Recombinant vector and method for producing recombinant fibroblast growth factor 19 using the same
11608366 · 2023-03-21
Assignee
- Industry Foundation Of Chonnam National University (Gwangju, KR)
- KOREA INSTITUTE OF OCEAN SCIENCE & TECHNOLOGY (Busan, KR)
Inventors
- Geun Joong Kim (Gwangju, KR)
- Hye Ji Choi (Jeollanam-do, KR)
- Dae Eun Cheong (Gwangju, KR)
- Su Kyoung Yoo (Gwangju, KR)
- Dong Hyun Lee (Gwangju, KR)
- Jae Hong Park (Gwangju, KR)
- Jung Hyun Lee (Busan, KR)
- Hyung Soon Yim (Seoul, KR)
- Young Jun An (Gyeonggi-do, KR)
- Kyeong Won Lee (Busan, KR)
Cpc classification
C07K2319/60
CHEMISTRY; METALLURGY
C12Y503/04001
CHEMISTRY; METALLURGY
International classification
C12N15/70
CHEMISTRY; METALLURGY
Abstract
A recombinant vector according to an embodiment of the present invention may produce fibroblast growth factor 19 (FGF19) having enhanced solubility. The synonymous codon substitution variant fibroblast growth factor 19 (scvhFGF19) and chaperone ΔssDsbC may be simultaneously and independently expressed in a host cell into which the recombinant vector is introduced, thereby it is possible to overexpress the fibroblast growth factor 19 in a soluble state.
Claims
1. A recombinant vector for inducing soluble expression of fibroblast growth factor 19 (FGF19), the recombinant vector comprising: a first polynucleotide which encodes the fibroblast growth factor 19 (FGF19); and a second polynucleotide which encodes disulfide bond isomerase (DsbC), wherein the first polynucleotide consists of the sequence of SEQ ID NO: 3; wherein the second polynucleotide does not comprise a signal sequence; wherein the first polynucleotide and the second polynucleotide are operably linked to different promoters, respectively; and wherein the recombinant vector is designed to introduce into Escherichia coli.
2. The recombinant vector according to claim 1, wherein the second polynucleotide encodes a protein consisting of the amino acid sequence of SEQ ID NO: 2.
3. The recombinant vector according to claim 1, wherein the second polynucleotide consists of the sequence of SEQ ID NO: 4.
4. A method for producing recombinant fibroblast growth factor 19 comprising culturing Escherichia coli transformed with the recombinant vector according to claim 1.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1) The above and other objects, features and other advantages of the present invention will be more clearly understood from the following detailed description taken in conjunction with the accompanying drawings, in which:
(2)
(3)
(4)
(5) In A of
(6) In B of
(7) In C of
(8)
(9)
(10) In
(11)
(12) In
(13)
(14)
(15) A of
DETAILED DESCRIPTION
(16) Hereinafter, the present invention will be described in detail.
(17) The present invention provides a recombinant vector for producing fibroblast growth factor 19 (FGF19) having enhanced solubility, wherein the recombinant vector includes a first polynucleotide which encodes the fibroblast growth factor 19 (FGF19), and a second polynucleotide which encodes disulfide bond isomerase (DsbC).
(18) The fibroblast growth factor 19 is not particularly limited in terms of its origin. For example, the fibroblast growth factor 19 may be human fibroblast growth factor 19 consisting of an amino acid sequence of SEQ ID NO: 1.
(19) The fibroblast growth factor 19 is fibroblast growth factor 19 encoded from polynucleotide substituted with a synonymous codon.
(20) The first polynucleotide is not particularly limited so long as it encodes a protein consisting of the amino acid sequence of SEQ ID NO: 1.
(21) In the first polynucleotide, any one or more of first 10 codons except for an initiation codon in a 5′ end coding region in polynucleotide consisting of a sequence of SEQ ID NO: 5 may be the synonymous codon.
(22) The synonymous codon substitution causes only the wobble codon of ten amino acids in the 5′ end coding region except for the initiation codon of FGF19 to be substituted, and may have the same codon as wild type FGF19 or may be substituted with one or more other codons.
(23) For example, the first polynucleotide may have a form in which eight codons are substituted, and specifically, may consist of a sequence of SEQ ID NO: 3, but it is not limited thereto.
(24) The disulfide isomerase (DsbC) may be expressed in the cytoplasm to induce disulfide bond formation of the fibroblast growth factor 19 protein.
(25) The second polynucleotide is not particularly limited so long as it encodes a protein consisting of an amino acid sequence of SEQ ID NO: 2.
(26) The second polynucleotide may not include a signal sequence, for example, may consist of a sequence of SEQ ID NO: 4.
(27) The first polynucleotide may consist of the sequence of SEQ ID NO: 3, and the second polynucleotide may consist of the sequence of SEQ ID NO: 4.
(28) The first polynucleotide and the second polynucleotide are operably linked to a promoter.
(29) As used herein, the term “operably linked” means a state in which a sequence for control of nucleic acid expression and the target protein or a nucleic acid sequence encoding RNA are functionally linked so as to perform a general function. For example, the promoter and the protein or the nucleic acid sequence encoding RNA may be operably linked to affect the expression of the coding sequence. Operable linkage with the expression vector may be made using genetic recombination techniques well known in the art, and site-specific DNA cleavage and linkage may be performed using enzymes and the like generally known in the art.
(30) The first polynucleotide and the second polynucleotide may be operably linked to one promoter or may be operably linked to separate promoters, respectively.
(31) When the first polynucleotide and the second polynucleotide are operably linked to one promoter, a position relative to the promoter is not limited, but it is preferable that the promoter—the second polynucleotide—the first polynucleotide are linked in this order.
(32) When the first polynucleotide and the second polynucleotide are operably linked to separate promoters, respectively, the promoters may be the same as or different from each other.
(33) When the first polynucleotide and the second polynucleotide are operably linked to different promoters, soluble expression of the target protein may be further enhanced.
(34) The promoter may be derived from a target for introducing the recombinant vector of the present invention, and the type thereof is not limited. For example, the promoter may be a T5 promoter or a T7 promoter.
(35) In the host cell into which the recombinant vector of the present invention is introduced, DsbC protein and synonymous codon substitution variant fibroblast growth factor 19 (scvhFGF19) may be independently and simultaneously expressed.
(36) The recombinant vector of the present invention may use a plasmid vector, a cosmid vector, a bacteriophage vector, a viral vector, and the like as a template, but it is not limited thereto. Suitable recombinant vectors may include expression control elements such as a promoter, operator, initiation codon, termination codon, polyadenylation signal, enhancer, and the like, and may be variously prepared according to the purposes.
(37) The recombinant vector may include an antibiotic resistance marker for screening the host into which the vector is introduced, which may be either inherent in the vector or introduced externally.
(38) The present invention provides a method for producing recombinant fibroblast growth factor 19 using the recombinant vector.
(39) The above-described method may be performed by conventional methods known in the art, for example, may be performed by cell-free protein synthesis (CFPS).
(40) Specifically, the recombinant vector may be contained in a composition including a cell extract related to protein synthesis, nucleic acid, amino acid, energy source, buffer solution and the like.
(41) The cell extract may be ribosomes, etc., and may be extracted from E. coli, yeast, plant and animal cells, and may be appropriately selected according to the type of protein to be produced.
(42) The above-described method may include the step of culturing a host cell transformed with the recombinant vector.
(43) The host cell may be used to express the fibroblast growth factor 19 and disulfide bond isomerase by introducing the recombinant vector of the present invention therein.
(44) The host cell is not particularly limited, and may be, for example, strains of genus Escherichia, genus Salmonella, genus Shigella, genus Enterobacter, genus Proteus, genus Pseudomonas, genus Moraxella, genus Helicobacter, genus Stenotrophomonas, genus Bdellovibrio, genus Legionella, genus Neisseria, and Erwinia, etc., and specifically, Escherichia coli.
(45) The transformation may be performed by conventional methods known in the art, and may be introduced, for example, through a natural introduction method, thermal shock method, electric shock method, or the like, but it is not particularly limited thereto.
(46) The host cell may overexpress hFGF19 and express DsbC in the cytoplasm, thereby producing recombinant hFGF19 having enhanced soluble expression.
(47) Conditions for culturing the host cell are not particularly limited. For example, the host cell may be cultured for 1 hour to 72 hours at 18° C. to 40° C.
(48) As the host cell culture medium, a medium known in the art may be used, and for example, a Luria-Bertani (LB) medium may be used, but it is not limited thereto.
(49) When the host cell expresses a recombinant target protein by introducing the recombinant vector, the culture medium may further include an antibiotic for screening transformed microorganisms.
(50) If necessary, the culture medium may further include isopropyl-1-thio-β-D-galactopyranoside (IPTG) for promoting expression of the recombinant target protein.
(51) In the above-described method, the recombinant fibroblast growth factor 19 may be obtained by separating it from the culture of the host cell.
(52) The culture may be a host cell or a culture medium thereof.
(53) The host cell may be disrupted for easier separation of the recombinant fibroblast growth factor 19.
(54) The host cell may be physically disrupted by ultrasonic irradiation, etc., or chemically destroyed by a surfactant, etc., but it is not limited thereto.
(55) The culture medium may be a medium containing the host cell, or a medium from which the host cell is separated.
(56) In addition, the production method of the present invention may further include the step of separating and purifying the recombinant fibroblast growth factor 19. The above step may be performed in connection with a conventional process in the art performed to use the produced protein for an intended use.
(57) For a specific example, the above step may be performed by passing the culture through a column of anion exchange chromatography or heparin-affinity chromatography. When performing the anion exchange chromatography and heparin-affinity chromatography together, the anion exchange chromatography may be performed first.
(58) The recombinant fibroblast growth factor 19 prepared according to the above-described method may have a disulfide bond well formed by DsbC expressed in the cytoplasm, such that soluble expression may be enhanced.
(59) The recombinant fibroblast growth factor 19 may have an enhanced ability to activate a Ras-Raf-Erk1/2 MARK signaling pathway.
(60) The present invention provides a pharmaceutical composition for treatment of diabetes or cancer comprising the recombinant fibroblast growth factor 19.
(61) The pharmaceutical composition of the present invention may further contain one or more pharmaceutically acceptable carriers, excipients or diluents. As used herein, the term “pharmaceutically acceptable” refers to a composition that, when physiologically administering to a human, commonly does not cause an allergic reaction or a reaction similar thereto.
(62) The composition may be delivered by a manner such as oral administration, parenteral administration, topical administration, or modified release, but it is not particularly limited thereto, and any manner may be selected so long as it can effectively deliver the composition of the present invention to a target site for promoting stem cell engraftment.
(63) The composition of the present invention may be delivered by a transdermal absorption manner and specifically, may be delivered to the target site for promoting stem cell engraftment through a transdermal absorption pathway by manners such as attachment of a cataplasma or patch, adhesion of a plaster, attachment of a microneedle patch, injection of transdermal injections, applying an emulsion or dispersant including ointment or cream to the skin, and spraying a spray (including aerosol form), for example, but it is not particularly limited thereto. In this case, the composition of the present invention can be delivered more directly to the target site, such that it is possible to efficiently deliver by preventing denaturation in the delivery process, and may be relatively excellent in a delivery speed comparted to other methods.
(64) In the oral administration, the composition of the present invention may be provided in a solid, semi-solid or liquid dosage form for oral administration. The oral administration also includes buccal and sublingual administrations. Suitable oral dosage forms may include tablets, fast melts (rapid dissolving tablets), chewable tablets, capsules, pills, strips, troches, lozenges, pastilles, cachets, pellets, medicinal chewing gum, bulk powders, effervescent or non-effervescent powders or granules, oral mist, solutions, emulsions, suspensions, wafers, sprinkles, elixirs and syrups, but it is not limited thereto. In addition to the active ingredient(s), the composition of the present invention includes binders, fillers, diluents, disintegrants, wetting agents, lubricants, glidants, coloring agents, dye-transfer inhibitors, sweeteners, fragrances, emulsifiers, suspending agents and dispersants, preservatives, solvents, oleaginous liquids, organic acids and carbon dioxide sources, but it is not limited thereto, and may include one or more excipients.
(65) Suitable dosages of the composition vary by factors such as a formulation method, administration manner, age, body weight, sex of a patient, severity of disease symptoms, administration time, administration route, and response sensitization. Usually, skilled doctors may easily determine and prescribe effective dosages for treatment.
(66) The present invention provides a composition for skin regeneration, revascularization, or antiobesity including the recombinant fibroblast growth factor 19.
(67) The composition of the present invention may be used not only as a pharmaceutical composition as described above, but also in any formulation conventionally produced in the art. For example, the composition may be formulated as a solution, suspension, emulsion, paste, gel, cream, lotion, powder, soap, surfactant-containing cleanser, oil, powder foundation, emulsion foundation, wax foundation, spray, and the like, but it is not limited thereto.
(68) When the formulation of the present invention is the paste, cream or gel, animal oil, vegetable oil, wax, paraffin, starch, tragacanth, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc, zinc oxide, or the like may be used as a carrier component.
(69) When the formulation of the present invention is the powder or spray, lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powders may be used as the carrier component, and particularly, in the case of the spray, the composition may further include propellants such as chloro-fluorohydrocarbon, propane/butane or dimethyl ether.
(70) When the formulation of the present invention is the solution or emulsion, a solvent, solubilizing agent or emulsifying agent may be used as the carrier component, and components such as water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butyl glycol oil, glycerol aliphatic esters, polyethylene glycol or sorbitan fatty acid ester may be used.
(71) When the formulation of the present invention is the suspension, aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, isethionate, imidazolinium derivative, methyl taurate, sarcosinate, fatty acid amide ether sulfate, alkylamido betaine, aliphatic alcohol, fatty acid glyceride, fatty acid diethanolamide, vegetable oil, lanolin derivative, ethoxylated glycerol fatty acid ester, or the like may be used as the carrier component.
(72) The composition may be the pharmaceutical composition, and the pharmaceutical composition is as described above.
(73) The composition may be a cosmetic composition.
(74) The cosmetic composition may be formulated as a skin lotion, toner, beauty soap, body wash, serum, cleansing lotion, essence, nourishing cream, pack, massage cream, or the like, and in addition, may be formulated as a softening beauty wash, converging beauty wash, nourishing beauty wash, eye cream, eye essence, cleansing foam, cleansing water, powder, body lotion, body cream, body oil, body essence, makeup base, foundation, shampoo, rinse or the like, but it is not limited thereto.
(75) When using as the cosmetic composition, substances may be further added thereto according to the formulation of a skin external application or cosmetic. For example, without limitation thereof, when the formulation is a paste, cream or gel, animal oil, vegetable oil, wax, paraffin, starch, tragacanth, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc, zinc oxide or the like may be used. When the formulation is the powder or spray, lactose, talc, silica, aluminum hydroxide, calcium silicate, or polyamide powder may be used as the carrier component, and particularly, in the case of the spray, the composition may further include propellants such as chloro-fluorohydrocarbon, propane/butane or dimethyl ether. In addition, when the formulation is the solution or emulsion, a solvent, solubilizing agent or emulsifying agent may be used as the carrier component, and preferably, the formulation includes water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butyl glycol oil, glycerol aliphatic esters, polyethylene glycol or sorbitan fatty acid ester, but it is not limited thereto. When the formulation is the suspension, liquid diluents such as water, ethanol or propylene glycol, suspending agents such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol esters and polyoxyethylene sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar, tragacanth, or the like may be used as the carrier component. When the formulation is the surfactant-containing cleanser, aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, isethionate, imidazolinium derivative, methyl taurate, sarcosinate, fatty acid amide ether sulfate, alkylamido betaine, aliphatic alcohol, fatty acid glyceride, fatty acid diethanolamide, vegetable oil, lanolin derivative, ethoxylated glycerol fatty acid ester, or the like may be used as the carrier component, but it is not limited thereto.
(76) The composition may be a health functional food.
(77) For example, the composition may be easily utilized as a main raw material or an auxiliary raw material of the food, a food additive, a functional food or beverage.
(78) Foods to which the food composition can be added include, for example, various foods, beverages, gums, teas, vitamin complexes, and functional foods. Further, the foods include special nutritional foods (e.g., milk formulas, infant and baby foods, etc.), processed meat products, fish and meat products, bean curds, jellied foods, noodles (e.g. ramens, instant noodles, etc.), breads, health supplements, seasoned foods (e.g. soy sauce, miso, red pepper paste, mixed sauce, etc.), sauces, confectionery (e.g. snacks), candies, chocolates, gums, ice creams, dairy products (e.g. fermented milk, cheese, etc.), other processed foods, kimchi, pickled foods (various kimchis, pickles, etc.), beverages (e.g., fruit drinks, vegetable drinks, soy milks, fermented drinks, etc.), natural seasonings (e.g., ramen soup, etc.), but it is not limited thereto. The foods, beverages or food additives may be prepared by a conventional production method.
(79) In addition, as used herein the term “functional food” or “health functional food” refers to a food group whose composition has added values so as to act and express the function of the food for a specific purpose by using physical, biochemical, or biotechnical methods, or foods designed and processed so as to sufficiently express body regulation functions in relation to regulation of immune system rhythms in the living body, disease prevention and recovery, etc., and specifically, may be the health functional food. The functional food may include food acceptable food supplement additives, and may further include suitable carriers, excipients, and diluents commonly used in the production of functional foods.
(80) The type of the health supplement is not limited, but may be in a form of powders, granules, tablets, capsules or beverages.
(81) Hereinafter, the present invention will be described in detail with reference to examples.
Example 1: Screening of Human Fibroblast Growth Factor 19 (scvhFGF19) Having Increased Expression from Synonymous Codon Library
(82) In order to improve an expression pattern of wild type hFGF19 in which expression in E. coli is not observed, a synonymous codon library consisting of variants in which ten amino acid codons except for an initiation codon at the amino terminus of hFGF19 are substituted with synonymous codons was prepared. In order to facilitate the screening of variants having the improved expression from the synonymous codon library, as illustrated in
(83) TABLE-US-00001 TABLE 1 Primer name Sequence (5′ .fwdarw. 3′) REase pSCT5_FGF19- ATAACTAGTATGCGCCCCCTCGCCTTC (SEQ ID SpeI mC-fw NO: 13) pSCT5_scvhFGF ATAACTAGTATGCGNCCNCTNGCNTTYTCNGAYGCN SpeI 19-mC-fw GGNCCNCACGTGCACT (SEQ ID NO: 14) pSCT5_FGF19- ATAGGATCCCTTCTCAAAGCTGGGACTCCTCAC BamHI mC-rv (SEQ ID NO: 15) pSCT5_scvhFGF ATAAAGCTTTTACTTCTCAAAGCTGGGACTCCTC HindIII 19-rv (SEQ ID NO: 16) pSCT5_ΔssDsbC- ATAACTAGTATGGATGACGCGGCAATTC (SEQ ID SpeI fw NO: 17) pSCT5_ΔssDsbC- ATAGGATCCTTATTTACCGCTGGTCATTTTTTGGTG BamHI rv (SEQ ID NO: 18) pSCT5_FGF19/Δ ATAGGATCCTAAATGGATGACGCGGCAATTCAAC BamHI ssDsbC-fw (SEQ ID NO: 19) pSCT5_FGF19/Δ ATAAAGCTTTTATTTACCGCTGGTCATTTTTTGGTG HindIII ssDsbC-rv TTC (SEQ ID NO: 20) pSCT5_scvhFGF ATACAATTTCACACAGAATTCATTAAAGAGGAGAAA BamHI 19-fw GGATCCATGCG (SEQ ID NO: 21) pSCT5_scvhFGF ATAAAGCTTTTACTTCTCAAAGCTGGGACTCCTC HindIII 19-rv (SEQ ID NO: 22) pACYCDuet1_Δs AGGAGATATACCATGGATGACGCGGCAATTCAACAA NcoI sDsbC-fw ACG (SEQ ID NO: 23) pACYCDuet1_Δs ATAGGATCCTTATTTACCGCTGGTCATTTTTTGGTG BamHI sDsbC-rv TTC (SEQ ID NO: 24) pACYCDuet1_sc CAATTTCACACAGAATTCATTAAAGAGGAGAAACAT NdeI vhFGF19-fw ATGCG (SEQ ID NO: 25) pACYCDuet1_sc ATACTCGAGTTACTTCTCAAAGCTGGGACTCCTCAC XhoI vhFGF19-rv G (SEQ ID NO: 26) pQE80L V-fw AGTTAATTTCTCCTCTTTAATGAATTCTGTGTG Infusion (SEQ ID NO: 27) pQE80L V-rv CCGCCCTCTAGATTACGTGC (SEQ ID NO: 28) Infusion pQHDuet_InfuΔ GAGGAGAAATTAACTATGGATGACGCGGCAATTC Infusion ssDsbC-fw (SEQ ID NO: 29) pQHDuet_InfuF TAATCTAGAGGGCGGTTTTTAAGGCAGTTATTGGTG Infusion GF19-rv CCC (SEQ ID NO: 30)
(84) The DNA fragment encoding 25 to 216 amino acid residues except for a signal sequence of human fibroblast growth factor 19 was amplified using a primer pair of pSCT5_scvFGF19-mC-fw and pSCT5_FGF19-mC-ry (Table 1) designed so that wobble bases are inserted into third base positions of the first ten amino acid codons except for the initiation codon, and pET24a_FGF19 provided from the Korea Institute of Ocean Science & Technology as a template. The PCR product was cleaved with SpeI and BamHI, cloned into a pSCT_mCherry vector cleaved with the same restriction enzyme, then transformed into E. coli XL1-Blue which is a typical cloning host and Origami 2 transformed so as to have an oxidative cytoplasmic environment, and then spread on a Luria-Bertani (LB) solid medium to which 100 μg/mL of ampicillin antibiotic was added to prepare a synonymous codon substitution library. Subsequently, after culturing at 37° C., colonies were selected in an order in which mCherry fluorescence fused to the carboxyl terminus of scvhFGF19 rapidly appeared to screen scvhFGF19 having increased expression.
(85) In order to compare expression levels of wild type fibroblast growth factor (hFGF19) and the screened synonymous codon substitution variant fibroblast growth factor 19 (scvhFGF19), a single colony was inoculated in 3.5 mL of LB medium (10 g/L of NaCl, 10 g/L of tryptone, 5 g/L of yeast extract), cultured under conditions of 220 rpm and 37° C., and when absorbance (OD.sub.600) of the culture liquid reached 2.0 to 2.5, 100 μl of the culture was reinoculated in 5 mL of a new LB medium having the same composition. By incubating under the same conditions, isopropyl-β-D-thiogalactopyranoside (IPTG) was added as an expression inducer so that the final concentration would be 0.2 mM when the absorbance (OD.sub.600) reached 0.6 to 0.8. After the addition of IPTG, expression of fibroblast growth factor 19 was induced while further incubating for 3 hours at 250 rpm and 30° C.
(86) After the culture was completed, the culture broth was corrected so that the absorbance (OD.sub.600) would be 2.0, and centrifuged for 2 minutes under conditions of 13,200 rpm and 4° C. to obtain cells. After the obtained cells were suspended in 10 mM sodium phosphate buffer solution (pH 7.4), the cells were disrupted by sonicating twice with ultrasonic waves for 2 seconds. Immediately after disrupting the cells through ultrasonication, entire protein fractions were taken, followed by centrifugation for 20 minutes at 13,200 rpm and 4° C. to remove insoluble aggregates, then soluble fractions were obtained.
(87) 5× sample loading buffers (0.225 M Tris-HCl (pH 6.8), 50% glycerol, 5% SDS, 0.005 M bromophenol blue and 0.25 M dithiothreitol (DTT)) were added to the samples taken at each step in a ratio of 5:1, and heated for 15 minutes at 100° C. to induce denaturation of all proteins. Subsequently, as a result of electrophoresis using 12% SDS-PAGE, as illustrated in
(88) Based on these results, for expression of scvhFGF19 from which mCherry fused as a reporter is removed from the variant screened in E. coli Origami 2 host, only scvhFGF19 was amplified from plasmid pSCT5_scvhFGF19-mCherry containing the synonymous codon substitution variants by using primers pSCT5_scvFGF19-fw and pSCT5_scvFGF19-rv as a template, then was cloned into pSCT5 vector cleaved with the same restriction enzyme by cleaving with BamHI and HindIII. After transforming pSCT5-scvhFGF19 expressing only the scvhFGF19 without mCherry fusion into Origami 2, the expression pattern was analyzed by inducing expression of scvhFGF19 in the same method as described above.
(89) According to the analysis results, as can be confirmed in C of
Example 2: Cytoplasmic Expression of Chaperone ΔssDsbC for Soluble Expression of scvhFGF19
(90) As mentioned in Example 1, by knocking out trxB and gor encoding thioredoxin reductase and glutathione reductase, even in Origami 2 in which the disulfide bond by oxidation between two cysteine residues can be more easily formed, the soluble expression of hFGF19 was not simply achieved. As emphasized above, the results of Example 1 mean that it is difficult to correctly form two disulfide bonds of hFGF19 by merely changing the reducing environment for formation of disulfide bond.
(91) Accordingly, the present inventors examined simultaneous expression of scvhFGF19 with the increased expression level in Origami 2 having an oxidative cytoplasm and ΔssDsbC from which a signal sequence is cleaved.
(92) In order to express a disulfide bond isomerase (DsbC) protein together with the fibroblast growth factor 19 in the cytoplasm, the signal sequence was removed, and as plasmids shown first and second from the top in
(93) In addition, ΔssDsbC product amplified using pSCT5_FGF19/ΔssDsbC-fw and pSCT5_FGF19/ΔssDsbC-rv primers was subjected to restriction enzyme treatment with BamHI and HindIII, then inserted into a pSCT5_scvhFGF19 vector cleaved with the same restriction enzyme to produce pSCT5_scvhFGF19/ΔssDsbC vector (plasmid shown second from the top in
(94) In order to confirm the effect of simultaneous expression of ΔssDsbC on the expression pattern of scvhFGF19, the prepared recombinant expression vectors pSCT5_ΔssDsbC/scvFGF19 and pSCT5_scvFGF19/ΔssDsbC were introduced into E. coli host XL1-Blue, then the expression pattern of scvhFGF19 was analyzed using the method of Example 1. As a result, as illustrated in
(95) Between the recombinant expression vectors pSCT5_ΔssDsbC/scvhFGF19 and pSCT5_scvhFGF19/ΔssDsbC, the former vector having a high expression level of scvhFGF19 was introduced into E. coli Origami 2 having a reducing cytoplasmic environment in which the disulfide bond is easily formed to analyze the expression pattern of scvhFGF19. As expected by the present inventors, it could be confirmed that the expression of scvhFGF19 was increased by about 2.5 times or more in Origami 2 as compared to the case of using E. coli XL1-Blue as a host, and more than 90% of the expressed scvhFGF19 was observed in the soluble fraction.
Example 3: Expression Control of ΔssDsbC for Increasing Soluble Expression of Synonymous Codon Substitution Variant Fibroblast Growth Factor 19 (scvhFGF19)
(96) In Example 2, it was confirmed that the simultaneous expression of chaperone ΔssDsbC positively affects the solubility and stability of scvhFGF19. Based on these results, expression vectors having a dual expression system, in which the expressions of two genes are independently controlled by separate promoters, were produced in order to control the expression ratios of the two proteins.
(97) (1) Confirmation of Expression of Synonymous Codon Substitution Variant Fibroblast Growth Factor 19 Using pACYCDuet Vector Controlled by Two Identical Promoters
(98) To produce vectors for independent simultaneous expression of ΔssDsbC and scvhFGF19, PCR was performed using pACYCDuet1_ΔssDsbC-fw and pACYCDuet1_ΔssDsbC-rv primers shown in Table 1 and the prepared pSCT5_ΔssDsbC/scvhFGF19 as a template, and the obtained product was inserted between NcoI and BamHI restriction enzyme recognition sequences present in the first multiple cloning site of pACYCDuet1 vector to produce a pACYCDuet1_ΔssDsbC vector. Then, the product, in which PCR was performed using pACYCDuet1 scvFGF19-fw and pACYCDuet1 scvFGF19-ry primers and pSCT5_ΔssDsbC/scvhFGF19 as a template, was inserted into NdeI and XhoI restriction enzyme recognition sequences within the second multi-cloning site of pACYCDuet1_ΔssDsbC vector to produce recombinant expression vector pACYCDuet1_ΔssDsbC/scvhFGF19 (plasmid shown third from the top in
(99) The constructed recombinant expression vector pACYCDuet1_ΔssDsbC/scvhFGF19 has the recognition sequence for T7 RNA polymerase, and thus transcriptions of each protein are controlled by two identical T7 promoters, and was transformed in E. coli host Origami (DE3) improved so as to have an oxidative environment. A single colony was inoculated in 3.5 mL of LB medium containing 25 μg/mL of chloramphenicol antibiotic, and cultured for 5 to 6 hours at 220 rpm and 37° C. Subsequently, 100 μl of the entire culture liquid was passaged in 5 mL of a fresh LB medium to which chloramphenicol was added, and then, when the absorbance (OD.sub.600) of the culture liquid reached 0.6 to 0.8, IPTG was added so that the final concentration would be 0.2 mM, while culturing at 220 rpm and 37° C. After the addition, expression of human fibroblast growth factor 19 was induced for 3 hours at 250 rpm and 30° C. After the culture was completed, 5 mL of the culture liquid was centrifuged for 2 minutes at 13,200 rpm and 4° C. to obtain cells. After the obtained cells were suspended in 10 mM sodium phosphate buffer solution (pH 7.4), the cells were disrupted by sonicating twice with ultrasonic waves for 2 seconds. Immediately after disrupting the cells through ultrasonication, entire protein fractions were taken, followed by centrifugation for 20 minutes at 13,200 rpm and 4° C. to remove insoluble aggregates, then soluble fractions were obtained.
(100) 5× sample loading buffers (0.225 M Tris-HCl (pH 6.8), 50% glycerol, 5% SDS, 0.005 M bromophenol blue and 0.25 M dithiothreitol (DTT)) were added to the samples taken at each step in a ratio of 4:1, and heated for 15 minutes at 100° C. to induce denaturation of all proteins. Subsequently, electrophoresis and western blotting analysis were performed using 12% SDS-PAGE. As illustrated in
(101) (2) Confirmation of Expression of Synonymous Codon Substitution Variant Fibroblast Growth Factor 19 Using pQHDuet Vector Controlled by Two Different Promoters
(102) In order to solve the low reproducibility of the expression level and expression pattern of the synonymous codon substitution variant fibroblast growth factor 19 cloned into the pACYCDuet1 vector described in the above (1) item, the recombinant expression vector was improved so that two genes could be independently expressed.
(103) To this end, pQE80L was used as a vector scaffold, and after removing a chloramphenicol resistance gene, the vector was designed so that transcription would be controlled by two different types of promoters, respectively. To produce a vector in which ΔssDsbC is expressed from T5 promoter and scvhFGF19 is expressed from T7 promoter, ΔssDsbC-T7 promoter-scvFGF19 region was amplified using pACYCDuet1_ΔssDsbC/scvhFGF19 as a template, and pQHDuet_InfuΔssDsbC-fw and pQHDuet_InfuFGF19-ry (Table 1), then cloned by using an infusion kit to produce recombinant expression vector pQHDuet_ΔssDsbC/scvhFGF19 (plasmid shown at a lower end in
(104) The constructed recombinant expression vector pQHDuet_ΔssDsbC/scvhFGF19 was introduced into E. coli host Origami (DE3), and the expression pattern was confirmed using the method performed in the above examples. As a result, as illustrated in
Example 4: Purification of Synonymous Codon Substitution Variant Fibroblast Growth Factor 19 (scvFGF19)
(105) Absolute purification of fibroblast growth factor 19 protein was performed in two steps by ion exchange chromatography using a Q-Sepharose high performance column (GE Healthcare) and heparin-affinity chromatography using a HiTrap heparin HP column.
(106) The cells cultured in above Example 3-(2) were harvested, followed by centrifugation for 5 minutes at 6000 rpm and 4° C., and then freezing and thawing were repeated twice before ultrasonication for disrupting the obtained cells. Then, after suspension with 50 mL of 20 mM sodium phosphate buffer (pH 7.3) which is a mobile phase for application to anion exchange chromatography, ultrasonication for 2 seconds and stopping for 8 seconds were repeated for 4 minutes and 30 seconds to disrupt the cells. The cell lysate was centrifuged for 1 hour at 10,000 rpm and 4° C. to prepare a supernatant from which insoluble aggregates were removed. The supernatant containing scvhFGF19 was loaded at a flow rate of 1 mL/min into a Q-Sepharose high performance column (GE Healthcare) equilibrated with an elution buffer solution (20 mM sodium phosphate, pH 7.3). After the loading of the supernatant into the ion exchange resin column was completed, the supernatant was sufficiently washed with a binding buffer solution. Thereafter, a concentration gradient was induced so as to increase to 0 to 1 M NaCl for 150 ml (corresponding to 30 times the column volume) using an elution buffer solution (20 mM sodium phosphate, 1M NaCl, pH 7.3) to elute scvhFGF19, and fractions were obtained by 5 ml. When analyzing the fractions having absorbance at a wavelength of 280 nm among the obtained fractions by SDS-PAGE, as shown in
(107) Subsequently, fractions containing only human fibroblast growth factor 19 were collected and sufficiently diluted with a binding buffer solution (20 mM sodium phosphate, pH 6.5), and then loaded at 0.5 mL/min on a heparin resin column equilibrated with the binding buffer solution. After the loading was completed, a concentration gradient was induced so as to reach 0.1 to 2 M NaCl for 40 ml using an elution buffer solution (20 mM sodium phosphate, 2 M NaCl, pH 6.5) to elute scvhFGF19. As a result, it was confirmed that scvhFGF19 was eluted around 500 mM NaCl similar to the previous reports (
Example 5: Quantification of Purified Synonymous Codon Substitution Variant Fibroblast Growth Factor 19 (scvFGF19) Protein
(108) Purity of the protein of the purified synonymous codon substitution variant fibroblast growth factor 19 (scvhFGF19) was evaluated by SDS-PAGE analysis and western blotting analysis. In addition, the total protein concentration was measured as follows in a Bradford method using bovine serum albumin (BSA) as a standard protein sample. 5 μl of the purified protein diluted about 10-fold and 150 μl of Bradford reagent were mixed in a 96 well plate, followed by reacting for 5 minutes at room temperature, and then the concentration of the purified protein was measured at a wavelength of 595 nm using a spectrophotometer.
(109) A purification yield of fibroblast growth factor 19 expressed using the recombinant expression vector pSCT5_ΔssDsbC/scvhFGF19 described in Example 2 was about 2 mg based on 1 L of a flask cell culture liquid, which is an increase of about 4 times compared to the previously reported yield (0.5 mg/L).
(110) A purification yield of fibroblast growth factor 19 expressed using the recombinant expression vector pQHDuet_ΔssDsbC/scvhFGF19 described in above Example 3-(2) was about 5 mg based on 1 L of the flask cell culture liquid, which is an increase of about 10 times compared to the previously reported yield (0.5 mg/L).
Example 6: Functional Evaluation of Purified Synonymous Codon Substitution Variant Fibroblast Growth Factor 19 (scvFGF19)
(111) Like human fibroblast growth factor 19 (hFGF19), a growth factor that triggers responses such as proliferation, differentiation and survival of a cell activates an extracellular signal regulated kinase (ERK) pathway in a vertebrate cell. Specifically, signaling between human FGF19 and fibroblast growth factor receptor 4 (FGFR4) activates a Ras-Raf-Erk1/2 MARK pathway. In other existing studies, a method, in which functional analysis for recombinant hFGF19 is confirmed through whether there is phosphorylation of a specific enzyme on the pathway in a human hepatocellular carcinoma cell (HepG2 cell) line, is used.
(112) Therefore, the following experiment was performed in order to evaluate whether the synonymous codon substitution variant human fibroblast growth factor 19 (scvhFGF19) obtained by the two-step chromatography purification system of the present invention activates the Ras-Raf-Erk1/2 MARK signaling pathway.
(113) First, the human hepatocellular carcinoma cell (HepG2 cell) line was cultured in a DMEM medium containing 10% fetal bovine serum (FBS), 100 U/mL penicillin and 100 μg/mL streptomycin. Then, before treating scvhFGF19, the cells were further cultured in the DMEM medium without FBS for 24 hours.
(114) To evaluate the activity of the purified scvFGF19, an endotoxin was removed using an endotoxin removal spin column (Thermo Fisher Scientific), and then the protein was requantified with Bradford reagent. Subsequently, HepG2 cells were treated with 5 μg/mL of purified scvhFGF19 for 15 minutes, 30 minutes, 50 minutes, 90 minutes, and 120 minutes, respectively, and then the cells were lysed by treating a buffer (25 mM Tris-HCl pH 7.5, 150 mM NaCl, 1 mM EDTA, 1% NP-40) containing a protease inhibitor cocktail and a phosphatase inhibitor cocktail. From the lysate, activity was analyzed by performing immunoblotting using antibodies against Erk1/2 (Cell Signaling Technology), phosphorylated Erk1/2 (Cell Signaling Technology) and α-tubulin (Sigma-Aldrich).
(115) A of
(116) Meanwhile, the activity of the purified scvhFGF19 of the present invention was compared using recombinant FGF19 commercially available from ProSpec-Tany TechnoGene Ltd. as a positive control. B of
(117) These results exhibit that the recombinant expression vector for overexpressing the fibroblast growth factor 19 in a soluble state, and the scvhFGF19, which is produced and purified by using the FGF19 production method using the same and the efficient purification method, have Erk1/2 phosphorylation activity which is equivalent to or higher than the commercially available recombinant FGF19.
(118) Although some embodiments of the present invention have been illustrated and described, those skilled in the art to which the present invention pertains will appreciate that various modifications are possible without departing from the principle or spirit of the present invention. The scope of the present invention will be defined by the appended claims and their equivalents.
(119) A sequence listing electronically submitted with the present application on Aug. 19, 2020 as an ASCII text file named 20200819 LC0182014_TU_SEQ.txt, created on Aug. 18, 2020 and having a size of 52,275 bytes, is incorporated herein by reference in its entirety.