate 20 (100 mg, 0.362 mmol) was dissolved in 1 mL of ethanol then added dropwise to 375 L of 6.67 M NaOH. The mixture was stirred for 5 h at 60 C. The solution was then cooled to 0 C., carefully acidified to pH 1 with 1 N HCl, and extracted with 5 portions of Et.sub.2O. The combined extracts were washed with a saturated aqueous solution of NaCl, dried over Na.sub.2SO.sub.4 and evaporated to dryness. 2-(3-methylbenzyl)malonic acid was dissolved in 1:1 H.sub.2O:MeCN and lyophilized to give a white solid. Yield >99%. .sup.1H NMR (500 MHz, MeOD) 7.04 (t, J=7.6 Hz, 1H), 6.95 (s, 1H), 6.94-6.88 (m, 2H), 3.49 (t, J=7.8 Hz, 1H), 3.01 (d, J=7.7 Hz, 2H), 2.20 (s, 3H). HR-ESI-MS [MH]: calculated for C11H11O4, m/z 207.0663, found m/z 207.0661.
[0221] Diethyl 2-(3-(trifluoromethyl)benzyl)malonate (21) Diethyl malonate (500.57 mg, 3.125 mmol, 1.05 equiv.) was added dropwise to a suspension of 60% NaH on mineral oil (125 mg, 3.125 mmol, 1.05 equiv.) in 6 mL dry THF at 0 C. After 20 min, 3-(trifluoromethyl)benzyl bromide (711.377 mg, 2.97 mmol, 1 equiv.) was added in one portion and the reaction mixture was refluxed overnight. The next day, the reaction was cooled and quenched by the addition of H.sub.2O. Et.sub.2O was added and the aqueous layer was extracted three times with Et.sub.2O. The combined organic layers were then dried over Na.sub.2SO.sub.4 then evaporated to dryness under reduced pressure. The crude product was purified by flash chromatography on SiO.sub.2 [eluent: EtOAc/hexane (5% then 10% then 15% then 20%)] to obtain pure diethyl 2-(3-(trifluoromethyl)benzyl)malonate as a clear liquid. Yield 22.1%. .sup.1H NMR (400 MHz, CDCl3) 7.56-7.49 (m, 2H), 7.45 (p, J=2.1 Hz, 2H), 4.21 (qd, J=7.2, 1.7 Hz, 4H), 3.68 (t, J=7.8 Hz, 1H), 3.31 (d, J=7.9 Hz, 2H), 1.25 (t, J=7.1 Hz, 6H). HR-EI-MS [M+H]+: calculated for C15H18F3O4+, m/z 319.1152, found m/z 319.1112.
[0222] 2-(3-(trifluoromethyl)benzyl)malonic acid (18) Diethyl 2-(3-(trifluoromethyl)benzyl)malonate (100 mg, 0.314 mmol) was dissolved in 1 mL of ethanol then added dropwise to 375 L of 6.67 M NaOH. The mixture was stirred for 5 h at 60 C. The solution was then cooled to 0 C., carefully acidified to pH 1 with 1 N HCl, and extracted with 5 portions of Et.sub.2O. The combined extracts were washed with a saturated solution of NaCl, dried over Na.sub.2SO.sub.4, and evaporated to dryness. 2-(3-(trifluoromethyl)benzyl)malonic acid was dissolved in 1:1 H.sub.2O:MeCN and lyophilized to give a white solid. Yield >99%. .sup.1H NMR (500 MHz, MeOD) 7.60-7.46 (m, 4H), 3.69 (t, J=7.8 Hz, 1H), 3.26 (d, J=7.7 Hz, 2H). HR-ESI-MS [MH]: calculated for C11H8F3O4, m/z 261.0380, found m/z 261.0377.
[0223] Diethyl 2-(3-bromobenzyl)malonate (22) Diethyl malonate (500.57 mg, 3.125 mmol, 1.05 equiv.) was added dropwise to a suspension of 60% NaH on mineral oil (125 mg, 3.125 mmol, 1.05 equiv.) in 6 mL dry THF at 0 C. After 20 min, 3-bromobenzyl bromide (743.91 mg, 2.97 mmol, 1 equiv.) was added in one portion and the reaction mixture was refluxed overnight. The next day, the reaction was cooled and quenched by the addition of H.sub.2O. Et.sub.2O was added and the aqueous layer was extracted three times with Et.sub.2O. The combined organic layers were then dried over Na.sub.2SO.sub.4 then evaporated to dryness under reduced pressure. The crude product was purified by flash chromatography on SiO.sub.2 [eluent: EtOAc/hexane (5% then 10% then 15% then 20%)] to obtain pure diethyl 2-(3-(trifluoromethyl)benzyl)malonate as a clear liquid. Yield 22.1%. .sup.1H NMR (400 MHz, CDCl3) 7.39-7.32 (m, 2H), 7.19-7.10 (m, 2H), 4.17 (qd, J=7.1, 1.3 Hz, 4H), 3.61 (t, J=7.8 Hz, 1H), 3.18 (d, J=7.9 Hz, 2H), 1.22 (t, J=7.1 Hz, 6H). HR-EI-MS [M+H]+: calculated for C14H18BrO4, m/z 329.0383, found m/z 329.0343.
[0224] 2-(3-bromobenzyl)malonic acid (19) Diethyl 2-(3-bromobenzyl)malonate 22 (100 mg, 0.305 mmol) was dissolved in 1 mL of ethanol then added dropwise to 375 L of 6.67 M NaOH. The mixture was stirred for 5 h at 60 C. The solution was then cooled to 0 C., carefully acidified to pH 1 with 1 N HCl, and extracted with 5 portions of Et.sub.2O. The combined extracts were washed with a saturated solution of NaCl, dried over Na.sub.2SO.sub.4, and evaporated to dryness. 2-(3-bromobenzyl)malonic acid was dissolved in 1:1 H.sub.2O:MeCN and lyophilized to give a white solid. Yield >99%. .sup.1H NMR (500 MHz, MeOD) 7.33 (t, J=1.9 Hz, 1H), 7.26 (dt, J=7.7, 1.7 Hz, 1H), 7.16-7.06 (m, 2H), 3.52 (t, J=7.8 Hz, 1H), 3.04 (d, J=7.8 Hz, 2H). HR-ESI-MS [MH]: calculated for C10H8BrO4, m/z 270.9611, found m/z 270.9609.
##STR00003##
[0225] Diethyl 2-(4-((tert-butoxycarbonyl)amino)butyl)malonate (23) Diethyl malonate (166.86 mg, 1.04 mmol, 1.05 equiv.) was added dropwise to a suspension of 60% NaH on mineral oil (41.67 mg, 1.04 mmol, 1.05 equiv.) in 6 mL dry THF at 0 C. After 20 min, 4-(Boc-amino)butyl bromide (250.17 mg, 0.99 mmol, 1 equiv.) was added in one portion and the reaction mixture was refluxed overnight. The next day, the reaction was cooled and quenched by the addition of H.sub.2O. Et.sub.2O was added and the aqueous layer was extracted three times with Et.sub.2O. The combined organic layers were then dried over Na.sub.2SO.sub.4 then evaporated to dryness under reduced pressure. The crude product was purified by flash chromatography on SiO.sub.2 [eluent: EtOAc/hexane (5% then 10% then 15% then 20%)] to obtain pure diethyl 2-(4-((tert-butoxycarbonyl)amino)butyl)malonate as a clear liquid. Yield 22.1%. .sup.1H NMR (500 MHz, CDCl3) 4.44 (s, 1H), 4.13 (qd, J=7.1, 2.0 Hz, 4H), 3.24 (t, J=7.5 Hz, 1H), 3.04 (q, J=6.7 Hz, 2H), 1.87-1.79 (m, 2H), 1.44 (p, J=7.3 Hz, 2H), 1.37 (s, 9H), 1.28 (tt, J=10.5, 6.3 Hz, 2H), 1.20 (t, J=7.1 Hz, 6H).
[0226] 2-(4-((tert-butoxycarbonyl)amino)butyl)malonic acid (16) Diethyl 2-(4-((tert-butoxycarbonyl)amino)butyl)malonate (72 mg, 0.22 mmol) was dissolved in 1 mL of ethanol then added dropwise to 375 L of 6.67 M NaOH. The mixture was stirred for 5 h at 60 C. The solution was then cooled to 0 C., carefully acidified to pH 1 with 1 N HCl, and extracted with 5 portions of Et.sub.2O. The combined extracts were washed with a saturated solution of NaCl, dried over Na.sub.2SO.sub.4, and evaporated to dryness. 2-(4-((tert-butoxycarbonyl)amino)butyl)malonic acid was dissolved in 1:1 H.sub.2O:MeCN and lyophilized to give a clear serum. Yield >99%. .sup.1H NMR (500 MHz, CDCl3) 6.29 (s, 1H), 4.57 (s, 1H), 3.35 (t, J=7.0 Hz, 1H), 3.03 (t, J=6.7 Hz, 2H), 1.92-1.85 (m, 2H), 1.43 (p, J=6.7 Hz, 2H), 1.36 (s, 11H). HR-ESI-MS [MH]: calculated for C12H20O6N1 m/z 274.1296, found m/z 274.1295.
[0227] (S)-6-(Boc-amino)-2-hydroxyhexanoic Acid (24) was synthesized by following a published method.sup.65.
TABLE-US-00001 EXTENDEDDATATABLE1 Oligonucleotidesusedinthisstudy Name Sequence(5-3) pET32a ATTTTGTTTAACTTTAAGAAGGAGATATAC MaPylRS ATATGGGCAGCAGCCATCATCATCATCATC gBlock ACAGCAGCGGCCTGGTGCCGCGCGGCAGCC ATATGACGGTGAAATACACTGACGCACAGA TCCAGCGCCTTCGCGAATATGGGAATGGCA CGTATGAACAGAAAGTGTTCGAAGATTTGG CTTCGCGCGACGCAGCCTTTAGCAAAGAAA TGAGTGTTGCCTCAACCGACAATGAGAAAA AAATTAAGGGCATGATTGCCAACCCGTCAC GTCATGGACTTACGCAACTTATGAACGACA TTGCCGACGCATTAGTCGCTGAGGGATTTA TCGAGGTCCGCACGCCAATCTTTATCTCAA AAGACGCGCTTGCCCGTATGACGATTACAG AAGACAAGCCCCTGTTCAAGCAAGTATTCT GGATCGACGAGAAGCGTGCCTTACGCCCAA TGTTGGCTCCAAATTTATATTCCGTTATGC GTGATTTGCGTGACCACACCGACGGCCCAG TGAAGATTTTCGAGATGGGGAGCTGTTTTC GCAAGGAAAGTCACAGTGGCATGCATTTGG AGGAGTTCACGATGCTGAACCTTGTGGATA TGGGACCGCGTGGTGATGCGACAGAGGTTT TAAAAAATTACATTAGTGTTGTGATGAAAG CAGCGGGATTGCCCGATTATGATTTAGTCC AGGAAGAGAGTGACGTCTACAAAGAAACTA TCGATGTTGAGATTAACGGGCAAGAAGTAT GTAGCGCTGCTGTCGGACCCCATTATCTGG ATGCTGCCCATGATGTGCATGAACCTTGGT CTGGTGCTGGTTTCGGTTTGGAGCGCTTAT TAACCATTCGTGAGAAATATTCCACAGTAA AGAAAGGGGGGGCAAGTATCTCGTACCTGA ACGGTGCAAAAATTAATTAACATATGCACC ATCACCACCATCATTCTTCTGG (SEQIDNO:13) pET32a ATTTTGTTTAACTTTAAGAAGGAGATATAC MaFRS1 ATATGGGCAGCAGCCATCATCATCATCATC gBlock ACAGCAGCGGCCTGGTGCCGCGCGGCAGCC ATATGACGGTGAAATACACTGACGCACAGA TCCAGCGCCTTCGCGAATATGGGAATGGCA CGTATGAACAGAAAGTGTTCGAAGATTTGG CTTCGCGCGACGCAGCCTTTAGCAAAGAAA TGAGTGTTGCCTCAACCGACAATGAGAAAA AAATTAAGGGCATGATTGCCAACCCGTCAC GTCATGGACTTACGCAACTTATGAACGACA TTGCCGACGCATTAGTCGCTGAGGGATTTA TCGAGGTCCGCACGCCAATCTTTATCTCAA AAGACGCGCTTGCCCGTATGACGATTACAG AAGACAAGCCCCTGTTCAAGCAAGTATTCT GGATCGACGAGAAGCGTGCCTTACGCCCAA TGTTGGCTCCAAATTTATATTCCGTTATGC GTGATTTGCGTGACCACACCGACGGCCCAG TGAAGATTTTCGAGATGGGGAGCTGTTTTC GCAAGGAAAGTCACAGTGGCATGCATTTGG AGGAGTTCACGATGCTGGCGCTTCTGGATA TGGGACCGCGTGGTGATGCGACAGAGGTTT TAAAAAATTACATTAGTGTTGTGATGAAAG CAGCGGGATTGCCCGATTATGATTTAGTCC AGGAAGAGAGTGACGTCTACAAAGAAACTA TCGATGTTGAGATTAACGGGCAAGAAGTAT GTAGCGCTGCTGTCGGACCCCATTATCTGG ATGCTGCCCATGATGTGCATGAACCTTGGT CTGGTGCTGGTTTCGGTTTGGAGCGCTTAT TAACCATTCGTGAGAAATATTCCACAGTAA AGAAAGGGGGGGCAAGTATCTCGTACCTGA ACGGTGCAAAAATTAATTAACATATGCACC ATCACCACCATCATTCTTCTGG (SEQIDNO:14) MaFRSA TGTGAGCGGATAACAATTCCCCTCTAGAAA fusiontag TAATTTTGTTTAACTTTAAGAAGGAGATAT gblock ACAATGGGCAGCAGCCATCATCATCATCAT CACAGCAGCGGCCTGGTGCCGCGCGGCAGC CATATGACGGTGAAATACACTGACGCACAG ATCCAGCGCCTTCGCGAATATGGGAATGGC ACGTA (SEQIDNO:15) pMega CAATTTCACAAAGGAGGTGCGGCCGCATGA MaPylRS CAGTCAAATATACCGACGCCCAGATTCAGC gBlock GTTTGCGCGAGTACGGCAACGGTACGTATG AGCAAAAGGTTTTTGAAGACCTTGCTAGTC GCGACGCGGCGTTCAGCAAGGAAATGAGTG TTGCCTCCACAGATAATGAAAAGAAAATCA AAGGCATGATCGCCAACCCCTCTCGTCACG GCTTGACCCAGCTGATGAACGATATTGCAG ATGCGTTGGTAGCTGAGGGGTTCATTGAGG TGCGTACTCCTATTTTCATTAGTAAGGACG CCCTTGCACGCATGACTATTACGGAGGATA AACCTTTGTTCAAACAGGTCTTCTGGATCG ATGAGAAGCGTGCACTGCGCCCCATGCTGG CACCCAACTTATATAGTGTCATGCGCGATT TACGCGATCACACTGACGGTCCGGTGAAAA TTTTTGAGATGGGCTCATGCTTCCGCAAAG AGTCGCATTCTGGTATGCACCTGGAAGAGT TTACCATGTTAAACCTGGTAGACATGGGGC CACGCGGGGACGCTACGGAGGTCCTGAAGA ACTACATTAGCGTCGTGATGAAAGCAGCCG GGTTACCCGATTACGATCTTGTTCAGGAAG AGAGTGACGTTTACAAAGAAACAATCGATG TTGAAATCAACGGTCAAGAAGTTTGTTCAG CGGCCGTGGGGCCGCATTATTTAGACGCTG CCCACGATGTACATGAGCCGTGGAGTGGTG CAGGCTTCGGTCTTGAGCGCTTGCTGACCA TTCGTGAGAAATATAGCACTGTCAAAAAAG GTGGCGCCTCCATCTCTTATCTTAATGGAG CTAAAATCAACTAAGCGGCCGCGTTTAAAC GGTCTCCAGCTTGGCTGTTTTGGCGGATGA GAGAAGATTTTCAGCCTGATACAGATTAAA TCAGAACGCAGAAGCGGTCTGATAAAACAG AATTTGCCTGGCGGCAGTAGCGCGGTGGTC CCACCTGACCCCATGCCGAACTCAGAAGTG AAACGCCGTAGCGCCGATGGTAGTGTGGGG TCTCCCCATGCGAGAGTAGGGAACTGCCAG GCATCAAATAAAACGAAAGGCTCAGTCGAA AGACTGGGCCTTGTTTGTGAGCTCCCGGTC ATCAATCATCCCCATAATCCTTGTTAGCCT GCAGGTAATTCCGCTTCGCAACATGTGAGC ACCGGTTTATTGACTACCGGAAGCAGTGTG ACCGTGTGCTTCTCAAATGCCTGAGGCCAG TTTGCTCAGGCTCTCCCCGTGGAGGTAATA ATTGACGATATGATCAGTGCACGGCTAACT AAGCGGCCTGCTGACTTTCTCGCCGATCAA AAGGCATTTTGCTATTAAGGGATTGACGAG GGCGTATCTGCGCAGTAAGATAATTGTGAG CGGATAACAATTAGCAGACAAGATGGGTCC CTTATCATGGCAACCATCTGAACGGGGGAC GGTCCGGCGACCAGCGGGTCTCTAAAACCT AGCCAGCGGGGTTCGACGCCCCGGTCTCTC GCCAAATTCGAAAAGCCTGCTCAACGAGCA GGCTTTTTTGCATGCTCGAGCAGCTCAGGG TCGAA (SEQIDNO:16) RF31 GCTGGCGCTTAAGGATATGGGA (SEQIDNO:17) RF32 ATCGTGAACTCCTCCAAATG (SEQIDNO:18) RF33 GCTGGCGCTTGCGGATATGGGA (SEQIDNO:19) RF48 TGGTATGCACCTGGAAGAGTTTA CCATGTTAGCGCTGGCGGACATG GGGCCACGCGGGGA (SEQIDNO:20) RF49 TCCCCGCGTGGCCCCATGTCCGC CAGCGCTAACATGGTAAACTCTT CCAGGTGCATACCA (SEQIDNO:21) RF61 GACATGGGGCCACGC (SEQIDNO:22) RF62 TAACATGGTAAACTCTTCCAGGTG CA(SEQIDNO:23) CS43 AGACAACCATTAGCTGTCGACACA ATC(SEQIDNO:24) CS44 GGTAAAAGGACAGGGCCA (SEQIDNO:25) T7F TAATACGACTCACTATAGGG (SEQIDNO:26) T7R GCTAGTTATTGCTCAGCGG (SEQIDNO:27) Ma-PylT-F CTAATACGACTCACTATAGGGGG ACGGTCCGGCGACCAGCGGGTCT CTAAAACCTAGCCA (SEQIDNO:28) Ma-PylT-R TmGGCGAGAGACCGGGGCGTCGA ACCCCGCTGGCTAGGTTTTAGAG ACCCGCTGGTCGCCG (SEQIDNO:29) Ma-tRNA.sup.Pyl GGGGGACGGUCCGGCGACCAGCG GGUCUCUAAAACCUAGCCAGCGG GGUUCGACGCCCCGGUCUCUCGC CA(SEQIDNO:30) Ma-PylT- CTAATACGACTCACTATAGGGGG ACC-F ACGGTCCGGCGACCAGCGGGTCT ACCAAACCTAGCCA (SEQIDNO:31) Ma-PylT- TmGGCGAGAGACCGGGGCGTCGA ACC-R ACCCCGCTGGCTAGGTTTGGTAG ACCCGCTGGTCGCCG (SEQIDNO:32) Ma- GGGGGACGGTCCGGCGACCAGCG tRNA.sup.Pyl GGTCTACCAAACCTAGCCAGCGG ACC GGTTCGACGCCCCGGTCTCTCGC CA(SEQIDNO:33) MGV-flag-1 GCGAATTAATACGACTCACTATA GGGTTAACTTTAACAAGGAGAAA AACATGGGTGTCGACTACAAGGA CGACGA(SEQIDNO:34) MGV-flag-2 AAACCCCTCCGTTTAGAGAGGGG TTATGCTAGTTACTTGTCGTCGTC GTCCTTGTAGTCGACACCCATGT TTTTC(SEQIDNO:35) *mG represents 2-O-methyl-deoxymethylguanosine
TABLE-US-00002 Extended Data Table 2. Expected exact masses of acyl-adenosine nucleosides extracted in LC-HRMS analysis of acyl-tRNA products digested by RNAse A. Substrate used Exact mass N.sup.-(tert-butoxycarbonyl)-L-lysine (1) 496.25142 (S)-6-((tert-butoxycarbonyl)amino)-2-hydroxyhexanoic acid (2) 497.23544 6-((tert-butoxycarbonyl)amino)hexanoic acid (3) 481.24052 N.sup.-(tert-butoxycarbonyl)-D-lysine (D-BocK, 5) 496.25142 2-(4-((tert-butoxycarbonyl)amino)butyl)malonic acid (16) 525.23035 L-phenylalanine (7) 415.17244 (S)-2-hydroxy-3-phenylpropanoic acid (8) 416.15646 3-phenylpropanoic acid (9) 400.16155 N-methyl-L-phenylalanine (10) 429.18809 D-phenylalanine (11) 415.17244 2-mercapto-3-phenylpropanoic acid (13) 432.13362 2-benzylmalonic acid (14) 444.15137 N-formyl-L-phenylalanine (15) 443.16736 2-(3-methylbenzyl)malonic acid (17) 458.16702 3-(meta-tolyl)propanoic acid (decarboxylation product of 17) 414.17720 2-(3-trifluoromethylbenzyl)malonic acid (18) 512.13876 3-(3-(trifluoromethyl)phenyl)propanoic acid (decarboxylation 468.14893 product of 18) 2-(3-bromobenzyl)malonic acid (19) 522.06189 3-(3-bromophenyl)propanoic acid (decarboxylation product of 19) 478.07206
TABLE-US-00003 Extended Data Table 3. Yields of mono- and diacylated Ma-tRNA.sup.Pyl calculated from intact tRNA analysis as shown in FIGS. S3 to S6 and performed as described in Section IV. The number on top in each box represents the average of 3 technical replicates, while the number on the bottom is the standard deviation. Enzyme MaPylRS MaFRS1 MaFRS2 MaFRSA Substrate mono di mono di mono di mono di 1 53.8 0.0 ND ND ND ND ND ND 0.3 0.0 2 76.8 13.7 ND ND ND ND ND ND 0.3 0.2 3 59.1 2.51 ND ND ND ND ND ND 0.5 0.09 5 0 0 ND ND ND ND ND ND 0 0 7 ND ND 36.2 29.9 47.7 17.7 0.24 0 1.1 0.7 0.3 0.3 0.01 0 8 ND ND 26.4 21.0 36.5 2.78 ND ND 1.0 0.3 0.5 0.23 9 ND ND 0.97 0 1.89 0 ND ND 0.03 0 0.02 0 10 ND ND 1.73 0 0.55 0 ND ND 0.06 0 0.02 0 11 ND ND 0 0 0 0 ND ND 0 0 0 0 13 ND ND 0* 0* 2.08 0 ND ND 0 0 0.06 0 14 ND ND 24.4 0 43.7 0 ND ND 0.8 0 0.5 0 15 ND ND 9.52 40.5 29.3 1.80 ND ND 0.28 0.5 0.3 0.15 16 0.25 0.0 ND ND ND ND ND ND 0.02 0.0 17 ND ND 49.8 3.64 52.0 0 9.48 1.54 0.7 0.35 0.1 0 0.07 0.10 18 ND ND 59.3 9.24 26.1 0 31.4 0 1.0 0.60 0.4 0 0.7 0 19 ND ND 37.4 10.8 32.7 0 22.3 0 0.7 1.4 0.7 0 0.4 0 *No product was observed when 13 was incubated with 2.5 M MaFRS1 and 25 M Ma-tRNA.sup.Pyl. Increasing [MaFRS1] to 12.5 M led to 0.72 0.02% and 9.72 0.31% of mono- and diacylated tRNA, respectively. ND = not determined.
TABLE-US-00004 Extended Data Table 4. Structure refinement statistics. MaFRSA, meta-CF.sub.3-2-BMA, AMP-PNP Wavelength () 1.11583 Resolution range () 45.37-1.803 (1.867-1.803) Space group I 4 Unit cell dimensions () 108.958 108.958 112.26 90 90 90 Total reflections 115764 (9210) Unique reflections 57972 (4659) Multiplicity 2.0 (2.0) Completeness (%) 95.02 (66.69) Mean I/sigma (I) 18.75 (0.43) Wilson B-factor 39.02 R-merge 0.02241 (1.976) R-meas 0.03169 (2.794) R-pim 0.02241 (1.976) CC1/2 1 (0.106) CC* 1 (0.437) Reflections used in refinement 57275 (4008) Reflections used for R-free 2924 (215) R-work 0.1800 (0.4105) R-free 0.2115 (0.4402) CC(work) 0.969 (0.410) CC(free) 0.955 (0.270) Number of non-hydrogen atoms 4931 macromolecules 4367 ligands 111 solvent 453 Protein residues 553 RMS(bonds) () 0.011 RMS(angles) () 1.1 Ramachandran favored (%) 98 Ramachandran allowed (%) 2 Ramachandran outliers (%) 0 Rotamer outliers (%) 0.64 Clashscore 5.2 Average B-factor 47.8 macromolecules 47.42 ligands 55.19 solvent 49.59 *Parentheses indicate values for last resolution shell
TABLE-US-00005 Extended Data Table 5. LC-MS/MS analysis of sfGFP samples generated in DH10B and DH10B aspC tyrB. Sample numbers refer to column values shown in FIG. 6E. All values are in %. Sample i ii iii iv v vi vii viii ix vari- substrate ant WT 1 2 20 21 20 21 20 21 Y 100.00 0.36 0.05 0.28 0.59 0.15 0.95 0.60 1.57 1 0.00 94.56 0.07 0.00 0.00 0.00 0.00 0.00 0.00 2 0.00 4.44 99.82 0.00 0.00 0.00 0.00 0.00 0.00 20 0.00 0.00 0.00 98.73 85.35 97.14 51.54 98.19 52.31 21 0.00 0.00 0.00 0.32 11.23 0.63 38.48 0.65 44.10 A 0.00 0.02 0.00 0.03 0.17 0.14 0.76 0.02 0.00 F 0.00 0.14 0.01 0.34 0.61 0.15 0.20 0.34 0.27 K 0.00 0.32 0.01 0.02 0.13 0.14 0.90 0.01 0.53 Q 0.00 0.08 0.03 0.11 0.81 0.62 3.49 0.07 0.07 W 0.00 0.08 0.00 0.17 1.11 1.02 3.68 0.12 0.48
Extended Data Data 1. Masses Identified in Deconvoluted Mass Spectra and their Identities
[0228] N-1 and N-2 refer to the tRNA missing the final 1 and 2 nucleotides at the 3 end, respectively. -P and -PPP refer to whether the 5 end of the tRNA has a monophosphate or a triphosphate. N+G and N+GG refer to tRNA products with non-templated addition of guanosine residues identified in the mass spectrum. Note that for some enzyme/substrate pairs there is evidence that N+G products are acylated by the synthetase, indicating that the untemplated guanosine addition does not exclude these tRNA species from activity with the synthetase.