Whole avian-origin reverse genetic system and its use in producing H7N9 subtype avian influenza vaccine
11607448 · 2023-03-21
Assignee
Inventors
- Wenbao Qi (Guangdong, CN)
- Ming Liao (Guangdong, CN)
- Yiqun Chen (Guangdong, CN)
- Huanan Li (Guangdong, CN)
- Bo Li (Guangdong, CN)
- Jiahao Zhang (Guangdong, CN)
- Ziwen Qiu (Guangdong, CN)
Cpc classification
C12N7/00
CHEMISTRY; METALLURGY
C12N2760/16134
CHEMISTRY; METALLURGY
C12N2760/16122
CHEMISTRY; METALLURGY
C12N2760/16151
CHEMISTRY; METALLURGY
A61K2039/545
HUMAN NECESSITIES
International classification
Abstract
The present disclosure discloses a whole avian-origin reverse genetic manipulation system and its use in producing a recombinant H7N9 avian influenza vaccine. The whole avian-origin reverse genetic manipulation system is an eight-plasmid reverse genetic manipulation system based on H5N2 subtype avian influenza D7 virus strain, which is comprised of 8 recombinant plasmids respectively containing PB2, PB1, PA, HA, NP, NA, M and NS gene fragments derived from H5N2 subtype avian influenza D7 virus strain. The genome of the recombinant H7N9 subtype avian influenza vaccine of the present disclosure is comprised of an NA gene and a modified HA gene derived from a highly pathogenic H7N9 subtype avian influenza virus strain, as well as PB2, PB1, PA, NP, M and NS genes derived from H5N2 subtype avian influenza D7 virus strain.
Claims
1. A recombinant H7N9 subtype avian influenza virus, wherein the genome of the recombinant virus is comprised of an NA gene and a modified HA gene derived from a highly pathogenic H7N9 subtype avian influenza virus strain, as well as PB2, PB1, PA, NP, M and NS genes derived from H5N2 subtype avian influenza D7 virus strain; the modified HA gene has a sequence set forth in SEQ ID NO: 9, and the NA gene has a sequence set forth in SEQ ID NO: 10; the PB2, PB1, PA, NP, M and NS genes derived from D7 strain have nucleotide sequences set forth in SEQ ID NOs: 1-3, 5 and 7-8, respectively; the highly pathogenic H7N9 subtype avian influenza virus strain is A/Chicken/Liaoning/19155/2019; and the recombinant virus has a deposit accession number of CCTCC NO: V202219.
2. A method for producing the recombinant virus according to claim 1, comprising recombining an NA gene and a modified HA gene derived from a highly pathogenic H7N9 subtype avian influenza virus strain with PB2, PB1, PA, NP, M and NS genes derived from H5N2 subtype avian influenza D7 virus strain to obtain the recombinant virus.
3. The method according to claim 2 comprising: constructing 6 plasmids expressing a protein encoded by PB2, PB1, PA, NP, M and NS genes derived from D7 virus strain, respectively, constructing 2 plasmids respectively expressing a modified HA protein encoded by SEQ ID NO: 9 and an NA protein encoded by SEQ ID NO: 10; and mixing the above 8 plasmids, mixing the mixed plasmids with a transfection reagent, and then adding to 293T cells to obtain the recombinant H7N9 subtype avian influenza virus.
4. The method according to claim 2, wherein the method comprises steps of: S1 constructing an 8-plasmid reverse genetic manipulation system, the 8 plasmids respectively contain PB2, PB1, PA, HA, NP, NA, M and NS genes derived from H5N2 subtype avian influenza D7 virus strain, and the PB2, PB1, PA, HA, NP, NA, M and NS genes have nucleotide sequences set forth in SEQ ID NOs: 1-8, respectively; S2. constructing 2 plasmids respectively containing the modified HA gene with a sequence set forth in SEQ ID NO: 9 and the NA gene with a sequence set forth in SEQ ID NO: 10; and S3. mixing 6 plasmids respectively containing PB2, PB1, PA, NP, M and NS genes in step S1 with the 2 plasmids respectively containing the modified HA gene and the NA gene in step S2, mixing the mixed plasmids with the transfection reagent and adding to 293T cells, and culturing the cells to obtain the recombinant H7N9 subtype avian influenza virus.
5. The method according to claim 4, wherein a vector used for constructing the plasmid in step S1 is a pSMC vector, and the obtained 8 plasmids are pSMC-PB2, pSMC-PB1, pSMC-PA, pSMC-HA, pSMC-NP, pSMC-NA, pSMC-M and pSMC-NS, respectively.
6. The method according to claim 5, wherein the pSMC vector is constructed by: removing BsmBI restriction enzyme site in pCI vector to obtain pCI-NEW vector; synthesizing a nucleotide fragment containing transcriptional promoter sequence and transcriptional terminator sequence; performing double enzyme digestion on the pCI-NEW vector and the synthesized fragment with XhoI and MluI, followed by ligation and transformation to obtain a recombinant plasmid; and performing enzyme digestion identification and sequencing identification on the obtained recombinant plasmid to obtain a positive plasmid as the pSMC vector.
7. A method for preventing H7N9 subtype avian influenza, comprising administering to a subject in need thereof the recombinant H7N9 subtype avian influenza virus according to claim 1.
Description
BRIEF DESCRIPTION OF DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
DETAILED DESCRIPTION
(8) The present disclosure is further described below in conjunction with the accompanying drawings and specific examples. However, the examples do not limit the present disclosure in any form. Unless otherwise specified, the reagents, methods and equipment used in the present disclosure are conventional reagents, methods and equipment in the technical field.
(9) Unless otherwise specified, the reagents and materials used in the following examples are commercially available.
(10) Polynucleotides encoding viral proteins can be synthesized artificially according to the sequences disclosed in the present invention, and commonly used promoters, transcription terminators, resistance genes, etc. can be synthesized according to the prior art.
(11) The avian influenza virus strain A/Duck/Guangdong/D7/2007 (H5N2), referred to as the D7 strain or D7 virus strain, is isolated and preserved by the National and Regional Joint Engineering Laboratory for Medicament of Zoonoses Prevention and Control.
(12) The highly pathogenic avian influenza virus strain A/Chicken/Liaoning/19155/2019 (H7N9), abbreviated as LN155 strain or LN155 virus strain, is isolated and preserved by the National and Regional Joint Engineering Laboratory for Medicament of Zoonoses Prevention and Control.
(13) The construction flow chart and uses of the avian influenza vaccine candidate H71903 of the present disclosure are shown in
(14) Deposit information: The recombinant H7N9 subtype avian influenza virus rLN155 was deposited under a deposit accession number of CCTCC NO: V202219 in the China Center for Type Culture Collection (Address: No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province, China) on Mar. 8, 2022.
Example 1 Construction of a Whole Avian-Origin Reverse Genetic Manipulation System Based on D7 Strain for Avian Influenza Vaccine
(15) 1. Construction of the Reverse Genetic System Vector pSMC (
(16) (1) Engineering of pCI Vector
(17) The pCI vector was a product of Promega (Cat. No. BR180). In order to remove the BsmBI restriction enzyme site in the pCI vector plasmid, the pCI vector was digested with the restriction endonuclease EarI to obtain a long fragment A and a short fragment B. The amplification primers pCI-EarI-1 and pCI-EarI-2 were designed according to the sequence of short fragment B.
(18) TABLE-US-00001 pCI-EarI-1: (SEQ ID NO: 11) 5′-TAGCGAGAGGCCGCACG-3′; pCI-EarI-2: (SEQ ID NO: 12) 5′-TCTTCGTTCGGTCACAGCTTCTGTAAG-3′.
(19) Amplification was carried out using short fragment B as a template to obtain fragment C, which was recovered. Fragment C and fragment A were digested and recovered with EarI respectively, and then ligated. After transformation, bacteria picking and plasmid extraction, enzyme digestion with BsmBI and identification by sequencing was performed, and the plasmid verified to be correct was named as pCI-NEW vector.
(20) (2) Acquisition of Transcription Elements
(21) DNA fragments containing transcription elements (pol I promoter and common transcription terminator) were obtained by gene synthesis. The sequence of the terminator is
(22) TABLE-US-00002 (SEQ ID NO: 13) CCAGGGTACTGGTCCTGACCACGTTGGAGGGGG GA.
(23) (3) Enzyme Digestion of pCI-NEW Vector and DNA Fragments Containing Transcription Elements
(24) The pCI-NEW vector and the DNA fragment synthesized in step (2) were subjected to double digestion with XhoI and MluI.
(25) (4) Ligation and Transformation of Digestion Products from pCI-NEW Vector and DNA Fragments Containing Transcription Elements
(26) The pCI-NEW vector and DNA fragments in step (3) were recovered, and subjected to ligation, transformation, bacteria picking, plasmid extraction, and enzyme digestion identification.
(27) (5) Enzyme Digestion Identification
(28) The plasmids extracted in step (4) were identified by single digestion with BsmBI and double digestion with XhoI and MluI, respectively.
(29) (6) Sequencing Identification
(30) The plasmids identified as positive by enzyme digestion in step (5) were sequenced, and the plasmid whose sequence was verified to be correct was named pSMC vector.
(31) 2. Construction of D7 System
(32) Eight gene fragments of D7 strain (PB2, PB1, PA, HA, NP, NA, M and NS genes) were amplified by PCR with reference to universal primers of 8 gene sequences of influenza virus (Universal primer set for the full-length amplification of all influenza A viruses. Arch Virol. 2001 December; 146(12):2275-89). The 8 gene fragments derived from the D7 virus strain obtained by amplification were inserted into the reverse genetic vector pSMC according to the conventional molecular biology experiment method, and the obtained 8 plasmids were named pSMC-PB2, pSMC-PB1, pSMC-PA, pSMC-HA, pSMC-NP, pSMC-NA, pSMC-M and pSMC-NS. A D7 reverse genetic system vaccine development platform was established to provide the required genes for vaccine strains. After 8 plasmids were co-transfected into 293T cells, the H5N2 avian influenza virus with hemagglutination activity could be successfully assembled, and could be stably passaged on chick embryos. After sequencing identification, it was proved that the reverse genetic system was successfully constructed.
Example 2 Construction of Recombinant H7N9 Subtype Avian Influenza Virus
(33) 1. Extraction and Reverse Transcription of Viral RNA
(34) Total RNA from virus-containing allantoic fluid was extracted using a total RNA extraction kit. cDNA was obtained by reverse transcription according to the instructions of M-MLV reverse transcriptase.
(35) 2. Design of Primers
(36) The full-length primers of HA and NA fragments for amplification were designed based on the HA and NA gene sequences of LN155 strain. Overlap primers for modifying the cleavage site of the HA gene were designed based on the HA sequence. The specific sequence is as follows, and the recognition sequence of the restriction endonuclease BsmBI is underlined.
(37) TABLE-US-00003 LN155-HA1-F: (SEQ ID NO: 14) 5′-TGAGGTTCCAAAGGGAAGAGGCCTATTTGGTGCTATAGC-3′ LN155-HA2-R: (SEQ ID NO: 15) 5′-AAATAGGCCTCTTCCCTTTGGAACCTCAGGAACATTCTTC-3′ Bm-HA-1F: (SEQ ID NO: 16) 5′-TATTCGTCTCAGGGAGCAAAAGCAGGGG-3′ Bm-NS-890R: (SEQ ID NO: 17) 5′-ATATCGTCTCGTATTAGTAGAAACAAGGGTGTTTT-3′ Bm-NA-1F: (SEQ ID NO: 18) 5′-TATTCGTCTCAGGGAGCAAAAGCAGGAGT-3′ Bm-NA-1413R: (SEQ ID NO: 19) 5′-ATATCGTCTCGTATTAGTAGAAACAAGGAGTTTTTT-3′
(38) 3. Modification of HA Fragments and Amplification and Purification of HA and NA Fragments
(39) Fragmented PCR amplification and fusion PCR amplification were performed on the HA fragment of LN155 strain using high-fidelity DNA polymerase and fragmented primers, and the full-length sequence of NA gene was amplified.
(40) The upstream and downstream universal primers with BsmBI restriction sites were paired with segmented primers, respectively, and two fragments, HA1 and HA2, were amplified. Finally, fusion PCR was performed to amplify the complete modified HA fragment. NA fragment was amplified. After PCR amplification, the amplified products were preliminarily detected by 1% agarose gel electrophoresis (the amplification results are shown in
(41) 4. Construction, Screening and Purification of Target Plasmids
(42) The amplified target fragments rHA, rNA and pSMC expression vector were digested with restriction endonuclease BsmBI, respectively (55° C. water bath for 3 h).
(43) The digested products were recovered, ligated and transformed into DH5α competent cells, which were cultured at 37° C. overnight, and the positive clones were initially screened by PCR (bacteria suspension as template). The specific operation is as follows: a single colony was picked out and transferred into an EP tube containing 500 μL of LB medium (ampicillin-resistant), which was then placed on a shaker at 37° C. and cultured with shaking for 3-4 h. 2 μL of bacterial suspension was used for PCR amplification, and 10 μL of PCR product was subjected to electrophoresis detection. The PCR-positive clones were identified by sequencing. The clones with correct sequencing were further expanded and cultured, and the plasmids were extracted. The concentration and purity of the plasmids were determined, and stored at −40° C. for future use.
(44) 5. Rescue and Identification of Recombinant Virus rLN155
(45) Cell preparation. One day before transfection, 293T cells were digested with trypsin and counted. Cells of appropriate concentration were added to a 12-well cell culture plate, which was then placed in a 37° C. incubator containing 5% CO.sub.2. The cells were used for subsequent experiments when the cell density reached about 90%.
(46) Transfection. Eight plasmids (300 ng/plasmid) required for transfection were added into EP tubes containing 150 μL serum-free medium Opti-MEM, mixed well, and named as solution A; 4.8 μL Lipofectamine 2000 (Invitrogen) was added to another EP tube containing 150 μL of Opti-MEM, named solution B, mixed well, and allowed to stand at room temperature for 5 min. Solution A was added to solution B, mixed gently and allowed to stand for 20 min. The 12-well culture plate with 293T cells was taken out, and the original medium was discarded. The plate was then washed twice with sterilized PBS, the mixture of plasmid and liposome was added, and the plate was placed in a 37° C. incubator with 5% CO.sub.2 for 4-6 h of culture. Then the DMEM medium containing BSA (concentration of 0.2%) was used to replace the medium containing Lipofectamine 2000 to continue the culture. After 48 h, the supernatant and cells were collected, mixed well and inoculated to 9˜11-day-old SPF embryos. After 60 h of inoculation, the allantoic fluid was tested for hemagglutination activity. The presence of hemagglutination activity indicated that it contained influenza virus. Allantoic fluid with hemagglutination activity was harvested and sequenced to identify the virus sequence. The virus was continuously passaged for five generations, and after collection, it was aliquoted and stored at −80° C. for future use.
(47) Identification of the recombinant virus. The RNA of the successfully rescued virus was extracted and subjected to whole genome sequencing by RT-PCR. After verification, the obtained recombinant virus was named rLN155.
Example 3 Preparation of vaccine H71903 with recombinant virus rLN155
(48) Example 3 Preparation of vaccine H71903 with recombinant virus rLN155
(49) 1. Preparation of Vaccine
(50) Large-scale preparation of antigens. The rLN155 virus used for vaccine preparation was diluted to about 10.sup.−4 TCID.sub.50/mL using sterile DMEM cell culture medium, and the diluted virus was inoculated to allantoic cavity of 9˜11-day-old SPF chick embryos at 0.2 mL/embryo under sterile conditions, sealed and placed in a 37° C. incubator. After 60 h of incubation, chick embryo allantoic fluid was collected in a biological safety cabin, and the hemagglutination (HA) titer was determined.
(51) Antigen inactivation: The virus solution collected above was inactivated with a final concentration of 0.1% formaldehyde, sealed, placed in a shaker, and incubated at 37° C. for 24 h; then the inactivated virus was inoculated to 9˜11-day-old SPF chick embryos at 0.2 mL/embryo.
(52) After culture at 37° C. for 48 h, the hemagglutination titer was tested to verify whether the virus had been completely inactivated.
(53) Preparation of inactivated oil emulsion vaccine H71903. Preparation of water phase: 97 parts of the solution containing the inactivated rLN155 virus and 3 parts of Tween-80 were mixed well. Preparation of oil phase: 94 parts of Marcol-52 white mineral oil and 6 parts of Span-80 were mixed well and sterilized by autoclaving for future use. The oil phase and the water phase in a ratio of 2:1 were emulsified using an emulsifier at 25,000 r/min for 5 min. During the mixing, a few drops of the prepared inactivated vaccine can be placed on the surface of cold water. In the case that only the first drop diffused and the others did not, the formulation is judged to be water-in-oil. The prepared vaccine was then put into a centrifuge to centrifuge at 3,000 r/min for 15 min, and the presence of stratification was observed. If absent, the preparation was successful. The vaccine, named H71903, was aliquoted and stored at 4° C.
(54) 2. Serum Hemagglutination Inhibition Test (HI test) for Cross-Reactivity
(55) SPF chickens were immunized with H71903 vaccine and commercial inactivated vaccine rGD76 for H7 subtype avian influenza, respectively. After 21 days, serum was collected, and was subjected to serum HI test with 12 virus strains from 2016 to 2019 for cross-reactivity (see Table 1). The results show that compared with rGD76, H71903 vaccine had higher overall HI titer and better responsiveness to circulating virus strains.
(56) TABLE-US-00004 TABLE 1 HI (log2) cross-test results Serum Antigen (virus isolation time) H71903 rGD76 LN155 (2019) 9 7 GD76 (2016) 9 9 16044(2016) 8 8 17178 (2017) 7 6 17213 (2017) 7 6 SX1801 (2018) 8 7 HeB1908 (2019) 8 5 LN19010 (2019) 9 7 HeB1907 (2019) 9 6 LN (2019) 10 7 19201(2019) 9 6 19254 (2019) 9 6
(57) 3. Immune Challenge Protection Test of H71903 Vaccine Strain in SPF Chicken
(58) In order to verify the immune effect of H71903 vaccine strain, in this experiment, SD1115, LN155, HeB1908 and LN virus strains (SD1115 is H7N2 subtype strain, and the other three are H7N9 subtype virus strains) were diluted to 100 LD.sub.50 as A/B/C/D treatment groups; and control groups (5 control chickens) were set up, named SD1115-control, LN155-control, HeB1908-control and LN-control. The chickens immunized with H71903 vaccine were challenged with SD1115, LN155, HeB1908 and LN virus by intranasal inoculation, 0.2 mL/chicken. After challenge, the chickens were observed in isolators for 14 consecutive days. On Day 5 after infection, the throat and cloacal swabs of chickens were collected, determined for the hemagglutination titer and analyzed for virus content.
(59) (1) HI Antibody Titer of Serum from Immunized Chicken
(60) On Day 21 of immunization, the blood of all the chickens in the treatment group and the control group in the isolator was collected and the serum was separated. The LN155 virus was used as the antigen to carry out the HI test. The HI antibody titers of the test chickens in each group are shown in Table 2. The results show that the HI neutralization titers of the four treatment groups A, B, C and D were all at high levels, and the geometric mean titer (GMT) of antibodies were 7.5, 7.5, 7.0 and 7.5, respectively.
(61) TABLE-US-00005 TABLE 2 HI antibody titers of test chicken in each group (log2) Test Chicken No. Group 1 2 3 4 5 6 7 8 9 10 GMT Group A 8 8 8 7 7 8 8 7 6 8 7.5 Group B 8 8 7 7 8 7 7 8 8 7 7.5 Group C 6 7 6 8 8 6 7 8 8 8 7.0 Group D 8 8 7 8 7 8 7 7 7 8 7.5 Control group 0 0 0 0 0
(62) (2) Survival Rate of SPF Chickens After Infection
(63) The immunized chickens and the control chickens were challenged with virus at an amount of 100 LD.sub.50, and the state of the chickens was observed and recorded for 14 consecutive days. All four groups of test chickens survived, while unimmunized control chickens developed depression and loss of appetite on Day 2 or Day 3, and died around Day 5. This result indicates that chickens were protected after immunization with recombinant inactivated vaccine H71903 (
(64) (3) Virus Detection of Throat/Anal Swabs of SPF Chickens After Infection
(65) On Day 5 after challenge, the throat swabs and cloacal swabs of chickens in all treatment groups and control groups were collected and tested for virus content. As can be seen from Table 3, the four groups of immunized chickens had no virus detected after 5 days of challenge, indicating that the vaccine can protect the chickens from the lethal challenge of the highly pathogenic H7 subtype avian influenza virus. In contrast, all chickens in the control group died on Day 3 to Day 6, and the virus could also be detected in the swabs of live chickens collected on Day 5.
(66) TABLE-US-00006 TABLE 3 Virus detection of immunized chickens Group Test Chicken No. A Throat/anal 361 362 363 364 365 366 367 368 369 370 swabs Detection − − − − − − − − − − result B Throat/anal 1 2 3 4 5 6 7 8 9 10 swabs Detection − − − − − − − − − − result C Throat/anal 411 412 413 414 415 416 417 418 419 420 swabs Detection − − − − − − − − − − result D Throat/anal 221 222 223 224 225 226 227 228 229 230 swabs Detection − − − − − − − − − − result Note: “+” means positive virus isolation, “−” means negative virus isolation.
(67) The test results of the recombinant avian influenza inactivated vaccine strain H71903 show that the vaccine had a good immune effect on SPF chickens aged 21 days that it not only induced high antibody levels in the immunized chickens, but also protected them from challenges of other highly pathogenic H7 subtype avian influenza virus with a protection rate up to 100% (
(68) The above-mentioned embodiments are preferred embodiments of the present disclosure, but the embodiments of the present disclosure are not limited by the above-mentioned embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not depart from the spirit and principle of the present disclosure should be equivalent embodiments and are included within the protection scope of the present disclosure.