Compositions and Methods of Generating Novel amiRNA
20250027088 ยท 2025-01-23
Inventors
- Giuseppe Militello (New York, NY, US)
- Christof Fellmann (Berkeley, CA, US)
- Johannes ZUBER (Vienna, AT)
Cpc classification
C12Y301/03067
CHEMISTRY; METALLURGY
International classification
C12N15/113
CHEMISTRY; METALLURGY
Abstract
Provided herein are Compositions and Methods of Generating Novel amiRNA's. Provided herein are methods for producing or generating one or more amiRNAs; also provided are constructs and compositions useful in the methods. The methods and constructs provided in this disclosure are highly efficient methods for production of a new generation of amiRNAs.
Claims
1. A method of generating amiRNAs and modifying a selected primary miRNA, comprising: Applying a base modifying step to produce a single stranded region of at least 9 nucleotides and a GU dinucleotide in position 13 and 14, respectively from a Drosha cleavage site to form a base modified construct; Applying a basal stem step to produce a double stranded RNA with a CHC motif and a bulge in position +8 from the Drosha cleavage site to form a base stem modified construct; Applying a loop modifying step to substitute the endogenous loop region of the primary miRNA with the loop of a miRE, or another loop with same number of nucleotides and the GUG motif in the same position, to form a loop modified construct; and Operably linking the base modified construct, the basal stem modified construct, and the loop modified construct with the primary miRNA into an amiRNA construct.
2. The method of claim 1, wherein the total length of the modified basal stem is 9 to 13 base pairs with optimal length being 11 base pairs.
3. The method of claim 2, further comprising checking the base modified construct, the basal stem modified construct, and the loop modified construct to form an intended structure.
4. The method of claim 3, further comprising decreasing expression of PTEN mRNA by the amiRNA construct compared to miRE and miR155.
5. The method of claim 4, wherein the loop modified construct is loop region is at least 75% sequence identity to SEQ ID NOs: 3-9.
6. The method of claim 5, wherein the stem modified construct is at least 75% sequence identity to SEQ ID NO: 1.
7. The method of claim 4, wherein the loop region is at least 75% sequence identity to SEQ ID Nos: 10-11.
8. The method of claim 4, further comprising DROSHA and DICER processing of the amiRNA construct and detecting a guide strand at a magnitude of thousands more than the Passenger strand amount.
9. The method of claim 4, further comprising DROSHA processing and the amiRNA construct are processed more efficiently than miRE and miR155.
10. A heterologous or synthetic or artificial single-stranded ribonucleic acid (RNA) sequence comprising (i) a selected primary miRNA and the complement thereof, and (ii) a base region in between the selected primary miRNA and the complement thereof, wherein the nucleotide sequence of the base region is at least 75% sequence identity to SEQ ID NO: 1.
11. A heterologous or synthetic or artificial single-stranded ribonucleic acid (RNA) sequence comprising (i) a selected primary miRNA and a complement thereof, and (ii) a base region and a basal stem in between the selected primary miRNA and a loop region, wherein the nucleotide sequence of the base region, the base stem region, and the loop region is at least 75% sequence identity to SEQ ID NOs: 3-9.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0013] In the accompanying figures, like elements are identified by like reference numerals among the several preferred embodiments of the present invention.
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
DETAILED DESCRIPTION OF THE INVENTION
[0023] The foregoing and other features and advantages of the invention are apparent from the following detailed description of exemplary embodiments, read in conjunction with the accompanying drawings. The detailed description and drawings are merely illustrative of the invention rather than limiting, the scope of the invention being defined by the appended claims and equivalents thereof.
[0024] Embodiments of the invention will now be described with reference to the Figures, wherein like numerals reflect like elements throughout. The terminology used in the description presented herein is not intended to be interpreted in any limited or restrictive way, simply because it is being utilized in conjunction with detailed description of certain specific embodiments of the invention. Furthermore, embodiments of the invention may include several novel features, no single one of which is solely responsible for its desirable attributes or which is essential to practicing the invention described herein.
[0025] The use of the terms a and an and the and similar referents in the context of describing the invention are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. It will be further understood that the terms comprises, comprising, includes, and/or including, when used herein, specify the presence of stated features, integers, steps, operations, elements, and/or components, but do not preclude the presence or addition of one or more other features, integers, steps, operations, elements, components, and/or groups thereof.
[0026] Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. The word about, when accompanying a numerical value, is to be construed as indicating a deviation of up to and inclusive of 10% from the stated numerical value. The use of any and all examples, or exemplary language (e.g. or such as) provided herein, is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed. No language in the specification should be construed as indicating any nonclaimed element as essential to the practice of the invention.
[0027] References to one embodiment, an embodiment, example embodiment, various embodiments, etc., may indicate that the embodiment(s) of the invention so described may include a particular feature, structure, or characteristic, but not every embodiment necessarily includes the particular feature, structure, or characteristic. Further, repeated use of the phrase in one embodiment, or in an exemplary embodiment, do not necessarily refer to the same embodiment, although they may.
[0028] As used herein the term method refers to manners, means, techniques and procedures for accomplishing a given task including, but not limited to, those manners, means, techniques and procedures either known to, or readily developed from known manners, means, techniques and procedures by practitioners of the chemical, pharmacological, biological, biochemical and medical arts. Unless otherwise expressly stated, it is in no way intended that any method or aspect set forth herein be construed as requiring that its steps be performed in a specific order. Accordingly, where a method claim does not specifically state in the claims or descriptions that the steps are to be limited to a specific order, it is no way intended that an order be inferred, in any respect. This holds for any possible non-express basis for interpretation, including matters of logic with respect to arrangement of steps or operational flow, plain meaning derived from grammatical organization or punctuation, or the number or type of aspects described in the specification.
Definitions
[0029] As used herein, nucleic acid means a polynucleotide (or oligonucleotide) and includes single or double-stranded polymer of deoxyribonucleotide or ribonucleotide bases, and unless otherwise limited, encompasses known analogues having the essential nature of natural nucleotides in that they hybridize to single-stranded nucleic acids in a manner similar to naturally occurring nucleotides (e.g., peptide nucleic acids). Nucleic acids may also include fragments and modified nucleotides.
[0030] As used herein, nucleic acid construct or construct refers to an isolated polynucleotide which is introduced into a host cell. This construct may comprise any combination of deoxyribonucleotides, ribonucleotides, and/or modified nucleotides. The construct may be transcribed to form an RNA, wherein the RNA may be capable of forming a double-stranded RNA and/or hairpin structure. This construct may be expressed in the cell, or isolated or synthetically produced. The construct may further comprise a promoter, or other sequences which facilitate manipulation or expression of the construct.
[0031] As used herein, microRNA (also referred to herein interchangeable as miRNA or miR) refers to an oligoribonucleic acid, which regulates the expression of a polynucleotide comprising the target sequence transcript. Typically, microRNAs (miRNAs) are noncoding RNAs of approximately 21 nucleotides (nt) in length that have been identified in diverse organisms, including animals and plants (Lagos-Quintana et al., Science 294:853-858 2001, Lagos-Quintana et al, Curr. Biol. 12:735-739 2002; Lau et al, Science 294:858-862 2001; Lee and Ambros, Science 294:862-864 2001; Llave et al., Plant Cell 14:1 605-1619 2002; Mourelatos et al., Genes. Dev. 16:720-728 2002; Park et al., Curr. Biol. 12:1484-1495 2002; Reinhart et al, Genes. Dev. 16:1616-1626 2002). Primary transcripts of miRNA genes form hairpin structures that are processed by the multidomain RNases DICER and DROSHA (in animals) or DICER-LIKE1 (DCL1; in plants) to yield miRNA duplexes. As used herein pre-microRNA refers to these miRNA duplexes, wherein the foldback includes a distal stem-loop or distal SL region of partially complementary oligonucleotides, mature miRNA refers to the miRNA which is incorporated into RISC complexes after duplex unwinding. In one embodiment, the miRNA is the region comprising R] to Rn, wherein n corresponds to the number of nucleotides in the miRNA. In another embodiment, the miRNA is the region comprising Ri to Rn, wherein n corresponds to the number of nucleotides in the miRNA. In one aspect, n is in the range of about from 15 to about 25 nucleotides, in another aspect, n is about 20 or about 21 nucleotides. The term miRNA is specifically intended to cover naturally occurring polynucleotides, as well as those that are recombinantly or synthetically or artificially produced, or amiRNAs.
[0032] A small interfering RNA or siRNA means RNA of approximately 21-25 nucleotides that is processed from a dsRNA by a DICER enzyme (in animals) or a DCL enzyme (in plants). The initial DICER or DCL products are double-stranded, in which the two strands are typically 21-25 nucleotides in length and contain two unpaired bases at each 3 end. The individual strands within the double stranded siRNA structure are separated, and typically one of the siRNAs then are associated with a multi-subunit complex, the RNAi-induced silencing complex (RISC). A typical function of the siRNA is to guide RISC to the target based on base-pair complementarity. The term siRNA is specifically intended to cover naturally occurring oligonucleotides, as well as those that are recombinantly or synthetically produced.
[0033] The term silencing or silencing molecule as used herein means a specific molecule, which can exert an influence on a cell in a sequence-specific manner to reduce or silence the expression or function of a target, such as a target gene or protein. Examples of silence agents include nucleic acid molecules such as naturally occurring or synthetically generated small interfering RNAs (siRNAs), naturally occurring or synthetically generated microRNAs (miRNAs), naturally occurring or synthetically generated dsRNAs, and antisense sequences (including antisense oligonucleotides, hairpin structures, and antisense expression vectors), as well as constructs that code for any one of such molecules.
[0034] The term RNAi potency or amiRNA potency as used here in refers to the RNAs ability to interfere or inhibit the expression of a target sequence. RNAi potency refers to the ability of a small RNA, or other molecule, to measurably reduce the expression and/or stability of molecules carrying the target sequence. Interfering or inhibiting expression contemplates reduction of the end-product of the gene or sequence, e.g., the expression or function of the encoded protein or a protein, nucleic acid, other biomolecule, or biological function influenced by the target sequence, and thus includes reduction in the amount or longevity of the mRNA transcript or other target sequence. In some embodiments, the small RNA or other molecule guides chromatin modifications which inhibit the expression of a target sequence. It is understood that the phrase is relative, and does not require absolute inhibition (suppression) of the sequence. Thus, in certain embodiments, interfering with or inhibiting expression of a target sequence requires that, following application of the small RNA or other molecule (such as a vector or other construct encoding one or more small RNAs), the target sequence is expressed at least 5% less than prior to application, at least 10% less, at least 15% less, at least 20% less, at least 25% less, or even more reduced. Thus, in some particular embodiments, application of a small RNA or other molecule reduces expression of the target sequence by about 30%, about 40%, about 50%, about 60%, or more. In specific examples, where the small RNA or other molecule is reduces expression of the target sequence by 70%, 80%, 85%, 90%, 95%, or even more.
[0035] As used herein, the phrases target sequence, targeting a gene, and sequence of interest are used interchangeably and encompass DNA, RNA (comprising pre-mRNA and mRNA) transcribed from such DNA, and also cDNA derived from such RNA, and may also refer to a polynucleotide comprising the target sequence. Target sequence is used to mean the nucleic acid sequence that is selected for suppression of expression, and is not limited to polynucleotides encoding polypeptides. Target sequences may include coding regions and non-coding regions such as long non-coding RNAs, promoters, enhancers, terminators, introns and the like. The target sequence may be an endogenous sequence, or may be an introduced heterologous sequence, or transgene. The specific hybridization of an oligomeric compound with its target sequence interferes with the normal function of the nucleic acid. The target sequence comprises a sequence that is substantially or completely complementary between the oligomeric compound and the target sequence. This modulation of function of a target nucleic acid by compounds, which specifically hybridize to it, is generally referred to as antisense.
[0036] As used herein operably linked refers to a functional arrangement of elements. A first nucleic acid sequence is operably linked with a second nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence. In specific embodiments, operably linked nucleic acids as discussed herein are aligned in a linear concatamer capable of being cut into fragments, at least one of which is a small RNA molecule.
[0037] As used herein, the phrase sequence identity or sequence similarity is the similarity between two (or more) nucleic acid sequences, or two (or more) amino acid sequences, is expressed in terms of the similarity between the sequences, otherwise referred to as sequence identity or sequence homology. Sequence identity is frequently measured as the percent of identical nucleotide or amino acid residues at corresponding positions in two or more sequences when the sequences are aligned to maximize sequence matching, i.e., taking into account gaps and insertions.
[0038] One of ordinary skill in the art will appreciate that these sequence identity ranges are provided for guidance only; it is entirely possible that strongly significant similarity could be obtained that fall outside of the ranges provided. Nucleic acid sequences that do not show a high degree of identity can nevertheless encode similar amino acid sequences, due to the degeneracy of the genetic code. It is understood that changes in nucleic acid sequence can be made using this degeneracy to produce multiple nucleic acid molecules that all encode substantially the same protein. Means for making this adjustment are well-known to those of skill in the art. When percentage of sequence identity is used in reference to amino acid sequences it is recognized that residue positions which are not identical often differ by conservative amino acid substitutions, where amino acid residues are substituted for other amino acid residues with similar chemical properties (e.g. charge or hydrophobicity) and therefore do not change the functional properties of the molecule. Where sequences differ in conservative substitutions, the percent sequence identity may be adjusted upwards to correct for the conservative nature of the substitution. Sequences which differ by such conservative substitutions are said to have sequence similarity or similarity. Means for making this adjustment are well-known to those of skill in the art. Typically this involves scoring a conservative substitution as a partial rather than a full mismatch, thereby increasing the percentage sequence identity.
DESCRIPTION OF EMBODIMENTS
[0039] Artificial miRNAs (amiRNAs) are important and promising tools for the development of novel targeted therapeutics. However, just a few amiRNAs are available to the scientific community. Generally speaking, the method of generating amiRNAs comprises optimizing miRNA processing and miRNA potency. In one embodiment, the composition of amiRNAs includes a miRNA potency higher than the gold standard amiRNAs miRE and miR155. A decrease in fluorescence in a miRNA potency assay is directly proportional to potency. The mean value for the potency is represented by a percentage of the target that is reduced compared to a control with no amiRNA and includes: miR155 at about 65.86%, miRE at about 68.12%, Let7a3_Loop at about 70.51%, Let7a1_Loop at about 75.54%, Let7a2_All at about 75.93%, Let7c_All at about 76.10%, miR26b_All at about 76.38%, Let7f2_All at about 76.91%, Let7f1_All at about 77.18%, Let7a3_All at about 78.18%, miR26a1_All at about 78.31%, miR26a2_Base at about 80.28%, and miR26a2_Stem at about 80.50%.
[0040] The amiRNAs can be modified by creating hybrid constructs of the Base region, the Basal Stem region, and the Loop region from different endogenous and modified primary miRNAs. Experimental validation may investigate if the function remains intact or not. Artificial miRNAs (amiRNAs) disclosed herein may be used as RNA Therapeutics, according to one embodiment. Experimental validation includes transgenic animal models that a) exhibited the expected phenotypes predicted by loss of target gene function, b) accumulated high levels of accurately processed amiRNAs, or c) had reduced levels of the corresponding target RNAs.
[0041] In one embodiment, the method of generating amiRNAs comprises modifying specific regions of a primary miRNA to increase the silencing potency and to target a given mRNA of interest. In one embodiment, the method comprises selecting a set of miRNAs with high expression rate according to a miRNAs database including miRbase (https://www.mirbase.org/). The method comprises obtaining the sequence of the corresponding primary miRNAs, and selecting between about 100 to about 200 nucleotides of each primary miRNA according to the conservation tool. In one embodiment, the conservation tool includes the Cons 100 Verts tool in the USCS Genome Browser (http://genomc.ucsc.edu/). Then, the method comprises modifying the selected primary miRNAs in specific regions including a base region, a basal stem region, and a loop region.
[0042] The base modifying step produces a single stranded region of at least 9 nucleotides and a GU dinucleotide in position 13 and 14 respectively from a Drosha cleavage site. Drosha cleavage site is for Drosha ribonuclease III. The base modifying step entails the mutation of nucleotides in a manner to result in an intended structure for the base. The intended structures resulting from the base modifying step are checked using a RNA folding webserver tool In one embodiment, the RNA folding webserver tool is selected from http://rna.tbi.univie.ac.at/cgi-bin/RNA WebSuite/RNAfold.cgi.
[0043] The basal stem step modifying produces a double stranded RNA with a CHC motif and a bulge in position +8 from Drosha cleavage site. In one embodiment, the total length of the modified basal stem is 11 base pairs or between 9 to 13 base pairs, wherein the optimal length being 11 base pairs. The basal stem modifying step entails the mutation of nucleotides in a manner to result in the intended structure of the basal stem. The structures resulting from the basal stem modifying step are checked using the RNA folding webserver tool.
[0044] The loop modifying step entails the substitution of the endogenous loop region of the primary miRNA with the loop of miRE, an amiRNA or another loop with same number of nucleotides and the GUG motif in the same position. The structures resulting from the modifications were checked using the RNA folding webserver tool (http://rna.tbi.univie.ac.at/cgi-bin/RNA WebSuite/RNAfold.cgi).
[0045] The base modified construct, the basal stem modified construct, and the loop modified construct are operably linked into one amiRNA construct with the primary miRNA. The combination of the base modifying step, the basal stem modifying step, and the loop modifying step result in amiRNAs with an enhanced silencing potency.
[0046] The method of generating Artificial miRNAs 200 (amiRNAs) comprises modifying an endogenous primary-miRNAs gene 100, as shown in
[0047] The modifications at the nucleotide level, are based on known structural determinants that generate more powerful tools for RNA-mediated gene silencing.
EXAMPLES
[0048] The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how the compounds, compositions, articles, devices and/or methods claimed herein are made and evaluated, and are intended to be purely exemplary of the invention and are not intended to limit the scope of what the inventors regard as their invention. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.
[0049] Efforts have been made to ensure accuracy with respect to numbers (e.g., amounts, temperature, etc.), but some errors and deviations should be accounted for. Unless indicated otherwise, parts are parts by weight, temperature is in C. or is at ambient temperature, and pressure is at or near atmospheric.
Example 1
[0050] To validate the method of generating novel amiRNAs, silencing experiments were performed comparing the potency of the novel amiRNAs with the known and extensively used amiRNAs miRE and miR155. The experiment is based on the targeting of fluorescent gene with the amiRNAs; the decreasing in fluorescence is directly proportional to the potency of the amiRNA. As shown in
Sequences:
[0051] The sequences are heterologous or synthetic or artificial single-stranded ribonucleic acid (RNA) comprising (i) a selected primary miRNA and the complement thereof, and (ii) a base region in between the selected primary miRNA and the complement thereof, wherein the nucleotide sequence of the base region is at least 75% sequence identity to SEQ ID NO: 1.
[0052] The heterologous or synthetic or artificial single-stranded ribonucleic acid (RNA) sequence may comprise (i) a selected primary miRNA and a complement thereof, and (ii) a base region and a basal stem in between the selected primary miRNA and a loop region, wherein the nucleotide sequence of the base region, the base stem region, and the loop region is at least 75% sequence identity to SEQ ID NOs: 3-9.
[0053] In accordance with another embodiment, the nucleotide sequence identity of the base region, the base stem region, and the loop region is at least 70%, is at least 75%, is at least 80%, is at least 85%, is at least 90%, is at least 95%, is at least 97%, is at least 99% to SEQ ID NOs: 3-9. In accordance with another embodiment of the invention, the nucleotide sequence identity of the loop region is at least 75% sequence identity to SEQ ID Nos: 10-11.
[0054] In accordance with another embodiment, the nucleotide sequence is identical or 100% sequence identity to SEQ ID NOs: 1-11.
[0055] In one embodiment, the sequences of the novel amiRNAs are listed below. The lower-case nucleotides are the modifications implemented to obtain the intended structures. The green labelled sequences are the Guide/Passenger duplex; such region can be changed to target virtually any mRNA or RNA transcript.
TABLE-US-00001 miR26a2_Stem: SEQIDNO:1 CCTGTCGGAGCCAAGGACAGAAAGCTCCCATAGAGGCTGTctCcccaggaattataatg cttatctaCTGTTTCCATCTGTGAGGtagataagcattataattcctagGGcGGCAGCTGATGGTCCGCCG CCGGAAACAGAGATGGCTCC miR26a2_Base: SEQIDNO:2 CCTGTCGGAGCCAAGGACAGAAAGCTCCCAaAGtGGCTGTGGCcccaggaattataatg cttatctaCTGTTTCCATCTGTGAGGtagataagcattataattcctagGGAGGCAGCTcAaGGTCCGCCG CCGGAAACAGAGATGGCTCC miR26a1_All: SEQIDNO:3 AGGGAATGAAGCCACAGGAGCCAAGAGCAGGAGGACCAAGGCCCTGGCGAt GGCCGTctCCTcaggaattataatgcttatctatagtgaagccacagatgtatagataagcattataattcctaGGGcgGCGGc CCaGaAaGCCGGCATCCGGGCTCAGGACCCCCCTCTCTGCCAGAGG Let7a3_All: SEQIDNO:4 TCTGGAAGCCACGGAGTCCCATCGGCACCAAGACCGtgTGCCCcTcGGcaggaattat aatgcttatctatagtgaagccacagatgtatagataagcattataattcctaCTGcgGgGcacTAATAaCTGCGGTGGAC AGAGCGTCTGGAACCCTGGCTGGGAGCGGGCAGG Let7f1_All: SEQIDNO:5 TCGAAAGAGATTGTACTTTCCATTCCAGAAGAcAACcTgGCTCTcTCcGcaggaatta taatgcttatctatagtgaagccacagatgtatagataagcattataattcctaTGgcGAGagccCTTGCTGCATTATTTTC TTTTTATTTAGATG Let7f2_All: SEQIDNO:6 GATAGTTCCGAGTAGCTGGCCCACATAGGCTGAAGATaGcCcCTtGTGCTactcG GcaggaattataatgcttatctatagtgaagccacagatgtatagataagcattataattcctaCcgcGTGGTACtCTTCTTCTC CGACTGGCTCTGTTCAGGTTCTT miR26b_All: SEQIDNO:7 CCGTGCTGTGCTCCCTCGCCCCACCCTGcCCGGctCCCcaggaattataatgcttatctatagtga agccacagatgtatagataagcattataattcctagGGcGcCgGgcCCCccCtGCCTTGGGGTGAGGGGGCTGC CCCTGGATTCCTGC Let7c_All: SEQIDNO:8 TGCCATATTTGGAGGAGCTGACTGAAGATATGATAAGGAGTTTGAAGCAACA TTGGAAaaTtgGTGgActCGGcaggaattataatgcttatctatagtgaagccacagatgtatagataagcattataattcctaTT GcgtCcacCTTcAagCGTCGAGGAATTCTTCATCACTTTAACCTGATTGAGCCAAT Let7a2_All: SEQIDNO:9 ATAAGACTAACTTGTAATTTCCCTGCTTAAGAAATGGTAGTTTTCCAGCCATT GaGACTtgATGCTCtCAGcaggaattataatgcttatctatagtgaagccacagatgtatagataagcattataattcctaTTGc GagcatCcCTAAACAACATGGTGAGAACGATCATGATTCCTCCAGGCCTTTTCTCC Let7a1_Loop: SEQIDNO:10 ACCATTCACCCTGGATGTTCTCTTCACTGTGGcaggaattataatgcttatctatagtgaagccaca gatgtatagataagcattataattcctaCTAACGTGATAGAAAAGTCTGCATCCAGGCGGTC Let7a3_Loop: SEQIDNO:11 TCTGGAAGCCACGGAGTCCCATCGGCACCAAGACCGACTGCCCTTTGGcaggaat tataatgcttatctatagtgaagccacagatgtatagataagcattataattcctaCTGAAGTGGCTGTAATATCTGCGG TGGACAGAGCGTCTGGAACCCTGGCTGGGAGCGGGCAGG
Example 2: Novel Artificial amiRNA Supplemental Experimental Validation GM
[0056] In order to further confirm the efficiency of the novel amiRNAs in a system that resembles more a therapeutical setting, the scaffolds were delivered using rAAV vectors in Human Induced Pluripotent Stem Cells (hIPSC)-derived NGN2 Neurons in vitro. A schematic of the viral vectors is shown in
[0057] The amiRNAs were loaded with a Guide/Passenger duplex targeting the gene PTEN, but as mentioned before, virtually any gene could be targeted.
[0058] Following rAAV infection, RNA and proteins from NGN2 neurons were collected to assess: Knockdown levels of PTEN at the protein level; Knockdown levels of PTEN at the RNA level; amiRNA processing rate through quantification of residual GFP transcript; amiRNA processing precision through small-RNA sequencing; Guide/Passenger ratio through small-RNA sequencing.
[0059]
Knockdown Levels of PTEN at the RNA Level
[0060] Quantitative Polymerase Chain Reaction (qPCR) shows how the expression of all the novel amiRNAs causes a similar or stronger knockdown of PTEN mRNA compared to miRE and miR155. The results are shown in Table 1 below and
TABLE-US-00002 TABLE 1 mRNA Construct n1 n2 n3 Average ST. DEV. PTEN miR155 0.3588212 0.8859063 0.20832285 0.4843501 0.3558061 PTEN miRE 0.5696833 0.7137689 0.49780797 0.5937534 0.1099741 PTEN Let7a1Loop 0.3554444 0.3788072 0.44323799 0.3924965 0.0454695 PTEN Let7a2All 0.4970672 0.7636191 0.33305910 0.5312485 0.2173056 PTEN Let7a3All 0.3015426 0.2899735 0.18795147 0.2598225 0.0625103 PTEN Let7a3Loop 0.3868847 0.3855019 0.32351912 0.3653019 0.0361915 PTEN Let7cAll 0.3382417 0.3588942 0.52827321 0.4084697 0.1042654 PTEN Let7f1All 0.3103382 0.3027810 0.41917458 0.3440979 0.0651279 PTEN Let7f2All 0.3616355 0.6188231 0.31349537 0.4313180 0.1641584 PTEN miR26a1All 0.3262570 0.6415056 0.09331101 0.3536912 0.2751250 PTEN miR26a1Bas 0.3336085 0.3019544 0.17008942 0.2685508 0.0867264 PTEN miR26a2Bas 0.2631133 0.2432865 0.09335516 0.1999183 0.0928173 PTEN miR26a2Ste 0.3598046 0.6709461 0.13055743 0.3871027 0.2712266 PTEN miR26bAll 0.6727930 0.2528890 0.19377922 0.3731537 0.2611728 PTEN Let7f2WT 0.9624846 1.4845724 0.78453175 1.0771962 0.3638451 PTEN no amiRNA 1 1 1 1 0 PTEN Mock 1.2040792 1.4804738 1.07503209 1.2531950 0.2071352
[0061] As shown in
amiRNA Processing Rate Through Quantification of Residual GFP Transcript
[0062] The amiRNAs are transcribed downstream of the GFP gene creating a GFPmRNA-amiRNA hybrid transcript. Following DROSHA processing, the amiRNA gets processed in the canonical miRNA biogenesis pathway (export into cytoplasm, DICER processing, loading of the guide strand into RISC complex and target silencing). Oppositely, the GFP portion of the transcript gets quickly degraded by cellular nucleases, as shown in
[0063] Therefore, quantification of the residual GFP transcript is an indicator of how efficiently a given amiRNA is processed by DROSHA. High DROSHA processing ensures high downstream levels of mature miRNA which eventually result in higher knockdown efficiency.
TABLE-US-00003 TABLE 2 mRNA Construct n1 n2 n3 Average ST. DEV. GFP miR155 0.7127257 0.6762464 0.62683733 0.6719365 0.0431061 GFP miRE 0.2855355 0.3119356 0.30245356 0.2999749 0.0133734 GFP Let7a1Loop 0.2063730 0.2605471 0.19203894 0.2196530 0.0361332 GFP Let7a2All 0.3612918 0.4041511 0.28178316 0.3490753 0.0620919 GFP Let7a3All 0.4822237 0.5156252 0.48856145 0.4954701 0.0177401 GFP Let7a3Loop 0.5827107 0.5976963 0.46632488 0.5489106 0.0719127 GFP Let7cAll 0.6009550 0.6044708 0.51556223 0.5736627 0.0503471 GFP Let7f1All 0.5269576 0.4880688 0.40747600 0.4741675 0.0609418 GFP Let7f2All 0.7039111 0.5645864 0.60598900 0.6248288 0.0715475 GFP miR26a1All 0.2354095 0.3187273 0.26144772 0.2718615 0.0426239 GFP miR26a1Base 0.2110199 0.2456738 0.21815576 0.2249498 0.0182987 GFP miR26a2Base 0.1459361 0.1679164 0.14448259 0.1527784 0.0131301 GFP miR26a2Stem 0.1586252 0.1652927 0.15732646 0.1604148 0.0042740 GFP miR26bAll 0.3597016 0.451126 0.38257302 0.3978002 0.0475763 GFP Let7f2WT 1.0556041 0.9366958 0.90445501 0.9655849 0.0796081 GFP no amiRNA 1 1 1 1 0 GFP Mock 0.0003547 5.979E05 4.62663 0.0001535 0.0001743
amiRNA Processing Precision Through Small-RNA Sequencing
[0064] An important feature of a powerful amiRNA is the precision of the processing by DROSHA and DICER. Indeed, unprecise processing may result in variable 5 ends of the guide and passenger strands with resulting off targeting and/or loading of the passenger strand into RISC. Small-RNA seq were employed to study this important aspect of amiRNAs processing and as shown in the figures contained in Processing Precision file, all the novel amiRNAs are precisely processed with >95% of the guide strands starting on the correct 5 nucleotide. Importantly, the negative control Letf2WT shows a dramatic decreasing of mature guides starting on the correct 5 nucleotide, pointing out the difference from the highly efficient scaffolds.
Guide/Passenger Ratio Through Small-RNA Sequencing
[0065] Following DROSHA and DICER processing, only the Guide strand should be loaded on RISC complex; the Passenger strand instead gets quickly degraded. In the case of amiRNAs, it is important to make sure that high amount of Guide strand is detectable in contrast to Passenger strand that should be detectable in far less copies. This aspect was assessed through small-RNA seq and while the Guide strand is detected at a magnitude of thousands to tens of thousands more abundant that the Passenger amount, which is several folds lower with amount topping at a few thousands reads only, as shown in the normalized data in Table 3 and
TABLE-US-00004 TABLE 3 Pten1523 Pten1523 Pten1523 Pten1523 guide passenger Guide Passenger Total 10 kb/total 10 kb/total scaffold replicate 10 kb 10 kb Sequences reads*1e6 reads*1e6 Let7a1Loop 1 283833 392 21214891 13378.95 18.48 Let7a1Loop 2 651429 383 54625402 Let7a1Loop 11925.39 7.01 Let7a2All 1 132129 393 20007167 6604.08 19.64 Let7a2All 2 76222 34 19618653 Let7a2All 3885.18 1.73 Let7a3All 1 335429 990 22841630 14684.99 43.34 Let7a3All 2 860834 551 72130408 Let7a3All 11934.41 7.64 Let7a3Loop 1 173257 250 20263497 8550.2 12.34 Let7a3Loop 2 294278 199 45484804 Let7a3Loop 6469.81 4.38 Let7cAll 1 285671 368 19939250 14327.07 18.46 Let7cAll 2 392677 284 58874966 Let7cAll 6669.68 4.82 Let7f1All 1 249889 543 20048575 12464.18 27.08 Let7f1All 2 468766 427 50402296 Let7f1All 9300.49 8.47 Let7f2All 1 318904 880 19896728 16027.96 44.23 Let7f2All 2 171109 146 19759004 Let7f2All 8659.8 7.39 Let7f2WT 1 2321 19 19971469 116.22 0.95 Let7f2WT 2 8473 105 53080657 Let7f2WT 159.63 1.98 miR26a1All 1 1120453 958 85715466 13071.77 11.18 miR26a1All 2 1178757 592 65805213 miR26a1All 17912.82 9 miR26a1Base 1 382401 2009 31061405 12311.13 64.68 miR26a1Base 2 990399 4655 54286572 miR26a1Base 18243.9 85.75 miR26a2Base 1 1381215 6716 105481002 13094.44 63.67 miR26a2Base 2 629819 2785 24415887 miR26a2Base 25795.46 114.07 miR26a2Stem 1 922231 4517 40626154 22700.43 111.18 miR26a2Stem 2 2203021 9151 67875045 miR26a2Stem 32457.01 134.82 miR26bAll 1 2489831 946 165376283 15055.55 5.72 miR26bAll 2 301817 176 20178795 miR26bAll 14957.14 8.72 miR155 1 816575 1313 82885883 9851.8 15.84 miR155 2 407397 1055 48993754 miR155 8315.28 21.53 miRE 1 56860 46 21493302 2645.48 2.14 miRE 2 48425 31 22359316 miRE 2165.76 1.39
[0066] All publications and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference.
[0067] While the invention has been described in connection with various embodiments, it will be understood that the invention is capable of further modifications. This application is intended to cover any variations, uses or adaptations of the invention following, in general, the principles of the invention, and including such departures from the present disclosure as, within the known and customary practice within the art to which the invention pertains.