Oncolytic viral vectors and uses thereof

12208126 · 2025-01-28

Assignee

Inventors

Cpc classification

International classification

Abstract

Oncolytic viral vectors that incorporate one or more of the following features: viral replication restriction by insertion of microRNA (miRNA) target sequences into the viral genome; disruption of oncogenic miRNA function; cancer microenvironment remodeling; and cancer cell targeting by incorporation of protease-activated antibodies into the viral particle. Such viral vectors can be used for the treatment and prevention of cancer.

Claims

1. A recombinant oncolytic herpes simplex virus (HSV) comprising (i) a first micro-RNA (miRNA) target sequence cassette (miR-TS) cassette inserted into at least one ICP4 gene or at least one ICP4 untranslated region (UTR) and comprising at least 2 target sequences for each of miR-124, miR-1, and miR-143; (ii) a second miR-TS cassette inserted into the ICP27 gene or an ICP27 untranslated region (UTR) and comprising at least 2 target sequences for each of miR-128, miR-219a, and miR-122; and (iii) a third miR-TS cassette inserted into at least one ICP34.5 gene or at least one ICP34.5 untranslated region (UTR) and comprising at least 2 target sequences for each of miR-219a, miR-204, and miR-128.

2. The recombinant oncolytic herpes simplex virus of claim 1, wherein the recombinant oncolytic HSV further comprises a fourth miR-TS cassette inserted into UL8 and comprising: (a) at least 2 target sequences for each of miR-137, miR-208b, and miR-126; or (b) at least 2 target sequences for each of miR-137, miR-217, and miR-126.

3. The recombinant oncolytic herpes simplex virus of claim 1, wherein replication of the recombinant oncolytic HSV is reduced in a non-cancerous cell compared to the replication of the recombinant oncolytic HSV in a cancerous cell of the same cell type, and wherein the non-cancerous cell and the cancerous cell are selected from the group consisting of a neuronal cell, a cardiac cell, a muscle cell, and a liver cell.

4. The recombinant oncolytic herpes simplex virus of claim 1, wherein: (a) the first miR-TS cassette: comprises a nucleic acid sequence that is at least 95% identical to SEQ ID NO: 852; comprises the nucleic acid sequence of SEQ ID NO: 852; or consists of the nucleic acid sequence of SEQ ID NO: 852; (b) the second miR-TS cassette: comprises a nucleic acid sequence that is at least 95% identical to SEQ ID NO: 853; comprises the nucleic acid sequence of SEQ ID NO: 853; or consists of the nucleic acid sequence of SEQ ID NO: 853; or (c) the third miR-TS cassette: comprises a nucleic acid sequence that is at least 95% identical to SEQ ID NO: 854; comprises the nucleic acid sequence of SEQ ID NO: 854; or consists of the nucleic acid sequence of SEQ ID NO: 854.

5. The recombinant oncolytic herpes simplex virus of claim 2, wherein the fourth miR-TS cassette comprises a nucleic acid sequence that is at least 95% identical to SEQ ID NO: 855; comprises the nucleic acid sequence of SEQ ID NO: 855; or consists of the nucleic acid sequence of SEQ ID NO: 855.

6. The recombinant oncolytic herpes simplex virus of claim 1, wherein each of the miR-TS cassettes is inserted into at least one UTR of said ICP4, ICP27, and ICP34.5 genes, wherein the at least one UTR is selected from a 5 UTR or a 3 UTR.

7. The recombinant oncolytic herpes simplex virus of claim 6, wherein each of the miR-TS cassettes has a length of less than 1000 nucleotides.

8. The recombinant oncolytic herpes simplex virus of claim 1, further comprising a heterologous polynucleotide sequence encoding one or more payload molecules.

9. The recombinant oncolytic herpes simplex virus of claim 8, wherein the heterologous polynucleotide sequence encodes the payload molecule selected from the group consisting of IL-12, CCL4, and CXCL10.

10. The recombinant oncolytic herpes simplex virus of claim 8, wherein the payload molecule comprises (a) an anti-FAP/anti-CD3 bispecific T cell engager or (b) an anti-PD1-Fc-41BBL protein.

11. A nucleic acid molecule encoding the recombinant oncolytic herpes simplex virus of claim 1.

12. A viral stock comprising the recombinant oncolytic herpes simplex virus of claim 1.

13. A composition comprising the recombinant oncolytic herpes simplex virus of claim 1 and a pharmaceutically acceptable carrier.

14. A method for killing a cancerous cell, comprising exposing the cancerous cell to the recombinant oncolytic herpes simplex virus of claim 1 under conditions sufficient for the oncolytic virus to infect and replicate within said cancerous cell, and wherein replication of the oncolytic virus within the cancerous cell results in cell death.

15. The method of claim 14, wherein the cancerous cell has a reduced expression of a miRNA capable of binding to the one or more miRNA target sequences compared to the expression of the miRNA in a non-cancerous cell, and wherein the expression level of the miRNA in the cancerous cell is at least 5% less than the expression level the miRNA in the non-cancerous cell.

16. The method of claim 14, wherein replication of the oncolytic virus is increased or maintained in cancerous cells with a reduced expression of the miRNA capable of binding to the one or more miRNA target sequences, and wherein the viral replication is at least 5% greater in the cancerous cells compared to the viral replication in the non-cancerous cell.

17. The method of claim 14, wherein the cell is in vivo.

18. The method of claim 14, wherein the cell is within a tumor.

19. A method for treating cancer in a subject in need thereof, comprising administering the recombinant oncolytic herpes simplex virus of claim 1 or a composition thereof.

20. The method of claim 19, wherein the subject is a mouse, a rat, a rabbit, a cat, a dog, a horse, a non-human primate, or a human.

21. The method of claim 19, wherein the oncolytic virus or the composition thereof is administered intravenously, subcutaneously, intratumorally, intramuscularly, or intranasally.

22. The method of claim 19, wherein the cancer is selected from lung cancer, breast cancer, ovarian cancer, cervical cancer, prostate cancer, testicular cancer, colorectal cancer, colon cancer, pancreatic cancer, liver cancer, gastric cancer, head and neck cancer, thyroid cancer, malignant glioma, glioblastoma, melanoma, B-cell chronic lymphocytic leukemia, diffuse large B-cell lymphoma (DLBCL), and marginal zone lymphoma (MZL).

23. The method of claim 22, wherein the lung cancer is small cell lung cancer or non-small cell lung cancer, or wherein the liver cancer is hepatocellular carcinoma (HCC).

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 illustrates a heat map of an miRNA expression profile in cancerous and non-cancerous brain tissue corresponding to 25 selected miRNAs.

(2) FIG. 2 illustrates a heat map of an miRNA expression profile in cancerous and non-cancerous bladder tissue corresponding to 25 selected miRNAs.

(3) FIG. 3 illustrates a heat map of an miRNA expression profile in cancerous and non-cancerous breast tissue corresponding to 25 selected miRNAs.

(4) FIG. 4 illustrates a heat map of an miRNA expression profile in cancerous and non-cancerous colon tissue corresponding to 25 selected miRNAs.

(5) FIG. 5 illustrates a heat map of an miRNA expression profile in glioblastoma and non-cancerous brain tissue corresponding to 25 selected miRNAs.

(6) FIG. 6 illustrates a heat map of an miRNA expression profile in cancerous and non-cancerous head and neck tissue corresponding to 25 selected miRNAs.

(7) FIG. 7 illustrates a heat map of an miRNA expression profile in cancerous and non-cancerous lung tissue corresponding to 25 selected miRNAs.

(8) FIG. 8 illustrates a heat map of an miRNA expression profile in cancerous and non-cancerous pancreatic tissue corresponding to 25 selected miRNAs.

(9) FIG. 9 illustrates a heat map of an miRNA expression profile in schwannoma and non-schwannoma tissue corresponding to 25 selected miRNAs.

(10) FIG. 10A-FIG. 10C illustrate an miRNA expression and attenuation reporter gene system described in Example 2. FIG. 10A shows a schematic of a pTetR tet repressor plasmid that induces expression of an miRNA expression plasmid. FIG. 10B shows a schematic of a pTF-002 miRNA expression plasmid containing a tet-inducible mCherry and miRNA expression cassette. FIG. 10C shows a schematic of a pTF-004 miRNA attenuation reporter enabling the read-out of destabilized GFP (dsGFP).

(11) FIG. 11 illustrates miR-122 expression and attenuation using the reporter system shown in FIG. 10 and described in Example 2.

(12) FIG. 12 illustrates miR-122, miR-184, miR-34a, and Let7a-mediated GFP attenuation using the reporter system shown in FIG. 10 and described in Example 2. Circled wells indicate reduced GFP expression levels.

(13) FIG. 13 illustrates expression of miR-122, miR-184, miR-34a, and Let7a, indicated by mCherry expression, using the reporter system shown in FIG. 10 and described in Example 2.

(14) FIG. 14 illustrates miR-122, miR-124, miR-145, miR-199, and miR-451-mediated GFP attenuation using the reporter system shown in FIG. 10 and described in Example 2. Circled wells indicate reduced GFP expression levels.

(15) FIG. 15 illustrates expression of miR-122, miR-124, miR-145, miR-199, and miR-451, indicated by mCherry expression, using the reporter system shown in FIG. 10 and described in Example 2.

(16) FIG. 16 shows quantitation of miR-122 and miR-184-attenuated GFP fluorescence.

(17) FIG. 17 shows quantitation of miR-34a and miR-184-attenuated GFP fluorescence.

(18) FIG. 18 shows quantitation of Let7a and miR-184-attenuated GFP fluorescence.

(19) FIG. 19 shows quantitation of miR-124 and miR-184-attenuated GFP fluorescence.

(20) FIG. 20 shows quantitation of miR-145 and miR-184-attenuated GFP fluorescence.

(21) FIG. 21 shows quantitation of miR-199 and miR-451-attenuated GFP fluorescence.

(22) FIG. 22 shows quantitation of miR-125 and miR-451-attenuated GFP fluorescence.

(23) FIG. 23 shows quantitation of miR-126 and miR-451-attenuated GFP fluorescence.

(24) FIG. 24 shows quantitation of miR-127 and miR-451-attenuated GFP fluorescence.

(25) FIG. 25 shows quantitation of miR-133 and miR-451-attenuated GFP fluorescence.

(26) FIG. 26 shows quantitation of miR-223 and miR-451-attenuated GFP fluorescence.

(27) FIG. 27A-FIG. 27D illustrate fluorescence-based quantitation of HSV attenuation by miR-125 in non-cancerous post-mitotic lung cells and cancerous A253 cells. FIG. 27A shows fluorescence-based quantitation of HSV attenuation in post-mitotic lung cells. FIG. 27B shows fluorescence-based quantitation of HSV attenuation in A253 cells. FIG. 27C shows qPCR-based quantitation of HSV attenuation in post-mitotic lung cells. FIG. 27D shows qPCR-based quantitation of HSV attenuation in A253 cells.

(28) FIG. 28A-FIG. 28B illustrate fluorescence-based (FIG. 28A) and qPCR-based (FIG. 28B) quantitation of HSV attenuation by miR-145 in HCC1395 vs. A253 cells.

(29) FIG. 29A-FIG. 29B illustrates fluorescence-based (FIG. 29A) and qPCR-based (FIG. 29B) quantitation of HSV attenuation by miR-199a-5p vs. miR-143-3p in normal lung cells.

(30) FIG. 30A-FIG. 30C illustrate miRNA-125a (FIG. 30A) and miRNA-122 (FIG. 30B) expression and effect on viral replication (FIG. 30C) in A253, Huh7, and Hep3B cell lines.

(31) FIG. 31 shows a Western blot illustrating reduced viral spread and protein expression after infection with miR-T122 and/or miR-T125a containing HSV in cells expressing miR-122 and miR-125a.

(32) FIG. 32A-FIG. 32D illustrate effects of miRNA expression on miR-attenuated HSV replication. FIG. 32A-FIG. 32B shows increased intracellular expression of miR-125a and mir-122 after transfection with a miR-125a mimic (FIG. 32A) or a miR-122 mimic (FIG. 32B). FIG. 32C shows attenuation of replication of oncolytic HSV vectors with cognate miR target sequences at distinct genetic loci shown by fluorescence images and quantification of GFP fluorescence (FIG. 32D).

(33) FIG. 33 illustrates a schematic of an ICP4-TmiRNA-attenuated HSV vector for the treatment of cancer or benign hyper-proliferative disorders. gB:NT: virus entry-enhancing double mutation in gB gene; BAC: loxP-flanked choramphenicol-resistance and lacZ sequences; joint: deletion of the complete internal repeat region including one copy of the ICP4 gene; ICP4:TmiRNA: insertion of miRNA target sequences (e.g. let-7, miR-34a, miR-101, miR-125b, miR-145, etc.) into the 3 UTR of the remaining ICP4 gene (also may be placed in 5 UTR)

(34) FIG. 34 shows a schematic of an ICP27-TmiRNA-attenuated HSV vector for the treatment of cancer or benign hyper-proliferative disorders. gB:NT: virus entry-enhancing double mutation in gB gene; BAC: loxP-flanked choramphenicol-resistance and lacZ sequences; joint: deletion of the complete internal repeat region including one copy of the ICP4 gene; ICP27:TmiRNA: insertion of miRNA target sequences (e.g. let-7, miR-34a, miR-101, miR-125b, miR-145, etc.) into the 3 UTR of the ICP27 gene (also may be placed in 5 UTR)

(35) FIG. 35 shows a schematic of a UL19-TmiRNA-attenuated HSV vector for the treatment of cancer or benign hyper-proliferative disorders. gB:NT: virus entry-enhancing double mutation in gB gene; BAC: loxP-flanked choramphenicol-resistance and lacZ sequences; joint: deletion of the complete internal repeat region including one copy of the ICP4 gene; UL19:TmiRNA: insertion of miRNA target sequences (e.g. let-7, miR-34a, miR-101, miR-125b, miR-145, etc.) into the 3 UTR of the UL19 gene (also may be placed in 5 UTR).

(36) FIG. 36 shows a schematic of an UL19-TmiRNA and ICP27-TmiRNA-attenuated HSV vector for the treatment of cancer or benign hyper-proliferative disorders. gB:NT: virus entry-enhancing double mutation in gB gene; BAC: loxP-flanked choramphenicol-resistance and lacZ sequences; joint: deletion of the complete internal repeat region including one copy of the ICP4 gene; UL19:TmiRNA & ICP27:TmiRNA: insertion of miRNA target sequences (e.g. let-7, miR-34a, miR-101, miR-125b, miR-145, etc.) into the 3 UTR of the UL19 and ICP27 genes (also may be placed in 5 UTR)

(37) FIG. 37 shows a schematic of an UL19-TmiRNA and ICP4-TmiRNA-attenuated HSV vector for the treatment of cancer or benign hyper-proliferative disorders. gB:NT: virus entry-enhancing double mutation in gB gene; BAC: loxP-flanked choramphenicol-resistance and lacZ sequences; joint: deletion of the complete internal repeat region including one copy of the ICP4 gene; UL19:TmiRNA & ICP4:TmiRNA: insertion of miRNA target sequences (e.g. let-7, miR-34a, miR-101, miR-125b, miR-145, etc.) into the 3 UTR of the UL19 and ICP4 genes (also may be placed in 5 UTR).

(38) FIG. 38 shows a schematic of an UL19-TmiRNA, ICP27-TmiRNA, and ICP4-TmiRNA-attenuated HSV vector for the treatment of cancer or benign hyper-proliferative disorders. gB:NT: virus entry-enhancing double mutation in gB gene; BAC: loxP-flanked choramphenicol-resistance and lacZ sequences; joint: deletion of the complete internal repeat region including one copy of the ICP4 gene; UL19:TmiRNA, ICP27:TmiRNA, & ICP4:TmiRNA: insertion of miRNA target sequences (e.g. let-7, miR-34a, miR-101, miR-125b, miR-145, etc.) into the 3 UTR of the UL19, ICP27, and ICP4 genes (also may be placed in 5 UTR).

(39) FIG. 39 shows a schematic of an ICP4-TmiRNA-attenuated, genome-editing HSV vector for the treatment of cancer. gB:NT: virus entry-enhancing double mutation in gB gene; BAC: loxP-flanked choramphenicol-resistance and lacZ sequences; joint: deletion of the complete internal repeat region including one copy of the ICP4 gene; ICP4:TmiRNA: insertion of miRNA target sequences (e.g. let-7, miR-34a, miR-101, miR-125b, miR-145) into the 3 UTR of the remaining ICP4 gene (also may be placed in 5 UTR); Pol II promoter: Constitutive (CAG, UbC, EF1a, PGK) or cell-specific (e.g. TRPV1, Nav1.7, hSYN); Endonuclease: CRISPR associated endonuclease (e.g. SpCas9, SaCas9, FnCpf1, FnCas9, etc.); Poly(A): polyadenylation signal (e.g. bGH); gRNA: Single crRNA-trRNA fusion (DR-crRNA-DR-trRNA); crRNA targeted to oncogenic microRNA (e.g. miR-17, miR-21, miR-155); Pol III promoter: E.g. U6, H1, 7SK.

(40) FIG. 40 shows a schematic of an ICP4-TmiRNA-attenuated, genome-editing, microenvironment-remodeling HSV vector for the treatment of cancer. gB:NT: virus entry-enhancing double mutation in gB gene; BAC: loxP-flanked choramphenicol-resistance and lacZ sequences; joint: deletion of the complete internal repeat region including one copy of the ICP4 gene; ICP4:TmiRNA: insertion of miRNA target sequences (e.g. let-7, miR-34a, miR-101, miR-125b, miR-145) into the 3 UTR of the remaining ICP4 gene (also may be placed in 5 UTR); Pol II promoter: Constitutive (CAG, UbC, EF1a, PGK) or cell-specific (e.g. TRPV1, Nav1.7, hSYN); Endonuclease: CRISPR associated endonuclease (e.g. SpCas9, SaCas9, FnCpf1, FnCas9, etc.); Poly(A): polyadenylation signal (e.g. bGH); gRNA2: crRNA targeted to microenvironment remodeling miRNA (e.g. miR-143, miR-218) or TIMP (e.g. TIMP1, TIMP2); Pol III promoter: E.g. U6, H1, 7SK.

(41) FIG. 41 shows a schematic of an ICP4-TmiRNA and ICP27-TmiRNA-attenuated HSV vector for the treatment of pancreatic, lung, and colon cancer. gB:NT: virus entry-enhancing double mutation in gB gene; BAC: loxP-flanked choramphenicol-resistance and lacZ sequences; joint: deletion of the complete internal repeat region including one copy of the ICP4 gene; ICP4:TmiRNA: insertion of miR-124 target sequence cassette into the 3 UTR of the remaining ICP4 gene (also may be placed in 5 UTR); ICP27:TmiRNA: insertion of miR-451a, miR-143-3p, and miR-559 target sequence cassettes into the 3 UTR of the ICP-27 gene (also may be placed in 5 UTR).

(42) FIG. 42 shows a schematic of an ICP4-TmiRNA and ICP27-TmiRNA-attenuated HSV vector for the treatment of multiple cancer types. gB:NT: virus entry-enhancing double mutation in gB gene; BAC: loxP-flanked choramphenicol-resistance and lacZ sequences; joint: deletion of the complete internal repeat region including one copy of the ICP4 gene; ICP4:TmiRNA: insertion of miR-124 target sequence cassette into the 3 UTR of the remaining ICP4 gene (also may be placed in 5 UTR); ICP27:TmiRNA: insertion of miR-451a, miR-145-5p, and miR-559 target sequence cassettes into the 3 UTR of the ICP-27 gene (also may be placed in 5 UTR).

(43) FIG. 43 shows a schematic of an ICP4-TmiRNA and ICP27-TmiRNA-attenuated HSV vector for the treatment of schwannoma. gB:NT: virus entry-enhancing double mutation in gB gene; BAC: loxP-flanked choramphenicol-resistance and lacZ sequences; joint: deletion of the complete internal repeat region including one copy of the ICP4 gene; ICP4:TmiRNA: insertion of miR-124 target sequence cassette into the 3 UTR of the remaining ICP4 gene (also may be placed in 5 UTR); ICP27:TmiRNA: insertion of miR-205p, miR-141-5p, and miR-31-5p target sequence cassettes into the 3 UTR of the ICP-27 gene (also may be placed in 5 UTR).

(44) FIG. 44 shows a schematic of a miR-attenuated HSV virus, wherein multiple copies of miR-122, miR-125a, and/or miR-124 target sites are inserted into ICP27, UL42 and/or ICP4.

(45) FIG. 45 shows a schematic of a miR-attenuated HSV virus (ONCR-157), wherein miR target site cassettes are inserted into UL8, ICP12, ICP4, and ICP34.5

(46) FIG. 46 shows a schematic of a miR-attenuated HSV virus (ONCR-159), wherein miR target site cassettes are inserted into UL8, ICP12, ICP4, and ICP34.5.

(47) FIG. 47A shows GFP intensity generated by a reporter virus engineered to expression GFP in cells treated with pooled siRNAs against various viral genes. FIG. 47B shows results in the same assay for individual siRNAs.

(48) FIGS. 48A and 48B shows GFP intensity generated by a reporter virus engineered to expression GFP in cells treated with pooled siRNAs against various viral genes using the HSV vector ONCR-003 (left) or ONCR-010 (right).

(49) FIG. 49 shows a Western blot to detect expression of viral proteins in cells infected with HSV vector and treated with siRNA against viral genes as indicated. Beta-actin is a positive control for the Western blot.

(50) FIGS. 50A and 50B show Nanostring assay data for normal brain tissue compared to malignant tissue as ratio of miRNA expression (FIG. 50A) and normalized counts (FIG. 50B).

(51) FIGS. 51A and 51B show Nanostring assay data for normal heart tissue compared to malignant tissue as ratio of miRNA expression (FIG. 51A) and normalized counts (FIG. 51B).

(52) FIG. 52A shows Nanostring assay data for normal spinal-cord tissue compared to malignant tissue as ratio of miRNA expression. FIGS. 52A and 52B show Nanostring assay data for normal nerve or ganglion tissue compared to malignant tissue as ratio of miRNA expression (FIG. 52A) and normalized counts (FIG. 52C).

(53) FIGS. 53A and 53B show luciferase assay testing of miR-TS cassettes for cassette 1 (FIG. 53A) or cassette 2 (FIG. 53B)

(54) FIG. 54A-FIG. 54G show cytotoxicity of oncolytic HSV viral vectors ONCR-125, ONCR-131, ONCR-142, and ONCR-157 in cancer cell lies SW837 (FIG. 54A), SKMEL28 (FIG. 54B), COLO 205 (FIG. 54C), A375 (FIG. 54D), H446 (FIG. 54E), BXPC3 (FIG. 54F), and BT549 (FIG. 54G).

(55) FIG. 55 shows tumor growth inhibitor effect of vehicle compared to virus (as indicated in legend) in a mouse xenograph experiment. The increase in tumor volume of the injected tumor is compared to the increase in tumor volume of the non-injected tumor. ONCR-133 significantly inhibited tumor growth of injected tumors compared to vehicle treated controls (p<0.0001). ONCR-133 treatment also significantly inhibited tumor growth of non-injected tumors (p<0.005), indicating an enhanced abscopal effect.

(56) FIG. 56 shows tumor growth inhibitor effect of vehicle compared to virus (as indicated in legend) in a mouse xenograph experiment. The increase in tumor volume of the injected tumor is compared to the increase in tumor volume of the non-injected tumor. Mice treated with ONCR-133+ONCR-007 (an HSV construct expressing ULBP3) or ONCR-133+ONCR-002 (an HSV construct that does not express any additional payload molecules) both demonstrated a significant inhibition of tumor growth compared to vehicle treated controls.

(57) FIG. 57 shows tumor growth inhibitor effect of vehicle compared to virus (as indicated in legend) in a mouse xenograph experiment. The increase in tumor volume of the injected tumor is compared to the increase in tumor volume of the non-injected tumor. The additional expression of CXCL10 in the ONCR-106+ONCR-113 treated group did not enhance the inhibition of tumor growth in either injected or non-injected tumors compared to mice treated with ONCR-031+ONCR-113.

(58) FIG. 58 shows tumor growth inhibitor effect of vehicle compared to virus (as indicated in legend) in a mouse xenograph experiment. The increase in tumor volume of the injected tumor is compared to the increase in tumor volume of the non-injected tumor. the additional expression of CXCL10 in the ONCR-106+ONCR-113 treated group did not enhance the inhibition of tumor growth in either injected or non-injected tumors compared to mice treated with ONCR-031+ONCR-113.

(59) FIG. 59A-FIG. 59B show replication of injected virus occurs only in the injected tumor, not in the non-injected tumor, suggesting that the anti-tumor effect observed in the non-injected tumor is immune-mediated. Data is ploted as raw genome copies per microgram DNA (FIG. 59A) or as normalized expression (FIG. 59B). HSV was detected in the injected tumors, but not in the non-injected tumors, indicating that the tumor growth inhibition observed in the non-injected tumors was not due to viral spread, but rather the abscopal effects of virus administration.

(60) FIG. 60A-FIG. 60C show payload expression peaked in the injected tumors at 24-hours post-treatment and decreased thereafter.

(61) FIG. 61A-FIG. 61C shows levels of the payloads in the serum of mice treated with ONCR-153, where only CXCL10 expression was observed.

(62) FIG. 62A shows the expression level of interferon gamma in the injected and non-injected tumors. Treatment of mice with ONCR-153 induced an intra-tumoral IFN response in both injected and non-injected tumors. FIG. 62B shows the expression level of interferon gamma in the plasma of the host animal.

(63) FIG. 63 shows tumor growth inhibitor effect of vehicle compared to virus (as indicated in legend) in a mouse xenograph experiment. The increase in tumor volume of the injected tumor is compared to the increase in tumor volume of the non-injected tumor.

(64) FIG. 64 shows tumor growth inhibitor effect of vehicle compared to virus (as indicated in legend) in a mouse xenograph experiment. The increase in tumor volume of the injected tumor is compared to the increase in tumor volume of the non-injected tumor.

(65) FIG. 65 shows tumor growth inhibitor effect of vehicle compared to virus (as indicated in legend) in a mouse xenograph experiment. The increase in tumor volume of the injected tumor is compared to the increase in tumor volume of the non-injected tumor.

(66) FIG. 66A shows tumor growth inhibitor effect of vehicle compared to virus (as indicated in legend) in a mouse xenograph experiment. FIG. 66B shows decreased incident of metastases to the lung. FIG. 66C shows images of lung tissue from vehicle (PBS) control or vector-treated animals.

(67) FIG. 67 shows tumor growth inhibitor effect of vehicle compared to virus (as indicated in legend) in a mouse xenograph experiment. The increase in tumor volume of the injected tumor is compared to the increase in tumor volume of the non-injected tumor. Treatment with ONCR-152 and -139 demonstrated an enhanced effect in tumor growth inhibition compared to treatment with ONCR-139 alone.

DETAILED DESCRIPTION

(68) In some aspects, the present invention utilizes differential miR expression profiles to effectively restrict viral vector replication to tumor cells by incorporating miR target sequences into one or more genes required for viral replication. In particular embodiments, the viral vectors described herein comprise two, three, four or more copies of a miR target sequence incorporated into one or more viral genes. In some embodiments, the viral vectors described herein also disrupt the expression of specific miRNAs for reduced tumor proliferation, metastasis, and/or remodeling of the tumor microenvironment to enable enhanced viral spread. In some embodiments, the viral vectors described herein encompass the use of surface molecules on viral vectors to facilitate targeting to tumor cells. These aspects can be applied individually or in combination to develop viral vectors potentially capable of treating a wide array of cancer types with a single viral vector. As such, the invention further encompasses recombinant oncolytic viral vectors for use in the treatment and prevention of diseases and disorders (e.g., cancer). In some embodiments, this invention utilizes endogenous microRNA (miR) expression to enable a safe and efficacious recombinant viral vector suitable to treat a broad array of cancers.

(69) The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. All documents, or portions of documents, cited herein, including but not limited to patents, patent applications, articles, books, and treatises, are hereby expressly incorporated by reference in their entirety for any purpose. In the event that one or more of the incorporated documents or portions of documents define a term that contradicts that term's definition in the application, the definition that appears in this application controls. However, mention of any reference, article, publication, patent, patent publication, and patent application cited herein is not, and should not be taken as an acknowledgment, or any form of suggestion, that they constitute valid prior art or form part of the common general knowledge in any country in the world.

Definitions

(70) In the present description, any concentration range, percentage range, ratio range, or integer range is to be understood to include the value of any integer within the recited range and, when appropriate, fractions thereof (such as one tenth and one hundredth of an integer), unless otherwise indicated. It should be understood that the terms a and an as used herein refer to one or more of the enumerated components unless otherwise indicated. The use of the alternative (e.g., or) should be understood to mean either one, both, or any combination thereof of the alternatives. As used herein, the terms include and comprise are used synonymously. As used herein, plurality may refer to one or more components (e.g., one or more miRNA target sequences).

(71) As used in this application, the terms about and approximately are used as equivalents. Any numerals used in this application with or without about/approximately are meant to cover any normal fluctuations appreciated by one of ordinary skill in the relevant art. In certain embodiments, the term approximately or about refers to a range of values that fall within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction (greater than or less than) of the stated reference value unless otherwise stated or otherwise evident from the context (except where such number would exceed 100% of a possible value).

(72) Decrease or reduce refers to a decrease or a reduction in a particular value of at least 5%, for example, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 99 or 100% as compared to a reference value. A decrease or reduction in a particular value may also be represented as a fold-change in the value compared to a reference value, for example, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 500, 1000-fold, or more, decrease as compared to a reference value.

(73) Increase refers to an increase in a particular value of at least 5%, for example, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 99, 100, 200, 300, 400, 500% or more as compared to a reference value. An increase in a particular value may also be represented as a fold-change in the value compared to a reference value, for example, at least 1-fold, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 500, 1000-fold or more, increase as compared to the level of a reference value.

(74) The term sequence identity refers to the percentage of bases or amino acids between two polynucleotide or polypeptide sequences that are the same, and in the same relative position. As such one polynucleotide or polypeptide sequence has a certain percentage of sequence identity compared to another polynucleotide or polypeptide sequence. For sequence comparison, typically one sequence acts as a reference sequence, to which test sequences are compared. The term reference sequence refers to a molecule to which a test sequence is compared.

(75) Complementary refers to the capacity for pairing, through base stacking and specific hydrogen bonding, between two sequences comprising naturally or non-naturally occurring (e.g., modified as described above) bases (nucleosides) or analogs thereof. For example, if a base at one position of a nucleic acid is capable of hydrogen bonding with a base at the corresponding position of a target, then the bases are considered to be complementary to each other at that position. Nucleic acids can comprise universal bases, or inert abasic spacers that provide no positive or negative contribution to hydrogen bonding. Base pairings may include both canonical Watson-Crick base pairing and non-Watson-Crick base pairing (e.g., Wobble base pairing and Hoogsteen base pairing). It is understood that for complementary base pairings, adenosine-type bases (A) are complementary to thymidine-type bases (T) or uracil-type bases (U), that cytosine-type bases (C) are complementary to guanosine-type bases (G), and that universal bases such as such as 3-nitropyrrole or 5-nitroindole can hybridize to and are considered complementary to any A, C, U, or T. Nichols et al., Nature, 1994; 369:492-493 and Loakes et al., Nucleic Acids Res., 1994; 22:4039-4043. Inosine (I) has also been considered in the art to be a universal base and is considered complementary to any A, C, U, or T. See Watkins and SantaLucia, Nucl. Acids Research, 2005; 33 (19): 6258-6267.

(76) Operably linked refers to a juxtaposition wherein the components so described are in a relationship permitting them to function in their intended manner. For instance, a promoter is operably linked to a polynucleotide sequence if the promoter affects the transcription or expression of the polynucleotide sequence.

(77) The term subject includes animals, such as e.g. mammals. In some embodiments, the mammal is a primate. In some embodiments, the mammal is a human. In some embodiments, subjects are livestock such as cattle, sheep, goats, cows, swine, and the like; or domesticated animals such as dogs and cats. In some embodiments (e.g., particularly in research contexts) subjects are rodents (e.g., mice, rats, hamsters), rabbits, primates, or swine such as inbred pigs and the like. The terms subject and patient are used interchangeably herein.

(78) The term effective amount refers to the minimum amount of an agent or composition required to result in a particular physiological effect (e.g., an amount required to increase, activate, and/or enhance a particular physiological effect). The effective amount of a particular agent may be represented in a variety of ways based on the nature of the agent, such as mass/volume, # of cells/volume, particles/volume, (mass of the agent)/(mass of the subject), # of cells/(mass of subject), or particles/(mass of subject). The effective amount of a particular agent may also be expressed as the half-maximal effective concentration (EC.sub.50), which refers to the concentration of an agent that results in a magnitude of a particular physiological response that is half-way between a reference level and a maximum response level.

(79) The phrase pharmaceutically acceptable is employed herein to refer to those compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.

(80) As used herein pharmaceutically acceptable carrier, diluent or excipient includes without limitation any adjuvant, carrier, excipient, glidant, sweetening agent, diluent, preservative, dye/colorant, flavor enhancer, surfactant, wetting agent, dispersing agent, suspending agent, stabilizer, isotonic agent, solvent, surfactant, and/or emulsifier which has been approved by the United States Food and Drug Administration as being acceptable for use in humans and/or domestic animals.

(81) As used herein, the term oncolytic virus refers to a virus that has been modified to, or naturally, preferentially infect cancer cells.

(82) The terms microRNA, miRNA, and miR are used interchangeably herein and refer to small non-coding endogenous RNAs of about 21-25 nucleotides in length that regulate gene expression by directing their target messenger RNAs (mRNA) for degradation or translational repression.

(83) Essential viral gene as used herein refers to a viral gene that is required for one or more essential viral function, such as viral replication, viral packaging, or viral infectivity.

(84) The term vector is used herein to refer to a nucleic acid molecule capable transferring or transporting another nucleic acid molecule. The transferred nucleic acid is generally linked to, e.g., inserted into, the vector nucleic acid molecule. A vector may include sequences that direct autonomous replication in a cell, or may include sequences sufficient to allow integration into host cell DNA.

(85) General methods in molecular and cellular biochemistry can be found in such standard textbooks as Molecular Cloning: A Laboratory Manual, 3rd Ed. (Sambrook et al., HaRBor Laboratory Press 2001); Short Protocols in Molecular Biology, 4th Ed. (Ausubel et al. eds., John Wiley & Sons 1999); Protein Methods (Bollag et al., John Wiley & Sons 1996); Nonviral Vectors for Gene Therapy (Wagner et al. eds., Academic Press 1999); Viral Vectors (Kaplift & Loewy eds., Academic Press 1995); Immunology Methods Manual (I. Lefkovits ed., Academic Press 1997); and Cell and Tissue Culture: Laboratory Procedures in Biotechnology (Doyle & Griffiths, John Wiley & Sons 1998), the disclosures of which are incorporated herein by reference.

(86) Oncolytic Viruses

(87) In some embodiments, the present invention provides for recombinant oncolytic viruses, wherein one or more copies of one or more micro-RNA (miRNA) target sequences are inserted into a locus of one or more essential viral genes required for viral replication. Examples of oncolytic viruses are known in the art including, but not limited to, herpes simplex virus (HSV), an adenovirus, a polio virus, a vaccinia virus, a measles virus, a vesicular stomatitis virus, an orthomyxovirus, a parvovirus, a maraba virus or a coxsackievirus. In some embodiments, the oncolytic viruses described herein are referred to as recombinant viral vectors or oncolytic vectors.

(88) In certain embodiments, an oncolytic virus described herein is a herpesvirus (for example, herpes simplex virus (e.g., HSV-1 or HSV-2)), an adenovirus, a polio virus, a vaccinia virus, a measles virus, a vesicular stomatitis virus, an orthomyxovirus, a parvovirus, a maraba virus or a coxsackievirus. In particular embodiments, the recombinant viral vector is an HSV capable of tumor-selective vector replication as described in International PCT Publication No. WO 2015/066042, which is incorporated by reference in its entirety.

(89) HSV-based vectors and methods for their construction are described in, for example, U.S. Pat. Nos. 7,078,029, 6,261,552, 5,998,174, 5,879,934, 5,849,572, 5,849,571, 5,837,532, 5,804,413, and 5,658,724, and International Patent Applications WO 91/02788, WO 96/04394, WO 98/15637, and WO 99/06583, which are incorporated herein by reference in their entireties. The sequence of HSV is published (NCBI Accession No. NC_001806; see also McGoech et al., J. Gen. Virol, 69 (PT 7), 1531-1574 (1988)), which may facilitate designing HSV-based vectors of the invention. In some cases, the oncolytic virus of the invention is a herpes simplex virus (HSV) and comprises a deletion of the internal repeat (joint) region comprising one copy each of the diploid genes ICP0, ICP34.5, LAT, and ICP4 along with the promoter for the ICP47 gene.

(90) In certain embodiments, the recombinant viral vector of the invention is an HSV that exhibits enhanced entry into cells, either through direct infection and/or lateral spread. In one aspect, HSV vectors of the present invention can directly infect cells through interaction with cell proteins other than typical mediators of HSV infection (e.g., other than nectin-1, HVEM, or heparan sulfate/chondroitin sulfate proteoglycans). In certain embodiments, the recombinant viral vector of the invention is an HSV and further comprises a mutation of the gB or gH gene that facilitates vector entry through non-canonical receptors. In another aspect, the invention provides an HSV vector further comprising mutant gH glycoproteins that exhibit lateral spread in cells typically resistant to HSV lateral spread, such as cells lacking gD receptors. In some embodiments, an HSV vector of the invention comprises one or more of the mutant gB or gH proteins as described in U.S. Patent Publication No. 2013/0096186, which is incorporated herein by reference in its entirety. In certain aspects, the mutant entry protein within an HSV vector is a glycoprotein involved with viral entry, such as gB, gH, and the mutant HSV vector can comprise mutated versions of both. However, the mutant entry protein can be any protein effecting entry of the HSV vector into cells. In certain embodiments, the mutant entry protein is other than gD, although the HSV vector can additionally comprise a mutant gD, such as containing a ligand or other desired mutation. Non-limiting mutations of gB or gH glycoprotein for use in the inventive HSV vector occur at one or more of the following residues: gB:D285, gB:A549, gB:S668, gH:N753, and gH:A778. In some embodiments, the inventive HSV vector comprises mutations at both gB:D285 and gB:A549, at both gH:N753 and gH:A778, and/or at each of gB:S668, gH:N753, and gH:A778. In certain embodiments, the HSV vector contains two or more of such mutations (e.g., 3 or more, 4 or more), and the HSV vector can comprise mutations in all five of these residues. In one embodiment, an HSV vector has mutations at gB:285, gB; 549, gH:753, and gH:778. The mutations are referred to herein relative to the codon (amino acid) numbering of the gD, gB, and gH genes of the HSV-1 strain KOS derivative K26GFP. The sequences for gB and gH of K26GFP differ from the sequences for gB as disclosed in GenBank (#AF311740 (incorporated herein by reference)) and for gH (GenBank #X03896 (incorporated herein by reference)) as reflected in Table 9 below.

(91) TABLE-US-00001 TABLE 9 Amino acid Nucleotide position AF311740 K26GFP position(s) AF311740 K26GFP gB 313 T S 938-939 ACG AGC 315 A T 943 GCC ACC 515 H R 1,544 CAC CGC X03896 gH 12 I L 1,011 ATT CTT 110 P S 1,305 CCG TCG 127 T I 1,357 ACC ATC 138 S A 1,389 TCG GCG 150 A T 1,425 GCC ACC 532 A A 2,573 GCT GCG 633 R R 2,876 CGT CGC

(92) However, K26GFP may contain additional differences in the region of the gene corresponding to nucleotides 2,079-2,102 of GenBank X03896. Thus, it will be understood that the sequence of either KOS derivative K26GFP or GenBank Accession No. AF311740 can serve as a reference sequence for the gB mutations discussed herein. Also, the sequence of either KOS derivative K26GFP or GenBank Accession No. X03896 can serve as a reference sequence for the gH mutations discussed herein. However, HSV vectors of the invention may include homologous mutations in gB and gH of any HSV strain.

(93) In some aspects, the mutation of the entry protein for inclusion in an HSV vector is a substitution mutation; however, mutations are not limited to substitution mutants. In certain embodiments, mutant gB or gH glycoproteins for use in an HSV vector are selected from the group of substitution mutations consisting of gB:D285N, gB:A549T, gB:S668N, gH:N753K, gH:A778V. In certain aspects, an HSV vector includes combinations of these substitutions (such as two or more of such substitutions (e.g., 3 or more, 4 or more, or all)), with the gB:D285N/gB:A549T double mutant, the gH:N753K/gH:A778V double mutant, and the gB:S668N/gH:N753K/gH:A778V triple mutant being examples of embodiments. In one embodiment, an HSV vector comprises gB:D285N/gB:A549T/gH:N753K/gH:A778V.

(94) In certain aspects, an HSV vector comprises a mutant gB and/or a mutant gH glycoprotein, wherein the mutations in the glycoproteins are substitution mutations in at least two residues, wherein, when the vector is HSV-1 K26GFP, the at least two residues are selected from the group consisting of gB:D285, gB:A549, gB:S668, gH:N753, and gH:A778, or wherein when the vector is a homologous HSV, the at least two residues are selected from amino acids that correlate to gB:D285, gB:A549, gB:S668, gH:N753, and gH:A778 wherein the gB:D285 residue correlates to X in VYPYXEFVL (SEQ ID NO: 838), the gB:A549 residue correlates to X in KLNPNXIAS (SEQ ID NO: 839), the gB:S668 residue correlates to X in ITTVXTFID (SEQ ID NO: 840) the gH:N753 residue correlates to X in VDTDXTQQQ (SEQ ID NO: 841), and the gH:A778 residue correlates to X in VPSTXLLLF (SEQ ID NO: 842); and wherein the HSV vector is an HSV-1 or HSV-2 vector.

(95) In some embodiments, the oncolytic HSV viruses described herein comprise one or more mutations in the UL37 gene that reduce HSV infection of neuronal cells, such as those described in International PCT Publication No. WO 2016/141320 and Richard et al., Plos Pathogens, 2017, 13 (12), e1006741.

(96) miRNA-Attenuated Oncolytic Viruses

(97) miRs are differentially expressed in a broad array of disease states, including multiple types of cancer. Importantly, miRNAs are differentially expressed in cancer tissues compared to normal tissues, enabling them to serve as a targeting mechanism in a broad variety of cancers. miRNAs that are associated (either positively or negatively) with carcinogenesis, malignant transformation, or metastasis are known as oncomiRs.

(98) In some aspects, the expression level of a particular oncomiR is positively associated with the development or maintenance of a particular cancer. Such miRs are referred to herein as oncogenic miRs. In some embodiments, the expression of an oncogenic miR is increased in cancerous cells or tissues compared to the expression level observed in non-cancerous controls cells (i.e., normal or healthy controls) or is increased compared to the expression level observed in cancerous cells derived from a different cancer type. In some embodiments, the expression of an oncogenic miR is increased by at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200%, 300%, 400%, 500%, 1000% or more compared to the expression of the oncogenic miR in a non-cancerous control cell or a cancerous cell derived from a different cancer type. In some aspects, a cancerous cell or tissue may express an oncogenic miR that is not expressed in non-cancerous control cells or tissues. Examples of oncogenic miRNAs that are frequently over-expressed in cancer tissues include, but are not limited to, miR-21, miR-155 and miR-17-92. Additional examples of oncogenic miRs are listed in Table 4.

(99) In some embodiments, the expression of a particular oncomiR is negatively associated with the development or maintenance of a particular cancer and/or metastasis. Such oncomiRs are referred to herein as tumor-suppressor miRs or tumor-suppressive miRs, as their expression prevents or suppresses the development of cancer. In some embodiments, the expression of a tumor-suppressor miRNA is decreased in cancerous cells or tissues compared to the expression level observed in non-cancerous control cells (i.e., normal or healthy controls), or is decreased compared to the expression level of the tumor-suppressor miRNA observed in cancerous cells derived from a different cancer type. For example, the expression of a tumor-suppressor miRNA in a cancerous cell may be decreased by at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 70%, 80%, 90%, or 100% compared to the expression of the tumor-suppressor miRNA in a non-cancerous control cell or a cancerous cell derived from a different cancer type. In some aspects, a non-cancerous control cell may express a tumor-suppressor miRNA that is not expressed in cancerous cells. Examples of tumor-suppressive miRNAs include, but are not limited to, miR-122, miR-184, miR-34a, let7a, miR-145-5p, miR-199a-5p, miR-451a, miR-125a, miR-125a-5p, miR-126-3p, miR-233-3p, miR-143-3p, miR-1-3p, miR-133a-3p, miR-127a-3p, miR-133b, miR-134-3p, miR-124, miR-101, miR-125b, miR-145, miR-559, miR-213, miR-31-5p, miR-205p, miR-15a, miR-16-1, miR-34, as well as miRNAs of the let-7 family. Additional examples of tumor-suppressive miRs are listed in Table 3 and Table 8.

(100) Cancer pathogenesis is a heterogeneous and multigenic process. As such, activation of particular pathways and the expression of particular genes may lead to cancer development in one context, and result in distinct or opposing results when activated or expressed in a different context. Therefore, the characterization of a particular gene or miR as an oncogene or oncogenic miR or as a tumor-suppressor or tumor-suppressive miR is not a binary distinction and will vary according to the type of cancer. For example, the expression of one miRNA may be increased in a particular cancer and associated with the development of that cancer, while the expression of the same miRNA may be decreased in a different cancer and associated with prevention of the development of that cancer. However, some miRNAs may function as oncogenic miRNAs independent of the type of cancer. For example, some miRNAs target mRNA transcripts of tumor suppressor genes for degradation, thereby reducing expression of the tumor suppressor protein. For example, miR-152b functions as an oncogenic miR in the vast majority of hematologic malignancies, but functions as a tumor-suppressive miR in many solid tumors. Further, a particular miR may be highly expressed in both cancerous and non-cancerous cells. For example, miR-155 is highly expressed in normal cells, playing an essential role in macrophage polarization, and is also highly expressed in cancer cells. As such, the development of the miR-attenuated, genome-editing, and microenvironment-remodeling oncolytic viruses described herein is based on the differential expression of a particular miR or group of miRs in one cell population or tissue compared to another cell population or tissue. One of skill in the art will understand that the term tumor-suppressive miR generally refers to a miR that is more highly expressed in a non-cancerous cell or tissue compared to a cancerous cell or tissue, and that the term oncogenic miR generally refers to a miR that is more highly expressed in a cancerous cell or tissue compared to a non-cancerous cell or tissue. One of skill in the art will further understand that a miR characterized as a tumor-suppressive miR in one type of cancer may or more may not function as a tumor-suppressive miR in a different type of cancer, and that a miR characterized as an oncogenic miR in one type of cancer may or more may not function as an oncogenic miR in a different type of cancer.

(101) Table 1 shows the relationship between 12 select oncomiRs (9 tumor suppressors and 3 oncogenic miRNAs) and numerous cancers. A list of 3,410 oncomiR-cancer relationships is shown in Table 2. miRNAs regulate many transcripts of proteins that are involved in the control of cellular proliferation and apoptosis. Regulated proteins include conventional proto-oncoproteins and tumor suppressors such as Ras, Myc, Bcl2, PTEN and p53. Aberrant expression of miRNAs therefore often is involved in development of cancer and can therapeutically be corrected by either inhibiting oncogenic miRNAs or replacing the depleted tumor suppressor miRNA. Further, the differential expression of particular oncomiRs in cancerous vs. non-cancerous cells can be exploited as a means to target cancer therapeutics specifically to cancer cells. As such, in some embodiments, the oncolytic viral vectors described herein can comprise the following properties individually or in combination: insertion of miRNA target sequences into the viral genome, thereby restricting viral vector replication to cancer or tumor cells; one or more polynucleotides incorporated into the viral genome whose product(s) disrupt the function of an oncogenic miRNA, modulate the cancer extracellular matrix, and/or enhance or activate an anti-cancer immune response; and/or protease-activated antibodies incorporated into the viral particle in order to selectively target the vectors to cancer and/or tumor cells.

(102) One aspect of the invention comprises a recombinant oncolytic virus (or viral vector) comprising a plurality of copies of one or more miRNA target sequences inserted into a locus of one or more essential viral genes. In certain embodiments, a recombinant oncolytic virus may comprise miRNA target sequences inserted into a locus of at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, or at least ten essential viral genes. miRNAs expressed in normal (non-cancerous) cells can bind to such target sequences and suppress expression of the viral gene containing the miRNA target sequence, thereby limiting viral replication in healthy, non-cancerous cells. Such recombinant oncolytic viruses are referred to herein as miR-attenuated or replication-restricted as they demonstrate reduced or attenuated viral replication in cells that express one or more miRNAs capable of binding to the incorporated miR target sequences compared to cells that do not express, or have reduced expression of, the miR. By incorporating miRNA target sequences into key genes required for viral replication, viral replication can be conditionally suppressed in normal diploid cells expressing the miRNAs and can proceed normally in cells that do not express themiRNAs. In such embodiments, healthy, non-cancerous cells are protected from the normal cells from lytic effects of infection by the recombinant viral vector.

(103) In certain embodiments, the one or more miRNA target sequences is incorporated into the 5 untranslated region (UTR) and/or 3 UTR of one or more essential viral genes. In some embodiments, the oncolytic virus is a herpes simplex virus (HSV), and the viral genes required for viral replication include any of UL1, UL5, UL6, UL7, UL8, UL9, UL11, UL12, UL14, UL15, UL17, UL18, UL19, UL20, UL22, UL25, UL26, UL26.5, UL27, UL28, UL29, UL30, UL31, UL32, UL33, UL34, UL35, UL36, UL37, UL38, UL39, UL40, UL42, UL48, UL49, UL52, UL53, UL54, ICP0, ICP4, ICP22, ICP27, ICP34.5, ICP47, gamma-34.5, US3, US4, US5, US6, US7, US8, US9, US10, US11, and/or US12. In certain embodiments, the oncolytic virus is HSV and comprises one or more miRNA target sequences incorporated into the 5 or 3 UTR of one or more essential viral genes. In some embodiments, the oncolytic virus is HSV, and the one or more miRNA target sequences is incorporated into one or more of ICP4, ICP27, UL8, UL42, UL19, and ICP34.5. In some embodiments, the oncolytic virus is HSV, and the one or more miRNA target sequences is incorporated into the 5 or 3 UTR of one or more of ICP4, ICP27, UL8, UL42, UL19, and ICP34.5

(104) miRNA Target Sequence Cassettes

(105) In animals, genes for miRNAs are transcribed to a primary miRNA (pri-miRNA), which is then processed in the nucleus by Drosha, a class 2 RNase III enzyme, to form a precursor miRNA (pre-miRNA) hairpin. The pre-miRNA hairpin are transported to the cytoplasm, where they are cleaved by the RNase III enzyme Dicer. This endoribonuclease interacts with 5 and 3 ends of the hairpin and cuts away the loop joining the 3 and 5 arms, yielding a duplex RNA molecule about 22 nucleotides in length. Although either strand of the duplex may potentially act as a functional miRNA, typically one strand of the miRNA is degraded and only one strand is loaded onto the Argonaute (Ago) protein to produce the effector RNA-induced silencing complex (RISC) where the miRNA and its mRNA target interact (Wahid et al., 1803:11, 2010, 1231-1243).

(106) Herein, the gene encoding a particular miRNA is referenced as MIR followed by the miRNA number. The intermediate hairpin pre-miRNA molecules are referenced as mir- followed by the miRNA number, while the mature single-stranded miRNA molecule is referenced as miR- followed by the miRNA number. For example, MIR122 refers to the gene encoding a hairpin mir-122 pre-miRNA molecule, which is then processed into a mature miR-122 molecule. Due to the hairpin structure of the pre-miRNA, it is possible that two mature microRNAs can originate from opposite arms of the same pre-miRNA. In some instances, expression data clearly identify one strand as the predominantly expressed miRNA and the other as the minor product. In such instances, the mature miRNA sequences are assigned names of the form miR-## (the predominant product) and miR-##* (minor product from the opposite arm of the precursor). For example, the major and minor products of mir-56 are denoted as miR-56 and miR-56*, respectively. When the existing data are not sufficient to determine which sequence is the predominant one, or when they are found in roughly similar amounts, the two mature miRNA products are denoted as miR-##-5p (from the 5 arm of the pre-miRNA hairpin) and miR-##-3p (from the 3 arm of the pre-miRNA hairpin). For example, the two mature miRNA products of mir-142 are denoted as miR-142-5p and miR-142-3p. Because they originate from opposite ends of the pre-miRNA hairpin, the -3p and -5p products of a particular miRNA will comprise different RNA sequences and will therefore recognize different target sequences.

(107) Herein, miRNA target sequences are inserted into the locus of one or more essential viral genes in the form of a miR target sequence cassette or miR-TS cassette. A miR-TS cassette which refers to a polynucleotide sequence comprising one or more miRNA target sequences and capable of being inserted into a specific locus of a viral gene. When transcribed, the mRNA transcripts of a viral gene comprising a miR-TS cassette will comprise one or more miRNA target sequences. In some embodiments, the miR-TS cassettes described herein comprise at least one miRNA target sequence. In some embodiments, the miR-TS cassettes described herein comprise a plurality of miRNA target sequences. For example, in some embodiments, the miR-TS cassettes described herein comprise 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more miRNA target sequences. In such embodiments, wherein the miR-TS cassettes comprise two or more miRNA target sequences, the two or more target sequences are arranged such that the total length of the miR-TS cassette (m) is less than or equal to the average length of the miRNA target sequences (n) multiplied by the total number of miRNA target sequences in the cassette (y) plus the average length of a linker sequence (l) multiplied by the total number of miRNA target sequences in the cassette plus 1 (y+1). Thus, the length of a miR-TS cassette (m) can be represented by the formula: m(n*y)+(l*(y+1)), wherein n=the average length of the miRNA target sequences, l=the average length of the linker sequences, and y=the total number of target sequences in the miR-TS cassette). As an illustrative example, if a miR-TS cassettes comprises 4 miRNA target sequences (y) with an average length of 21 nt (n), and the average length of the linker sequences is between 4 and 25 nt (l), the length of the miR-TS cassette (m) is between about 104 nt and about 205 nt.

(108) As used herein, the length of a miR-TS cassette is defined as the total number of nucleotides (basepairs for double-stranded polynucleotides) from the 5 nucleotide of the first miR-TS to the 3 nucleotide of the last miR-TS in the polynucleotide, inclusive of any intervening sequences. For non-overlapping miR-TSs, the minimum length of a miR-TS cassette will be the sum of the lengths of the miR-TSs. Spacers increase the length. The choice of spacer length determines the number of additional nucleotides in the cassette. Longer spacers increase the length of the cassette more than shorter spacers. By recognizing that shorter spacers (as short as 0, 1, 2, 3, 4, 5, or 6 nt) can be used when miR-TSs are interleaved (minimizing the number of mi-TSs for the same miRNA that are adjacent to one another)the interleaved miR-TSs serving to increase the space between the other miR-TSsthe present inventors have determined that it is possible to generate shorter miR-TS cassettes than is possible in miR-TS cassettes in which miR-TSs for the same miRNA are arrayed in tandem, e.g. four of one type followed by four of the next type. In some embodiments, the length of the miR-TS cassette is less than 1000 nt. In some embodiments, the length of the miR-TS cassette is less than 900 nt, less than 800 nt, less than 700 nt, less than 600 nt, less than 500 nt, less than 400 nt, less than 300 nt, less than 200 nt, less than 100 nt, or less than 50 nt. In some embodiments, the length of the miR-TS cassette is less than 26, 27, 28, 29, or 30 nt times the number of miR-TS sites, less than about 30 nt times the number of miR-TS sites, less than about 35 nt times the number of miR-TS sites, or less than about 40 nt times the number of miR-TS sites.

(109) In some embodiments, the miR-TS cassettes comprise a plurality miRNA target sequences, wherein each miRNA target sequence in the plurality is a target sequence for the same miRNA. For example, the miR-TS cassettes may comprise 2, 3, 4, 5, 6, 7, 8, 9, 10 or more copies of the same miR target sequence. In some embodiments, the miR-TS cassettes comprise between 2 to 6 copies of the same miR target sequence. In some embodiments, the miR-TS cassettes comprise 3 copies of the same miR target sequence. In some embodiments, the miR-TS cassettes comprise 4 copies of the same miR target sequence.

(110) In some embodiments, the miR-TS cassettes described herein comprise a plurality of miRNA target sequences, wherein the plurality comprises at least two different miRNA target sequences. In some embodiments, the miR-TS cassettes described herein comprise 2, 3, 4, 5, 6, 7, 8, 9, or 10 different miRNA target sequences. For example, in some embodiments, the miR-TS cassette may one or more copies of a first miRNA target sequence and one or more copies of a second miRNA target sequence. In some embodiments, the miR-TS cassette comprises at least 2, 3, 4, 5, 6, 7, 8, 9, 10, or more copies of a first miR target sequence and at least 2, 3, 4, 5, 6, 7, 8, 9, 10, or more copies of a second miR target sequence. In some embodiments, the miR-TS cassette comprises 3 or 4 copies of a first miR target sequence and 3 or 4 copies of a second miR target sequence. In some embodiments, the plurality of miRNA target sequences comprises at least 3 different miRNA target sequences. For example, in some embodiments, the miR-TS cassette comprises one or more copies of a first miR target sequence, one or more copies of a second miR target sequence, and one or more copies of a third miR target sequence. In some embodiments, the miR-TS cassette comprises at least 2, 3, 4, 5, 6, 7, 8, 9, 10, or more copies of a first miR target sequence, at least 2, 3, 4, 5, 6, 7, 8, 9, 10, or more copies of a second miR target sequence, and at least 2, 3, 4, 5, 6, 7, 8, 9, 10, or more copies of a third miR target sequence. In some embodiments, the miR-TS cassette comprises 3 or 4 copies of a first miR target sequence, 3 or 4 copies of a second miR target sequence, and 3 or 4 copies of a third miR target sequence. In some embodiments, the plurality of miRNA target sequences comprises at least 4 different miRNA target sequences. For example, in some embodiments, the miR-TS cassette comprises one or more copies of a first miR target sequence, one or more copies of a second miR target sequence, one or more copies of a third miR target sequence, and one or more copies of a fourth miR target sequence. In some embodiments, the miR-TS cassette comprises at least 2, 3, 4, 5, 6, 7, 8, 9, 10, or more copies of a first miR target sequence, at least 2, 3, 4, 5, 6, 7, 8, 9, 10, or more copies of a second miR target sequence, at least 2, 3, 4, 5, 6, 7, 8, 9, 10, or more copies of a third miR target sequence, and at least 2, 3, 4, 5, 6, 7, 8, 9, 10, or more copies of a fourth miR target sequence. In some embodiments, the miR-TS cassette comprises 3 or 4 copies of a first miR target sequence, 3 or 4 copies of a second miR target sequence, 3 or 4 copies of a third miR target sequence, and 3 or 4 copies of a fourth miR target sequence. In some embodiments, the miR-TS cassettes described herein comprise a plurality of miRNA target sequences, wherein

(111) In some aspects, wherein the miR-TS cassettes comprise a plurality of miRNA target sequences, the plurality of miRNA target sequences may arranged in tandem, without any intervening nucleic acid sequences. In some aspects, the plurality of miRNA target sequences may be separated by a linker sequence. In some embodiments, the linker sequence comprises 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, or more nucleotides. In some embodiments, the linker sequence comprises about 4 to about 20 nucleotides. In further embodiments, the linker sequence comprises about 4 to about 16 nucleotides. As an illustrative embodiment, a miR-TS cassette may comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more of the following subunits: (a) a first miRNA target sequence-linker-a second miRNA target sequence, wherein adjacent subunits are separated by an additional linker sequence. In some embodiments, the first and the second miRNA target sequence are targets of the same miRNA. In some embodiments, the first and the second miRNA target sequence are targets of different miRNAs.

(112) In some embodiments, miR-TS cassettes described herein comprise a miRNA target sequence that is at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the reverse complement of a sequence selected from SEQ ID NOs: 1-803. In some embodiments, miR-TS cassettes described herein comprise a miRNA target sequence that comprises or consists of the reverse complement of a sequence selected from SEQ ID NOs: 1-803.

(113) In some embodiments, the miR-TS cassettes described herein comprise at least 1, at least 2, at least 3, or at least 4 miR-122-5p target sequences. In some embodiments, the miR-122-5p target sequences are at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 804. In some embodiments, the miR-122-5p target sequences comprise or consist of SEQ ID NO: 804. In some embodiments, the miR-TS cassettes described herein comprise at least 1, at least 2, at least 3, or at least 4 miR-124-3p target sequences. In some embodiments, the miR-124-3p target sequences are at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 805. In some embodiments, the miR-124-3p target sequences comprise or consist of SEQ ID NO: 805. In some embodiments, the miR-TS cassettes described herein comprise at least 1, at least 2, at least 3, or at least 4 miR-125a-5p target sequences. In some embodiments, the miR-125a-5p target sequences are at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 806. In some embodiments, the miR-125a-5p target sequences comprise or consist of SEQ ID NO: 806.

(114) In some embodiments, the miR-TS cassettes described herein comprise at least 1, at least 2, at least 3, or at least 4 miR-126-3p target sequences. In some embodiments, the miR-126-3p target sequences are at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 807 or SEQ ID NO: 808. In some embodiments, the miR-126-3p target sequences comprise or consist of SEQ ID NO: 807 or SEQ ID NO: 808. In some embodiments, the miR-TS cassettes described herein comprise at least 1, at least 2, at least 3, or at least 4 miR-127a-3p target sequences. In some embodiments, the miR-127a-3p target sequences are at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 809. In some embodiments, the miR-127a-3p target sequences comprise or consist of SEQ ID NO: 809.

(115) In some embodiments, the miR-TS cassettes described herein comprise at least 1, at least 2, at least 3, or at least 4 miR-128-3p target sequences. In some embodiments, the miR-128-3p target sequences are at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 810 or SEQ ID NO: 811. In some embodiments, the miR-128-3p target sequences comprise or consist of SEQ ID NO: 810 or SEQ ID NO: 811. In some embodiments, the miR-TS cassettes described herein comprise at least 1, at least 2, at least 3, or at least 4 miR-129-3p target sequences. In some embodiments, the miR-129-3p target sequences are at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 812. In some embodiments, the miR-129-3p target sequences comprise or consist of SEQ ID NO: 812.

(116) In some embodiments, the miR-TS cassettes described herein comprise at least 1, at least 2, at least 3, or at least 4 miR-129-5p target sequences. In some embodiments, the miR-129-5p target sequences are at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 813. In some embodiments, the miR-129-5p target sequences comprise or consist of SEQ ID NO: 813. In some embodiments, the miR-TS cassettes described herein comprise at least 1, at least 2, at least 3, or at least 4 miR-130b-3p target sequences. In some embodiments, the miR-130b-3p target sequences are at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 814. In some embodiments, the miR-130b-3p target sequences comprise or consist of SEQ ID NO: 814. In some embodiments, the miR-TS cassettes described herein comprise at least 1, at least 2, at least 3, or at least 4 miR-130b-5p target sequences. In some embodiments, the miR-130b-5p target sequences are at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 815. In some embodiments, the miR-130b-5p target sequences comprise or consist of SEQ ID NO: 815.

(117) In some embodiments, the miR-TS cassettes described herein comprise at least 1, at least 2, at least 3, or at least 4 miR-133a-3p target sequences. In some embodiments, the miR-133a-3p target sequences are at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 816. In some embodiments, the miR-133a-3p target sequences comprise or consist of SEQ ID NO: 816. In some embodiments, the miR-TS cassettes described herein comprise at least 1, at least 2, at least 3, or at least 4 miR-133b-3p target sequences. In some embodiments, the miR-133b-3p target sequences are at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 817. In some embodiments, the miR-133b-3p target sequences comprise or consist of SEQ ID NO: 817. In some embodiments, the miR-TS cassettes described herein comprise at least 1, at least 2, at least 3, or at least 4 miR-134-3p target sequences. In some embodiments, the miR-134-3p target sequences are at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 818. In some embodiments, the miR-134-3p target sequences comprise or consist of SEQ ID NO: 818.

(118) In some embodiments, the miR-TS cassettes described herein comprise at least 1, at least 2, at least 3, or at least 4 miR-137-3p target sequences. In some embodiments, the miR-137-3p target sequences are at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 819. In some embodiments, the miR-137-3p target sequences comprise or consist of SEQ ID NO: 819. In some embodiments, the miR-TS cassettes described herein comprise at least 1, at least 2, at least 3, or at least 4 miR-1-3p target sequences. In some embodiments, the miR-1-3p target sequences are at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 820. In some embodiments, the miR-1-3p target sequences comprise or consist of SEQ ID NO: 820. In some embodiments, the miR-TS cassettes described herein comprise at least 1, at least 2, at least 3, or at least 4 miR-143-3p target sequences. In some embodiments, the miR-143-3p target sequences are at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 821. In some embodiments, miR-143-3p target sequences comprise or consist of SEQ ID NO: 821.

(119) In some embodiments, the miR-TS cassettes described herein comprise at least 1, at least 2, at least 3, or at least 4 miR-145-3p target sequences. In some embodiments, the miR-145-3p target sequences are at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 822. In some embodiments, the miR-145-3p target sequences comprise or consist of SEQ ID NO: 822. In some embodiments, the miR-TS cassettes described herein comprise at least 1, at least 2, at least 3, or at least 4 miR-145-5p target sequences. In some embodiments, the miR-145-5p target sequences are at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 823. In some embodiments, the miR-145-5p target sequences comprise or consist of SEQ ID NO: 823. In some embodiments, the miR-TS cassettes described herein comprise at least 1, at least 2, at least 3, or at least 4 miR-184-3p target sequences. In some embodiments, the miR-184-3p target sequences are at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 824. In some embodiments, the miR-184-3p target sequences comprise or consist of SEQ ID NO: 824.

(120) In some embodiments, the miR-TS cassettes described herein comprise at least 1, at least 2, at least 3, or at least 4 miR-199a-3p target sequences. In some embodiments, the miR-199a-3p target sequences are at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 825. In some embodiments, the miR-199a-3p target sequences comprise or consist of SEQ ID NO: 825. In some embodiments, the miR-TS cassettes described herein comprise at least 1, at least 2, at least 3, or at least 4 miR-199a-5p target sequences. In some embodiments, the miR-199a-5p target sequences are at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 826. In some embodiments, the miR-199a-5p target sequences comprise or consist of SEQ ID NO: 826. In some embodiments, the miR-TS cassettes described herein comprise at least 1, at least 2, at least 3, or at least 4 miR-204-5p target sequences. In some embodiments, the miR-204-5p target sequences are at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 827. In some embodiments, the miR-204-5p target sequences comprise or consist of SEQ ID NO: 827.

(121) In some embodiments, the miR-TS cassettes described herein comprise at least 1, at least 2, at least 3, or at least 4 miR-208b-3p target sequences. In some embodiments, the miR-208b-3p target sequences are at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 828. In some embodiments, the miR-208b-3p target sequences comprise or consist of SEQ ID NO: 828. In some embodiments, the miR-TS cassettes described herein comprise at least 1, at least 2, at least 3, or at least 4 miR-214-3p target sequences. In some embodiments, the miR-214-3p target sequences are at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 829. In some embodiments, the miR-214-3p target sequences comprise or consist of SEQ ID NO: 829. In some embodiments, the miR-TS cassettes described herein comprise at least 1, at least 2, at least 3, or at least 4 miR-217-5p target sequences. In some embodiments, the miR-217-5p target sequences are at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 830. In some embodiments, the miR-217-5p target sequences comprise or consist of SEQ ID NO: 830.

(122) In some embodiments, the miR-TS cassettes described herein comprise at least 1, at least 2, at least 3, or at least 4 miR-219a-5p target sequences. In some embodiments, the miR-219a-5p target sequences are at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 831. In some embodiments, the miR-219a-5p target sequences comprise or consist of SEQ ID NO: 831. In some embodiments, the miR-TS cassettes described herein comprise at least 1, at least 2, at least 3, or at least 4 miR-223-3p target sequences. In some embodiments, the miR-223-3p target sequences are at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 832. In some embodiments, the miR-223-3p target sequences comprise or consist of SEQ ID NO: 832. In some embodiments, the miR-TS cassettes described herein comprise at least 1, at least 2, at least 3, or at least 4 miR-34a-5p target sequences. In some embodiments, the miR-34a-5p target sequences are at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 833. In some embodiments, the miR-34a-5p target sequences comprise or consist of SEQ ID NO: 833.

(123) n some embodiments, the miR-TS cassettes described herein comprise at least 1, at least 2, at least 3, or at least 4 miR-451a target sequences. In some embodiments, the miR-451a target sequences are at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 834. In some embodiments, the miR-451a target sequences comprise or consist of SEQ ID NO: 834. In some embodiments, the miR-TS cassettes described herein comprise at least 1, at least 2, at least 3, or at least 4 miR-559-5p target sequences. In some embodiments, the miR-559-5p target sequences are at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 835. In some embodiments, the miR-559-5p target sequences comprise or consist of SEQ ID NO: 835. In some embodiments, the miR-TS cassettes described herein comprise at least 1, at least 2, at least 3, or at least 4 miR-Let-7a-5p target sequences. In some embodiments, the miR-Let-7a-5p target sequences are at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 836. In some embodiments, the miR-Let-7a-5p target sequences comprise or consist of SEQ ID NO: 836. In some embodiments, the miR-TS cassettes described herein comprise at least 1, at least 2, at least 3, or at least 4 miR-9-5p target sequences. In some embodiments, the miR-9-5p target sequences are at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 837. In some embodiments, the miR-9-5p target sequences comprise or consist of SEQ ID NO: 837.

(124) Table 10 below provides sequences of exemplary miRNAs that can bind to the miRNA target sequences in the oncolytic viruses described herein. Additional miRNA sequences are provided in SEQ ID NOs: 33-803.

(125) TABLE-US-00002 TABLE10 ExemplarymiRNAsandTargetSequences SEQ SEQ miRNA miRNASequence ID: miR-TS ID: 122-5p uggagugugacaaugguguuug 1 caaacaccattgtcacactcca 804 124-3p uaaggcacgcggugaaugcc 2 ggcattcaccgcgtgcctta 805 125a-5p ucccugagacccuuuaaccuguga 3 tcacaggttaaagggtctcaggga 806 126-3p ucguaccgugaguaauaaugcg 4 cgcattattactcacggtacga 807 cacattattactcacggtacga 808 127a-3p ucggauccgucugagcuuggcu 5 agccaagctcagacggatccga 809 128-3p ucacagugaaccggucucuuu 6 aaagagaccggttcactgtga 810 aaagagaccggttcactgtgg 811 129-3p aagcccuuaccccaaaaaguau 7 atactttttggggtaagggctt 812 129-5p cuuuuugcggucugggcuugc 8 gcaagcccagaccgcaaaaag 813 130b-3p cagugcaaugaugaaagggcau 9 atgccctttcatcattgcactg 814 130b-5p acucuuucccuguugcacuac 10 gtagtgcaacagggaaagagt 815 133a-3p uuugguccccuucaaccagcug 11 cagctggttgaaggggaccaaa 816 133b-3p uuugguccccuucaaccagcua 12 tagctggttgaaggggaccaaa 817 134-3p ccugugggccaccuagucaccaa 13 ttggtgactaggtggcccacagg 818 137_3p uuauugcuuaagaauacgcguag 14 ctacgcgtattcttaagcaataa 819 1-3p uggaauguaaagaaguauguau 15 atacatacttctttacattcca 820 143-3p ugagaugaagcacuguagcuc 16 gagctacagtgcttcatctca 821 145-3p ggauuccuggaaauacuguucu 17 agaacagtatttccaggaatcc 822 145-5p guccaguuuucccaggaaucccu 18 agggattcctgggaaaactggac 823 184-3p uggacggagaacugauaagggu 19 acccttatcagttctccgtcca 824 199a-3p acaguagucugcacauugguua 20 taaccaatgtgcagactactgt 825 199a-5p cccaguguucagacuaccuguuc 21 gaacaggtagtctgaacactggg 826 204-5p uucccuuugucauccuaugccu 22 aggcataggatgacaaagggaa 827 208b-3p auaagacgaacaaaagguuugu 23 acaaaccttttgttcgtcttat 828 214-3p acagcaggcacagacaggcagu 24 actgcctgtctgtgcctgctgt 829 217-5p uacugcaucaggaacugauugga 25 tccaatcagttcctgatgcagta 830 219a-5p ugauuguccaaacgcaauucu 26 agaattgcgtttggacaatca 831 223-3p ugucaguuugucaaauacccca 27 tggggtatttgacaaactgaca 832 34a-5p uggcagugucuuagcugguugu 28 acaaccagctaagacactgcca 833 451a aaaccguuaccauuacugaguu 29 aactcagtaatggtaacggttt 834 559-5p uaaaguaaauaugcaccaaaa 30 ttttggtgcatatttacttta 835 Let7a-5p ugagguaguagguuguauaguu 31 aactatacaacctactacctca 836 9-5p ucuuugguuaucuagcuguauga 32 tcatacagctagataaccaaaga 837

(126) In some embodiments, the miR-TS cassettes comprise one or more additional polynucleotide sequences that enable the cassette to be inserted into the locus of a viral gene. For example, a miR-TS cassette may further comprise short polynucleotide sequence on the 5 and 3 ends that are complementary to a nucleic acid sequence at a desired location in the viral genome. Such sequences are referred to herein as homology arms and facilitate the insertion of a miR-TS cassette into a specific location in the viral genome.

(127) In some embodiments, the miR-TS cassettes disclosed comprise two or more pluralities of miR-TSs each corresponding to a different miRNA and the miR-TSs are selected to protect diverse cell types or organs from an oncolytic virus. In some embodiments, the pluralities of miR-TSs are interleaved rather than in tandem to one another. In some embodiments, the miR-TS cassettes have short (e.g., 4-15 nt in length) spacers, resulting in a more compact cassette. In some embodiments, the miR-TS cassettes are free from (or have reduced) RNA secondary structures that inhibit activity of the miR-TSs. In some embodiments, the miR-TS cassettes are free from (or have reduced) seed sequences for miRNAs associated with carcinogenesis, malignant transformation, or metastasis (i.e., oncomiRs). In some embodiments, the miR-TS cassettes are free from (or have reduced) polyadenylation sites.

(128) Oncolytic Viruses Comprising miR-TS Cassettes

(129) In some embodiments, a recombinant oncolytic virus may comprise one miR-TS cassette incorporated into a locus of one essential viral gene, wherein the miR-TS cassette comprises a plurality of miRNA target sequences, such that the recombinant oncolytic virus comprises a plurality of miRNA target sequences incorporated into a locus of one essential viral gene. In some aspects, the miR-TS cassette may comprise a plurality of miRNA target sequences, wherein each miRNA target sequence of the plurality is a target for the same miRNA, such that the recombinant oncolytic virus comprises a plurality (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) copies of the same miRNA target sequence incorporated into a locus of an essential viral gene. For example, in some embodiments, a recombinant oncolytic HSV may comprise a miR-TS cassette comprising 2, 3, 4, 5, 6 or more target sequences inserted into one of ICP4, ICP27, ICP8, ICP22, ICP34.5, UL5, UL8, UL9, UL30, UL39/40, or UL42. In some embodiments, a recombinant oncolytic HSV may comprise a miR-TS cassette comprising 2, 3, 4, or more target sequences inserted into one of ICP8, ICP22, ICP34.5, UL5, UL8, UL9, UL30, UL39/40, or UL42. In some embodiments, a recombinant oncolytic HSV may comprise a miR-TS cassette comprising 2, 3, 4, 5, 6 or more target sequence inserted into one of ICP4, ICP27, ICP34.5, UL8, or UL9.

(130) In some aspects, the plurality of miRNA target sequences comprises at least two different miRNA target sequences, at least three different miRNA target sequences, or at least four different miRNA target sequences, such that the recombinant oncolytic virus comprises one or more copies of at least 2, 3, or 4 different miRNA target sequence incorporated into a locus of an essential viral gene. For example, in some embodiments, a recombinant oncolytic HSV may comprise a miR-TS cassette comprising one or more target sequences for miR-122-5p, miR-34a-5p, and miR-Let-7a-5p inserted into one of ICP4, ICP27, ICP8, ICP22, ICP34.5, UL5, UL8, UL9, UL30, UL39/40, or UL42. In some embodiments, a recombinant oncolytic HSV may comprise a miR-TS cassette comprising one or more target sequences for miR-122-5p, miR-34a-5p, and miR-Let-7a-5p inserted into one of ICP8, ICP22, ICP34.5, UL5, UL8, UL9, UL30, UL39/40, or UL42. In some embodiments, a recombinant oncolytic HSV may comprise a miR-TS cassette comprising one or more target sequences for miR-122-5p, miR-34a-5p, and miR-Let-7a-5p inserted into one of ICP4, ICP27, ICP34.5, UL8, or UL9. In some embodiments, a recombinant oncolytic HSV may comprise a miR-TS cassette comprising one or more target sequences for miR-122-5p, miR-184-3p, and miR-Let-7a-5p inserted into one of ICP4, ICP27, ICP8, ICP22, ICP34.5, UL5, UL8, UL9, UL30, UL39/40, or UL42. In some embodiments, a recombinant oncolytic HSV may comprise a miR-TS cassette comprising one or more target sequences for miR-122-5p, miR-184-3p, and miR-Let-7a-5p inserted into one of ICP8, ICP22, ICP34.5, UL5, UL8, UL9, UL30, UL39/40, or UL42. In some embodiments, a recombinant oncolytic HSV may comprise a miR-TS cassette comprising one or more target sequences for miR-122-5p, miR-184-3p, and miR-Let-7a-5p inserted into one of ICP4, ICP27, ICP34.5, UL8, or UL9.

(131) In some embodiments, a recombinant oncolytic HSV may comprise a miR-TS cassette comprising one or more target sequences for miR-122-5p and miR-Let-7a-5p inserted into one of ICP4, ICP27, ICP8, ICP22, ICP34.5, UL5, UL8, UL9, UL30, UL39/40, or UL42. In some embodiments, a recombinant oncolytic HSV may comprise a miR-TS cassette comprising one or more target sequences for miR-122-5p and miR-Let-7a-5p inserted into one of ICP8, ICP22, ICP34.5, UL5, UL8, UL9, UL30, UL39/40, or UL42. In some embodiments, a recombinant oncolytic HSV may comprise a miR-TS cassette comprising one or more target sequences for miR-122-5p and miR-Let-7a-5p inserted into one of ICP4, ICP27, ICP34.5, UL8, or UL9. In some embodiments, a recombinant oncolytic HSV may comprise a miR-TS cassette comprising one or more target sequences for miR-145-5p, miR-199a-5p, and miR-599-5p inserted into one of ICP4, ICP27, ICP8, ICP22, ICP34.5, UL5, UL8, UL9, UL30, UL39/40, or UL42. In some embodiments, a recombinant oncolytic HSV may comprise a miR-TS cassette comprising one or more target sequences for miR-145-5p, miR-199a-5p, and miR-599-5p inserted into one of ICP8, ICP22, ICP34.5, UL5, UL8, UL9, UL30, UL39/40, or UL42. In some embodiments, a recombinant oncolytic HSV may comprise a miR-TS cassette comprising one or more target sequences for miR-145-5p, miR-199a-5p, and miR-599-5p inserted into one of ICP4, ICP27, ICP34.5, UL8, or UL9.

(132) In some embodiments, a recombinant oncolytic HSV may comprise a miR-TS cassette comprising one or more target sequences for miR-124-3p, miR-1-3p, and miR-124-3p inserted into one of ICP4, ICP27, ICP8, ICP22, ICP34.5, UL5, UL8, UL9, UL30, UL39/40, or UL42. In some embodiments, a recombinant oncolytic HSV may comprise a miR-TS cassette comprising one or more target sequences for miR-124-3p, miR-1-3p, and miR-124-3p inserted into one of ICP8, ICP22, ICP34.5, UL5, UL8, UL9, UL30, UL39/40, or UL42. In some embodiments, a recombinant oncolytic HSV may comprise a miR-TS cassette comprising one or more target sequences for miR-124-3p, miR-1-3p, and miR-124-3p inserted into one of ICP4, ICP27, ICP34.5, UL8, or UL9. In some embodiments, a recombinant oncolytic HSV may comprise a miR-TS cassette comprising one or more target sequences for miR-219a-5p, miR-122-5p, and miR-128-3p inserted into one of ICP4, ICP27, ICP8, ICP22, ICP34.5, UL5, UL8, UL9, UL30, UL39/40, or UL42. In some embodiments, a recombinant oncolytic HSV may comprise a miR-TS cassette comprising one or more target sequences for miR-219a-5p, miR-122-5p, and miR-128-3p inserted into one of ICP8, ICP22, ICP34.5, UL5, UL8, UL9, UL30, UL39/40, or UL42. In some embodiments, a recombinant oncolytic HSV may comprise a miR-TS cassette comprising one or more target sequences for miR-219a-5p, miR-122-5p, and miR-128-3p inserted into one of ICP4, ICP27, ICP34.5, UL8, or UL9.

(133) In some embodiments, a recombinant oncolytic HSV may comprise a miR-TS cassette comprising one or more target sequences for miR-137-3p, miR-208b-3p, and miR-126-3p inserted into one of ICP4, ICP27, ICP8, ICP22, ICP34.5, UL5, UL8, UL9, UL30, UL39/40, or UL42. In some embodiments, a recombinant oncolytic HSV may comprise a miR-TS cassette comprising one or more target sequences for miR-137-3p, miR-208b-3p, and miR-126-3p inserted into one of ICP8, ICP22, ICP34.5, UL5, UL8, UL9, UL30, UL39/40, or UL42. In some embodiments, a recombinant oncolytic HSV may comprise a miR-TS cassette comprising one or more target sequences for miR-137-3p, miR-208b-3p, and miR-126-3p inserted into one of ICP4, ICP27, ICP34.5, UL8, or UL9. In some embodiments, a recombinant oncolytic HSV may comprise a miR-TS cassette comprising one or more target sequences for miR-137-3p, miR-217-3p, and miR-126-3p inserted into one of ICP4, ICP27, ICP8, ICP22, ICP34.5, UL5, UL8, UL9, UL30, UL39/40, or UL42. In some embodiments, a recombinant oncolytic HSV may comprise a miR-TS cassette comprising one or more target sequences for miR-137-3p, miR-217-3p, and miR-126-3p inserted into one of ICP8, ICP22, ICP34.5, UL5, UL8, UL9, UL30, UL39/40, or UL42. In some embodiments, a recombinant oncolytic HSV may comprise a miR-TS cassette comprising one or more target sequences for miR-137-3p, miR-217-3p, and miR-126-3p inserted into one of ICP4, ICP27, ICP34.5, UL8, or UL9.

(134) In some embodiments, a recombinant oncolytic HSV may comprise a miR-TS cassette comprising one or more target sequences for miR-128-3p, miR-204-5p, and miR-219-5p inserted into one of ICP4, ICP27, ICP8, ICP22, ICP34.5, UL5, UL8, UL9, UL30, UL39/40, or UL42. In some embodiments, a recombinant oncolytic HSV may comprise a miR-TS cassette comprising one or more target sequences for miR-128-3p, miR-204-5p, and miR-219-5p inserted into one of ICP8, ICP22, ICP34.5, UL5, UL8, UL9, UL30, UL39/40, or UL42. In some embodiments, a recombinant oncolytic HSV may comprise a miR-TS cassette comprising one or more target sequences for miR-128-3p, miR-204-5p, and miR-219-5p inserted into one of ICP4, ICP27, ICP34.5, UL8, or UL9.

(135) In some embodiments, a recombinant oncolytic virus may comprise one miR-TS cassette incorporated into the 3 or 5 untranslated region (UTR) of the viral genome. In such embodiments, the miR-TS cassette may comprise one copy of a miRNA target sequence, such that the recombinant oncolytic virus comprises one copy of a miRNA target sequence incorporated into the 3 or 5 UTR of the viral genome. For example, in some embodiments, a recombinant polio virus, SVV, or Coxsackievirus may comprise a miR-TS cassette comprising a miRNA target sequence shown in Table 10 inserted into the 3 or 5 UTR of the viral genome. In some embodiments, a recombinant oncolytic virus may comprise one miR-TS cassette incorporated into the 3 or 5 UTR of the viral genome, wherein the miR-TS cassette comprises a plurality of miRNA target sequences shown in Table 10, such that the recombinant oncolytic virus comprises a plurality of miRNA target sequences incorporated into the 3 or 5 UTR of the viral genome.

(136) In some aspects, the plurality of miRNA target sequences comprises at least two different miRNA target sequences, at least three different miRNA target sequences, or at least four different miRNA target sequences, such that the recombinant oncolytic virus comprises one or more copies of at least 2, 3, or 4 different miRNA target sequence incorporated into the 3 or 5 UTR of the viral genome. For example, in some embodiments, a recombinant polio virus, SVV, or Coxsackievirus may comprise a miR-TS cassette comprising one or more copies of at least 2, 3, or 4 different miRNA target sequences selected from Table 10 inserted into the 3 or 5 UTR of the viral genome.

(137) In some embodiments, a recombinant oncolytic virus may comprise a miR-TS cassette incorporated into a locus of two or more essential viral genes. In some embodiments, the recombinant oncolytic virus is an HSV virus and the two or more essential viral genes are selected from the group consisting of ICP4, ICP27, ICP8, ICP22, ICP34.5, UL5, UL8, UL9, UL30, UL39/40, or UL42. In some embodiments, the recombinant oncolytic virus is an HSV virus and the two or more essential viral genes are selected from the group consisting of ICP8, ICP22, ICP34.5, UL5, UL8, UL9, UL30, UL39/40, or UL42. In some embodiments, the recombinant oncolytic virus is an HSV virus and the two or more essential viral genes are selected from the group consisting of ICP4, ICP27, ICP34.5, UL8, or UL9. In some embodiments, the recombinant oncolytic virus is an HSV virus and the two or more essential viral genes are selected from the group consisting of ICP27, ICP4, ICP34.5, UL8, and UL42.

(138) In some embodiments, the recombinant oncolytic virus is an HSV virus comprising (i) a first miR-TS cassette comprising a plurality of miRNA target sequences inserted into a locus of ICP4 and a second miR-TS cassette comprising a plurality of miRNA target sequences into a locus of ICP27. In some embodiments, the first miR-TS cassette is inserted into a locus of ICP4 and comprises 1, 2, 3, or 4 copies of a target sequence for miR-124. In some embodiments, the first miR-TS cassette is inserted into a locus of ICP4 and comprises 1, 2, 3, or 4 copies of a target sequence for miR-124; 1, 2, 3, or 4 copies of a target sequence for miR-1-3p; and 1, 2, 3, or 4 copies of a target sequence for miR-143-3p. In some embodiments, the plurality of miRNA target sequences in the first miR-TS cassettes are arranged as follows: (a) (124-3p)-(124-3p)-(124-3p)-(124-3p); (b) (124-3p)-(124-3p)-(124-3p)-(124-3p)-(1-3p)-(143-3p)-(1-3p)-(143-3p)-(1-3p)-(143-3p)-(1-3p)-(143-3p).

(139) In some embodiments, the second miR-TS cassette is inserted into a locus of ICP27 and comprises 1, 2, 3, or 4 copies of a target sequence for miR-1-3p; 1, 2, 3, or 4 copies of a target sequence for miR-145-5p; 1, 2, 3, or 4 copies of a target sequence for miR-199-5p; and 1, 2, 3, or 4 copies of a target sequence for miR-559. In some embodiments, the second miR-TS cassette is inserted into a locus of ICP27 and comprises 1, 2, 3, or 4 copies of a target sequence for miR-219a-5p; 1, 2, 3, or 4 copies of a target sequence for miR-122-5p; and 1, 2, 3, or 4 copies of a target sequence for miR-128.

(140) In some embodiments, the first miR-TS cassette comprises 4 copies of a target sequence for miR-124 and the second miR-TS cassette comprises 2, 3, or more copies of a target sequence for each of 1-3p, 145-5p, 199a-5p, and 559. In some embodiments, the first miR-TS cassette comprises 4 copies of a target sequence for miR-124 and the second miR-TS cassette comprises 4 copies of a target sequence for each of 219a-5p, 122-5p, 128T.

(141) In some embodiments, the recombinant oncolytic virus is an HSV virus comprising (i) a first miR-TS cassette comprising a plurality of miRNA target sequences inserted into a locus of ICP4; and (ii) a second miR-TS cassette comprising a plurality of miRNA target sequences inserted into a locus of UL42. In some embodiments, the first miR-TS cassette is inserted into a locus of ICP4 and comprises 1, 2, 3, or 4 copies of a target sequence for miR-124. In some embodiments, the plurality of miRNA target sequences in the second miR-TS cassettes are arranged as follows: (a) (124-3p)-(124-3p)-(124-3p)-(124-3p).

(142) In some embodiments, the second miR-TS cassette is inserted into a locus of UL42 comprises 1, 2, 3, or 4 copies of a target sequence for miR-122-5p. In some embodiments, the plurality of miRNA target sequences in the second miR-TS cassettes are arranged as follows: (a) (122-5p)-(122-5p)-(122-5p).

(143) In some embodiments, the recombinant oncolytic virus is an HSV virus comprising (i) a first miR-TS cassette comprising 4 copies of a target sequence for miR-124 inserted into a locus of ICP4; and (ii) a second miR-TS cassette comprising 3 copies of a target sequence for miR-122-5p inserted into a locus of UL42.

(144) In some embodiments, the recombinant oncolytic virus is an HSV virus comprising (i) a first miR-TS cassette comprising a plurality of miRNA target sequences inserted into a locus of ICP4; (ii) a second miR-TS cassette comprising a plurality of miRNA target sequences inserted into a locus of ICP27; and (iii) a third miR-TS cassette comprising a plurality of miRNA target sequences is inserted into a locus of UL42. In some embodiments, the first miR-TS cassette is inserted into a locus of ICP4 and comprises 1, 2, 3, or 4 copies of a target sequence for miR-124. In some embodiments, the plurality of miRNA target sequences in the second miR-TS cassettes are arranged as follows: (a) (124-3p)-(124-3p)-(124-3p)-(124-3p).

(145) In some embodiments, the second miR-TS cassette is inserted into a locus of ICP27 and comprises 1, 2, 3, or 4 copies of a target sequence for miR-122. In some embodiments, the plurality of miRNA target sequences in the second miR-TS cassettes are arranged according to one of the following: (a) (122-5p); (b) (122-5p)-(122-5p)-(122-5p)-(122-5p); (c) (122-5p)-(122-5p)-(122-5p).

(146) In some embodiments, the third miR-TS cassette is inserted into a locus of UL42 and comprises 1, 2, 3, or 4 copies of a target sequence for miR-125-5p. In some embodiments, the plurality of miRNA target sequences in the third miR-TS cassettes are arranged according to one of the following: (a) (122-5p); (b) (122-5p)-(122-5p)-(122-5p)-(122-5p); (c) (122-5p)-(122-5p)-(122-5p).

(147) In some embodiments, the recombinant oncolytic virus is an HSV virus comprising (i) a first miR-TS cassette inserted into a locus of ICP4 and comprising 4 copies of a target sequence for miRNA-124-3p; (ii) a second miR-TS cassette inserted into a locus of ICP27 and comprising 1, 2, 3, or 4 copies of a target sequence for miR-122-5p; and (iii) a third miR-TS cassette inserted into a locus of UL42 and comprising 4 copies of a target sequence for miR-125-5p. In some embodiments, the recombinant oncolytic virus is an HSV virus comprising (i) a first miR-TS cassette inserted into a locus of ICP4 and comprising 4 copies of a target sequence for miRNA-124; (ii) a second miR-TS cassette inserted into a locus of ICP27 and comprising 4 copies of a target sequence for miR-122; and (iii) a third miR-TS cassette inserted into a locus of UL42 and comprising 1, 2, 3, or 4 copies of a target sequence for miR-125-5p. In some embodiments, the recombinant oncolytic virus is an HSV virus comprising (i) a first miR-TS cassette inserted into a locus of ICP4 and comprising 4 copies of a target sequence for miRNA-124; (ii) a second miR-TS cassette inserted into a locus of ICP27 and comprising 4 copies of a target sequence for miR-122-3p; and (iii) a third miR-TS cassette inserted into a locus of UL42 and comprising 4 copies of a target sequence for miR-125-5p. In some embodiments, the recombinant oncolytic virus is an HSV virus comprising (i) a first miR-TS cassette inserted into a locus of ICP4 and comprising 4 copies of a target sequence for miRNA-124-3p; (ii) a second miR-TS cassette inserted into a locus of ICP27 and comprising 3 copies of a target sequence for miR-122-3p; and (iii) a third miR-TS cassette inserted into a locus of UL42 and comprising 4 copies of a target sequence for miR-125-5p.

(148) In some embodiments, the recombinant oncolytic virus is an HSV virus comprising (i) a first miR-TS cassette comprising a plurality of miRNA target sequences inserted into a locus of ICP4; (ii) a second miR-TS cassette a plurality of miRNA target sequences inserted into a locus of UL8. In some embodiments, the first miR-TS cassette is inserted into a locus of ICP4 and comprises 1, 2, 3, or 4 copies of a target sequence for miR-124. In some embodiments, the plurality of miRNA target sequences in the second miR-TS cassettes are arranged as follows: (a) (124-3p)-(124-3p)-(124-3p)-(124-3p).

(149) In some embodiments, the second miR-TS cassette is inserted into a locus of UL8 and comprises 1, 2, 3, or 4 copies of a target sequence for each of miR-137, miR-208b-3p, and miR-126. In some embodiments, the plurality of miRNA target sequences in the second miR-TS cassettes are arranged as follows: (a) (208b-3p)-(126-3p)-(137-3p)-(208b-3p)-(137-3p)-(126-3p)-(208b-3p)-(137-3p)-(126-3p)-(137-3p)-(126-3p)-(208b-3p).

(150) In some embodiments, the recombinant oncolytic virus is an HSV virus comprising (i) a first miR-TS cassette inserted into a locus of ICP4 and comprising 4 copies of a target sequence for miR-124; (ii) a second miR-TS cassette inserted into a locus of UL8 and comprising 4 copies of a miR-137 target sequence, 4 copies of a miR-208b-3p target sequence, and 4 copies of a miR-126-3p target sequence.

(151) In some embodiments, the recombinant oncolytic virus is an HSV virus comprising (i) a first miR-TS cassette comprising a plurality of miRNA target sequences inserted into a locus of ICP4; (ii) a second miR-TS cassette comprising a plurality of miRNA target sequences inserted into a locus of ICP27; and (iii) a third miR-TS cassette comprising a plurality of miRNA target sequences inserted into a locus of UL8. In some embodiments, the first miR-TS cassette is inserted into a locus of ICP4 and comprises 1, 2, 3, or 4 copies of a target sequence for each of miR-124, miR-1-3p, and miR-143-3p. In some embodiments, the plurality of miRNA target sequences in the first miR-TS cassette are arranged as follows: (a) (124-3p)-(124-3p)-(124-3p)-(124-3p)-(1-3p)-(143-3p)-(1-3p)-(143-3p)-(1-3p)-(143-3p)-(1-3p)-(143-3p).

(152) In some embodiments, the second miR-TS cassette is inserted into a locus of ICP27 and comprises 1, 2, 3, or 4 copies of a target sequence for each of miR-219a-5p, miR-122-5p, and miR-128. In some embodiments, the plurality of miRNA target sequences in the second miR-TS cassette are arranged as follows: (a) (219a-5p)-(122-5p)-(128-3p)-(122-5p)-(219a-5p)-(128-3p)-(122-5p) (128-3p)-(219a-5p)-(128-3p)-(122-5p)-(219a-5p).

(153) In some embodiments, the third miR-TS cassette is inserted into a locus of UL8 and comprises 1, 2, 3, or 4 copies of a target sequence for each of miR-137, miR-208a, and miR-126. In some embodiments, the plurality of miRNA target sequences in the third miR-TS cassette are arranged as follows: (a) (208b-3p)-(126-3p)-(137-3p)-(208b-3p)-(137-3p)-(126-3p)-(208b-3p)-(137-3p)-(126-3p)-(137-3p)-(126-3p)-(208b-3p).

(154) In some embodiments, the recombinant oncolytic virus is an HSV virus comprising (i) a first miR-TS cassette inserted into a locus of ICP4 and comprising 4 copies of a target sequence for each of miR-124, miR-1-3p, and miR-143-3p; (ii) a second miR-TS cassette inserted into a locus of ICP27 and comprising 4 copies of a target sequence for miR-219a-5p, 4 copies of a target sequence for miR-122-5p, and 4 copies of a target sequence for miR-128; and (iii) a third miR-TS cassette inserted into a locus of UL8 and comprising 4 copies of a target sequence for miR-137, 4 copies of a target sequence for miR-208a, and 4 copies of a target sequence for miR-126.

(155) In some embodiments, the recombinant oncolytic virus is an HSV virus comprising (i) a first miR-TS cassette comprising a plurality of miRNA target sequences inserted into a locus of ICP4; (ii) a second miR-TS cassette comprising a plurality of miRNA target sequences inserted into a locus of ICP27; (iii) a third miR-TS cassette comprising a plurality of miRNA target sequences inserted into a locus of UL8; and (iv) a fourth miR-TS cassette comprising a plurality of miRNA target sequences inserted into a locus of ICP34.5. In some embodiments, the first miR-TS cassette is inserted into a locus of ICP4 and comprises 1, 2, 3, or 4 copies of a target sequence for each of miR-124, miR-1-3p, and miR-143-3p. In some embodiments, the plurality of miRNA target sequences in the first miR-TS cassette are arranged as follows: (a) (124-3p)-(124-3p)-(124-3p)-(124-3p)-(1-3p)-(143-3p)-(1-3p)-(143-3p)-(1-3p)-(143-3p)-(1-3p)-(143-3p).

(156) In some embodiments, the second miR-TS cassette is inserted into a locus of ICP27 and comprises 1, 2, 3, or 4 copies of a target sequence for each of miRNA 219a-5p, miRNA 122-5p, and miRNA 128. In some embodiments, the plurality of miRNA target sequences in the second miR-TS cassette are arranged as follows: (a) (219a-5p)-(122-5p)-(128-3p)-(122-5p)-(219a-5p)-(128-3p)-(122-5p) -(128-3p)-(219a-5p)-(128-3p)-(122-5p)-(219a-5p).

(157) In some embodiments, the third miR-TS cassette is inserted into a locus of UL8 and comprises 1, 2, 3, or 4 copies of a target sequence for each of miR-137, miR-208a, and miR-126. In some embodiments, the plurality of miRNA target sequences in the third miR-TS cassette are arranged as follows: (a) (208b-3p)-(126-3p)-(137-3p)-(208b-3p)-(137-3p)-(126-3p)-(208b-3p)-(137-3p)-(126-3p)-(137-3p)-(126-3p)-(208b-3p).

(158) In some embodiments, the third miR-TS cassette is inserted into a locus of UL8 and comprises 1, 2, 3, or 4 copies of a target sequence for each of miR-137, miR-217-5p, and miR-126. In some embodiments, the plurality of miRNA target sequences in the third miR-TS cassette are arranged as follows: (a) (137-3p)-(126-3p)-(217-5p)-(126-3p)-(217-5p)-(137-3p)-(217-5p)-(126-3p)-(137-3p)-(126-3p)-(217-5p)-(137-3p).

(159) In some embodiments, the third miR-TS cassette is inserted into a locus of UL8 and comprises 1, 2, 3, or 4 copies of a target sequence for each of miR-137, miR-217-5p, and miR-127. In some embodiments, the plurality of miRNA target sequences in the third miR-TS cassette are arranged as follows: (a) (137-3p)-(127-3p)-(217-5p)-(127-3p)-(217-5p)-(137-3p)-(217-5p)-(127-3p)-(137-3p)-(127-3p)-(217-5p)-(137-3p).

(160) In some embodiments, the third miR-TS cassette is inserted into a locus of UL8 and comprises 1, 2, 3, or 4 copies of a target sequence for each of miR-137, miR-217-5p, and miR-128. In some embodiments, the plurality of miRNA target sequences in the third miR-TS cassette are arranged as follows: (a) (137-3p)-(128-3p)-(217-5p)-(128-3p)-(217-5p)-(137-3p)-(217-5p)-(128-3p)-(137-3p)-(128-3p)-(217-5p)-(137-3p).

(161) In some embodiments, the third miR-TS cassette is inserted into a locus of UL8 and comprises 1, 2, 3, or 4 copies of a target sequence for each of miR-137, miR-217-5p, and miR-129. In some embodiments, the plurality of miRNA target sequences in the third miR-TS cassette are arranged as follows: (a) (137-3p)-(129-3p)-(217-5p)-(129-3p)-(217-5p)-(137-3p)-(217-5p)-(129-3p)-(137-3p)-(129-3p)-(219-5p)-(137-3p).

(162) In some embodiments, the third miR-TS cassette is inserted into a locus of UL8 and comprises 1, 2, 3, or 4 copies of a target sequence for each of miR-137, miR-217-5p, and miR-130. In some embodiments, the plurality of miRNA target sequences in the third miR-TS cassette are arranged as follows: (a) (137-3p)-(130-3p)-(217-5p)-(130-3p)-(217-5p)-(130-3p)-(217-5p)-(127-3p)-(137-3p)-(130-3p)-(217-5p)-(137-3p).

(163) In some embodiments, the fourth miR-TS cassette is inserted into a locus of ICP34.5 and comprises 1, 2, 3, or 4 copies of a target sequence for each of miRNA 128M, miRNA 204, and miRNA 219-3p. In some embodiments, the plurality of miRNA target sequences in the fourth miR-TS cassette are arranged as follows: (a) (128-3p)-(219a-5p)-(204-5p)-(128-3p)-(219a-5p)-(204-5p)-(128-3p) -(219a-5p)-(204-5p)-(128-3p)-(219a-5p)-(204-5p).

(164) In some embodiments, the recombinant oncolytic virus is an HSV virus comprising (i) a first miR-TS cassette inserted into a locus of ICP4 and comprising four copies of a target sequence for each of miR-124, miR-1-3p, and miR-14; (ii) a second miR-TS cassette inserted into a locus of ICP27 and comprising 4 of a target sequence for each of miR-219a-5p, miR-122-5p, and miR-128; (iii) a third miR-TS cassette inserted into a locus of UL8 and comprising 4 of a target sequence for each of miR-137, miR-208b-3p, and miR-126; and (iv) a fourth miR-TS cassette inserted into a locus of ICP34.5 and comprising 4 of a target sequence for miR-128, 4 copies of a target sequence for miR-204, and 4 copies of a target sequence for miR-219-3p. In some embodiments, the recombinant oncolytic virus is an HSV virus comprising (i) a first miR-TS cassette inserted into a locus of ICP4 and comprising four copies of a target sequence for each of miR-124, miR-1-3p, and miR-14; (ii) a second miR-TS cassette inserted into a locus of ICP27 and comprising 4 of a target sequence for each of miR-219a-5p, miR-122-5p, and miR-128; and (iii) a third miR-TS cassette inserted into a locus of UL8 and comprising 4 of a target sequence for each of miR-137, miR-208a, and miR-126.

(165) In some embodiments, the recombinant oncolytic virus is an HSV virus comprising (i) a first miR-TS cassette inserted into a locus of ICP4 and comprising four copies of a target sequence for each of miR-124, miR-1-3p, and miR-14; (ii) a second miR-TS cassette inserted into a locus of ICP27 and comprising 4 of a target sequence for each of miR-219a-5p, miR-122-5p, and miR-128; (iii) a third miR-TS cassette inserted into a locus of UL8 and comprising 4 of a target sequence for miR-137-3p, 4 of a target sequence for miR-217-5p, and 4 of a target sequence for miR-126-3p; and (iv) a fourth miR-TS cassette inserted into a locus of ICP34.5 and comprising 4 of a target sequence for miR-128, 4 copies of a target sequence for miR-204, and 4 copies of a target sequence for miR-219-3p.

(166) In some embodiments, the recombinant oncolytic virus is an HSV virus comprising (i) a first miR-TS cassette inserted into a locus of ICP4 and comprising four copies of a target sequence for each of miR-124, miR-1-3p, and miR-14; (ii) a second miR-TS cassette inserted into a locus of ICP27 and comprising 4 of a target sequence for each of miR-219a-5p, miR-122-5p, and miR-128; (iii) a third miR-TS cassette inserted into a locus of UL8 and comprising 4 of a target sequence for miR-137-3p, 4 of a target sequence for miR-217-5p, and 4 of a target sequence for miR-127; and (iv) a fourth miR-TS cassette inserted into a locus of ICP34.5 and comprising 4 of a target sequence for miR-128, 3 copies of a target sequence for miR-204, and 3 copies of a target sequence for miR-219-5p.

(167) In some embodiments, the recombinant oncolytic virus is an HSV virus comprising (i) a first miR-TS cassette inserted into a locus of ICP4 and comprising four copies of a target sequence for each of miR-124, miR-1-3p, and miR-14; (ii) a second miR-TS cassette inserted into a locus of ICP27 and comprising 4 of a target sequence for each of miR-219a-5p, miR-122-5p, and miR-128; (iii) a third miR-TS cassette inserted into a locus of UL8 and comprising 4 of a target sequence for miR-137-3p, 4 of a target sequence for miR-217-5p, and 4 of a target sequence for miR-128; and (iv) a fourth miR-TS cassette inserted into a locus of ICP34.5 and comprising 4 of a target sequence for miR-128, 3 copies of a target sequence for miR-204, and 3 copies of a target sequence for miR-219-5p. In some embodiments, the recombinant oncolytic virus is an HSV virus comprising (i) a first miR-TS cassette inserted into a locus of ICP4 and comprising four copies of a target sequence for each of miR-124, miR-1-3p, and miR-14; (ii) a second miR-TS cassette inserted into a locus of ICP27 and comprising 4 of a target sequence for each of miR-219a-5p, miR-122-5p, and miR-128; (iii) a third miR-TS cassette inserted into a locus of UL8 and comprising 4 of a target sequence for miR-137-3p, 4 of a target sequence for miR-217-5p, and 4 of a target sequence for miR-129; and (iv) a fourth miR-TS cassette inserted into a locus of ICP34.5 and comprising 4 of a target sequence for miR-128, 3 copies of a target sequence for miR-204, and 3 copies of a target sequence for miR-219-5p In some embodiments, the recombinant oncolytic virus is an HSV virus comprising (i) a first miR-TS cassette inserted into a locus of ICP4 and comprising four copies of a target sequence for each of miR-124, miR-1-3p, and miR-14; (ii) a second miR-TS cassette inserted into a locus of ICP27 and comprising 4 of a target sequence for each of miR-219a-5p, miR-122-5p, and miR-128; (iii) a third miR-TS cassette inserted into a locus of UL8 and comprising 4 of a target sequence for miR-137-3p, 4 of a target sequence for miR-217-5p, and 4 of a target sequence for miR-130; and (iv) a fourth miR-TS cassette inserted into a locus of ICP34.5 and comprising 4 of a target sequence for miR-128, 3 copies of a target sequence for miR-204, and 3 copies of a target sequence for miR-219-5p.

(168) In some embodiments, the viral vectors described herein comprise one copy of a miR-125a target sequence incorporated into one essential viral gene. In some embodiments, the viral vectors described herein comprise one copy of a miR-125a target sequence incorporated into the UL42 locus. In some embodiments, the viral vectors described herein comprise one copy of a miR-122 target sequence incorporated into one essential viral gene. In some embodiments, the viral vectors described herein comprise one copy of a miR-122 target sequence incorporated into the ICP27 locus (e.g., ONCR-036).

(169) In further embodiments, the viral vectors described herein comprise 3 copies of a miR-125a target sequence incorporated a viral gene required for viral replication. In further embodiments, the viral vectors described herein may comprise 3 copies of a miR-125a target sequence incorporated into the UL42 locus. In some embodiments, 4 copies of a miR target sequence are incorporated into the 3 UTR of an essential viral gene. In further embodiments, the viral vectors described herein may comprise 4 copies of a miR-125a target sequence incorporated into an essential viral gene. In further embodiments, the viral vectors described herein may comprise 4 copies of a miR-125a target sequence incorporated into the UL42 locus. In some embodiments, the viral vectors described herein may comprise 4 copies of a miR-122 target sequence incorporated into an essential viral gene. In further embodiments, the viral vectors described herein may comprise 4 copies of a miR-122 target sequence incorporated into the ICP27 locus (e.g., ONCR-063).

(170) In some embodiments, 1 copy of a miR-122 target sequence is incorporated into the 3 UTR of a first essential viral gene, and 1 copy of a miR-125a target sequence is incorporated into the 3 UTR of a second essential viral gene. In some embodiments, 1 copy of a miR-122 target sequence is incorporated into the 3 UTR of the ICP27 locus, and 1 copy of a miR-125a target sequence is incorporated into the 3 UTR of the UL42 locus (e.g., ONCR-094).

(171) In some embodiments, 1 copy of a miR-122 target sequence is incorporated into the 3 UTR of a first essential viral gene, and 3 copies of a miR-125a target sequence are incorporated into the 3 UTR of a second essential viral gene. In some embodiments, 1 copy of a miR-122 target sequence is incorporated into the 3 UTR of the ICP27 locus, and 3 copies of a miR-125a target sequence are incorporated into the 3 UTR of the UL42 locus (e.g., ONCR-095).

(172) In some embodiments, 4 copies of a first miR target sequence are incorporated into the 3 UTR of a first essential viral gene, and 1 copy of a second miR target sequence is incorporated into the 3 UTR of a second essential viral gene. In some embodiments, 4 copies of a miR-122 target sequence are incorporated into the 3 UTR of a first essential viral gene, and 1 copy of a miR-125a target sequence is incorporated into the 3 UTR of a second essential viral gene. In some embodiments, 4 copies of a miR-122 target sequence are incorporated into the 3 UTR of the ICP27 locus, and 1 copy of a miR-125a target sequence is incorporated into the 3 UTR of the UL42 locus (e.g., ONCR-093).

(173) In some embodiments, 4 copies of a first miR target sequence are incorporated into the 3 UTR of a first essential viral gene, and 4 copies of a second miR target sequence are incorporated into the 3 UTR of a second essential viral gene. In some embodiments, 4 copies of a miR-122 target sequence are incorporated into the 3 UTR of a first essential viral gene, and 4 copies of a miR-125a target sequence are incorporated into the 3 UTR of a second essential viral gene. In some embodiments, 4 copies of a miR-122 target sequence are incorporated into the 3 UTR of the ICP27 locus, and 4 copies of a miR-125a target sequence is incorporated into the 3 UTR of the UL42 locus (e.g., ONCR-096).

(174) In some embodiments, the miR-attenuated oncolytic viruses described herein result in reduced viral replication in a cell that expresses a miR capable of binding to one or more of the incorporated miR-target sequences. Viral replication refers to the total number of viral replication cycles that occur in a particular cell or population of cells during a given amount of time. In some embodiments, viral replication can be measured directly by assessing the total viral titer present over the course of the given amount of time, or by assessing the number of viral genome copies present (e.g., by sequencing). In some embodiments, the viral vector may additionally comprise a detectable label, such as a fluorescent reporter. In such embodiments, viral replication may be assessed by measuring the fluorescence intensity of the reporter, or the number of cells that express the reporter. In some embodiments, viral replication can be measured indirectly by assessing the number of viable cells over the course of the given amount of time. For example, the level of viral replication would be expected to inversely correlate with the number of viable cells over time.

(175) Reduced viral replication as used herein, refers to a level of viral replication that is lower in a first cell or first population of cells compared to a second cell or a second population of cells. In some embodiments, the level of viral replication in the first cell or first population of cells is reduced by at least 5% compared to the level of viral replication in the second cell or population of cells. In some embodiments, the level of viral replication in the first cell or first population of cells is reduced by at least 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80%, 90% or more compared to the level of viral replication in the second cell or population of cells. In some embodiments, viral replication in the first cell or first population of cells is completely inhibited compared to the viral replication in the second cell or population of cells.

(176) In some embodiments, the reduced viral replication in the first cell or first population of cells correlates with the expression of a miR capable of binding to the one or more miR-target sequences incorporated into one or more viral genes required for replication. In some embodiments, expression of a miR corresponding to the incorporated miR-target sequence therefore inhibits or reduces the expression of the replication gene, thereby inhibiting or reducing viral replication. In some embodiments, the second cell or second population of cells does not express, or has a reduced expression level, of the t miR. In some embodiments, absent or reduced expression of a miR (e.g., in a cancer cell) corresponding to the incorporated miR-target sequence allows for viral replication to proceed. In some embodiments, the expression level of the miR in the second cell or population of cells is at least 5% lower than the expression level of the miR in the first cell or population. In some embodiments, the expression level of the miR in the second cell or population of cells is reduced at least 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80%, 90% or more compared to the expression level of the miR in the first cell or population. In some embodiments, the second cell does not express the miR. In particular embodiments, the first cell is a non-cancerous cell and the second cell is a cancerous cell.

(177) In some embodiments, a replication-restricted viral vector (e.g., a miR-attenuated viral vector) comprises at least one let-7 target sequence and is used to treat lung cancer. In some embodiments, a replication-restricted viral vector comprises at least one miR-15a and/or at least one miR-16A target sequences and is used to treat B-cell chronic lymphocytic leukemia. In some embodiments, a replication-restricted viral vector comprises at least one miR-125b, at least one miR-145, at least one miR-21, and/or at least one miR-155 target sequences and is used to treat breast cancer. In other embodiments, a replication-restricted viral vector comprises at least one miR-143 and/or at least one miR-145 target sequences and is used to treat colorectal cancer. In certain embodiments, a replication-restricted viral vector comprises at least one miR-181a, at least one miR-181b, and/or at least one miR-181c target sequences and is used to treat glioblastoma. In some embodiments, a replication-restricted viral vector comprises at least one miR-199a*, at least one miR-195, at least one miR-199a, at least one miR-200a, and/or at least one miR-125a target sequences and is used to treat liver cancer (e.g., hepatocellular carcinoma).

(178) In particular embodiments, a replication-restricted viral vector comprises at least one miR-451a target sequence, at least one miR-143-3p target sequence, at least one miR-559 target sequence, and at least one miR-124 target sequence and is used for the treatment of pancreatic, lung, and/or colon cancer. In such embodiments, the target sequences for miR-451a, miR-143-3p, miR-559, and miR-124 are incorporated into two or more genes required for viral replication (e.g., ICP4 and ICP27). In further particular embodiments, a replication-restricted viral vector comprises at least one miR-451a target sequence, at least one miR-145-5p target sequence, at least one miR-559 target sequence, and at least one miR-124 target sequence and is used for the treatment of any type of cancer described herein. In such embodiments, the target sequences for miR-451a, miR-145-5p, miR-559, and miR-124 are incorporated into two or more genes required for viral replication (e.g., ICP4 and ICP27). In further particular embodiments, a replication-restricted viral vector comprises at least one miR-205p target sequence, at least one miR-141-5p target sequence, at least one miR-31-5p target sequence, and at least one miR-124 target sequence and is used for the treatment of schwannoma. In such embodiments, the target sequences for miR-205p, miR-141-5p, miR-31-5p, and miR-124 are incorporated into two or more genes required for viral replication (e.g., ICP4 and ICP27).

(179) In some embodiments, a recombinant oncolytic virus comprises a plurality of copies of one or more miRNA target sequences for miR-136-3p, miR-432-5p, miR-1-3p, miR-127-3p, miR-379-5p, miR-493-5p, miR-223-5p, miR-223-5p, miR-136-5p, miR-451a, miR-487b-3p, miR-370-3p, miR-410-3p, miR-431-3p, miR-4485-3p, miR-4485-5p, miR-127-5p, miR-409-3p, miR-338-3p, miR-559, miR-411-5p, miR-133a-5p, miR-143-3p, miR-376b-3p, miR-758-3p, miR-1, miR-101, miR-1180, miR-1236, miR-124-3p, miR-125b, miR-126, miR-1280, miR-133a, miR-133b, miR-141, miR-143, miR-144, miR-145, miR-155, miR-16, miR-18a, miR-192, miR-195, miR-200a, miR-200b, miR-200c, miR-203, miR-205, miR-214, miR-218, miR-23b, miR-26a, miR-29c, miR-320c, miR-34a, miR-370, miR-409-3p, miR-429, miR-451, miR-490-5p, miR-493, miR-576-3p, and/or miR-99a inserted into the 5 UTR or 3 UTR of one or more viral genes required for viral replication. This oncolytic virus may be used in methods and compositions for treating bladder cancer.

(180) In some embodiments, a recombinant oncolytic virus comprises a plurality of copies of one or more miRNA target sequences for miR-1251-5p, miR-219a-5p, miR-219a-2-3p, miR-124-3p, miR-448, miR-138-2-3p, miR-490-5p, miR-129-1-3p, miR-1264, miR-3943, miR-490-3p, miR-383-5p, miR-133b, miR-129-2-3p, miR-128-2-5p, miR-133a-3p, miR-129-5p, miR-1-3p, miR-885-3p, miR-124-5p, miR-759, miR-7158-3p, miR-770-5p, miR-135a-5p, miR-885-5p, let-7g-5p, miR-100, miR-101, miR-106a, miR-124, miR-124a, miR-125a, miR-125a-5p, miR-125b, miR-127-3p, miR-128, miR-129, miR-136, miR-137, miR-139-5p, miR-142-3p, miR-143, miR-145, miR-146b-5p, miR-149, miR-152, miR-153, miR-195, miR-21, miR-212-3p, miR-219-5p, miR-222, miR-29b, miR-31, miR-3189-3p, miR-320, miR-320a, miR-326, miR-330, miR-331-3p, miR-340, miR-342, miR-34a, miR-376a, miR-449a, miR-483-5p, miR-503, miR-577, miR-663, miR-7, miR-7-5p, miR-873, let-7a, let-7f, miR-107, miR-122, miR-124-5p, miR-139, miR-146a, miR-146b, miR-15b, miR-16, miR-181a, miR-181a-1, miR-181a-2, miR-181b, miR-181b-1, miR-181b-2, miR-181c, miR-181d, miR-184, miR-185, miR-199a-3p, miR-200a, miR-200b, miR-203, miR-204, miR-205, miR-218, miR-23b, miR-26b, miR-27a, miR-29c, miR-328, miR-34c-3p, miR-34c-5p, miR-375, miR-383, miR-451, miR-452, miR-495, miR-584, miR-622, miR-656, miR-98, miR-124-3p, miR-181b-5p, miR-200b, and/or miR-3189-3p inserted into the 5 UTR or 3 UTR of one or more viral genes required for viral replication. This oncolytic virus may be used in methods and compositions for treating brain cancer. In certain embodiments, the brain cancer is astrocytoma, glioblastoma, or glioma.

(181) In some embodiments, a recombinant oncolytic virus comprises a plurality of copies of one or more miRNA target sequences for miR-10b-5p, miR-126-3p, miR-145-3p, miR-451a, miR-199b-5p, miR-5683, miR-3195, miR-3182, miR-1271-5p, miR-204-5p, miR-409-5p, miR-136-5p, miR-514a-5p, miR-559, miR-483-3p, miR-1-3p, miR-6080, miR-144-3p, miR-10b-3p, miR-6130, miR-6089, miR-203b-5p, miR-4266, miR-4327, miR-5694, miR-193b, let-7a, let-7a-1, let-7a-2, let-7a-3, let-7b, let-7c, let-7d, let-7e, let-7f-1, let-7f-2, let-7g, let-7i, miR-100, miR-107, miR-10a, miR-10b, miR-122, miR-124, miR-1258, miR-125a-5p, miR-125b, miR-126, miR-127, miR-129, miR-130a, miR-132, miR-133a, miR-143, miR-145, miR-146a, miR-146b, miR-147, miR-148a, miR-149, miR-152, miR-153, miR-15a, miR-16, miR-17-5p, miR-181a, miR-1826, miR-183, miR-185, miR-191, miR-193a-3p, miR-195, miR-199b-5p, miR-19a-3p, miR-200a, miR-200b, miR-200c, miR-205, miR-206, miR-211, miR-216b, miR-218, miR-22, miR-26a, miR-26b, miR-300, miR-30a, miR-31, miR-335, miR-339-5p, miR-33b, miR-34a, miR-34b, miR-34c, miR-374a, miR-379, miR-381, miR-383, miR-425, miR-429, miR-450b-3p, miR-494, miR-495, miR-497, miR-502-5p, miR-517a, miR-574-3p, miR-638, miR-7, miR-720, miR-873, miR-874, miR-92a, miR-98, miR-99a, mmu-miR-290-3p, and/or mmu-miR-290-5p inserted into the 5 UTR or 3 UTR of one or more viral genes required for viral replication. This oncolytic virus may be used in methods and compositions for treating breast cancer.

(182) In some embodiments, a recombinant oncolytic virus comprises a plurality of copies of one or more miRNA target sequences for miR-143, miR-145, miR-17-5p, miR-203, miR-214, miR-218, miR-335, miR-342-3p, miR-372, miR-424, miR-491-5p, miR-497, miR-7, miR-99a, miR-99b, miR-100, miR-101, miR-15a, miR-16, miR-34a, miR-886-5p, miR-106a, miR-124, miR-148a, miR-29a, and/or miR-375 inserted into the 5 UTR or 3 UTR of one or more viral genes required for viral replication. This oncolytic virus may be used in methods and compositions for treating cervical cancer.

(183) In some embodiments, a recombinant oncolytic virus comprises a plurality of copies of one or more miRNA target sequences for miR-133a-5p, miR-490-5p, miR-124-3p, miR-137, miR-655-3p, miR-376c-3p, miR-369-5p, miR-490-3p, miR-432-5p, miR-487b-3p, miR-342-3p, miR-223-3p, miR-136-3p, miR-136-3p, miR-143-5p, miR-1-3p, miR-214-3p, miR-143-3p, miR-199a-3p, miR-199b-3p, miR-451a, miR-127-3p, miR-133a-3p, miR-145-5p, miR-145-3p, miR-199a-5p, let-7a-1, let-7a-2, let-7a-3, let-7b, let-7c, let-7d, let-7e, let-7f-1, let-7f-2, let-7g, let-7i, miR-100, miR-101, miR-126, miR-142-3p, miR-143, miR-145, miR-192, miR-200c, miR-21, miR-214, miR-215, miR-22, miR-25, miR-302a, miR-320, miR-320a, miR-34a, miR-34c, miR-365, miR-373, miR-424, miR-429, miR-455, miR-484, miR-502, miR-503, miR-93, miR-98, miR-186, miR-30a-5p, miR-627, let-7a, miR-1, miR-124, miR-125a, miR-129, miR-1295b-3p, miR-1307, miR-130b, miR-132, miR-133a, miR-133b, miR-137, miR-138, miR-139, miR-139-5p, miR-140-5p, miR-148a, miR-148b, miR-149, miR-150-5p, miR-154, miR-15a, miR-15b, miR-16, miR-18a, miR-191, miR-193a-5p, miR-194, miR-195, miR-196a, miR-198, miR-199a-5p, miR-203, miR-204-5p, miR-206, miR-212, miR-218, miR-224, miR-24-3p, miR-26b, miR-27a, miR-28-3p, miR-28-5p, miR-29b, miR-30a-3p, miR-30b, miR-328, miR-338-3p, miR-342, miR-345, miR-34a-5p, miR-361-5p, miR-375, miR-378, miR-378a-3p, miR-378a-5p, miR-409-3p, miR-422a, miR-4487, miR-483, miR-497, miR-498, miR-518a-3p, miR-551a, miR-574-5p, miR-625, miR-638, miR-7, miR-96-5p, miR-202-3p, miR-30a, and/or miR-451 inserted into the 5 UTR or 3 UTR of one or more viral genes required for viral replication. This oncolytic virus may be used in methods and compositions for treating colon or colorectal cancer.

(184) In some embodiments, a recombinant oncolytic virus comprises a plurality of copies of one or more miRNA target sequences for miR-101, miR-130a, miR-130b, miR-134, miR-143, miR-145, miR-152, miR-205, miR-223, miR-301a, miR-301b, miR-30c, miR-34a, miR-34c, miR-424, miR-449a, miR-543, and/or miR-34b inserted into the 5 UTR or 3 UTR of one or more viral genes required for viral replication. This oncolytic virus may be used in methods and compositions for treating endometrial cancer.

(185) In some embodiments, a recombinant oncolytic virus comprises a plurality of copies of one or more miRNA target sequences for miR-125b, miR-138, miR-15a, miR-15b, miR-16, miR-16-1, miR-16-1-3p, miR-16-2, miR-181a, miR-181b, miR-195, miR-223, miR-29b, miR-34b, miR-34c, miR-424, miR-10a, miR-146a, miR-150, miR-151, miR-155, miR-2278, miR-26a, miR-30e, miR-31, miR-326, miR-564, miR-27a, let-7b, miR-124a, miR-142-3p, let-7c, miR-17, miR-20a, miR-29a, miR-30c, miR-720, miR-107, miR-342, miR-34a, miR-202, miR-142-5p, miR-29c, miR-145, miR-193b, miR-199a, miR-214, miR-22, miR-137, and/or miR-197 inserted into the 5 UTR or 3 UTR of one or more viral genes required for viral replication. This oncolytic virus may be used in methods and compositions for treating hematologic cancer. In some embodiments, the hematologic cancer is leukemia, lymphoma, or myeloma.

(186) In some embodiments, a recombinant oncolytic virus comprises a plurality of copies of one or more miRNA target sequences for miR-1, miR-145, miR-1826, miR-199a, miR-199a-3p, miR-203, miR-205, miR-497, miR-508-3p, miR-509-3p, let-7a, let-7d, miR-106a*, miR-126, miR-1285, miR-129-3p, miR-1291, miR-133a, miR-135a, miR-138, miR-141, miR-143, miR-182-5p, miR-200a, miR-218, miR-28-5p, miR-30a, miR-30c, miR-30d, miR-34a, miR-378, miR-429, miR-509-5p, miR-646, miR-133b, let-7b, let-7c, miR-200c, miR-204, miR-335, miR-377, and/or miR-506 inserted into the 5 UTR or 3 UTR of one or more viral genes required for viral replication. This oncolytic virus may be used in methods and compositions for treating kidney cancer.

(187) In some embodiments, a recombinant oncolytic virus comprises a plurality of copies of one or more miRNA target sequences for let-7a-1, let-7a-2, let-7a-3, let-7b, let-7c, let-7d, let-7e, let-7f, let-7f-1, let-7f-2, let-7g, let-7i, miR-1, miR-100, miR-101, miR-105, miR-122, miR-122a, miR-1236, miR-124, miR-125b, miR-126, miR-127, miR-1271, miR-128-3p, miR-129-5p, miR-130a, miR-130b, miR-133a, miR-134, miR-137, miR-138, miR-139, miR-139-5p, miR-140-5p, miR-141, miR-142-3p, miR-143, miR-144, miR-145, miR-146a, miR-148a, miR-148b, miR-150-5p, miR-15b, miR-16, miR-181a-5p, miR-185, miR-188-5p, miR-193b, miR-195, miR-195-5p, miR-197, miR-198, miR-199a, miR-199a-5p, miR-199b, miR-199b-5p, miR-200a, miR-200b, miR-200c, miR-202, miR-203, miR-204-3p, miR-205, miR-206, miR-20a, miR-21, miR-21-3p, miR-211, miR-212, miR-214, miR-217, miR-218, miR-219-5p, miR-22, miR-223, miR-26a, miR-26b, miR-29a, miR-29b-1, miR-29b-2, miR-29c, miR-302b, miR-302c, miR-30a, miR-30a-3p, miR-335, miR-338-3p, miR-33a, miR-34a, miR-34b, miR-365, miR-370, miR-372, miR-375, miR-376a, miR-377, miR-422a, miR-424, miR-424-5p, miR-433, miR-4458, miR-448, miR-450a, miR-451, miR-485-5p, miR-486-5p, miR-497, miR-503, miR-506, miR-519d, miR-520a, miR-520b, miR-520c-3p, miR-582-5p, miR-590-5p, miR-610, miR-612, miR-625, miR-637, miR-675, miR-7, miR-877, miR-940, miR-941, miR-98, miR-99a, miR-132, and/or miR-31 inserted into the 5 UTR or 3 UTR of one or more viral genes required for viral replication. This oncolytic virus may be used in methods and compositions for treating liver cancer. In some embodiments, the liver cancer is hepatocellular carcinoma.

(188) In some embodiments, a recombinant oncolytic virus comprises a plurality of copies of one or more miRNA target sequences for miR-143-3p, miR-126-3p, miR-126-5p, miR-1266-3p, miR-6130, miR-6080, miR-511-5p, miR-143-5p, miR-223-5p, miR-199b-5p, miR-199a-3p, miR-199b-3p, miR-451a, miR-142-5p, miR-144, miR-150-5p, miR-142-3p, miR-214-3p, miR-214-5p, miR-199a-5p, miR-145-3p, miR-145-5p, miR-1297, miR-141, miR-145, miR-16, miR-200a, miR-200b, miR-200c, miR-29b, miR-381, miR-409-3p, miR-429, miR-451, miR-511, miR-99a, let-7a-1, let-7a-2, let-7a-3, let-7b, let-7c, let-7d, let-7e, let-7f-1, let-7f-2, let-7g, let-7i, miR-1, miR-101, miR-133b, miR-138, miR-142-5p, miR-144, miR-1469, miR-146a, miR-153, miR-15a, miR-15b, miR-16-1, miR-16-2, miR-182, miR-192, miR-193a-3p, miR-194, miR-195, miR-198, miR-203, miR-217, miR-218, miR-22, miR-223, miR-26a, miR-26b, miR-29c, miR-33a, miR-34a, miR-34b, miR-34c, miR-365, miR-449a, miR-449b, miR-486-5p, miR-545, miR-610, miR-614, miR-630, miR-660, miR-7515, miR-9500, miR-98, miR-99b, miR-133a, let-7a, miR-100, miR-106a, miR-107, miR-124, miR-125a-3p, miR-125a-5p, miR-126, miR-126*, miR-129, miR-137, miR-140, miR-143, miR-146b, miR-148a, miR-148b, miR-149, miR-152, miR-154, miR-155, miR-17-5p, miR-181a-1, miR-181a-2, miR-181b, miR-181b-1, miR-181b-2, miR-181c, miR-181d, miR-184, miR-186, miR-193b, miR-199a, miR-204, miR-212, miR-221, miR-224, miR-27a, miR-27b, miR-29a, miR-30a, miR-30b, miR-30c, miR-30d, miR-30d-5p, miR-30e-5p, miR-32, miR-335, miR-338-3p, miR-340, miR-342-3p, miR-361-3p, miR-373, miR-375, miR-4500, miR-4782-3p, miR-497, miR-503, miR-512-3p, miR-520a-3p, miR-526b, miR-625*, and/or miR-96 inserted into the 5 UTR or 3 UTR of one or more viral genes required for viral replication. This oncolytic virus may be used in methods and compositions for treating lung cancer.

(189) In some embodiments, a recombinant oncolytic virus comprises a plurality of copies of one or more miRNA target sequences for let-7b, miR-101, miR-125b, miR-1280, miR-143, miR-146a, miR-146b, miR-155, miR-17, miR-184, miR-185, miR-18b, miR-193b, miR-200c, miR-203, miR-204, miR-205, miR-206, miR-20a, miR-211, miR-218, miR-26a, miR-31, miR-33a, miR-34a, miR-34c, miR-376a, miR-376c, miR-573, miR-7-5p, miR-9, and/or miR-98 inserted into the 5 UTR or 3 UTR of one or more viral genes required for viral replication. This oncolytic virus may be used in methods and compositions for treating melanoma.

(190) In some embodiments, a recombinant oncolytic virus comprises a plurality of copies of one or more miRNA target sequences for let-7d, miR-218, miR-34a, miR-375, miR-494, miR-100, miR-124, miR-1250, miR-125b, miR-126, miR-1271, miR-136, miR-138, miR-145, miR-147, miR-148a, miR-181a, miR-206, miR-220a, miR-26a, miR-26b, miR-29a, miR-32, miR-323-5p, miR-329, miR-338, miR-370, miR-410, miR-429, miR-433, miR-499a-5p, miR-503, miR-506, miR-632, miR-646, miR-668, miR-877, and/or miR-9 inserted into the 5 UTR or 3 UTR of one or more viral genes required for viral replication. This oncolytic virus may be used in methods and compositions for treating oral cancer.

(191) In some embodiments, a recombinant oncolytic virus comprises a plurality of copies of one or more miRNA target sequences for let-7i, miR-100, miR-124, miR-125b, miR-129-5p, miR-130b, miR-133a, miR-137, miR-138, miR-141, miR-145, miR-148a, miR-152, miR-153, miR-155, miR-199a, miR-200a, miR-200b, miR-200c, miR-212, miR-335, miR-34a, miR-34b, miR-34c, miR-409-3p, miR-411, miR-429, miR-432, miR-449a, miR-494, miR-497, miR-498, miR-519d, miR-655, miR-9, miR-98, miR-101, miR-532-5p, miR-124a, miR-192, miR-193a, and/or miR-7 inserted into the 5 UTR or 3 UTR of one or more viral genes required for viral replication. This oncolytic virus may be used in methods and compositions for treating ovarian cancer.

(192) In some embodiments, a recombinant oncolytic virus comprises a plurality of copies of one or more miRNA target sequences for miR-216a-5p, miR-802, miR-217, miR-145-3p, miR-143-3p, miR-451a, miR-375, miR-214-3p, miR-216b-3p, miR-432-5p, miR-216a-3p, miR-199b-5p, miR-199a-5p, miR-136-3p, miR-216b-5p, miR-136-5p, miR-145-5p, miR-127-3p, miR-199a-3p, miR-199b-3p, miR-559, miR-129-2-3p, miR-4507, miR-1-3p, miR-148a-3p, miR-101, miR-1181, miR-124, miR-1247, miR-133a, miR-141, miR-145, miR-146a, miR-148a, miR-148b, miR-150*, miR-150-5p, miR-152, miR-15a, miR-198, miR-203, miR-214, miR-216a, miR-29c, miR-335, miR-34a, miR-34b, miR-34c, miR-373, miR-375, miR-410, miR-497, miR-615-5p, miR-630, miR-96, miR-132, let-7a, let-7a-1, let-7a-2, let-7a-3, let-7b, let-7c, let-7d, let-7e, let-7f-1, let-7f-2, let-7g, let-7i, miR-126, miR-135a, miR-143, miR-144, miR-150, miR-16, miR-200a, miR-200b, miR-200c, miR-217, miR-218, miR-337, miR-494, and/or miR-98 inserted into the 5 UTR or 3 UTR of one or more viral genes required for viral replication. This oncolytic virus may be used in methods and compositions for treating pancreatic cancer.

(193) In some embodiments, a recombinant oncolytic virus comprises a plurality of copies of one or more miRNA target sequences for let-7a-3p, let-7c, miR-100, miR-101, miR-105, miR-124, miR-128, miR-1296, miR-130b, miR-133a-1, miR-133a-2, miR-133b, miR-135a, miR-143, miR-145, miR-146a, miR-154, miR-15a, miR-187, miR-188-5p, miR-199b, miR-200b, miR-203, miR-205, miR-212, miR-218, miR-221, miR-224, miR-23a, miR-23b, miR-25, miR-26a, miR-26b, miR-29b, miR-302a, miR-30a, miR-30b, miR-30c-1, miR-30c-2, miR-30d, miR-30e, miR-31, miR-330, miR-331-3p, miR-34a, miR-34b, miR-34c, miR-374b, miR-449a, miR-4723-5p, miR-497, miR-628-5p, miR-642a-5p, miR-765, and/or miR-940 inserted into the 5 UTR or 3 UTR of one or more viral genes required for viral replication. This oncolytic virus may be used in methods and compositions for treating prostate cancer.

(194) In some embodiments, a recombinant oncolytic virus comprises a plurality of copies of one or more miRNA target sequences for miR-101, miR-183, miR-204, miR-34a, miR-365b-3p, miR-486-3p, and/or miR-532-5p inserted into the 5 UTR or 3 UTR of one or more viral genes required for viral replication. This oncolytic virus may be used in methods and compositions for treating retinoblastoma.

(195) In some embodiments, an oncolytic virus described herein is a herpes simplex virus and wherein the one or more viral genes required for viral replication is selected from the group consisting of UL1, UL5, UL6, UL7, UL8, UL9, UL11, UL12, UL14, UL15, UL17, UL18, UL19, UL20, UL22, UL25, UL26, UL26.5, UL27, UL28, UL29, UL30, UL31, UL32, UL33, UL34, UL35, UL36, UL37, UL38, UL39, UL40, UL42, UL48, UL49, UL52, UL53, UL54, ICP0, ICP4, ICP22, ICP27, ICP47, gamma-34.5, US3, US4, US5, US6, US7, US8, US9, US10, US11, and US12.

(196) Payload Molecules

(197) In some embodiments, the oncolytic viruses described herein comprise a nucleic acid sequence encoding a payload molecule. As used herein, a payload molecule refers to a molecule capable of further enhancing the therapeutic efficacy of a virus. Payload molecules suitable for use in the present disclosure include antigen-binding molecules such as antibodies or antigen binding fragments thereof, cytokines, chemokines, soluble receptors, cell-surface receptor ligands, bipartite peptides, enzymes, and nucleic acids (e.g., shRNAs, siRNAs, antisense RNAs, antagomirs, ribozymes, apatamers, a decoy oligonucleotide, or an antagomir). The nature of the payload molecule will vary with the disease type and desired therapeutic outcome. In some embodiments, one or more miRNA target sequences is incorporated in to the 3 or 5 UTR of a polynucleotide sequence encoding a payload molecule. In such embodiments, translation and subsequent expression of the payload does not occur, or is substantially reduced, in cells where the corresponding miRNA is expressed. In some embodiments, one or more miRNA target sequences are inserted into the 3 and/or 5 UTR of the polynucleotide sequence encoding the therapeutic polypeptide.

(198) In some embodiments, the recombinant oncolytic viruses described herein comprise at least one polynucleotide encoding a payload molecule that that reduces the expression or inhibits the function of an endogenous miRNA, a gene, or a tissue inhibitor of metalloproteinases (TIMP). Such recombinant oncolytic viruses are referred to herein as genome-editing or microenvironment-remodeling viruses or vectors. The encoded protein or oligonucleotide may reduce expression or inhibit the function of a miRNA, gene, or TIMP in any number of ways including targeting the protein (e.g., a TIMP) for degradation (e.g., by ubiquitination and proteosomal degradation or targeting for lysosomal degradation), blocking interactions with cognate receptors (e.g., blocking antibodies or antigen binding fragments thereof or peptide inhibitors), degrading messenger RNA transcripts (e.g., a short interfering RNA or short hairpin RNA), and/or altering the genomic DNA sequence encoding the specific miRNA, gene, or protein (e.g., by an endonuclease).

(199) In particular embodiments, the protein or oligonucleotide reduces the expression of a miR or a gene involved in carcinogenesis or metastasis (e.g., an oncogenic miR or an oncogene). In some embodiments, a recombinant oncolytic virus comprises at least one polynucleotide encoding a payload molecule that reduces the expression or function of a miRNA that is an oncogenic miRNA (e.g., one or more of the miRNAs listed in Table 4). In some embodiments, the recombinant oncolytic virus comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more polynucleotides encoding for a protein or oligonucleotide that reduces the expression or function of an oncogenic miRNA. In some embodiments, the recombinant oncolytic virus comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more polynucleotides encoding for a plurality of proteins or oligonucleotides that reduce the expression or function of a plurality of oncogenic miRNAs. In some embodiments, the protein or oligonucleotide reduces the expression of miR-17-92 and is used to treat lung cancer (e.g., small-cell lung cancer). In other embodiments, the protein or oligonucleotide reduces the expression of miR-221 and/or miR-21 and is used to treat glioblastoma. In certain embodiments, the protein or oligonucleotide reduces the expression of miR-155 and/or miR-17-92 and is used to treat lymphoma (e.g., Burkitt's lymphoma, diffuse large B cell lymphoma, marginal zone lymphoma, or chronic lymphocytic leukemia). In some embodiments, the protein or oligonucleotide reduces the expression of miR-221, miR-222, and/or miR-146 and is used to treat thyroid cancer. In some embodiments, the protein or oligonucleotide reduces the expression of miR-372 and/or miR-373 and is used to treat testicular cancer (e.g., testicular germ cell tumors). In some embodiments, the protein or oligonucleotide reduces the expression of miR-18 and/or miR-224 and is used to treat liver cancer (e.g., hepatocellular carcinoma).

(200) In some embodiments, a recombinant viral vectors described herein comprise a polynucleotide encoding a payload molecule that degrades the tumor extracellular matrix (ECM), which in some aspects leads to enhanced viral spread. Matrix metalloproteinases (MMPs) are zinc-dependent proteases that are classified, based on their activity, into collagenases, gelatinases, stromelysins and matrilysins. These proteases are generally secreted as pro-enzymes (zymogens) and are activated by proteolytic removal of the pro-peptide pro-domain. The primary role that MMPs play in cancer is in the degradation of the ECM, which facilitates tumor invasion and metastasis. MMPs are also involved in tumor progression, epithelial to mesenchymal transition (EMT), and angiogenesis. MMPs are regulated by miRs as well as TIMPs, which comprise a family of four protease inhibitors (TIMP1, TIMP2, TIMP3, and TIMP4). A broad array of tumor microenvironments can be degraded by disrupting miRNAs or TIMPs that negatively regulate the MMP family with the recombinant viral vectors of the invention. Examples of miR/MMP interactions are shown in Table 5. Many of these interactions show that multiple MMPs are regulated by a single miRNA: e.g. let-7 regulates MMP-2, MMP-9, and MMP-14; miR-143 regulates MMP-2, MMP-9, and MMP-13; miR-218 regulates MMP-2, MMP-7, and MMP-9. Furthermore, the vast majority of MMPs may be regulated by a single TIMP master switch: e.g. TIMP1 is known to inhibit most all of the known MMPs and also promotes cell proliferation in a wide range of cell types; TIMP2 interacts with MMP-14 and MMP-2.

(201) In some embodiments, the recombinant oncolytic viruses described herein comprise at least one polynucleotide encoding a protein or an oligonucleotide that reduces the expression or function of a miRNA that is capable of altering the extracellular matrix or capable of modulating a pathway that alters the extracellular matrix, particularly in a tumor microenvironment (e.g., one or more of the miRNAs listed in Table 5). A microenvironment remodeling miR, as used herein, refers to a miR. In some embodiments, the protein or oligonucleotide reduces the expression or function of one microenvironment remodeling miR. In some embodiments, the protein or oligonucleotide reduces the expression or function of at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more microenvironment remodeling miRs. In some embodiments, the recombinant oncolytic virus comprises a plurality of polynucleotides encoding a plurality of protein or oligonucleotides that reduce the expression or function of a plurality of microenvironment remodeling miRs. In some embodiments, strategies described herein may be utilized by recombinant viral vectors of the present invention to knockdown or disrupt expression or function of miRs or TIMPs which negatively regulate MMPs. In some embodiments, a recombinant oncolytic virus reduces the expression of a TIMP selected from TIMP1, TIMP2, TIMP3 and TIMP4.

(202) In some embodiments, the recombinant oncolytic viruses described herein comprise at least one polynucleotide encoding a protein or an oligonucleotide that reduces the expression or function of a gene in the host cell genome. In some aspects, the gene is an oncogenic gene (e.g., a gene selected from the genes listed in Table 7). In some aspects, the gene encodes an oncogenic miR (e.g., a miRNA listed in Table 4), a microenvironment remodeling miR (e.g., a miRNA listed in Table 5), or a negative regulator of ECM-degradation (e.g., a TIMP). Reduction of gene expression and/or function may be accomplished by at the level of transcription (e.g., mutating, deleting, or silencing the genomic DNA sequence) or at the level of translation (e.g., by inhibiting the production of the gene product through mRNA degradation). In some embodiments, the recombinant oncolytic viruses described herein comprise one or more polynucleotides that encode for nucleases that reduce the expression or function of a gene by enabling the mutation, deletion, or repression of transcription of a gene sequence. In specific embodiments, the nuclease is selected from a Clustered Regulatory Interspaced Short Palindromic Repeats (CRISPR)-associated endonuclease, a zinc-finger nuclease (ZFN) or a Transcription activator-like effector nuclease (TALEN). In non-limiting examples, a CRISPR-associated endonuclease is selected from SpCas9, SpCas9-HF1, SpCas9-HF2, SpCas9-HF3, SpCas9-HF4, SaCas9, FnCpf, FnCas9, eSpCas9, C2C1, C2C3, Cpf1, Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas10, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, and Csf4.

(203) Recombinant viral vectors of the invention may utilize the CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)/Cas (CRISPR Associated) nuclease system, which is an engineered nuclease system based on a bacterial system that can be used for mammalian genome engineering. Generally, the system comprises a Cas nuclease and a guide RNA (gRNA). The gRNA is comprised of two parts; a crispr-RNA (crRNA) that is specific for a target genomic DNA sequence, and a tracr RNA (trRNA) that facilitates Cas binding. The crRNA and trRNA may be present as separate RNA oligonucleotides, or may be present in the same RNA oligonucleotide, referred to as a single guide-RNA (sgRNA). As used herein, the term guide RNA or gRNA refers to either the combination of an individual trRNA and an individual crRNA or an sgRNA. See, e.g., Jinek et al. (2012) Science 337:816-821; Cong et al. (2013) Science 339:819-823; Mali et al. (2013) Science 339:823-826; Qi et al. (2013) Cell 152:1173-1183; Jinek et al. (2013), eLife 2: e00471; David Segal (2013) eLife 2: e00563; Ran et al. (2013) Nature Protocols 8 (11): 2281-2308; Zetsche et al. (2015) Cell 163 (3): 759-771; PCT Publication Nos. WO 2007/025097, WO 2008/021207, WO 2010/011961, WO 2010/054108, WO 2010/054154, WO 2012/054726, WO 2012/149470, WO 2012/164565, WO 2013/098244, WO 2013/126794, WO 2013/141680, and WO 2013/142578; U.S. Patent Publication Nos. 2010-0093617, 2013-0011828, 2010-0257638, 2010-0076057, 2011-0217739, 2011-0300538, 2013-0288251, and 2012-0277120; and U.S. Pat. No. 8,546,553, each of which is incorporated herein by reference in its entirety.

(204) Multiple class 1 CRISPR-Cas systems, which include the type I and type III systems, have been identified and functionally characterized in detail, revealing the complex architecture and dynamics of the effector complexes (Brouns et al., 2008, Marraffini and Sontheimer, 2008, Hale et al., 2009, Sinkunas et al., 2013, Jackson et al., 2014, Mulepati et al., 2014). In addition, several class 2-type II CRISPR-Cas systems that employ homologous RNA-guided endonucleases of the Cas9 family as effectors have also been identified and experimentally characterized (Barrangou et al., 2007, Garneau et al., 2010, Deltcheva et al., 2011, Sapranauskas et al., 2011, Jinek et al., 2012, Gasiunas et al., 2012). A second, putative class 2-type V CRISPR-Cas system has been recently identified in several bacterial genomes. The putative type V CRISPR-Cas systems contain a large, 1,300 amino acid protein called Cpf1 (CRISPR from Prevotella and Francisella 1).

(205) In some embodiments, an oncolytic virus described herein further comprises at least one polynucleotide encoding a trRNA and crRNA targeted to the miRNA or the TIMP. In some cases, the at least one polynucleotide encoding a trRNA and crRNA is inserted into a locus on the viral genome. In some embodiments, the polynucleotide is an insulated sequence comprising a synthetic insulator or a native viral (e.g., HSV) insulator. In certain embodiments, an oncolytic virus is a herpes simplex virus and the at least one polynucleotide encoding an RNA binding site is inserted into or between one or more loci including the internal repeat joint region (comprising one copy each of the diploid genes ICP0, ICP34.5, LAT, ICP4, and the ICP47 promoter), ICP0, LAT, UL1, UL5, UL6, UL7, UL8, UL9, UL11, UL12, UL14, UL15, UL17, UL18, UL19, UL20, UL22, UL25, UL26, UL26.5, UL27, UL28, UL29, UL30, UL31, UL32, UL33, UL34, UL35, UL36, UL37, UL38, UL39, UL40, UL42, UL48, UL49, UL52, UL53, UL54, ICP0, ICP4, ICP22, ICP27, ICP47, gamma-34.5, US3, US4, US5, US6, US7, US8, US9, US10, US11, and US12. In one embodiment, an oncolytic virus is a herpes simplex virus (HSV) and the at least one polynucleotide encoding an RNA binding site is inserted into a locus between the UL3 and the UL4 open reading frames (e.g., FIG. 39 and FIG. 40).

(206) In some embodiments, the recombinant oncolytic virus comprises at least one polynucleotide encoding a payload molecule that activate or enhances an anti-tumor immune response. In some embodiments, the payload molecule is a cytokine, a chemokine, an antibody or antigen binding fragment thereof, a bispecific T-cell engager (BiTE). For example, in some embodiments, the payload molecule is an antibody or antigen binding fragments thereof that bind to and inhibit immune checkpoint receptors (e.g. CTLA4, LAG3, PD1, PDL1, and others). In some embodiments, the payload molecule is an anti-PD1 antibody or antigen-binding fragment thereof, an anti-PDL1 antibody or antigen-binding fragment thereof, or an anti-CTLA4 antibody or antigen-binding fragment thereof.

(207) In some embodiments, the payload molecule is a protein that binds to and activates a cell-surface receptor. For example, in some embodiments, payload molecule comprises an endogenous cell-surface ligand, such as the extracellular domain of 41BBL, the extracellular domain of CD40L, FLT3L. In some embodiments, the payload molecule is a cytokine (e.g., IFN, IFN, IFN, TNF, IL-12, IL-2, IL-6, IL-8, IL-15, GM-CSF, IL-21, IL-35, TGF, and others) or chemokine (e.g., CCL4, CXCL10, CCL5, CXCL13, or XCL1).

(208) In some embodiments, the payload molecule is a protein that binding to and activate an activating receptor (e.g., FcRI, FcIIa, FcIIIa, costimulatory receptors, and others). In particular embodiments, the protein is selected from EpCAM, folate, A2A, anti-FGF2, anti-FGFR/FGFR2b, anti-SEMA4D, CD137, CD200, CD38, CD44, CSF-1R, endothelin B Receptor, ISRE7, LFA-1, NG2 (also known as SPEG4), SMADs, STING, and VCAM1.

(209) In certain embodiments, a polynucleotide encoding a protein or an oligonucleotide targeted to reduce expression of an miRNA, a gene, or a TIMP is inserted into a locus on the viral genome of a recombinant oncolytic virus. In some embodiments, the polynucleotide is an insulated sequence comprising a synthetic insulator or a native viral (e.g., HSV) insulator. In certain embodiments, the oncolytic virus is a herpes simplex virus and the at least one polynucleotide encoding an RNA binding site is inserted into or between one or more loci including the internal repeat joint region (comprising one copy each of the diploid genes ICP0, ICP34.5, LAT, ICP4, and the ICP47 promoter), ICP0, LAT, UL1, UL5, UL6, UL7, UL8, UL9, UL11, UL12, UL14, UL15, UL17, UL18, UL19, UL20, UL22, UL25, UL26, UL26.5, UL27, UL28, UL29, UL30, UL31, UL32, UL33, UL34, UL35, UL36, UL37, UL38, UL39, UL40, UL42, UL48, UL49, UL52, UL53, UL54, ICP0, ICP4, ICP22, ICP27, ICP47, gamma-34.5, US3, US4, US5, US6, US7, US8, US9, US10, US11, and US12 . . . . In one embodiment, the virus is a herpes simplex virus (HSV) and the at least one polynucleotide is inserted into a locus between the UL3 and the UL4 open reading frames (see, e.g., FIG. 39 and FIG. 40).

(210) In some embodiments, the recombinant oncolytic virus comprises at least one protease-activated antibody. Protease-activated antibodies, such as those described by Metz et al. (Protein Eng Des Sel, 25 (10): 571-80, 2012) are activated and bind only to targets following protease cleavage of a protective cap. In some instances, tumor microenvironments possess an array of proteases that are well differentiated from surrounding healthy tissues. For example, the protease cathepsin B is overexpressed in numerous cancers, including breast, cervix, colon, colorectal, gastric, head and neck, liver, lung, melanoma, ovarian, pancreatic, prostate, and thyroid cancer. The human degradome, comprised of a complete list of proteases synthesized by human cells, is made up of at least 569 proteases that are distributed into five broad classes (in order from greatest to least number): metalloproteinases (MMPs), serine, cysteine, threonine, and aspartic proteases (Lopez-Otin et al., Nat Rev Cancer, 7 (10): 800-8, 2007). In particular, protease antibodies specifically cleaved by MMPs can serve as an excellent means of targeting the recombinant viral vectors described herein to the tumor microenvironment, as MMPs are found in the extracellular and pericellular areas of the cell. Table 6 summarizes proteases that are overexpressed in cancers which can be exploited to enable specific binding of recombinant viral vectors pseudotyped with protease-activated antibodies.

(211) In certain embodiments, the protease-activated antibody is incorporated into the viral glycoprotein envelope. Protease-activated antibodies can be incorporated into the glycoprotein envelope of a recombinant viral vector of the invention (e.g., an HSV vector) to increase the therapeutic index and reduce off-target infection. In the case of an HSV vector, in some embodiments, the glycoprotein may be gC or gD. In some embodiments, the recombinant oncolytic viruses described herein comprise at least one polynucleotide encoding a protease-activated antibody. In certain embodiments, a protease-activated antibody is activated by a protease selected from a cysteine cathepsin, an aspartic cathepsin, a kallikrein (hK), a serine protease, a caspase, a matrix metalloproteinase (MMP), and a disintegrin and metalloproteinase (ADAM). In some embodiments, a protease is selected from cathepsin K, cathepsin B, cathepsin L, cathepsin E, cathepsin D, hK1, PSA (hK3), hK10, hK15, uPA, uPAR, MMP-1, MMP-2, MMP-3, MMP-7, MMP-8, MMP-9, MMP-10, MMP-11, MMP-12, MMP-13, MMP-14, MMP-15, MMP-16, MMP-17, MMP-18, MMP-19, MMP-20, MMP-21, MMP-23A, MMP-23B, MMP-24, MMP-25, MMP-26, MMP-27, MMP-28, or a protease listed in Table 6.

(212) In some embodiments, the protease-activated antibody binds a protein expressed more highly by cancer cells or in cancer microenvironments than by non-cancer cells or in non-cancer microenvironments. In certain aspects, a protease-activated antibody binds NKG2D, c-met, HGFR, CD8, heparan sulfate, VSPG4 (also known as NG2), EGFR, EGFRvIII, CD133, CXCR4, carcinoembryonic antigen (CEA), CLC-3, annexin II, human transferrin receptor, or EpCAM. In certain instances, multiple protease activated antibodies may be incorporated into a single viral vector particle to ensure that diverse tumor histotypes are targeted. For example, at least 1, 2, 3, 4, 6, 7, 8, 9, 10, or more protease activated antibodies may be incorporated into the viral glycoprotein envelope. In some embodiments, the recombinant oncolytic virus comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more polynucleotides that encodes for at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more protease activated antibodies. In some embodiments, an oncolytic virus comprises a first protease-activated antibody that binds a first protein expressed more highly by cancer cells or in cancer microenvironments than by non-cancer cells or in non-cancer microenvironments, and a second protease-activated antibody that binds a second protein expressed more highly by cancer cells or in cancer microenvironments than by non-cancer cells or in non-cancer microenvironments. In further embodiments, an oncolytic virus comprises a plurality of protease-activated antibodies binding a plurality of protein expressed more highly by cancer cells or in cancer microenvironments than by non-cancer cells or in non-cancer microenvironments. An oncolytic virus comprises, for example, a protease-activated antibody that is a human antibody, a humanized antibody or a chimeric antibody. In some embodiments, an oncolytic virus comprises an antibody that is a full-length immunoglobulin, an scFv, a Fab, a Fab, an F(ab)2, an Fv, a diabody, a triabody, a minibody, a single-domain antibody, or a multispecific antibody.

(213) In some embodiments, a recombinant oncolytic virus comprises one or more of: one or more micro-RNA (miR) target sequences inserted into a locus of one or more viral genes required for viral replication; one or more polynucleotides encoding one or more proteins or oligonucleotides, wherein the proteins or oligonucleotides reduce the expression or inhibit the function of a miR, a gene, or a TIMP; at least one protease-activated antibody; and/or a polynucleotide encoding at least one protease activated antibody. In some embodiments, a recombinant oncolytic virus comprises: a plurality of copies of one or more miRNA target sequences inserted into a locus of a viral gene required for viral replication in non-cancerous cells; and/or a first polynucleotide encoding a protein or an oligonucleotide targeted to reduce expression of an oncogenic miRNA or an oncogenic gene; and/or a second polynucleotide encoding a protein or an oligonucleotide targeted to reduce expression of a microenvironment remodeling miRNA or a TIMP. In some embodiments, a recombinant oncolytic virus comprises: a plurality of copies of one or more miRNA target sequences inserted into a locus of a viral gene required for viral replication in non-cancerous cells; and/or a polynucleotide encoding a protein or an oligonucleotide targeted to reduce expression of an oncogenic miRNA or an oncogenic gene; and/or at least one protease-activated antibody. In further embodiments, a recombinant oncolytic virus comprises a plurality of copies of one or more miRNA target sequences inserted into a locus of a viral gene required for viral replication in non-cancerous cells; and/or a polynucleotide encoding a protein or an oligonucleotide targeted to reduce expression of a microenvironment remodeling miRNA or a TIMP; and/or at least one protease-activated antibody. In one embodiment, a recombinant oncolytic virus comprises a plurality of copies of one or more miRNA target sequences inserted into a locus of a viral gene required for viral replication in non-cancerous cells; and/or a first polynucleotide encoding a protein or an oligonucleotide targeted to reduce expression of an oncogenic miRNA or an oncogenic gene; and/or a second polynucleotide encoding a protein or an oligonucleotide targeted to reduce expression of a microenvironment remodeling miRNA or a TIMP; and/or at least one protease-activated antibody. In some specific embodiments, an oncolytic virus described in this paragraph is a herpes simplex virus and the viral gene required for viral replication in non-cancerous cells is UL1, UL5, UL6, UL7, UL8, UL9, UL11, UL12, UL14, UL15, UL17, UL18, UL19, UL20, UL22, UL25, UL26, UL26.5, UL27, UL28, UL29, UL30, UL31, UL32, UL33, UL34, UL35, UL36, UL37, UL38, UL39, UL40, UL42, UL48, UL49, UL52, UL53, UL54, ICP0, ICP4, ICP22, ICP27, ICP47, gamma-34.5, US3, US4, US5, US6, US7, US8, US9, US10, US11, and US12.

(214) In certain aspects, the invention relates to a recombinant oncolytic virus comprising a first polynucleotide encoding a protein or an oligonucleotide targeted to reduce expression of an oncogenic miRNA or an oncogenic gene; and a second polynucleotide encoding a protein or an oligonucleotide targeted to reduce expression of a microenvironment remodeling miRNA or a TIMP. In other embodiments, a recombinant oncolytic virus comprises a polynucleotide encoding a protein or an oligonucleotide targeted to reduce expression of an oncogenic miRNA or an oncogenic gene; and at least one protease-activated antibody. In some embodiments, a recombinant oncolytic virus comprises a polynucleotide encoding a protein or an oligonucleotide targeted to reduce expression of a microenvironment remodeling miRNA or a TIMP; and at least one protease-activated antibody. In one embodiment, a recombinant oncolytic virus comprises a first polynucleotide encoding a protein or an oligonucleotide targeted to reduce expression of an oncogenic miRNA or an oncogenic gene; and/or a second polynucleotide encoding a protein or an oligonucleotide targeted to reduce expression of a microenvironment remodeling miRNA or a TIMP; and/or at least one protease-activated antibody.

(215) In some embodiments, the oncolytic virus is an HSV virus comprising a first miR-TS cassette inserted into the 3 UTR of ICP4 comprising 4 target sequences for each of miR-124-3p, miR-1-3p, and miR-143-3p; a second miR-TS cassette inserted into the 3 UTR of ICP27 comprising 4 target sequences for each of miR-219a-5p, miR-122-5p, and miR128-3p; and a third miR-TS cassette inserted into the 3 UTR of UL8 comprising 4 target sequences for each of miR-137-3p, miR-208b-3p, and miR-126-3p. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12 and MMP9. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding CXCL10. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12 and CXCL10. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding CXCL10 and MMP9. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12, CXCL10, and XCL1. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12, CXCL10, and CCL4. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12, CXCL10, and FLT3L. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12 and 41BBL. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12 and CD40L. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding 41BBL and CD40L. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding an anti-CTLA4 antibody or antigen binding fragment thereof. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding an anti-PD1 or anti-PDL1 antibody or antigen binding fragment thereof. In some embodiments, the oncolytic virus comprises a nucleic acid sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to one of SEQ ID NOs: 843, 844, 847, or 848. In some embodiments, the oncolytic virus comprises or consists of the nucleic acid sequence of one of SEQ ID NOs: 843, 844, 847, or 848.

(216) In some embodiments, the oncolytic virus is an HSV virus comprising a first miR-TS cassette inserted into the 3 UTR of ICP4 comprising 4 target sequences for each of miR-124-3p, miR-1-3p, and miR-143-3p; a second miR-TS cassette inserted into the 3 UTR of ICP27 comprising 4 target sequences for each of miR-219a-5p, miR-122-5p, and miR128-3p; a third miR-TS cassette inserted into the 3 UTR of UL8 comprising 4 target sequences for each of miR-137-3p, miR-208b-3p, and miR-126-3p. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12 and MMP9. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding CXCL10. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12 and CXCL10. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding CXCL10 and MMP9. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12, CXCL10, and XCL1. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12, CXCL10, and CCL4. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12, CXCL10, and FLT3L. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12 and 41BBL. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12 and CD40L. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding 41BBL and CD40L. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding an anti-CTLA4 antibody or antigen binding fragment thereof. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding an anti-PD1 or anti-PDL1 antibody or antigen binding fragment thereof. In some embodiments, the oncolytic virus comprises a nucleic acid sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 845 or 846. In some embodiments, the oncolytic virus comprises or consists of the nucleic acid sequence of one of SEQ ID NOs: 845 or 846.

(217) In some embodiments, the oncolytic virus is an HSV virus comprising a first miR-TS cassette inserted into the 3 UTR of ICP4 comprising 4 target sequences for each of miR-124-3p, miR-1-3p, and miR-143-3p; a second miR-TS cassette inserted into the 3 UTR of ICP27 comprising 4 target sequences for each of miR-219a-5p, miR-122-5p, and miR128-3p; a third miR-TS cassette inserted into the 3 UTR of UL8 comprising 4 target sequences for each of miR-137-3p, miR-208b-3p, and miR-126-3p; and a fourth miR-TS cassette inserted into the 3 UTR of ICP34.5 comprising 4 target sequences for each of miR-128-3p, miR-204-5p, and miR-219a-5p. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12 and MMP9. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding CXCL10. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12 and CXCL10. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding CXCL10 and MMP9. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12, CXCL10, and XCL1. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12, CXCL10, and CCL4. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12, CXCL10, and FLT3L. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12 and 41BBL. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12 and CD40L. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding 41BBL and CD40L. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding an anti-CTLA4 antibody or antigen binding fragment thereof. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding an anti-PD1 or anti-PDL1 antibody or antigen binding fragment thereof. In some embodiments, the oncolytic virus comprises a nucleic acid sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 850. In some embodiments, the oncolytic virus comprises or consists of the nucleic acid sequence of SEQ ID NO: 850.

(218) In some embodiments, the oncolytic virus is an HSV virus comprising a first miR-TS cassette inserted into the 3 UTR of ICP4 comprising 4 target sequences for each of miR-124-3p, miR-1-3p, and miR-143-3p; a second miR-TS cassette inserted into the 3 UTR of ICP27 comprising 4 target sequences for each of miR-219a-5p, miR-122-5p, and miR128-3p; a third miR-TS cassette inserted into the 3 UTR of UL8 comprising 4 target sequences for each of miR-137-3p, miR-217-5p, and miR-126-3p; and a fourth miR-TS cassette inserted into the 3 UTR of ICP34.5 comprising 4 target sequences for each of miR-128-3p, miR-204-5p, and miR-219a-5p. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12 and MMP9. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding CXCL10. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12 and CXCL10. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding CXCL10 and MMP9. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12, CXCL10, and XCL1. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12, CXCL10, and CCL4. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12, CXCL10, and FLT3L. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12 and 41BBL. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12 and CD40L. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding 41BBL and CD40L. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding an anti-CTLA4 antibody or antigen binding fragment thereof. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding an anti-PD1 or anti-PDL1 antibody or antigen binding fragment thereof. In some embodiments, the oncolytic virus comprises a nucleic acid sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 849. In some embodiments, the oncolytic virus comprises or consists of the nucleic acid sequence of SEQ ID NO: 849.

(219) In some embodiments, the oncolytic virus is an HSV virus comprising a first miR-TS cassette inserted into the 3 UTR of ICP4 comprising 4 target sequences for each of miR-124-3p, miR-1-3p, and miR-143-3p; a second miR-TS cassette inserted into the 3 UTR of ICP27 comprising 4 target sequences for each of miR-219a-5p, miR-122-5p, and miR128-3p; a third miR-TS cassette inserted into the 3 UTR of UL8 comprising 4 target sequences for each of miR-137-3p, miR-217-5p, and miR-126-3p; and a fourth miR-TS cassette inserted into the 3 UTR of ICP34.5 comprising 4 target sequences for each of miR-128-3p, miR-204-5p, and miR-219a-5p. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12 and MMP9. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding CXCL10. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12 and CXCL10. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding CXCL10 and MMP9. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12, CXCL10, and XCL1. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12, CXCL10, and CCL4. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12, CXCL10, and FLT3L. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12 and 41BBL. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12 and CD40L. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding 41BBL and CD40L. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding an anti-CTLA4 antibody or antigen binding fragment thereof. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding an anti-PD1 or anti-PDL1 antibody or antigen binding fragment thereof. In some embodiments, the oncolytic virus comprises a nucleic acid sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 851. In some embodiments, the oncolytic virus comprises or consists of the nucleic acid sequence of SEQ ID NO: 851.

(220) The invention also encompasses a nucleic acid molecule encoding an oncolytic virus described herein.

(221) Compositions and Methods of Use

(222) Certain aspects of the invention relate to stocks and compositions comprising the oncolytic viruses described herein. In some aspects, the invention relates to a viral stock comprising an oncolytic virus described herein. In some embodiments, a viral stock is a homogeneous stock. The preparation and analysis of viral stocks is well known in the art. For example, a viral stock can be manufactured in roller bottles containing cells transduced with the viral vector. The viral stock can then be purified on a continuous nycodenze gradient, and aliquotted and stored until needed. Viral stocks vary considerably in titer, depending largely on viral genotype and the protocol and cell lines used to prepare them.

(223) In particular embodiments, the titer of a viral stock (e.g., an HSV-based vector viral stock) contemplated herein is at least about 10.sup.5 plaque-forming units (pfu), such as at least about 10.sup.6 pfu or even more preferably at least about 10.sup.7 pfu. In certain embodiments, the titer can be at least about 10.sup.8 pfu, or at least about 10.sup.9 pfu, and high titer stocks of at least about 10.sup.10 pfu or at least about 10.sup.11 pfu are most preferred.

(224) The invention further contemplates a composition comprising an oncolytic virus or a nucleic acid molecule described herein and a pharmaceutically acceptable carrier. The phrase pharmaceutically-acceptable refers to molecular entities and compositions that do not produce an allergic or similar untoward reaction when administered to a subject (e.g., a human). The term composition as used herein refers to a formulation of one or more oncolytic virus or a nucleic acid molecules described herein that is capable of being administered or delivered to a subject and/or a cell. Typically, formulations include all physiologically acceptable compositions including derivatives and/or prodrugs, solvates, stereoisomers, racemates, or tautomers thereof with any physiologically acceptable carriers, diluents, and/or excipients. A therapeutic composition or pharmaceutical composition (used interchangeably herein) is a composition of one or more agents capable of being administered or delivered to a patient and/or subject and/or cell for the treatment of a particular disease or disorder.

(225) The compositions disclosed herein may be formulated in a neutral or salt form. Pharmaceutically acceptable salt includes both acid and base addition salts. Pharmaceutically-acceptable salts include the acid addition salts (formed with the free amino groups of the protein) and which are formed with inorganic acids such as, for example, hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid and the like, and organic acids such as, but not limited to, acetic acid, 2,2-dichloroacetic acid, adipic acid, alginic acid, ascorbic acid, aspartic acid, benzenesulfonic acid, benzoic acid, 4-acetamidobenzoic acid, camphoric acid, camphor-10-sulfonic acid, capric acid, caproic acid, caprylic acid, carbonic acid, cinnamic acid, citric acid, cyclamic acid, dodecylsulfuric acid, ethane-1,2-disulfonic acid, ethanesulfonic acid, 2-hydroxyethanesulfonic acid, formic acid, fumaric acid, galactaric acid, gentisic acid, glucoheptonic acid, gluconic acid, glucuronic acid, glutamic acid, glutaric acid, 2-oxo-glutaric acid, glycerophosphoric acid, glycolic acid, hippuric acid, isobutyric acid, lactic acid, lactobionic acid, lauric acid, maleic acid, malic acid, malonic acid, mandelic acid, methanesulfonic acid, mucic acid, naphthalene-1,5-disulfonic acid, naphthalene-2-sulfonic acid, 1-hydroxy-2-naphthoic acid, nicotinic acid, oleic acid, orotic acid, oxalic acid, palmitic acid, pamoic acid, propionic acid, pyroglutamic acid, pyruvic acid, salicylic acid, 4-aminosalicylic acid, sebacic acid, stearic acid, succinic acid, tartaric acid, thiocyanic acid, ptoluenesulfonic acid, trifluoroacetic acid, undecylenic acid, and the like. Salts formed with the free carboxyl groups can also be derived from inorganic bases such as, for example, sodium, potassium, lithium, ammonium, calcium, magnesium, iron, zinc, copper, manganese, aluminum salts and the like. Salts derived from organic bases include, but are not limited to, salts of primary, secondary, and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines and basic ion exchange resins, such as ammonia, isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, diethanolamine, ethanolamine, deanol, 2-dimethylaminoethanol, 2-diethylaminoethanol, dicyclohexylamine, lysine, arginine, histidine, caffeine, procaine, hydrabamine, choline, betaine, benethamine, benzathine, ethylenediamine, glucosamine, methylglucamine, theobromine, triethanolamine, tromethamine, purines, piperazine, piperidine, N-ethylpiperidine, polyamine resins and the like. Particularly preferred organic bases are isopropylamine, diethylamine, ethanolamine, trimethylamine, dicyclohexylamine, choline and caffeine. Upon formulation, solutions will be administered in a manner compatible with the dosage formulation and in such amount as is therapeutically effective. The formulations are easily administered in a variety of dosage forms such as injectable solutions, drug-release capsules, and the like.

(226) As used herein, carrier includes any and all solvents, dispersion media, vehicles, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, carrier solutions, suspensions, colloids, and the like. The use of such media and agents for pharmaceutical active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active ingredient, its use in the therapeutic compositions is contemplated. Supplementary active ingredients can also be incorporated into the compositions.

(227) As used herein pharmaceutically acceptable carrier includes without limitation any adjuvant, carrier, excipient, glidant, sweetening agent, diluent, preservative, dye/colorant, flavor enhancer, surfactant, wetting agent, dispersing agent, suspending agent, stabilizer, isotonic agent, solvent, surfactant, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like that are physiologically compatible, including pharmaceutically acceptable cell culture media and/or emulsifier which has been approved by the United States Food and Drug Administration as being acceptable for use in humans and/or domestic animals. Exemplary pharmaceutically acceptable carriers include, but are not limited to, to sugars, such as lactose, glucose and sucrose; starches, such as corn starch and potato starch; cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; tragacanth; malt; gelatin; talc; cocoa butter, waxes, animal and vegetable fats, paraffins, silicones, bentonites, silicic acid, zinc oxide; oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; glycols, such as propylene glycol; polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; esters, such as ethyl oleate and ethyl laurate; agar; buffering agents, such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic saline; Ringer's solution; ethyl alcohol; phosphate buffer solutions; and any other compatible substances employed in pharmaceutical formulations. Except insofar as any conventional media and/or agent is incompatible with the agents of the present disclosure, its use in therapeutic compositions is contemplated. Supplementary active ingredients also can be incorporated into the compositions.

(228) Wetting agents, emulsifiers and lubricants, such as sodium lauryl sulfate and magnesium stearate, as well as coloring agents, release agents, coating agents, sweetening, flavoring and perfuming agents, preservatives and antioxidants can also be present in the compositions.

(229) Examples of pharmaceutically-acceptable antioxidants include: (1) water soluble antioxidants, such as ascorbic acid, cysteine hydrochloride, sodium bisulfate, sodium metabisulfite, sodium sulfite and the like; (2) oil-soluble antioxidants, such as ascorbyl palmitate, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), lecithin, propyl gallate, alpha-tocopherol, and the like; and (3) metal chelating agents, such as citric acid, ethylenediamine tetraacetic acid (EDTA), sorbitol, tartaric acid, phosphoric acid, and the like.

(230) In one embodiment, a composition comprising a carrier is suitable for parenteral administration, e.g., intravascular (intravenous or intraarterial), intraperitoneal or intramuscular administration. Pharmaceutically acceptable carriers include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. The use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with a viral vector or nucleic acid molecule, use thereof in the pharmaceutical compositions of the invention is contemplated.

(231) The compositions of the invention may comprise one or more polypeptides, polynucleotides, vectors comprising same, infected cells, etc., as described herein, formulated in pharmaceutically-acceptable or physiologically-acceptable solutions for administration to a cell or an animal, either alone, or in combination with one or more other modalities of therapy. It will also be understood that, if desired, the compositions of the invention may be administered in combination with other agents as well, such as, e.g., cytokines, growth factors, hormones, small molecules or various pharmaceutically-active agents. There is virtually no limit to other components that may also be included in the compositions, provided that the additional agents do not adversely affect the ability of the composition to deliver the intended therapy.

(232) In the pharmaceutical compositions of the invention, formulation of pharmaceutically-acceptable excipients and carrier solutions is well-known to those of skill in the art, as is the development of suitable dosing and treatment regimens for using the particular compositions described herein in a variety of treatment regimens. Upon formulation, solutions are administered in a manner compatible with the dosage formulation and in such amount as is therapeutically effective to result in an improvement or remediation of the symptoms. The formulations are easily administered in a variety of dosage forms such as ingestible solutions, drug release capsules and the like. Some variation in dosage can occur depending on the condition of the subject being treated. The person responsible for administration can, in any event, determine the appropriate dose for the individual subject. Moreover, for human administration, preparations meet sterility, general safety and purity standards as required by FDA Center for Biologics Evaluation and Research standards. The route of administration will vary, naturally, with the location and nature of the disease being treated, and may include, for example intradermal, transdermal, subdermal, parenteral, nasal, intravenous, intramuscular, intranasal, subcutaneous, percutaneous, intratracheal, intraperitoneal, intratumoral, perfusion, lavage, direct injection, and oral administration.

(233) In certain circumstances it will be desirable to deliver the compositions, recombinant viral vectors, and nucleic acid molecules disclosed herein parenterally, intravenously, intramuscularly, or even intraperitoneally as described, for example, in U.S. Pat. Nos. 5,543,158; 5,641,515 and 5,399,363 (each specifically incorporated herein by reference in its entirety). Solutions of the active compounds as free base or pharmacologically acceptable salts may be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose. Dispersions may also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms.

(234) The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions (U.S. Pat. No. 5,466,468, specifically incorporated herein by reference in its entirety). In all cases the form should be sterile and should be fluid to the extent that easy syringability exists. It should be stable under the conditions of manufacture and storage and should be preserved against the contaminating action of microorganisms, such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and/or vegetable oils. Proper fluidity may be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. The prevention of the action of microorganisms can be facilitated by various antibacterial and antifungal agents, for example, parabenes, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin. The preparation of an aqueous composition that contains a protein as an active ingredient is well understood in the art. Typically, such compositions are prepared as injectables, either as liquid solutions or suspensions; solid forms suitable for solution in, or suspension in, liquid prior to injection can also be prepared. The preparation can also be emulsified.

(235) For parenteral administration in an aqueous solution, for example, the solution should be suitably buffered if necessary and the liquid diluent first rendered isotonic with sufficient saline or glucose. These particular aqueous solutions are especially suitable for intravenous, intramuscular, subcutaneous and intraperitoneal administration. In this connection, a sterile aqueous medium that can be employed will be known to those of skill in the art in light of the present disclosure. For example, one dosage may be dissolved in 1 ml of isotonic NaCl solution and either added to 1000 ml of hypodermoclysis fluid or injected at the proposed site of infusion (see, e.g., Remington: The Science and Practice of Pharmacy, 20th Edition. Baltimore, MD: Lippincott Williams & Wilkins, 2000). Some variation in dosage will necessarily occur depending on the condition of the subject being treated. The person responsible for administration will, in any event, determine the appropriate dose for the individual subject. Moreover, for human administration, preparations should meet sterility, pyrogenicity, and the general safety and purity standards as required by FDA Office of Biologics standards.

(236) Sterile injectable solutions can be prepared by incorporating the active compounds in the required amount in the appropriate solvent with the various other ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum-drying and freeze-drying techniques which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.

(237) In certain embodiments, the compositions may be delivered by intranasal sprays, inhalation, and/or other aerosol delivery vehicles. Methods for delivering polynucleotides and peptide compositions directly to the lungs via nasal aerosol sprays has been described e.g., in U.S. Pat. Nos. 5,756,353 and 5,804,212 (each specifically incorporated herein by reference in its entirety). Likewise, the delivery of drugs using intranasal microparticle resins (Takenaga et al., 1998) and lysophosphatidyl-glycerol compounds (U.S. Pat. No. 5,725,871, specifically incorporated herein by reference in its entirety) are also well-known in the pharmaceutical arts. Likewise, transmucosal drug delivery in the form of a polytetrafluoroetheylene support matrix is described in U.S. Pat. No. 5,780,045 (specifically incorporated herein by reference in its entirety).

(238) In certain embodiments, the delivery may occur by use of liposomes, nanocapsules, microparticles, microspheres, lipid particles, vesicles, optionally mixing with CPP polypeptides, and the like, for the introduction of the compositions of the present invention into suitable host cells. In particular, the compositions of the present invention may be formulated for delivery either encapsulated in a lipid particle, a liposome, a vesicle, a nanosphere, a nanoparticle or the like. The formulation and use of such delivery vehicles can be carried out using known and conventional techniques. The formulations and compositions of the invention may comprise one or more polypeptides, polynucleotides, and small molecules, as described herein, formulated in pharmaceutically-acceptable or physiologically-acceptable solutions (e.g., culture medium) for administration to a cell or an animal, either alone, or in combination with one or more other modalities of therapy. It will also be understood that, if desired, the compositions of the invention may be administered in combination with other agents as well, such as, e.g., cells, other proteins or polypeptides or various pharmaceutically-active agents.

(239) In a particular embodiment, a formulation or composition according to the present invention comprises a cell contacted with a combination of any number of polynucleotides or viral vectors, as contemplated herein.

(240) In certain aspects, the present invention provides formulations or compositions suitable for the delivery of viral vector systems.

(241) Exemplary formulations for ex vivo delivery may also include the use of various transfection agents known in the art, such as calcium phosphate, electroporation, heat shock and various liposome formulations (i.e., lipid-mediated transfection). Liposomes are lipid bilayers entrapping a fraction of aqueous fluid. DNA spontaneously associates to the external surface of cationic liposomes (by virtue of its charge) and these liposomes will interact with the cell membrane.

(242) Particular embodiments of the invention may comprise other formulations, such as those that are well known in the pharmaceutical art, and are described, for example, in Remington: The Science and Practice of Pharmacy, 20th Edition. Baltimore, MD: Lippincott Williams & Wilkins, 2000.

(243) In certain aspects, the present invention provides pharmaceutically acceptable compositions which comprise a therapeutically effective amount of one or more viral vectors or polynucleotides, as described herein, formulated together with one or more pharmaceutically acceptable carriers (additives) and/or diluents (e.g., pharmaceutically acceptable cell culture medium). As used herein, a therapeutically effective amount refers to the amount of a composition or recombinant virus described herein required to achieve a desired physiologic and/or biological outcome. A therapeutically effective amount of a virus, a viral stock, or a composition may vary according to factors such as the disease state, age, sex, and weight of the individual, and the ability of the stem and progenitor cells to elicit a desired response in the individual. A therapeutically effective amount is also one in which any toxic or detrimental effects of the virus or transduced therapeutic cells are outweighed by the therapeutically beneficial effects. The term therapeutically effective amount includes an amount that is effective to treat a subject (e.g., a patient). The therapeutically effective amount may be quantified by the total number of plaque forming units (pfu) (e.g. at least 1e.sup.1 to at least 1e.sup.20, particularly about 1e.sup.4 to about 1e.sup.15, more particularly about 1e.sup.6 to about 1e.sup.12 pfu), or number of viral genomes (e.g. at least 1e.sup.1 to at least 1e.sup.20, particularly about 1e.sup.4 to about 1e.sup.15, more particularly about 1e.sup.6 to about 1e.sup.12 viral genomes). One of skill in the art will understand that the therapeutically effective amount will vary based on the type of virus being administered, nature of the formulation, route of administration, nature and/or severity of the disease to be treated, and/or general health and well-being of the subject.

(244) Some aspects of the invention encompass a method of killing a cancerous cell, comprising exposing the cancerous cell to an oncolytic virus described herein or compositions thereof under conditions sufficient for the oncolytic virus to infect and replicate within said cancerous cell, and wherein replication of the oncolytic virus within the cancerous cell results in cell death. In certain embodiments, the cancerous cell has a reduced expression of a miR compared to a non-cancerous cell. In some embodiments, a cancerous cell killed by this method is in vivo. In certain embodiments, a cancerous cell killed by this method is within a tumor.

(245) The invention relates to a method of treating cancer in a subject in need thereof, comprising administering a prophylactically effective amount or a therapeutically effective amount of an oncolytic virus, a viral stock, or a composition as described herein to the subject. A subject, as used herein, includes any animal that exhibits a symptom of a disease, disorder, or condition that can be treated with the recombinant viral vectors, compositions, and methods disclosed herein. Suitable subjects (e.g., patients) include laboratory animals (such as mouse, rat, rabbit, or guinea pig), farm animals (such as horse or cow), and domestic animals or pets (such as cat or dog). Non-human primates and, preferably, human patients, are included.

(246) Administration refers herein to introducing an oncolytic virus, a viral stock, or a composition thereof into a subject or contacting an oncolytic virus, a viral stock, or a composition thereof with a cell and/or tissue. Administration can occur by injection, irrigation, inhalation, consumption, electro-osmosis, hemodialysis, iontophoresis, and other methods known in the art. The route of administration will vary, naturally, with the location and nature of the disease being treated, and may include, for example auricular, buccal, conjunctival, cutaneous, dental, endocervical, endosinusial, endotracheal, enteral, epidural, interstitial, intra-articular, intraarterial, intra-abdominal, intraauricular, intrabiliary, intrabronchial, intrabursal, intracavernous, intracerebral, intracisternal, intracorneal, intracronal, intracoronary, intracranial, intradermal, intradiscal, intraductal, intraduodenal, intraduodenal, intradural, intraepicardial, intraepidermal, intraesophageal, intragastric, intragingival, intrahepatic, intraileal, intralesional, intralingual, intraluminal, intralymphatic, intramammary, intramedulleray, intrameningeal, instramuscular, intranasal, intranodal, intraocular, intraomentum, intraovarian, intraperitoneal, intrapericardial, intrapleural, intraprostatic, intrapulmonary, intraruminal, intrasinal, intraspinal, intrasynovial, intratendinous, intratesticular, intratracheal, intrathecal, intrathoracic, intratubular, intratumoral, intratympanic, intrauterine, intraperitoneal, intravascular, intraventricular, intravesical, intravestibular, intravenous, intravitreal, larangeal, nasal, nasogastric, oral, ophthalmic, oropharyngeal, parenteral, percutaneous, periarticular, peridural, perineural, periodontal, respiratory, retrotubular, rectal, spinal, subarachnoid, subconjunctival, subcutaneous, subdermal, subgingival, sublingual, submucosal, subretinal, topical, transdermal, transendocardial, transmucosal, transplacental, trantracheal, transtympanic, ureteral, urethral, and/or vaginal perfusion, lavage, direct injection, and oral administration.

(247) The term treating and treatment as used herein refers to administering to a subject a therapeutically effective amount of a recombinant virus or composition thereof as described herein so that the subject has an improvement in a disease or condition, or a symptom of the disease or condition. The improvement is any improvement or remediation of the disease or condition, or symptom of the disease or condition. The improvement is an observable or measurable improvement, or may be an improvement in the general feeling of well-being of the subject. Thus, one of skill in the art realizes that a treatment may improve the disease condition, but may not be a complete cure for the disease. A prophylactically effective amount refers to an amount of a virus, a viral stock, or a composition effective to achieve the desired prophylactic result. As used herein, prophylaxis can mean complete prevention of the symptoms of a disease, a delay in onset of the symptoms of a disease, or a lessening in the severity of subsequently developed disease symptoms. Typically, but not necessarily, since a prophylactic dose is used in subjects prior to or at an earlier stage of disease, the prophylactically effective amount is less than the therapeutically effective amount.

(248) Cancer herein refers to or describes the physiological condition in mammals that is typically characterized by unregulated cell growth. Examples of cancer include but are not limited to carcinoma, lymphoma, blastoma, sarcoma (including liposarcoma, osteogenic sarcoma, angiosarcoma, endotheliosarcoma, leiomyosarcoma, chordoma, lymphangiosarcoma, lymphangioendotheliosarcoma, rhabdomyosarcoma, fibrosarcoma, myxosarcoma, chondrosarcoma), neuroendocrine tumors, mesothelioma, synovioma, schwannoma, meningioma, adenocarcinoma, melanoma, and leukemia or lymphoid malignancies. More particular examples of such cancers include squamous cell cancer (e.g. epithelial squamous cell cancer), lung cancer including small-cell lung cancer, non-small cell lung cancer, adenocarcinoma of the lung and squamous carcinoma of the lung, small cell lung carcinoma, cancer of the peritoneum, hepatocellular cancer, gastric or stomach cancer including gastrointestinal cancer, pancreatic cancer, glioblastoma, cervical cancer, ovarian cancer, liver cancer, bladder cancer, hepatoma, breast cancer, colon cancer, rectal cancer, colorectal cancer, endometrial or uterine carcinoma, salivary gland carcinoma, kidney or renal cancer, prostate cancer, vulvar cancer, thyroid cancer, hepatic carcinoma, anal carcinoma, penile carcinoma, testicular cancer, esophageal cancer, tumors of the biliary tract, Ewing's tumor, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinomas, cystadenocarcinoma, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatoma, bile duct carcinoma, choriocarcinoma, seminoma, embryonal carcinoma, Wilms' tumor, testicular tumor, lung carcinoma, bladder carcinoma, epithelial carcinoma, glioma, astrocytoma, medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, meningioma, melanoma, neuroblastoma, retinoblastoma, leukemia, lymphoma, multiple myeloma, Waldenstrom's macroglobulinemia, myelodysplastic disease, heavy chain disease, neuroendocrine tumors, Schwannoma, and other carcinomas, as well as head and neck cancer.

(249) In certain embodiments, an oncolytic virus (e.g., an HSV), a viral stock, or a composition as described herein are used to treat a cancer selected from lung cancer (e.g., small cell lung cancer or non-small cell lung cancer), breast cancer, ovarian cancer, cervical cancer, prostate cancer, testicular cancer, colorectal cancer, colon cancer, pancreatic cancer, liver cancer (e.g., hepatocellular carcinoma (HCC)), gastric cancer, head and neck cancer, thyroid cancer, malignant glioma, glioblastoma, melanoma, B-cell chronic lymphocytic leukemia, diffuse large B-cell lymphoma (DLBCL), and marginal zone lymphoma (MZL).

(250) In certain aspects, the invention relates to an oncolytic viral vector as shown in any one of the figures or embodiments disclosed herein.

EXAMPLES

(251) The following examples for the purpose of illustrating various embodiments of the invention and are not meant to limit the present invention in any fashion. The present examples, along with the methods described herein, are exemplary, and are not intended as limitations on the scope of the invention. Alterations, modifications, and other changes to the described embodiments which are encompassed within the spirit of the invention as defined by the scope of the claims are specifically contemplated.

Example 1miR Sequence Analysis of Normal and Malignant Cells

(252) Differential miR expression is a hallmark of many cancers (Lu et al, Nature, 2005). Experiments were performed to determine the miRs that were mostly highly differentially expressed in eight different cancer cells lines. Differential expression was determined by comparisons to non-cancerous control tissues. In total, 108 samples were sequenced. Sample details are provided in Table 11.

(253) TABLE-US-00003 TABLE 11 # of Cancer # of Control Cancer Type Cell Lines Tissue Samples Bladder 8 4 Colon 8 3 Breast 12 4 Pancreatic 7 3 Lung 8 5 Head and Neck 6 6 Schwannoma 7 4* Glioblastoma 14 4* Additional Controls Normal Liver 3 Normal Bone 3 Marrow *Same control samples used for both Schwannoma and glioblastoma analysis

(254) To facilitate the identification of appropriate miRNA target sequences suitable for HSV attenuation in select cell types, miRNA sequence profiling of cancer lines and non-cancer control tissue was performed. Sequencing libraries of dicer-processed RNAs were generated for cancer and non-cancer cells, including bladder, colon, breast, pancreas, lung, head and neck, schwannoma, glioblastoma, brain, liver, and bone marrow. These miRNA sequencing libraries were normalized to total RNA, and sequenced using a HiSeq 2500 ultra-high throughput sequencing system with HiSeq V4 chemistry reagents for sequencing reads up to 3e.sup.8 reads/run (Illumina). FASTQ files from sequencing runs were analyzed using the miRNAs Analysis tool in Basespace (Illumina). Rankings were made by calculating the mean of normal, the mean of cancer and sorting the ratio of normal/cancer from high to low. Heat maps were generated with natural logarithmic values with zero and negative values converted to zero (scale: black is high, white is low expression). Normalized data across samples were expressed as normalized miRNA read counts in a given sample. Normalization is related to total number of reads in a given sample relative to other samples in the comparison.

(255) FIG. 1 exemplifies the miRNA expression profile heat map in non-cancerous and cancerous brain tissue of twenty-five miRNAs. Additional examples of miRNA expression profile heat maps are shown for non-cancerous and cancerous bladder (FIG. 2), breast (FIG. 3), colon (FIG. 4), brain (FIG. 5), head and neck (FIG. 6), lung (FIG. 7), pancreas (FIG. 8), and schwannoma (FIG. 9) tissue corresponding to twenty-five miRNAs in each example. Table 12 shows a summary of the expression levels of particular miRs between cancerous and non-cancerous tissue. As shown, miR-451a levels are down regulated in all tumor types compared to non-cancerous tissue, representing a potential pan-tumor suppressor miRNA. miR-1-3p is down-regulated in all tumor types tested, present at moderate levels in non-cancerous tissue, and present at high levels in head and neck tissue. miR-559 is down-regulated in all tumor types tested, present generally at low levels in non-cancerous tissue, and present at high levels in non-cancerous lung tissue. miR-145-5p is down-regulated in all tumor types tested and present generally at high levels in the majority of non-cancerous tissue types tested. miR-143-3p is down-regulated in colon, lung, and pancreatic tumors, and is present at high levels in all normal tissue types and some breast tumor lines. miRNA data analysis revealed at least eleven miRNAs that represent novel and unexpected miRNA expression profiles not previously identified in the literature.

(256) TABLE-US-00004 TABLE 12 miR-451a miR-1-3p miR-559 miR-145-5p miR-143-3p Tissue Norm Can Norm Can Norm Can Norm Can Norm Can Bladder 1402.9 21.1 175 0.8 14 0.4 971.5 39.8 489028.8 14904.6 Breast 2262.1 3.9 3 0.3 88.4 0.9 406.1 106.6 125943.9 91543.1 Colon 3606.9 22 149.3 1.6 40.8 2.1 1177.3 0.5 809955.6 193.9 Glioma 4269.7 16.7 75.2 1 162.7 0.4 2399.2 7.2 514114.8 1248.6 Head & Neck 11919.8 10.3 2846.6 2.6 71.2 2.2 690.9 30.4 331034.2 20706.2 Lung 31442 10.5 73.3 1.4 548.3 0.1 1547.5 1 436136.8 390.9 Pancreatic 1035.8 13.3 4.1 0.4 13.3 0.5 81.7 0.5 25557 269.8

(257) Many of these identified miRNAs are pan- or multi-tumor specific. For example, expression of miR-451a, miR-559, miR-1-3p, miR-145-3p, and miR143-3p were generally down-regulated across all cancer cell lines tested compared to control tissues. This was particularly notable for miR-451a, which was highly expressed in all normal tissue type and substantially down-regulated in all cancer types, thus representing a pan-specific tumor-suppressive miRNA. The expression of miR-559 was lower in normal tissue types, except for normal lung tissue, and expression of miR-1-3p and mir-145-3p in normal tissue was variable. Despite the variability in the magnitude of differences and absolute expression levels, mean expression of each miR in cancer cells lines was substantially lower compared to levels in the corresponding normal tissues. These miRNAs are candidates for generating pan-tumor HSV virions that are capable of broadly treating a variety of cancer types. Although the mean expression for miR-451a, miR-559, miR-1-3p, miR-145-3p, and miR143-3p was lower in cancer cell lines compared to normal controls, the decreased expression was not fully penetrant across all cancer cell lines. For example, 2/3 of the normal bladder samples tested showed increased expression of miR-145-3p, while expression in the remaining sample was substantially similar to the average observed in the cancer cell lines. Similar results were observed in breast cancer cell lines. Although the average read count for all breast cancer samples was 106, 5/12 samples had a normalized read count of >1000 counts, 2 of which were >40,000 counts.

(258) These data indicate the potential to generate a single miR-attenuated oncolytic virus capable of targeting a broad array of tumor types. For example, a construct comprising target sequences for miR-124, miR-451a, miR-559, miR-1, and miR-145-3p may be used in the treatment of all the tumor types tested (e.g., bladder, colon, breast, pancreatic, lung, head and neck, Schwannoma, and glioblastoma). The variability in expression levels of miRs in different cancer types indicates the potential need to stratify patients by miR expression or through the use of an additional biomarker.

(259) Additional miRNA profiling between cancerous and non-cancerous tissues was performed using a quantitative expression assay from Nanostring. The results of these experiments are shown for brain samples (FIG. 50), and demonstrate the identification of additional miRNAs that exhibit differential expression in cancerous and non-cancerous brain tissue that were not previously identified by the earlier studies outlined above, namely miR-9-5p, miR-128-3p, miR-137, miR-129-2-3p, and miR-487b-3p. Additional results are shown for heart samples (FIG. 51), demonstrating differential expression of miR-208b-3p, miR-1-3p, miR-208a-3p, miR133-3p, miR-4284, and miR-499a-5p between cancerous and non-cancerous heart tissue. Additional results are shown for peripheral nervous system samples (FIG. 52A-B), demonstrating differential expression of miR-204-5p, miR-1-3p, miR-206, miR-9-5p, miR-199b-5p, miR-145-5p, miR-100-5p, miR-574-3p. Specifically, miR-219a-2-3p, miR-9-5, miR-219a-5p, and miR-204-5p are differentially expressed in the spinal cord.

Example 2Identification of Viral Genes for miR-T Attenuation

(260) siRNA screens were performed to test the attenuation phenotype HSV genes. An siRNA screen is the ideal modality to test RISC attenuation phenotype of immediate early genes, and select early genes. siRNAs targeting the HSV genes ICP27, ICP4, ICP0, UL5, UL8, UL9, ICP8, ULC39/40, ICP22, UL30, UL42, and VP19 were transfected individually and in pools into A253 cells. 24 hours after siRNA transfection, cells were infected with ONCR-003 or ONCR-010 (described below in Table 13), each of which comprise a GFP cassette. Viral spread was measured 48 hours post-infection by quantifying GFP intensity. HSV genes identified as potential hits were validated by Western blots, viral titer measurements, and RT-PCR.

(261) The results of these screen are shown in FIGS. 47A and 47B. Individual siRNAs mediating >75% knockdown of the corresponding HSV gene are indicated by arrows in FIG. 47A and GFP intensity for a select subset of the siRNAs are shown in FIG. 47B. As shown in FIG. 48, siRNA-mediated knockdown of ICP4, UL5, UL8, ICP8, ICP22, and UL30 substantially reduced viral replication of ONCR-003 as indicated by a reduction in GFP intensity. Further, siRNA-mediated knockdown of ICP27, ICP4, UL5, UL8, UL9, ICP8, ICP22, and ICP30 substantially reduced viral replication of ONCR-010 as indicated by a reduction in GFP intensity. Cells infected with ONCR-010 were further analyzed by Western blot for expression of particular viral proteins. As shown in FIG. 49, significant reduction in these HSV genes was also observed at the protein level.

Example 3Construction and Use of a Reporter System to Rapidly Assay miRNA-Based Gene Attenuation

(262) A reporter system was developed to assess miRNA-based gene attenuation using virtually any miRNA target sequence and cognate miRNA. In this system (shown in FIG. 10), the target sequence recognized by miRNAs (i.e. hsa-miR-122) was inserted into the 3 UTR of de-stabilized green fluorescent protein (dsGFP). The cognate miRNA was then expressed via a tetracycline (tet) inducible promoter using mCherry as a control for miRNA expression. All expression vectors were cloned into a tet repressible vector pcDNA5 Frt/To that also expresses mCherry (pTF002). All miRNAs for expression generated by gene synthesis from human genomic DNA and were cloned into pTF002. To generate attenuation reporter vectors, dsGFP was cloned into cDNA3.1+, generating vector pTF004. Attenuation vectors contain four tandem repeats of the reverse complement of the miRNA sequence of interest separated by 8-16 nucleotides. Plasmids were constructed by insertion of synthetically generated oligonucleotides into the 3 UTR of the dsGFP gene of pTF004 using standard molecular biology techniques. On day one, HEK293TetR cells were transfected with the miRNA attenuation and reporter expression plasmids (0.15 g each, for a total of 0.3 g of CMV promotor-containing plasmid) using Lipofectamine 2000 per manufacturers protocol (Invitrogen). On day two, cells were treated with Tetracycline at 5 ng/ml and allowed to incubate for up to 72 hours. After incubation, GFP and mCherry fluorescence signals were detected daily using a SpectraMax i3x Minimax multi-mode microplate reader (Molecular Devices) and analyzed using Softmax Pro or Metamorph imaging software (Molecular Devices). Phase images were acquired with an exposure of 5-6 ms. Fluorescence images were acquired with a GFP (541 nm channel) exposure of 10 ms, and an mCherry (713 nm channel) of 200-1500 ms.

(263) FIG. 11 exemplifies miR-122 mediated attenuation of GFP expression upon induction of miR-122 expression via tet at 24 hours. The control miRNA mimics, miR-184, miR-34a, and Let7a, do not attenuate GFP levels, nor is GFP attenuation observed in the absence of tet. FIG. 12 shows the effect of miR-122, miR-184, miR-34a, and Let7a mimics on attenuation of GFP cassettes with miR-TS cassettes comprising each miR target sequence individually and in cassette combinations of miR-122/Let7a, miR-122/Let7a/miR-34a, or miR-122/Let7a/miR-184. Decreased GFP is only observed when the appropriate miR and cognate target sequence are present together (circled wells). FIG. 13 serves as a non-attenuated control and shows mCherry expression as a measure of the expression of the miR-122, miR-184, miR-34a, and Let7a mimics. FIG. 14 shows the effects of miR-122, miR-124, miR-145, miR-199, and miR-451 mimic expression on attenuated-GFP cassettes with miR-TS cassettes comprising each miR target sequence individually (circled wells). Non-attenuated controls are shown in FIG. 15 and show miR-122, miR-124, miR-145, miR-199, and miR-451 expression and mCherry expression using each target sequence individually.

(264) The ability of additional combinations of miR target sequence to attenuate GFP expression in the presence of cognate miR mimics are shown in FIG. 16-FIG. 26. In each figure, GFP fluorescence is measured at 72 hours post-transfection. In each instance, insertion of the indicated miR target sequences resulted in attenuated GFP expression when the cognate miRs were also expression. The effects of insertion of miR-122 and miR-184 target sequences (FIG. 16), miR-34a and miR-184 target sequences (FIG. 17), Let-7a and miR-184 target sequences (FIG. 18), miR-124 and miR-184 target sequences (FIG. 19), miR-145 and miR-184 target sequences (FIG. 20), miR-199 and miR-451 target sequences (FIG. 21), miR-125 and miR-451 target sequences (FIG. 22), miR-126 and miR-451 target sequences (FIG. 23), miR-127 and miR-451 target sequences (FIG. 24), miR-133 and miR-451 target sequences (FIG. 25), and miR-223 and miR-451 target sequences (FIG. 26) are each shown.

(265) As such, these data indicate that miR expression can result in the specific attenuation of genes expressing the cognate miR target sequence.

Example 4Generation of miRNA-Attenuated HSV

(266) Following reporter gene-based validation of miRNA target sequences and cognate miRNA pairs, HSV-based viruses comprising miR-TS cassettes were generated. A series of modifications were made in KOS-37 BAC, a full-length genomic clone of the KOS strain of HSV-1 on a bacterial artificial chromosome (BAC) as described (Mazzacurati et al., Mol Ther., 2015). The product, KG.sup.BAC, was deleted for the internal repeat (joint) region containing one copy each of the diploid genes ICP0, ICP34.5, LAT and ICP4 along with the promoter for the ICP47 gene. This deletion facilitates manipulation of the remaining copies of the 4 deleted genes, provides abundant space for the potential incorporation of transgenes that enhance the oncolytic activity of the virus, and increases tumor specificity by reducing expression of the neurovirulence factor ICP34.5; elimination of ICP47 expression benefits immune recognition of infected cancer cells by virus-specific T cells. KG.sup.BAC also contains the GFP open reading frame (ORF) fused to the glycoprotein C (gC) ORF via a 2A peptide sequence to allow monitoring of late (post-replication) viral gene expression. Lastly, KG.sup.BAC contains a pair of mutations in the gB gene shown to enhance HSV entry through non-canonical receptors (See e.g., International PCT Publication No. WO 2011/130749). A miR-TS cassette comprising 4 repeats of a target sequence for miR-124-3p were recombined into the 3 UTR of ICP4 to generate the 2A5B vector See e.g., International PCT Publication No. WO 2015/066042), and an expression cassette for MMP9 was inserted into the intergenic region between the UL3 and UL4 genes to generate the 2A5B-MMP9 vector (ONCR-003). Additional miRNA target sequence cassettes were recombined into the 3 UTR of the ICP4, ICP27, UL8, UL42, and/or ICP34.5 genes of ONCR-003 to generate the constructs shown in Table 13 below. All BAC constructs were converted to virus particles with simultaneous removal of the BAC sequences located between loxP sites by transfection of Vero-Cre cells. Following plaque purification, virus stocks were prepared and titered on Vero cells.

(267) TABLE-US-00005 TABLE 13 Exemplary miRNA-attenuated HSV constructs Construct ICP27 UL8 ICP34.5 ICP4 UL42 ONCR-003 None X X 124-3p (4x) X ONCR-010 122-5p X X 124-3p (4x) X 34a-5p Let-7a-5p ONCR-011 125a-5p (1x) X X 124-3p (4x) X ONCR-012 143-3p (1x) X X 124-3p (4x) X ONCR-013 145-5p (1x) X X 124-3p (4x) X ONCR-014 199a-5p (1x) X X 124-3p (4x) X ONCR-015 1-3p (1x) X X 124-3p (4x) X ONCR-016 133a-3p (1x) X X 124-3p (4x) X ONCR-017 223-3p (1x) X X 124-3p (4x) X ONCR-018 451a.sup.# (1x) X X 124-3p (4x) X ONCR-019 126-3p (1x) X X 124-3p (4x) X ONCR-020 127a-3p (1x) X X 124-3p (4x) X ONCR-021 133b-3p (1x) X X 124-3p (4x) X ONCR-022 134-3p (1x) X X 124-3p (4x) X ONCR-030 199a-3p (1x) X X 124-3p (4x) X ONCR-035 214-3p (1x) X X 124-3p (4x) X ONCR-036 122-5p (1x) X X 124-3p (4x) X ONCR-039 122-5p (2x) X X 124-3p (4x) X ONCR-040 122-5p (3x) X X 124-3p (4x) X ONCR-043 137-3p X X 124-3p (4x) X ONCR-047 34a-5p X X 124-3p (4x) X ONCR-048 184-3p X X 124-3p (4x) X ONCR-053 Let7a-5p X X 124-3p (4x) X ONCR-054 122-5p X X 124-3p (4x) X 184-3p Let-7a-5p ONCR-055 145-3p X X 124-3p (4x) X ONCR-062 559-5p X X 124-3p (4x) X ONCR-063 122-5p X X 124-3p (4x) X ONCR-064 122-5p X X 124-3p (4x) X Let-7a-5p ONCR-081 X X X 124-3p (4x) 125a-5p (1x) ONCR-082 X X X 124-3p (4x) 125a-5p (2x) ONCR-083 X X X 124-3p (4x) 125a-5p (3x) ONCR-084 X X X 124-3p (4x) 125a-5p (4x) ONCR-092 122-5p (1x) X X 124-3p (4x) 125a-5p (4x) ONCR-093 122-5p (4x) X X 124-3p (4x) 125a-5p (1x) ONCR-094 122-5p (1x) X X 124-3p (4x) 125a-5p (1x) ONCR-095 122-5p (1x) X X 124-3p (4x) 125a-5p (3x) ONCR-096 122-5p (4x) X X 124-3p (4x) 125a-5p (4x) ONCR-098 1-3p X X 124-3p (4x) X ONCR-099 145-5p 199a-5p 559-5p ONCR-100 X X X 124-3p (4x) 122-5p (3x) ONCR-103 122-5p (3x) X X 124-3p (4x) 125a-5p (1x) ONCR-104 122-5p (3x) X X 124-3p (4x) 125a-5p (4x) ONCR-129 219a-5p (4x) X X 124-3p (4x), X ONCR-144 122-5p (4x) 1-3p (4x), 128-3p (4x) 143-3p (4x) ONCR-130 219a-5p (4x) X X 124-3p (4x) X 122-5p (4x) 128-3p (4x) ONCR-131 219a-5p (4x) 137-3p (4x) X 124-3p (4x), X ONCR-136 122-5p (4x) 208b-3p (4x) 1-3p (4x), ONCR-155 128-3p (4x) 126-3p (4x) 143-3p (4x) ONCR-132 X 137-3p (4x) X 124-3p (4x) X 208b-3p (4x) 126-3p (4x) .sup.#miR-451a is non-canonically processed by Ago2 and does not have -3p and -5p arms

Example 5Viral Infectivity Assay Using miRNA-Attenuated HSV

(268) To assay for viral infectivity and replication in normal and cancerous cells, miRNA-attenuated HSV particles were tested in the following in vitro assay. On day one, for each cell type infected, HSV particles were introduced to achieve a multiplicity of infection (moi) of 0.01. On days two through five, viral infectivity was assayed by GFP detection using a SpectraMax i3x Minimax multi-mode microplate reader (Molecular Devices) and analyzed using Softmax Pro or Metamorph imaging software (Molecular Devices). Phase images were acquired with an exposure of 5-6 ms. Fluorescence images were acquired with a GFP (541 nm channel) exposure of 10 ms and an mCherry (713 nm channel) exposure of 200-1500 ms to evaluated any potential nonspecific autofluorescence signal.

(269) ONCR-011 replication was significantly attenuated in post-mitotic lung tissue due to the presence of the miR-T125 cassette in the ICP27 gene and high levels of miR-125a (>3000 counts, Table 14 below) in these cells, as shown in FIG. 27A (read out by GFP positive cell quantitation) and FIG. 27C (read out by quantitative PCR). Although ONCR-011 and the control virus, ONCR-003, contain miR-124 target sequences in the ICP4 gene, miR-124 is present at low levels (<100 counts, Table 14 below) which were insufficient to attenuate viral replication (FIG. 27B and FIG. 27D). Both ONCR-011 and ONCR-003 replicated freely in head and neck cancer cells (A253) because these cells contain low levels of both miR-125a and miR-124 (<100 counts) (Table 14).

(270) TABLE-US-00006 TABLE 14 miR-125a and miR-124 counts in post-mitotic lung and A253 cells Cell miRNA 125a counts miRNA 124 counts PM-lung >3000 <100 H&N CA <100 <100

(271) FIG. 28 shows replication of a miR-145 attenuated construct, ONCR-013, in HCC1395 and A253 cells. As shown in FIG. 28A (read out by GFP positive cell quantitation) and FIG. 28B (read out by quantitative PCR), replication of ONCR-013 was significantly attenuated in HCC1395 cells, but not in A253 cells due to the high expression of miR-145 in A253 and absence of expression in HCC1395 cells (Table 15).

(272) TABLE-US-00007 TABLE 15 miR-145 counts in A253 and HCC1395 cells Cell miRNA 145 counts A253 0 HCC1395 4487

(273) FIG. 29 shows attenuation of a miR-143-3p attenuated construct (ONCR-012) and a miR-199a-5p attenuated construct (ONCR-014) in normal BEAS-2B lung cells. As shown, replication of ONCR-014 was significantly attenuated in non-cancerous lung tissue (FIG. 29A, read out by GFP positive cell quantitation and FIG. 29B, read out by quantitative PCR), indicating that miR-199a-5p target sequences can attenuate viral replication in normal lung cells.

Example 6Attenuated Replication of oHSV Comprising Multiple miRNA Target Sequences in Multiple Gene Loci

(274) Viral infectivity and replication of constructs comprising miR-TS cassettes in multiple genetic loci was assessed in A253, Hep3B, and Huh7 cells. Results for ONCR-036, ONCR-063, ONCR-093, ONCR-094, ONCR-095, and ONCR-096 miR-attenuated HSV constructs are provided herein. Each of these viruses comprised one or more miR-124 target sequences, one or more miR-122 target sequences, and/or one or more miR-125a target sequences inserted into the ICP4, ICP27 and/or UL42 loci. Expression of miR-122 and miR-125a in each of the cell lines was assessed by a TaqMan assay. Briefly, total RNA, including the small RNA fraction, were isolated from growing cells with miRNeasy columns. The RNA was then used as the substrate for miR-122 and miR-125 specific TaqMan assays, and a parallel TaqMan assay for the U6 snRNA was performed to normalize expression levels per cell type per the CT method. The data are represented as a fold change relative to lowest cell line in question in each assay (A253 cells, FIG. 30A; Hep3B, FIG. 30B). As shown, A253 cells do not express miR-122 or miR-125a. Hep3B cells express high levels of miR-125 and low levels of miR-122, and Huh7 cells express miR-125a and high levels of miR-122.

(275) Viral infectivity and replication was assessed in an in vitro assay. Briefly, cells were plated at 45,000 cells/well in a 48-well dish and cultured overnight. On day one HSV particles were introduced into each cell type to achieve a multiplicity of infection (moi) of 0.01. 48 hours post-infection, viral infectivity was assessed by fluorescence microscopy. The results of this experiment are shown in FIG. 30C, and viral replication is indicated by eGFP levels. These data demonstrate enhanced attenuation of viral replication in cells that express intermediate to high levels of both miR-122 and miR-125a (Huh7 cells) compared to the attenuation observed in cells that express only one of the cognate miRs (Hep3B, expressing high levels of miR-125a) or compared to cells that express neither cognate miR (A253 cell, expressing neither miR-125a nor miR-122).

(276) Viral spread and protein expression were also assessed. Briefly, cell lysates were harvested 72 hours post-infection and subjected to PAGE and Western blot analysis. An anti-HSV1 capsid (VP5) antibody was used to monitor viral spread/protein expression and B-actin antibody was used as a loading control. In A253 cells, where there is no miR-125a or miR-122 expression, a level of high viral replication was observed in all of the miR-attenuated viruses (FIG. 31, lanes 3-6) as compared to the non-attenuated control (FIG. 31, ONCR-003 as non-attenuated control). However, viral replication was reduced in Huh7 cells, which express both cognate miRNAs and especially high levels of miR-122. These data exemplify viral attenuation by specific miRs relative to control virus.

(277) To further confirm that reduced viral replication of miR-attenuated HSV viruses was mediated by expression of specific miRs, A253 cells, which do not express endogenous miR-122 or miR-125a, were transfected with miR-122 and miR-125a mimics. Briefly, A253 cells were plated at 35,000 cells/well in a 48 well dish and cultured overnight. The cells were then transfected with Ambion miRNA mimics at 2.5 pM/well with Lipofectamine RNAiMAX. Total RNA, including the small RNA fraction, were isolated from growing cells with miRNeasy columns. These RNA samples were used as the substrate for miR-122 and miR-125 specific TaqMan assays, and a parallel TaqMan assay for the U6 snRNA was performed to normalize expression levels per cell type per the CT method. The results are shown in FIG. 32. As shown in FIG. 32A and FIG. 32B, miR-122 and miR-125 mimics specifically increased intracellular miR-122 and miR-125 expression levels in A253 cells by orders of magnitude.

(278) The subsequent day, cells were individually counted and infected with ONCR-036, ONCR-063, ONCR-093, ONCR-094, ONCR-095, or ONCR-096 miR-attenuated HSV particles and ONCR-003 non-attenuated controls at a MOI of 0.01; each of the oHSV viruses were added in 50 L for 1 hr, followed by addition of complete media. eGFP expressed by productive viral infection was assessed by fluorescence microscopy images taken 48 hrs post-infection. All images were exposed and processed identically. The results of this experiment are shown in FIG. 32C and are quantified by GFP detection using a SpectraMax i3x Minimax multi-mode microplate reader (Molecular Devices) and analyzed using Softmax Pro in FIG. 32D. These data exemplify attenuated viral replication in the presence of miR-122 mimics for all viruses with the exception of the ONCR-003 (WT). Further, the level of attenuation was proportional to the copy number of miR target sequences present in the HSV constructs, with the greatest reduction in GFP in ONCR-063, ONCR-093, ONCR-096, each comprising 4 miR-122 target sequence repeats in the ICP27 gene. Further, these data exemplify attenuated viral replication in the presence of miR-125a mimics for ONCR-093, -094, -095, and -096, relative to ONCR-003 (WT) and ONCR-036/ONCR-063 (each comprising only miR-122 target sequences).

(279) Similar experiments were performed to assess the viral replication of additional constructs comprising multiple miR-TS cassettes in two or more viral genes (e.g., ONCR-129, ONCR-131, ONCR-125, ONCR-126, ONCR-128, ONCR-130). In each case, expression of one or more miRNAs was able to attenuate viral replication of a particular construct comprising a target sequence corresponding to the expressed miRNA (data not shown).

Example 7Computational Method for Generating miR-TS Cassettes

(280) Based on the data described in the previous examples, miR-target sequence (miR-TS) cassettes were generated for insertion into particular HSV genes. miR target sequences exhibiting differential expression between cancerous and non-cancerous cells of different tissue types were selected to generate cassettes that are capable of attenuating viral replication in a broad variety of healthy cells, while allowing viral replication in cancerous cells where expression of the cognate miRs is decreased.

(281) This examples illustrates a method of generating candidate miR-TS cassettes and selected preferred candidates from the list. The method, implemented in the computer language Python, is depicted in FIG. 1. The inputs for the method include a list of seeds for exclusionin this example, seed sequences for miRNAs that are expressed in cancers were excludedand a list of miR-TSs to include in the cassette. The included miR-TSs used in this example are provided in Table 10, along with the parent miRNA sequence and length in nucleotides (nt) of each. miR-TSs tolerate imperfect matches between the microRNA and the miR-TS, so it will be understood that cassettes can be made with imperfect miR-TSs. miR-TS cassettes can be made with other miR-TSs, include miR-TSs based on any of the microRNAs known in the art or prospectively discovered.

(282) For this example, we designed four miR-TS cassettes, one for each of four essential viral genes: ICP4, ICP27, ICP34.5, and UL8, as shown in Table 16. But in principle these cassettes could be used with other viral (or non-viral) genes. Because the viral genes are in the reverse complementary orientation in our favored vectors, in each case the reverse complementary sequence was used. The abbreviation miR-126m refers to a version of the miR-126 site mutagenized to improve the site by removing a seed match for the oncomiR miR-155. The abbreviation miR-128m refers to a version of the miR-128 site mutagenized to improve the site by removing a seed match for the oncomiR miR-27a-3p.

(283) TABLE-US-00008 TABLE 16 Candidate miR-TS cassettes and target genes HSV Indication Cassette miR-T gene Protected Tissue Specificity 1 miR-124-3p ICP4 CNS/Brain/PNS, Lung, HnN miR-1-3p smooth muscle, miR-143-3p striated muscle/ heart 2 miR-128-3p ICP27 CNS/Brain/PNS/ Lung, HnN miR-219a-5p oligodend miR-122-5p rocytes, liver 3 miR-137-3p UL8 CNS/Brain/PNS, Lung, HnN, miR-208b-3p heart, Bladder miR-126-3p vasculature, hematopoietic stem cells 4 miR-219a-5p ICP34.5 Spine, PNS, CNS All miR-204-5p (Oligodendrocytes, miR-128-3p Glial cells, Neurons)

(284) The cassette designed for ICP4 can be used to down-regulate any gene, to which it is operatively linked, in smooth muscle (because of miR-143 target site) and striated muscale (because of miR-1 target site). The cassette designed for ICP27 can be used to down-regulate any gene, to which it is operatively linked, in healthy tissue because of miR-128m (expressed in cortical neurons), miR-122 (expressed in the liver), and miR-219 (expressed in the brain, spine and nerves) target sites. The cassette designed for ICP27 can be used to down-regulate any gene, to which it is operatively linked, in healthy tissue because of miR-128m, miR-204, and miR-219 target sites. The cassette designed for UL8 can be used to down-regulate any gene, to which it is operatively linked, in non-tumor tissue because of the mRNA target sites: miR-217, miR-137, and miR-126m.

(285) The program was run, outputting 10,000-100,000 cassettes for each combination which match the criteria used for list example (each of which is optional): (1) four copies of each miR-TS sites (in reverse-complementary orientation) arranged in a random order; (2) except that the same miR-TS cannot repeat adjacent to itself; (3) separated by 4 nucleotide spacers having random sequence; (4) no seeds from the excluded seed list; and (4) no polyadenylation sequence (AATAAA). The program also can, optionally, add 5 arm (CATGGACGAGCTGTACAAGTAAAGC) and 3 arm (GCGACCGGCTAGCGTACTAGCTTAG) sequences for Gibson assembly cloning (Nat Methods 2009; 6 (5): 343-5).

(286) The program next calculated a delta-G for folding of the candidate sequences using the fold subroutine of the ViennaRNA package (Lorenz et al. Algorithms for Molecular Biology, 6:1 26, 2011) with a 40 nt sliding window. The values for this sliding window calculation were stored as a list for each candidate sequence, and the candidate sequences are sorted by the maximum value of the absolute values of all delta-G values in the list (i.e., by the folding energy of the strongest secondary-structure element in the RNA). Sequences were further reviewed manually to eliminate candidate sequences with multiple, lower energy minima. Whenever possible, a candidate sequence with no local minima was chosen. In this manner, candidate sequences were identified in which there are no strong RNA secondary structure (low max of abs of delta-G) and also no local minima, or few local minima, in predicted secondary-structure folding energy.

(287) Finally, a microRNA target scanning algorithm (miranda v3.3a) was run on each candidate sequence to ensure that the desired miR-TSs were present and that no undesirable miR-TS were inserted by the program.

(288) Example sequences generated by this method are provided in Table 17. The length of the cassette is defined as the number of nucleotides from the first miR-TS to the last miR-TS, inclusive of the first and last miR-TS. Because the program adds a 5 first spacer of 4 nt and a 3 last space not including the definition of length used herein, the length of the cassette is the length of the sequence output by the program minus 8 nt (=2*4 nt first and last spacer).

(289) TABLE-US-00009 TABLE17 Nucleo- SEQ #of tides/ Cassette Sequence ID miR-TS Length miR-TS miRT-1- ccatatacatacttctttacattccatcctg 852 8 200 25 143_1736 agctacagtgcttcatctcattgcatacata cttctttacattccaacgtgagctacagtgc ttcatctcatccgatacatacttctttacat tccacggcgagctacagtgcttcatctcacc ttatacatacttctttacattccaaaaagag ctacagtgcttcatctcaccat miRT-128m- cacgagaattgcgtttggacaatcagacaca 853 12 300 25 122- aacaccattgtcacactccatcttaaagaga 219_6793 ccggttcactgtggatgtcaaacaccattgt cacactccaacttagaattgcgtttggacaa tcaagggaaagagaccggttcactgtggcca gcaaacaccattgtcacactccaaaacaaag agaccggttcactgtggtacgagaattgcgt ttggacaatcagaaaaaagagaccggttcac tgtggaatacaaacaccattgtcacactcca acaaagaattgcgtttggacaatcaggtt miRT-128m- aagtaaagagaccggttcactgtggaataag 854 12 300 25 204- aattgcgtttggacaatcaaggtaggcatag 219_9304 gatgacaaagggaacagcaaagagaccggtt cactgtggggctagaattgcgtttggacaat cacgtaaggcataggatgacaaagggaacga gaaagagaccggttcactgtgggggaagaat tgcgtttggacaatcatactaggcataggat gacaaagggaattagaaagagaccggttcac tgtggatttagaattgcgtttggacaatcat agaaggcataggatgacaaagggaattgt miRT-217- tatgctacgcgtattcttaagcaataagact 855 12 300 25 137- tccaatcagttcctgatgcagtacgaccaca 126m_3163 ttattactcacggtacgaaagcctacgcgta ttcttaagcaataaccgccacattattactc acggtacgataaatccaatcagttcctgatg cagtaattactacgcgtattcttaagcaata actattccaatcagttcctgatgcagtaccc ccacattattactcacggtacgagaattcca atcagttcctgatgcagtacagtcacattat tactcacggtacgatcaactacgcgtattct taagcaataaccaa

(290) The ability of the miR-TS cassettes shown in Table 17 to attenuate viral replication is shown in FIG. 53A-FIG. 53B.

(291) Additional constructs comprising miR-TS cassettes designed with this method are shown in Table 18 were constructed.

(292) TABLE-US-00010 TABLE 18 HSV constructs comprising candidate miR-TS cassettes Construct ICP27 UL8 ICP34.5 ICP4 UL42 ONCR-142 219a-5p (4x) 137-3p (4x) 128-3p.sup.M (4x) 124-3p (4x) X ONCR-154 122-5p (4x) 208b-3p (4x) 204-5p (4x).sup. 1-3p (4x) 128-3p (4x) 126-3p (4x) 219a-5p (4x).sup. 143-3p (4x) ONCR-156 219a-5p (4x) 137-3p (4x) 124-3p (4x) X 122-5p (4x) 208b-3p (4x) 1-3p (4x) 128-3p (4x) 126-3p (4x) 143-3p (4x) ONCR-158 219a-5p (4x) 137-3p (4x) 128-3p.sup.M (4x) 124-3p (4x) 122-5p (4x) 208b-3p (4x) 204-5p (4x) 1-3p (4x) 128-3p (4x) 126-3p (4x) 219a-5p (4x) 143-3p (4x) ONCR-157 219a-5p (4x) 137-3p (4x) 128-3p.sup.M (4x) 124-3p (4x) X 122-5p (4x) 217-5p (4x) 204-5p (4x) 1-3p (4x) 128-3p (4x) 126-3p (4x) 219a-5p (4x) 143-3p (4x) ONCR-159 219a-5p (4x) 137-3p (4x) 128-3p.sup.M (4x) 124-3p (4x) X ONCR-165 122-5p (4x) 217-5p (4x) 204-5p (4x) 1-3p (4x) ONCR-166 128-3p (4x) 126-3p.sup.M (4x) 219a-5p (4x) 143-3p (4x) ONCR-167 ONCR-168 ONCR-169 ONCR-170 ONCR-171 ONCR-172 ONCR-173 ONCR-174 ONCR-175 ONCR-176 ONCR-177 ONCR-160 219a-5p (4x) 137-3p (4x) 128-3p.sup.M 124-3p (4x) X 122-5p (4x) 208b-3p (4x) 204-5p (4x).sup. 1-3p (4x) 128-3p (4x) 126-3p (4x) 219a-5p (4x).sup. 143-3p (4x) ONCR-161 219a-5p (4x) 137-3p (4x) 128-3p.sup.M (4x) 124-3p (4x) X 122-5p (4x) 208b-3p (4x) 204-5p (4x).sup. 1-3p (4x) 128-3p (4x) 127 (4x) 219-5p (4x).sup. 143-3p (4x) ONCR-162 219a-5p (4x) 137-3p (4x) 128-3p.sup.M (4x) 124-3p (4x) X 122-5p (4x) 208b-3p (4x) 204-5p (4x).sup. 1-3p (4x) 128-3p (4x) 128-3p (4x) 219-5p (4x).sup. 143-3p (4x) ONCR-163 219a-5p (4x) 137-3p (4x) 128-3p.sup.M (4x) 124-3p (4x) X 122-5p (4x) 208b-3p (4x) 204-5p (4x).sup. 1-3p (4x) 128-3p (4x) 129 (4x) 219-5p (4x).sup. 143-3p (4x) ONCR-164 219a-5p (4x) 137-3p (4x) 128-3p.sup.M (4x) 124-3p (4x) X 122-5p (4x) 208b-3p (4x) 204-5p (4x).sup. 1-3p (4x) 128-3p (4x) 130 (4x) 219-5p (4x).sup. 143-3p (4x) .sup.one of the 4 target sequences was non-functional due to cloning error .sup.Mcomprises a modified target sequence

Example 8Cytotoxicity of miR-Attenuated HSV Constructs

(293) Experiments were performed to assess the in vitro cytotoxicity of select miR-attenuated HSV constructs, ONCR-125, ONCR-131, ONCR-142, and ONCR-157. Various cancer cell lines were infected with the indicated constructs at MOIs of 30, 10, 3.33, 1.11, 0.37, 0.12, 0.04, 0.13, 0.0045, and 0.0015 and cell viability was assessed at 72 hours post infection. Cell lines used include the colorectal adenocarcinoma cell lines SW837 and COLO205, the melanoma cell lines SKMEL28 and A375, small cell lung cancer cell line H446, pancreatic adenocarcinoma cell line BXPC3, and the breast cancer cell line BT 549. The IC50 of each construct was calculated and is shown below in Table 19. Results of each of these experiments are shown in FIG. 54A-FIG. 54E.

(294) TABLE-US-00011 TABLE 19 ONCR-125 ONCR-131 ONCR-142 ONCR-157 SW837 0.07 0.04 0.05 0.07 COLO205 0.45 0.12 0.223 0.45 SKMEL28 0.12 0.04 0.12 0.25 A375 0.87 0.26 0.89 1.5 H446 0.13 0.05 0.15 0.15 BXPC3 0.08 0.002 0.08 0.07 BT549 0.45 0.17 0.6 1.0

Example 9IL-12 Enhances Abscopal Efficacy of HSV

(295) Experiments were performed to assess the effects of IL-12 on the absocpal effect of oncolytic HSV. Briefly, the ONCR-133 construct, comprising an ICP4 miR-TS cassette comprising 4 repeats of miR-124-3p and an expression cassette encoding murine IL-12 was administered to mice in an MC38 tumor model. As shown in FIG. 55, ONCR-133 significantly inhibited tumor growth of injected tumors compared to vehicle treated controls (p<0.0001). ONCR-133 treatment also significantly inhibited tumor growth of non-injected tumors (p<0.005), indicating an enhanced abscopal effect.

(296) Surprisingly, expression of an additional immune-activating payload, ULBP3, did not further enhance the tumor growth inhibition effects of HSV expressing IL-12. As shown in FIG. 56, mice treated with ONCR-133+ONCR-007 (an HSV construct expressing ULBP3) or ONCR-133+ONCR-002 (an HSV construct that does not express any additional payload molecules) both demonstrated a significant inhibition of tumor growth compared to vehicle treated controls. However, there was no added benefit of ULBP3 expression in the inhibition of growth of injected or non-injected tumors. In fact, as shown in the table in FIG. 56, additional expression of ULBP3 slightly decreased the tumor growth inhibition observed with IL-12 expression alone.

(297) Similarly, additional expression of CXCL10 did not further enhance and anti-tumor efficacy of HSV expressing IL-12. Mice treated with ONCR-113 (an HSV construct expressing IL-12 and MMP9)+ONCR-106 (an HSV construct expressing CXCL10 and MMP9) or ONCR-113+ONCR-031 (an HSV construct expressing MMP9). As shown in FIG. 57, the additional expression of CXCL10 in the ONCR-106+ONCR-113 treated group did not enhance the inhibition of tumor growth in either injected or non-injected tumors compared to mice treated with ONCR-031+ONCR-113. In fact, as shown in the table in FIG. 57, additional expression of CXCL10 slightly decreased the tumor growth inhibition in both injected and non-injected tumors.

Example 10CCL4 Expression Further Enhances Abscopal Efficacy of HSV

(298) Experiments were performed to assess the effects of CCL4 in tumor growth inhibition in the MC38 model described in Example F. Results of this experiment are shown in FIG. 58 and Table 20 below. Mice were treated with one of 4 constructs, ONCR-133 (expressing IL-12), ONCR-151 (expressing IL-12, CXCL10, and XCL1), ONCR-152 (expressing IL-12, CXCL10, and FLT3 ligand), or ONCR-153 (expressing IL-12, CXCL10, and CCL4). As shown in FIG. 58, treatment with all of ONCR-133, -151, -152, and -153 significantly inhibited tumor growth of injected and non-injected tumors compared to vehicle controls. However, mice treated with ONCR-153 demonstrated an increase in tumor growth inhibition in the injected tumors and in the non-injected tumors compared to treatment with ONCR-133, whereas ONCR-151 or -152 demonstrated a slight decrease in efficacy compared to treatment with ONCR-133. These results demonstrate that CCL4 expression can increase the tumor growth inhibition and abscopal effect of oncolytic HSV above the effects observed with IL-12 expression alone.

(299) TABLE-US-00012 TABLE 20 Injected Non-injected Combo Payloads CR % TGI p CR % TGI p ONCR-133 IL-12 3/8 82 <0.0001 0/8 44 0.19 ONCR-151 IL-12, CXCL10, XCL1 3/8 76 <0.0001 0/8 33 0.35 ONCR-152 IL-12, CXCL10, FLT3L 1/8 81 <0.0001 0/8 34 0.3 ONCR-153 IL-12, CXCL10, CCL4 3/8 89 <0.0001 0/8 58 0.001

(300) Tumors from mice treated with ONCR-153 were harvested and assessed for the presence of HSV by RT-PCR analysis of the gD gene. As shown in FIG. 59A and FIG. 59B, HSV was detected in the injected tumors, but not in the non-injected tumors, indicating that the tumor growth inhibition observed in the non-injected tumors was not due to viral spread, but rather the abscopal effects of virus administration. Tumors were also assessed for the presence of the three payloads, IL-12, CXCL10, and CCL4. As shown in FIG. 60A-60C, payload expression peaked in the injected tumors at 24-hours post-treatment and decreased thereafter. Levels of the payloads were also assessed in the serum (FIG. 61A-61C) of mice treated with ONCR-153, where only CXCL10 expression was observed. However, as shown in FIG. 62, treatment of mice with ONCR-153 induced an intra-tumoral IFN response in both injected and non-injected tumors (left panel). Similarly, increased expression of IFN was observed in the serum of ONCR-153 treated mice. These data further indicate that the combination of IL-12 and CCL4 expression by HSV induce a localized immune response that may contribute to the abscopal effect observed with ONCR-153.

Example 11FLT3 Expression Further Enhances Abscopal Efficacy of HSV

(301) Experiments were performed to assess the effects of FLT3 in tumor growth inhibition in the MC38 model described in Example F. Results of this experiment are shown in FIG. 63 and Table 21 below. Mice were treated with one of 3 combinations of constructs expressing different payloads as outlined in Table 21. As shown in FIG. 63, treatment with a combination of ONCR-152 and ONCR-140 enhanced the tumor growth inhibition in non-injected tumors, indicating that FLT3L expression can enhance the abscopal effect over that observed with IL-12, CXL10, and CCL4.

(302) TABLE-US-00013 TABLE 21 Injected Non-injected Combo Payloads CR % TGI p CR % TGI p 152 + 140 IL12, CXCL10, CCL4 8/8 97 <0.0001 3/8 69 0.29 153 + 140 IL 12, CXCL10, FLT3 8/8 99 <0.0001 3/8 58 0.22 152 + 153 IL 12, CXCL10, CCL4, FLT3 8/8 97 <0.0001 3/8 75 0.005

Example 13CD40L Expression Further Enhances Abscopal Efficacy of HSV

(303) Experiments were performed to assess the effects of CD40L in tumor growth inhibition in the MC38 model described in Example F. Results of this experiment are shown in FIG. 64 and Table 22 below. Mice were treated with constructs expressing different payloads as outlined in Table 22. As shown in FIG. 64, treatment with a combination of ONCR-153 and ONCR-147 enhanced the tumor growth inhibition in non-injected tumors, indicating that CD40L expression can enhance the abscopal effect over that observed with IL-12, CXL10, and CCL4.

(304) TABLE-US-00014 TABLE 22 Injected Non-injected Combo Payloads CR % TGI p CR % TGI p 153 IL12, CXCL10, CCL4 1/8 65 0.0005 0/8 41 0.02 147 CD40L, 41BBL 0/8 14 0.35 0/8 0.83 153 + IL12, CXCL10, 2/8 73 <0.0001 0/8 59 0.0005 147 CCL4, CD40L, 41BBL

Example 12Anti-CTLA4 Expression Further Enhances Abscopal Efficacy of HSV

(305) Experiments were performed to assess the effects of CTLA4 in tumor growth inhibition in the MC38 model described in Example F. Results of this experiment are shown in FIG. 66A-FIG. 66C and Table 23 below. Mice were treated with constructs expressing different payloads as outlined in Table 23. As shown in FIG. 66A-FIG. 66C, treatment with a combination of ONCR-149 and ONCR-139 enhanced the tumor growth inhibition in injected and non-injected tumors compared to treatment with ONCR-149 alone, indicating that anti-CTLA4 expression can enhance the anti-tumor effects and abscopal effect over that observed with IL-12.

(306) TABLE-US-00015 TABLE 23 Injected Non-injected Combo Payloads CR % TGI p CR % TGI p 149 IL 12 0/8 66 <0.0001 0/8 41 0.0002 149 + 139 IL 12, anti-CTLA4 1/8 75 <0.0001 1/8 57 <0.0001

(307) Similar experiments were performed to assess the effects of anti-CTLA4 over IL-12, CXCL10, FLT3L, and CCL4 expression in a 4T1-luc model. In brief, 110.sup.6 4T1-luc cells in 100 L of DPBS were injected subcutaneously into the right flank of Balb/c mice. When tumor volume reach an average of 100 mm.sup.3, mice were intratumorally injected with HSV-1 at a dose of 3e.sup.6 PFU/injection. Dosing was repeated twice every third day for a total number of 3 doses (Q3D3). Tumor growth and body weight was monitor twice weekly. The experiment concluded at Day 22 when the first clinical symptoms of metastatic disease were observed. Lung metastases were visualized ex vivo using IVIS Lumina LT system and analyzed with Living Image Software. Mice were treated with a combination of constructs as shown in Table 24. Results of this experiment are shown in FIG. 67. As shown, treatment with ONCR-152 and -139 demonstrated an enhanced effect in tumor growth inhibition compared to treatment with ONCR-139 alone.

(308) TABLE-US-00016 TABLE 24 Combo Payloads 152 IL12, CXCL10, FLT3L 139 anti-CTLA4 152 + 139 IL12, CXCL10, FLT3L, anti-CTLA4

Example 13Treatment with Anti-PD1 Expression Further Enhances Efficacy of HSV

(309) Experiments were performed to assess the effects of anti-PD1 treatment on HSV-mediated tumor growth inhibition in the MC38 model described in Example F. Results of this experiment are shown in FIG. 68 and Table 25 below. Mice were treated with constructs expressing different payloads as outlined in Table 25. As shown in FIG. 68, treatment with a combination of ONCR-153 and anti-PD1 enhanced the tumor growth inhibition in injected tumors compared to that observed with ONCR-152 or anti-PD1 alone.

(310) TABLE-US-00017 TABLE 25 Injected Non-injected Combo Payloads CR % TGI p CR % TGI p 153 IL12, CXCL10, CCL4 2/8 79 <0.0001 5/8 84 <0.0001 anti-PD1 5/8 65 0.0005 0/8 41 0.02 153 + anti- IL12, CXCL10, 2/8 95 <0.0001 0/8 83 <0.0001 PD1 CCL4, anti-PD1

Example 14Treatment of a Patient Suffering from Pancreatic Cancer, Lung Cancer, or Colon Cancer

(311) A patient suffering from pancreatic cancer, lung cancer, or colon cancer is treated using the compositions and methods disclosed herein. HSV-based viral stocks may be generated that are attenuated by incorporating one or more miRNA target sequences into UL19, ICP4, ICP27, or UL42 (or other viral genes) as shown in FIGS. 39-50. In some cases, genome-editing capabilities for tumor destruction and/or microenvironment remodeling are engineered into the virus in addition to miRNA target sequences, as shown in FIGS. 45-46. In a specific example, an HSV-based stock containing miR-124, miR-451a, miR-143-3p, and miR-559 attenuation cassettes incorporated into ICP4 and ICP27 is used. In another example, an HSV-based stock containing attenuation cassettes with one or more copies of miR-122 and miR-125a target sequences incorporated into ICP27 and/or UL42 genes. For any of these compositions, the HSV-based stock is generated according to the methods described in Example 3. The miRNA target sequence cassettes are introduced into the 3 UTR of the ICP4, ICP27UL19, and/or UL42 genes. BAC constructs are converted to virus particles with simultaneous removal of the BAC sequences located between loxP sites by transfection of Vero-Cre cells. Following plaque purification, virus stocks are further purified, buffer exchanged, and titered on Vero cells. For in vivo administration to a patient suffering from pancreatic cancer, lung cancer, or colon cancer, HSV particles are prepared in phosphate buffered solution (PBS) along with pharmaceutically acceptable stabilizing agents. On the day of treatment, 10.sup.9 vector genomes in a volume of 1.0 mL pharmaceutically acceptable carrier are administered via intra-tumoral infusion. The patient is monitored for tumor regression using standard of care procedures at an appropriate time interval based on that patient's particular prognosis.

Example 15Treatment of Patients Suffering from Brain Cancer, Bladder Cancer, Breast Cancer, or Head and Neck Cancer

(312) A patient suffering from brain cancer, bladder cancer, breast cancer, or head and neck cancer is treated using the compositions and methods disclosed herein. An HSV-based viral stock is generated containing miR-124, miR-451a, miR-145-3p, and miR-559 attenuation cassettes according to the methods described in Example 3. The miRNA target sequence cassettes are introduced into the 3 UTR of the ICP4 (miR-124) and ICP27 (miR-451a, miR-145-3p, miR-559) genes as shown in FIG. 48. BAC constructs are converted to virus particles with simultaneous removal of the BAC sequences located between loxP sites by transfection of Vero-Cre cells. Following plaque purification, virus stocks are further purified, buffer exchanged, and titered on Vero cells. For in vivo administration to a patient suffering from brain cancer, bladder cancer, breast cancer, or head and neck cancer, HSV particles are prepared in phosphate buffered solution (PBS) along with pharmaceutically acceptable stabilizing agents. On the day of treatment, 109 vector genomes in a volume of 1.0 mL pharmaceutically acceptable carrier are administered via intra-tumoral infusion. The patient is monitored using standard of care procedures at an appropriate time interval based on that patient's particular prognosis. Potential outcomes of these experiments include partial or complete inhibition of tumor growth, inhibition of tumor metastasis, prolonged time in remission, and/or reduced rate of relapse compared to standard of care therapies.

Example 16Treatment of a Patient Suffering from Schwannoma

(313) A patient suffering from schwannoma is treated using the compositions and methods disclosed herein. An HSV-based viral stock is generated containing miR-124-3p, miR-205-5p, miR-141-5p, and miR-31-5p attenuation cassettes according to the methods described in Example 3. The miRNA target sequence cassettes were recombined into the 3 UTR of the ICP4 (miR-124) and ICP27 (miR-205-5p, miR-141-5p, miR-31-5p) genes as shown in FIG. 49. BAC constructs are converted to virus particles with simultaneous removal of the BAC sequences located between loxP sites by transfection of Vero-Cre cells. Following plaque purification, virus stocks were further purified, buffer exchanged, and titered on Vero cells. For in vivo administration to a patient suffering from schwannoma, HSV particles are prepared in phosphate buffered solution (PBS) along with pharmaceutically acceptable stabilizing agents. On the day of treatment, 109 vector genomes in a volume of 1.0 mL pharmaceutically acceptable carrier are administered via intra-tumoral infusion. The patient is monitored using standard of care procedures at an appropriate time interval based on that patient's particular prognosis. Potential outcomes of these experiments include partial or complete inhibition of tumor growth, inhibition of tumor metastasis, prolonged time in remission, and/or reduced rate of relapse compared to standard of care therapies

(314) While preferred embodiments of the present invention are shown and described herein, it will be obvious to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions can be implemented by those skilled in the art without departing from the invention. It should be understood that various alternatives to the embodiments of the invention described herein may be employed in practicing the invention. It is intended that the following claims define the scope of the invention and that methods and structures within the scope of these claims and their equivalents be covered thereby.

INCORPORATION BY REFERENCE

(315) All references, articles, publications, patents, patent publications, and patent applications cited herein are incorporated by reference in their entireties for all purposes. However, mention of any reference, article, publication, patent, patent publication, and patent application cited herein is not, and should not, be taken as an acknowledgment or any form of suggestion that they constitute valid prior art or form part of the common general knowledge in any country in the world.

(316) TABLE-US-00018 TABLE 1 Summary of relationships between 12 select oncomiRs (9 tumor suppressors and 3 oncogenic miRNAs) and various cancers Down-regulated Up-regulated miR- miR- miR- miR- miR- miR- miR- miR- miR- miR- miR- Malignancy let-7 15a 16 29a 34a 98 101 124 202 17 21 155 acute lymphoblastic leukemia X X acute myeloid leukemia X X X X acute promyelocytic leukemia X adrenal cortical carcinoma X anaplastic astrocytoma X anaplastic large-cell lymphoma X astrocytoma X B cell lymphoma X X bladder cancer X X X X X X breast cancer X X X X X X X X X breast carcinoma X bronchioloalveolar carcinoma X X cervical cancer X X X cervical carcinoma X X X X cervical squamous cell X X carcinoma cholangiocarcinoma X X X chondrosarcoma X chordoma X choriocarcinoma X chronic lymphocytic leukemia X X X chronic myelogenous leukemia X X clear cell renal cell cancer X X colon cancer X X X X X colorectal cancer X X X X X X X X X X colorectal carcinoma X X cutaneous T cell lymphoma X diffuse large B cell lymphoma X endometrial cancer X X X epithelial ovarian cancer X esophageal cancer X X X esophageal squamous cell X X X X X X carcinoma extrahepatic X cholangiocarcinoma follicular lymphoma X gallbladder carcinoma X gastric cancer X X X X X X X X X glioblastoma X X X X glioma X X X X X X X head and neck cancer head and neck squamous cell X X X X X carcinoma hepatocellular carcinoma X X X X X X X X X X X hypopharyngeal squamous X cell carcinoma kidney cancer laryngeal carcinoma X X laryngeal squamous cell X X carcinoma liver cancer X X X lung adenocarcinoma X X lung cancer X X X X X X X X X malignant melanoma X X X X X X X malt lymphoma X mantle cell lymphoma X X X X medulloblastoma X X mesenchymal cancer X monocytic leukemia X multiple myeloma X nasopharyngeal cancer X nasopharyngeal carcinoma X X X X X X neuroblastoma X X X X X X X non-small cell lung cancer X X X X X X X X X X oral cancer X X X oral squamous cell carcinoma X X X X osteosarcoma X X X X X X X X X ovarian cancer X X X X X X ovarian carcinoma X pancreatic adenocarcinoma X X pancreatic cancer X X X X X pancreatic ductal X X X X X X adenocarcinoma papillary thyroid carcinoma X X X X X X pituitary carcinoma X prostate cancer X X X X X X X rectal cancer X X X renal cell carcinoma X X X X renal clear cell carcinoma X X retinoblastoma X X X squamous carcinoma X X X X X T cell lymphoblastic lymphoma X uveal melanoma X

(317) TABLE-US-00019 TABLE 2 Summary of miRNA expression in cancer Malignancy Down-regulated miRs Up-regulated miRs breast cancer let-7a, let-7a-1, let-7a-2, let-7a-3, let-7b, mir-10b, mir-125a, mir-135a, let-7c, let-7d, let-7e, let-7f-1, let-7f-2, mir-140, mir-141, mir-142, mir- let-7g, let-7i, mir-100, mir-107, mir-10a, 150, mir-155, mir-181a, mir- mir-10b, mir-122, mir-124, mir-1258, 181b, mir-182, mir-18a, mir-18b, mir-125a-5p, mir-125b, mir-126, mir- mir-191, mir-196a, mir-197, mir- 127, mir-129, mir-130a, mir-132, mir- 19a, mir-19b, mir-200a, mir- 133a, mir-143, mir-145, mir-146a, mir- 200b, mir-200c, mir-203, mir- 146b, mir-147, mir-148a, mir-149, mir- 205, mir-20a, mir-20b, mir-21, 152, mir-153, mir-15a, mir-16, mir-17- mir-217, mir-221, mir-224, mir- 5p, mir-181a, mir-1826, mir-183, mir- 23a, mir-24, mir-24-2-5p, mir-24- 185, mir-191, mir-193a-3p, mir-193b, 3p, mir-27a, mir-29a, mir-29b-1, mir-195, mir-199b-5p, mir-19a-3p, mir- mir-29b-2, mir-29c, mir-373, 200a, mir-200b, mir-200c, mir-205, mir- mir-378, mir-423, mir-429, mir- 206, mir-211, mir-216b, mir-218, mir-22, 495, mir-503, mir-510, mir-520c, mir-26a, mir-26b, mir-300, mir-30a, mir- mir-526b, mir-96 31, mir-335, mir-339-5p, mir-33b, mir- 34a, mir-34b, mir-34c, mir-374a, mir- 379, mir-381, mir-383, mir-425, mir-429, mir-450b-3p, mir-494, mir-495, mir-497, mir-502-5p, mir-517a, mir-574-3p, mir- 638, mir-7, mir-720, mir-7515, mir-92a, mir-98, mir-99a, mmu-mir-290-3p, mmu-mir-290-5p chondrosarcoma let-7a, mir-100, mir-136, mir-145, mir- 199a, mir-222, mir-30a, mir-335, mir- 376a colorectal cancer let-7a, mir-1, mir-100, mir-101, mir-124, let-7a, mir-103, mir-106a, mir- mir-125a, mir-126, mir-129, mir-1295b- 10b, mir-1179, mir-1229, mir- 3p, mir-1307, mir-130b, mir-132, mir- 1246, mir-125b-2*, mir-1269a, 133a, mir-133b, mir-137, mir-138, mir- mir-130b, mir-133b, mir-135a, 139, mir-139-5p, mir-140-5p, mir-143, mir-135a-1, mir-135a-2, mir- mir-145, mir-148a, mir-148b, mir-149, 135b, mir-139-3p, mir-145, mir- mir-150-5p, mir-154, mir-15a, mir-15b, 150, mir-150*, mir-155, mir-17, mir-16, mir-18a, mir-191, mir-192, mir- mir-181a, mir-182, mir-183, mir- 193a-5p, mir-194, mir-195, mir-196a, 18a, mir-191, mir-196a, mir- mir-198, mir-199a-5p, mir-200c, mir- 196b, mir-19a, mir-19b, mir- 203, mir-204-5p, mir-206, mir-212, mir- 200b, mir-200c, mir-203, mir- 215, mir-218, mir-22, mir-224, mir-24- 204-5p, mir-20a, mir-20a-5p, 3p, mir-26b, mir-27a, mir-28-3p, mir-28- mir-21, mir-210, mir-211, mir- 5p, mir-29b, mir-30a-3p, mir-30b, mir- 221, mir-223, mir-224, mir-23a, 320a, mir-328, mir-338-3p, mir-342, mir- mir-25, mir-27a, mir-29a, mir- 345, mir-34a, mir-34a-5p, mir-361-5p, 301a, mir-31, mir-32, mir-320b, mir-375, mir-378, mir-378a-3p, mir- mir-326, mir-424, mir-429, mir- 378a-5p, mir-409-3p, mir-422a, mir- 494, mir-497, mir-499-5p, mir- 4487, mir-483, mir-497, mir-498, mir- 592, mir-630, mir-7-5p, mir- 518a-3p, mir-551a, mir-574-5p, mir-625, 892a, mir-92, mir-92a, mir-93, mir-638, mir-7, mir-96-5p mir-95, mir-96 esophageal squamous let-7a, let-7a-1, let-7a-2, let-7a-3, let-7b, mir-100, mir-1179, mir-1290, cell carcinoma let-7c, let-7d, let-7e, let-7f-1, let-7f-2, mir-130b, mir-145, mir-16, mir- let-7g, let-7i, mir-1, mir-100, mir-101, 17, mir-183, mir-18a, mir-19a, mir-126, mir-1294, mir-133a, mir-133b, mir-19b, mir-208, mir-20a, mir- mir-138, mir-143, mir-145, mir-150, mir- 21, mir-218, mir-223, mir-25, 185, mir-195, mir-200b, mir-203, mir-21, mir-30a-5p, mir-31, mir-330-3p, mir-210, mir-214, mir-218, mir-22, mir- mir-373, mir-9, mir-92a, mir-942 27a, mir-29b, mir-29c, mir-302b, mir- 34a, mir-375, mir-494, mir-518b, mir- 655, mir-98, mir-99a gastric cancer let-7a, let-7b, let-7g, mir-1, mir-101, mir- mir-100, mir-103, mir-106a, mir- 103a, mir-10a, mir-10b, mir-1207-5p, 106b, mir-107, mir-10a, mir-10b, mir-122, mir-1228*, mir-124, mir-124- mir-1259, mir-125b, mir-126, 3p, mir-125a-3p, mir-126, mir-1266, mir- mir-1274a, mir-1303, mir-130b*, 1271, mir-129-1-3p, mir-129-2-3p, mir- mir-135a-5p, mir-135b, mir-138, 129-3p, mir-129-5p, mir-133a, mir-133b, mir-143, mir-146a, mir-147, mir- mir-137, mir-141, mir-143, mir-144, mir- 148a, mir-150, mir-17, mir-17- 145, mir-146a, mir-146a-5p, mir-148a, 5p, mir-181a, mir-181a-2*, mir- mir-148b, mir-149, mir-152, mir-155, 181a-5p, mir-181c, mir-183, mir- mir-155-5p, mir-181a, mir-181b, mir- 185, mir-18a, mir-191, mir-192, 182, mir-183, mir-185, mir-194, mir-195, mir-196a, mir-196a*, mir-196a- mir-197, mir-199a-3p, mir-200b, mir- 5p, mir-196b, mir-199a, mir- 200c, mir-202-3p, mir-204, mir-204-5p, 199a-3p, mir-199a-5p, mir-19a, mir-205, mir-206, mir-210, mir-212, mir- mir-19b, mir-200b, mir-20a, mir- 217, mir-218, mir-22, mir-23b, mir-24, 21, mir-214, mir-215, mir-221, mir-26a, mir-29a, mir-29a-3p, mir-29b, mir-221*, mir-222, mir-223, mir- mir-29b-1, mir-29b-2, mir-29c, mir-30a- 224, mir-23a, mir-23b, mir-27a, 5p, mir-30b, mir-31, mir-328, mir-329, mir-27b, mir-296-5p, mir-301a, mir-331-3p, mir-335-5p, mir-338, mir- mir-302f, mir-337-3p, mir-340*, 338-3p, mir-34a, mir-34b, mir-34c, mir- mir-34a, mir-362-3p, mir-370, 361-5p, mir-367, mir-375, mir-378, mir- mir-374a, mir-377, mir-421, mir- 409-3p, mir-410, mir-429, mir-433, mir- 425, mir-500, mir-520c-3p, mir- 449, mir-449a, mir-490-3p, mir-494, mir- 544, mir-575, mir-601, mir-616*, 497, mir-503, mir-506, mir-513b, mir- mir-650, mir-92, mir-98, mir-99a 520d-3p, mir-542-3p, mir-622, mir-625, mir-638, mir-663, mir-7, mir-765, mir-9 glioma let-7a, let-7f, mir-106a, mir-107, mir- mir-106b, mir-106b-5p, mir-10b, 122, mir-124, mir-124-5p, mir-124a, mir- mir-125b, mir-132, mir-155, mir- 125b, mir-128, mir-136, mir-137, mir- 17, mir-181a, mir-182, mir-183, 139, mir-143, mir-145, mir-146a, mir- mir-193b, mir-19a, mir-19b, mir- 146b, mir-146b-5p, mir-152, mir-15b, 20a, mir-210, mir-214, mir-221, mir-16, mir-181a, mir-181a-1, mir-181a- mir-222, mir-224, mir-23a, mir- 2, mir-181b, mir-181b-1, mir-181b-2, 24, mir-24-3p, mir-25, mir-26a, mir-181c, mir-181d, mir-184, mir-185, mir-27a-3p, mir-27b, mir-30a-5p, mir-195, mir-199a-3p, mir-200a, mir- mir-30e, mir-30e*, mir-328, mir- 200b, mir-203, mir-204, mir-205, mir- 335, mir-33a, mir-372, mir-486, 218, mir-219-5p, mir-23b, mir-26b, mir- mir-494, mir-497, mir-566, mir- 27a, mir-29c, mir-320, mir-326, mir-328, 603, mir-650, mir-675, mir-9, mir-34a, mir-34c-3p, mir-34c-5p, mir- mir-92b, mir-93, mir-96 375, mir-383, mir-451, mir-452, mir- 483-5p, mir-495, mir-584, mir-622, mir- 656, mir-7, mir-98 nasopharyngeal let-7a, let-7a-1, let-7a-2, let-7a-3, let-7b, mir-10b, mir-144, mir-149, mir- carcinoma let-7c, let-7d, let-7e, let-7f-1, let-7f-2, 155, mir-18a, mir-21, mir-214, let-7g, let-7i, mir-1, mir-101, mir-124, mir-24, mir-421, mir-663, mir-7- mir-138, mir-143, mir-145, mir-148a, 5p, mir-93 mir-200b, mir-204, mir-216b, mir-29c, mir-320a, mir-324-3p, mir-34c, mir-375, mir-378, mir-451, mir-506, mir-9, mir-98 non-small cell lung let-7a, let-7c, mir-1, mir-100, mir-101, mir-10b, mir-125a-5p, mir-1280, cancer mir-106a, mir-107, mir-124, mir-125a- mir-136, mir-140, mir-141, mir- 3p, mir-125a-5p, mir-126*, mir-129, mir- 142-3p, mir-145, mir-146a, mir- 133a, mir-137, mir-138, mir-140, mir- 150, mir-18a, mir-196a, mir-19a, 143, mir-145, mir-146a, mir-146b, mir- mir-200a, mir-200c, mir-205, 148a, mir-148b, mir-149, mir-152, mir- mir-205-5p, mir-21, mir-212, 153, mir-154, mir-155, mir-15a, mir-16, mir-22, mir-221, mir-222, mir- mir-17-5p, mir-181a-1, mir-181a-2, mir- 24, mir-25, mir-29c, mir-31, mir- 181b, mir-181b-1, mir-181b-2, mir-181c, 328, mir-330-3p, mir-339, mir- mir-181d, mir-184, mir-186, mir-193b, 34a, mir-375, mir-494, mir-675- mir-195, mir-199a, mir-204, mir-212, 5p, mir-9, mir-92b, mir-93, mir- mir-221, mir-224, mir-26b, mir-27a, mir- 95 27b, mir-29a, mir-29b, mir-29c, mir-30a, mir-30b, mir-30c, mir-30d, mir-30d-5p, mir-30e-5p, mir-32, mir-335, mir-338- 3p, mir-340, mir-342-3p, mir-34a, mir- 34b, mir-361-3p, mir-365, mir-373, mir- 375, mir-429, mir-449a, mir-4500, mir- 451, mir-4782-3p, mir-497, mir-503, mir-512-3p, mir-520a-3p, mir-526b, mir- 625*, mir-96, mir-99a osteosarcoma let-7a, mir-1, mir-100, mir-101, mir-122, mir-128, mir-151-3p, mir-17, mir-124, mir-125b, mir-126, mir-127-3p, mir-181a, mir-181b, mir-181c, mir-132, mir-133a, mir-141, mir-142-3p, mir-18a, mir-191, mir-195-5p, mir-142-5p, mir-143, mir-144, mir-145, mir-199a-3p, mir-19a, mir-19b, mir-153, mir-16, mir-183, mir-194, mir- mir-20a, mir-21, mir-210, mir- 195, mir-199a-3p, mir-204, mir-212, mir- 214, mir-221, mir-27a, mir-300, 217, mir-218, mir-22, mir-23a, mir-24, mir-320a, mir-374a-5p, mir-720, mir-26a, mir-26b, mir-29b, mir-32, mir- mir-9, mir-92a 320, mir-335, mir-33b, mir-340, mir-34a, mir-34b, mir-34c, mir-375, mir-376c, mir-382, mir-3928, mir-424, mir-429, mir-449a, mir-451, mir-454, mir-503, mir-519d, mir-646 pancreatic ductal let-7a, let-7a-1, let-7a-2, let-7a-3, let-7b, mir-10b, mir-186, mir-18a, mir- adenocarcinoma let-7c, let-7d, let-7e, let-7f-1, let-7f-2, 192, mir-194, mir-196a, mir-198, let-7g, let-7i, mir-126, mir-135a, mir- mir-203, mir-21, mir-212, mir- 143, mir-144, mir-145, mir-148a, mir- 30b-5p, mir-31, mir-34a, mir- 150, mir-15a, mir-16, mir-200a, mir- 369-5p, mir-376a, mir-541 200b, mir-200c, mir-217, mir-218, mir- 337, mir-375, mir-494, mir-615-5p, mir- 98 renal cell carcinoma let-7a, let-7d, mir-1, mir-106a*, mir-126, mir-100, mir-1233, mir-1260b, mir-1285, mir-129-3p, mir-1291, mir- mir-146a, mir-146b, mir-16, mir- 133a, mir-133b, mir-135a, mir-138, mir- 193a-3p, mir-203a, mir-21, mir- 141, mir-143, mir-145, mir-182-5p, mir- 210, mir-27a, mir-362, mir-572, 199a-3p, mir-200a, mir-205, mir-218, mir-7 mir-28-5p, mir-30a, mir-30c, mir-30d, mir-34a, mir-378, mir-429, mir-509-3p, mir-509-5p, mir-646 bronchioloalveolar let-7a-1, let-7a-2, let-7a-3, let-7b, let-7c, carcinoma let-7d, let-7e, let-7f-1, let-7f-2, let-7g, let-7i, mir-98 colon cancer let-7a-1, let-7a-2, let-7a-3, let-7b, let-7c, mir-1290, mir-145, mir-155, mir- let-7d, let-7e, let-7f-1, let-7f-2, let-7g, 181a, mir-18a, mir-200c, mir-31, let-7i, mir-100, mir-101, mir-126, mir- mir-675 142-3p, mir-143, mir-145, mir-192, mir- 200c, mir-21, mir-214, mir-215, mir-25, mir-302a, mir-320, mir-320a, mir-34a, mir-34c, mir-365, mir-373, mir-424, mir- 429, mir-455, mir-484, mir-502, mir-503, mir-93, mir-98 hepatocellular let-7a-1, let-7a-2, let-7a-3, let-7b, let-7c, mir-106b, mir-10b, mir-122, mir- carcinoma let-7d, let-7e, let-7f, let-7f-1, let-7f-2, let- 1228, mir-1269, mir-128a, mir- 7g, let-7i, mir-1, mir-100, mir-101, mir- 130a, mir-130b, mir-146a, mir- 105, mir-122, mir-122a, mir-1236, mir- 153, mir-155, mir-17-5p, mir- 124, mir-125b, mir-126, mir-127, mir- 181a, mir-181a-1, mir-181a-2, 1271, mir-128-3p, mir-129-5p, mir-130a, mir-181b, mir-181b-1, mir-181b- mir-130b, mir-133a, mir-134, mir-137, 2, mir-181c, mir-181d, mir-182, mir-138, mir-139, mir-139-5p, mir-140- mir-183, mir-184, mir-190b, mir- 5p, mir-141, mir-142-3p, mir-143, mir- 191, mir-20a, mir-20b, mir-21, 144, mir-145, mir-146a, mir-148a, mir- mir-210, mir-214, mir-215, mir- 148b, mir-150-5p, mir-15b, mir-16, mir- 216a, mir-217, mir-221, mir-222, 181a-5p, mir-185, mir-188-5p, mir-193b, mir-223, mir-224, mir-23a, mir- mir-195, mir-195-5p, mir-197, mir-198, 24, mir-25, mir-27a, mir-301a, mir-199a, mir-199a-5p, mir-199b, mir- mir-30d, mir-31, mir-3127, mir- 199b-5p, mir-200a, mir-200b, mir-200c, 32, mir-331-3p, mir-362-3p, mir- mir-202, mir-203, mir-204-3p, mir-205, 371-5p, mir-372, mir-373, mir- mir-206, mir-20a, mir-21, mir-21-3p, 423, mir-429, mir-452, mir-483- mir-211, mir-212, mir-214, mir-217, mir- 3p, mir-483-5p, mir-485-3p, mir- 218, mir-219-5p, mir-22, mir-26a, mir- 490-3p, mir-494, mir-495, mir- 26b, mir-29a, mir-29b-1, mir-29b-2, mir- 500, mir-501-5p, mir-519d, mir- 29c, mir-302b, mir-302c, mir-30a, mir- 520g, mir-574-3p, mir-590-5p, 30a-3p, mir-335, mir-338-3p, mir-33a, mir-630, mir-650, mir-657, mir- mir-34a, mir-34b, mir-365, mir-370, mir- 664, mir-885-5p, mir-9, mir-92a, 372, mir-375, mir-376a, mir-377, mir- mir-96 422a, mir-424, mir-424-5p, mir-433, mir- 4458, mir-448, mir-450a, mir-451, mir- 485-5p, mir-486-5p, mir-497, mir-503, mir-506, mir-519d, mir-520a, mir-520b, mir-520c-3p, mir-582-5p, mir-590-5p, mir-610, mir-612, mir-625, mir-637, mir- 675, mir-7, mir-877, mir-940, mir-941, mir-98, mir-99a lung cancer let-7a-1, let-7a-2, let-7a-3, let-7b, let-7c, mir-10b, mir-135b, mir-150, mir- let-7d, let-7e, let-7f-1, let-7f-2, let-7g, 155, mir-17, mir-182, mir-183- let-7i, mir-1, mir-101, mir-133b, mir- 3p, mir-18a, mir-197, mir-19a, 138, mir-142-5p, mir-144, mir-145, mir- mir-19b, mir-205, mir-20a, mir- 1469, mir-146a, mir-153, mir-15a, mir- 21, mir-210, mir-24, mir-30d, 15b, mir-16-1, mir-16-2, mir-182, mir- mir-4423, mir-5100, mir-570, 192, mir-193a-3p, mir-194, mir-195, mir- mir-663, mir-7, mir-92a 198, mir-203, mir-217, mir-218, mir-22, mir-223, mir-26a, mir-26b, mir-29c, mir- 33a, mir-34a, mir-34b, mir-34c, mir-365, mir-449a, mir-449b, mir-486-5p, mir- 545, mir-610, mir-614, mir-630, mir-660, mir-7-5p, mir-9500, mir-98, mir-99b neuroblastoma let-7a-1, let-7a-2, let-7a-3, let-7b, let-7c, mir-125b, mir-15a, mir-15b, mir- let-7d, let-7e, let-7f-1, let-7f-2, let-7g, 16-1, mir-16-2, mir-18a, mir-195, let-7i, mir-124, mir-137, mir-145, mir- mir-19a, mir-23a, mir-421, mir- 181c, mir-184, mir-200a, mir-29a, mir- 92 335, mir-338-3p, mir-34a, mir-449a, mir- 885-5p, mir-98 prostate cancer let-7a-3p, let-7c, mir-100, mir-101, mir- mir-125b, mir-141, mir-153, mir- 105, mir-124, mir-128, mir-1296, mir- 155, mir-181a-1, mir-181a-2, 130b, mir-133a-1, mir-133a-2, mir-133b, mir-181b, mir-181b-1, mir-181b- mir-135a, mir-143, mir-145, mir-146a, 2, mir-181c, mir-181d, mir-182, mir-154, mir-15a, mir-187, mir-188-5p, mir-182-5p, mir-183, mir-18a, mir-199b, mir-200b, mir-203, mir-205, mir-204, mir-20a, mir-21, mir- mir-212, mir-218, mir-221, mir-224, mir- 221, mir-223-3p, mir-31, mir- 23a, mir-23b, mir-25, mir-26a, mir-26b, 429, mir-96 mir-29b, mir-302a, mir-30a, mir-30b, mir-30c-1, mir-30c-2, mir-30d, mir-30e, mir-31, mir-330, mir-331-3p, mir-34a, mir-34b, mir-34c, mir-374b, mir-449a, mir-4723-5p, mir-497, mir-628-5p, mir- 642a-5p, mir-720, mir-940 acute lymphoblastic let-7b, mir-124a, mir-142-3p mir-128 leukemia malignant melanoma let-7b, mir-101, mir-125b, mir-1280, mir-126, mir-141, mir-15b, mir- mir-143, mir-146a, mir-146b, mir-155, 17, mir-17-5p, mir-182, mir-18a, mir-17, mir-184, mir-185, mir-18b, mir- mir-193b, mir-200a, mir-200b, 193b, mir-200c, mir-203, mir-204, mir- mir-200c, mir-20a, mir-21, mir- 205, mir-206, mir-20a, mir-211, mir-218, 210, mir-214, mir-221, mir-222, mir-26a, mir-31, mir-33a, mir-34a, mir- mir-429, mir-455-5p, mir-532-5p, 34c, mir-376a, mir-376c, mir-573, mir-7, mir-638, mir-92a mir-9, mir-98 renal clear cell let-7b, let-7c, mir-138, mir-141, mir- mir-122, mir-155, mir-630 carcinoma 200c, mir-204, mir-218, mir-335, mir- 377, mir-506 acute myeloid let-7c, mir-17, mir-181a, mir-20a, mir- mir-125b, mir-126-5p, mir-128, leukemia 223, mir-26a, mir-29a, mir-30c, mir-7 mir-155, mir-29a, mir-32, mir- 331, mir-370, mir-378 acute promyelocytic let-7c, mir-107, mir-342 mir-181a, mir-181b, mir-92a leukemia head and neck let-7d, mir-1, mir-107, mir-128, mir- mir-106b, mir-134, mir-16, mir- squamous cell 133a, mir-138, mir-149, mir-200c, mir- 184, mir-196a, mir-21, mir-25, carcinoma 205, mir-218, mir-27a*, mir-29a, mir- mir-30a-5p, mir-31, mir-372, 29b-1, mir-29b-2, mir-29c, mir-300, mir- mir-93 34a, mir-363, mir-375, mir-874 oral cancer let-7d, mir-218, mir-34a, mir-375, mir- mir-10b, mir-196a-1, mir-196a-2, 494 mir-196b, mir-21 papillary thyroid mir-101, mir-130b, mir-138, mir-146a, let-7e, mir-146b, mir-146b-5p, carcinoma mir-16, mir-195, mir-199a-3p, mir-204- mir-151-5p, mir-155, mir-181a-1, 5p, mir-219-5p, mir-26a, mir-34b, mir- mir-181a-2, mir-181b-1, mir- 613 181b-2, mir-181c, mir-181d, mir- 182, mir-183, mir-199b-5p, mir- 21, mir-221, mir-222, mir-339- 5p, mir-34a glioblastoma let-7g-5p, mir-100, mir-101, mir-106a, mir-10b, mir-125b, mir-127-3p, mir-124, mir-124a, mir-125a, mir-125a- mir-148a, mir-18a, mir-196a, 5p, mir-125b, mir-127-3p, mir-128, mir- mir-196a-1, mir-196a-2, mir- 129, mir-136, mir-137, mir-139-5p, mir- 196b, mir-21, mir-210, mir-210- 142-3p, mir-143, mir-145, mir-146b-5p, 3p, mir-223, mir-340, mir-576- mir-149, mir-152, mir-153, mir-195, mir- 5p, mir-626, mir-92b 21, mir-212-3p, mir-219-5p, mir-222, mir-29b, mir-31, mir-3189-3p, mir-320, mir-320a, mir-326, mir-330, mir-331-3p, mir-340, mir-342, mir-34a, mir-376a, mir-449a, mir-483-5p, mir-503, mir-577, mir-663, mir-7, mir-744 ovarian cancer let-7i, mir-100, mir-124, mir-125b, mir- mir-106a, mir-141, mir-148b, 129-5p, mir-130b, mir-133a, mir-137, mir-181b, mir-182, mir-200a, mir-138, mir-141, mir-145, mir-148a, mir-200c, mir-205, mir-20a, mir- mir-152, mir-153, mir-155, mir-199a, 21, mir-210, mir-214, mir-221, mir-200a, mir-200b, mir-200c, mir-212, mir-224-5p, mir-23b, mir-25, mir-335, mir-34a, mir-34b, mir-34c, mir- mir-26a, mir-27a, mir-27b, mir- 409-3p, mir-411, mir-429, mir-432, mir- 346, mir-378, mir-424, mir-503, 449a, mir-494, mir-497, mir-498, mir- mir-572, mir-9, mir-96 519d, mir-655, mir-9, mir-98 bladder cancer mir-1, mir-101, mir-1180, mir-1236, mir- mir-103a-3p, mir-10b, mir-135a, 124-3p, mir-125b, mir-126, mir-1280, mir-137, mir-141, mir-155, mir- mir-133a, mir-133b, mir-141, mir-143, 17-5p, mir-182, mir-182-5p, mir- mir-144, mir-145, mir-155, mir-16, mir- 183, mir-185, mir-19a, mir-203, 18a, mir-192, mir-195, mir-200a, mir- mir-205, mir-210, mir-221, mir- 200b, mir-200c, mir-203, mir-205, mir- 222, mir-223, mir-23a, mir-23b, 214, mir-218, mir-23b, mir-26a, mir-29c, mir-26b, mir-639, mir-96 mir-320c, mir-34a, mir-370, mir-409-3p, mir-429, mir-451, mir-490-5p, mir-493, mir-576-3p, mir-99a chordoma mir-1, mir-222, mir-31, mir-34a, mir-608 mir-140-3p, mir-148a kidney cancer mir-1, mir-145, mir-1826, mir-199a, mir- mir-183, mir-21, mir-210, mir- 199a-3p, mir-203, mir-205, mir-497, mir- 223 508-3p, mir-509-3p cervical carcinoma mir-100, mir-101, mir-15a, mir-16, mir- mir-133b, mir-21, mir-25, mir- 34a, mir-886-5p, mir-99a, mir-99b 373 mesenchymal cancer mir-100, mir-141, mir-199b-5p, mir- mir-125b-1-3p, mir-182 200a, mir-200b, mir-200c, mir-29a, mir- 29b-1, mir-29b-1-5p, mir-29b-2, mir-29c, mir-335, mir-429, mir-99a oral squamous cell mir-100, mir-124, mir-1250, mir-125b, mir-125b, mir-126, mir-146a, carcinoma mir-126, mir-1271, mir-136, mir-138, mir-146b, mir-155, mir-181b, mir-145, mir-147, mir-148a, mir-181a, mir-196a-1, mir-196a-2, mir- mir-206, mir-220a, mir-26a, mir-26b, 196b, mir-21, mir-221, mir-222, mir-29a, mir-32, mir-323-5p, mir-329, mir-24, mir-27b, mir-31, mir-345 mir-338, mir-370, mir-410, mir-429, mir- 433, mir-499a-5p, mir-503, mir-506, mir- 632, mir-646, mir-668, mir-877, mir-9 ovarian carcinoma mir-100, mir-101, mir-34b, mir-34c, mir- mir-148b, mir-182 532-5p cholangiocarcinoma mir-101, mir-144, mir-200b, mir-200c mir-17, mir-18a, mir-19a, mir- 19b, mir-20a, mir-21, mir-26a, mir-92a endometrial cancer mir-101, mir-130a, mir-130b, mir-134, mir-106a, mir-145, mir-155, mir- mir-143, mir-145, mir-152, mir-205, mir- 182, mir-200b, mir-200c, mir- 223, mir-301a, mir-301b, mir-30c, mir- 205, mir-21, mir-222-3p, mir-25, 34a, mir-34c, mir-424, mir-449a, mir- mir-93 543 esophageal cancer mir-124, mir-126, mir-140, mir-197, mir- mir-101, mir-10b, mir-130a, mir- 203, mir-218, mir-223, mir-30b, mir-375, 141, mir-143, mir-146b, mir-15a, mir-454, mir-486, mir-574-3p mir-183, mir-196b, mir-200a, mir-203, mir-205, mir-21, mir- 210, mir-221, mir-27a, mir-28- 3p, mir-31, mir-452, mir-96, mir- 99b liver cancer mir-101, mir-122, mir-132, mir-140-5p, mir-1301, mir-155, mir-21, mir- mir-145, mir-148b, mir-31, mir-338-3p, 221, mir-27a, mir-525-3p mir-433 pancreatic cancer mir-101, mir-1181, mir-124, mir-1247, mir-10a, mir-10b, mir-132, mir- mir-133a, mir-141, mir-145, mir-146a, 15a, mir-17-5p, mir-181a, mir- mir-148a, mir-148b, mir-150*, mir-150- 18a, mir-191, mir-196a, mir-21, 5p, mir-152, mir-15a, mir-198, mir-203, mir-212, mir-214, mir-222, mir- mir-214, mir-216a, mir-29c, mir-335, 27a, mir-301a, mir-301a-3p, mir- mir-34a, mir-34b, mir-34c, mir-373, mir- 367, mir-424-5p, mir-7, mir-92, 375, mir-410, mir-497, mir-615-5p, mir- mir-99a 630, mir-96 retinoblastoma mir-101, mir-183, mir-204, mir-34a, mir- mir-181b, mir-21 365b-3p, mir-486-3p, mir-532-5p cervical squamous cell mir-106a, mir-124, mir-148a, mir-214, mir-205 carcinoma mir-218, mir-29a, mir-375 clear cell renal cell mir-106a-5p, mir-135a-5p, mir-206 mir-142-5p, mir-155, mir-21-5p cancer laryngeal carcinoma mir-106b, mir-16, mir-21, mir- 27a, mir-423-3p medulloblastoma mir-124, mir-128a, mir-199b-5p, mir- mir-106b, mir-17, mir-18a, mir- 206, mir-22, mir-31, mir-383 19a, mir-19b, mir-20a, mir-30b, mir-30d, mir-92 pituitary carcinoma mir-106b, mir-122, mir-20a, mir- 493 prostate carcinoma mir-107 cervical cancer mir-143, mir-145, mir-17-5p, mir-203, mir-10a, mir-155, mir-181a, mir- mir-214, mir-218, mir-335, mir-342-3p, 181b, mir-196a, mir-19a, mir- mir-372, mir-424, mir-491-5p, mir-497, 19b, mir-205, mir-20a, mir-21, mir-7, mir-99a, mir-99b mir-215, mir-224, mir-31, mir- 494, mir-590-5p, mir-92a, mir- 944 chronic myelogenous mir-10a, mir-146a, mir-150, mir-151, mir-424, mir-96 leukemia mir-155, mir-2278, mir-26a, mir-30e, mir-31, mir-326, mir-564 gastrointestinal cancer mir-122a, mir-148a, mir-152 anaplastic astrocytoma mir-124, mir-137 astrocytoma mir-124-3p, mir-181b-5p, mir-200b, mir- mir-335 3189-3p epithelial ovarian mir-124a, mir-192, mir-193a, mir-7 mir-372, mir-373 cancer mantle cell lymphoma mir-142-3p, mir-142-5p, mir-150, mir- mir-124a, mir-155, mir-17, mir- 223, mir-29a, mir-29b, mir-29c 18a, mir-19a, mir-19b, mir-20a, mir-92a chronic lymphocytic mir-125b, mir-138, mir-15a, mir-15b, mir-150, mir-155 leukemia mir-16, mir-16-1, mir-16-1-3p, mir-16-2, mir-181a, mir-181b, mir-195, mir-223, mir-29b, mir-34b, mir-34c, mir-424 follicular cancer NA mir-125b malignant mir-126 mesothelioma small cell lung cancer mir-126, mir-138, mir-27a mir-25 meningioma mir-128, mir-200a mir-224, mir-335 laryngeal squamous mir-129-5p, mir-203, mir-205, mir-206, mir-21, mir-9, mir-93 cell carcinoma mir-24, mir-370, mir-375 medullary thyroid mir-129-5p mir-183 carcinoma lung adenocarcinoma mir-1297, mir-141, mir-145, mir-16, mir- mir-150, mir-155, mir-31 200a, mir-200b, mir-200c, mir-29b, mir- 381, mir-409-3p, mir-429, mir-451, mir- 511, mir-99a pancreatic carcinoma mir-132, mir-375 mir-301b lung squamous cell mir-133a, mir-218 carcinoma multiple myeloma mir-137, mir-197, mir-214 mir-21 squamous carcinoma mir-15a, mir-16, mir-203, mir-205, mir- mir-137, mir-155, mir-184, mir- 375 196a, mir-203, mir-21, mir-221, mir-27a, mir-34a uveal melanoma mir-137, mir-144, mir-145, mir-182, mir- NA 34a, mir-34b, mir-34c, mir-9 anaplastic thyroid mir-138 mir-146b, mir-221, mir-222 carcinoma colorectal carcinoma mir-139, mir-143, mir-145, mir-202-3p, mir-17, mir-182, mir-191, mir- mir-30a, mir-338-3p, mir-429, mir-451, 21, mir-95 mir-93 malt lymphoma mir-142-5p, mir-155 thyroid cancer mir-144, mir-886-3p primary cns mir-145, mir-193b, mir-199a, mir-214 lymphomas follicular thyroid mir-199b mir-146b, mir-183, mir-197, mir- carcinoma 221, mir-346 gallbladder carcinoma mir-146b-5p mir-155, mir-182 adult t-cell leukemia mir-150 anaplastic large-cell mir-155 lymphoma cutaneous t-cell mir-155 lymphoma diffuse large B-cell mir-155, mir-21 lymphoma rectal cancer mir-155, mir-200c, mir-21-5p, mir-34a tongue cancer mir-15b, mir-200b b-cell lymphoma mir-34a mir-17, mir-18a, mir-19a, mir- 19b, mir-20a, mir-92a breast carcinoma mir-17, mir-18a, mir-19a, mir- 19b, mir-20a, mir-24, mir-92a nasopharyngeal cancer mir-218, mir-223, mir-29c mir-17, mir-20a gastric mir-181b, mir-182, mir-200a, mir-302b, mir-23a, mir-27a, mir-373 adenocarcinoma mir-449a, mir-9 colorectal mir-182 adenocarcinoma colon carcinoma mir-186, mir-30a-5p mir-221, mir-23a adrenal cortical mir-195, mir-1974, mir-335, mir-497 mir-21, mir-210, mir-483-3p, carcinoma mir-483-5p esophageal mir-203 mir-196a, mir-199a-3p, mir- adenocarcinoma 199a-5p, mir-199b-3p, mir-200a, mir-223 gastrointestinal mir-218, mir-221, mir-222 mir-196a stromal tumor uterine leiomyoma mir-197 choriocarcinoma mir-199b, mir-218, mir-34a follicular lymphoma mir-202 basal cell carcinoma mir-203 hypopharyngeal mir-203 cancer pancreatic mir-203, mir-301a adenocarcinoma rhabdomyosarcoma mir-203 head and neck cancer NA mir-21 hypopharyngeal mir-451a, mir-504 mir-21 squamous cell carcinoma t-cell lymphoma mir-22 thyroid carcinoma mir-221, mir-222 splenic marginal zone mir-223 lymphoma laryngeal cancer mir-23a primary thyroid mir-26a lymphoma acute leukemia mir-27a monocytic leukemia mir-29a, mir-29b oral carcinoma mir-375 mir-31 primary gallbladder mir-335 carcinoma endometrial serous mir-34b adenocarcinoma esophageal carcinoma mir-451 hepatoblastoma mir-492 colonic mir-627 adenocarcinoma

(318) TABLE-US-00020 TABLE 4 Exemplary oncogenic miRs Cancer miRNA colorectal cancer let-7a, mir-103, mir-106a, mir-10b, mir-1179, mir-1229, mir-1246, mir-125b-2*, mir- 1269a, mir-130b, mir-133b, mir-135a, mir-135a-1, mir-135a-2, mir-135b, mir-139-3p, mir-145, mir-150, mir-150*, mir-155, mir-17, mir-181a, mir-182, mir-183, mir-18a, mir-191, mir-196a, mir-196b, mir-19a, mir-19b, mir-200b, mir-200c, mir-203, mir- 204-5p, mir-20a, mir-20a-5p, mir-21, mir-210, mir-211, mir-221, mir-223, mir-224, mir-23a, mir-25, mir-27a, mir-29a, mir-301a, mir-31, mir-32, mir-320b, mir-326, mir- 424, mir-429, mir-494, mir-497, mir-499-5p, mir-592, mir-630, mir-720, mir-892a, mir-92, mir-92a, mir-93, mir-95, mir-96 papillary thyroid let-7e, mir-146b, mir-146b-5p, mir-151-5p, mir-155, mir-181a-1, mir-181a-2, mir- carcinoma 181b-1, mir-181b-2, mir-181c, mir-181d, mir-182, mir-183, mir-199b-5p, mir-21, mir- 221, mir-222, mir-339-5p, mir-34a esophageal squamous mir-100, mir-1179, mir-1290, mir-130b, mir-145, mir-16, mir-17, mir-183, mir-18a, cell carcinoma mir-19a, mir-19b, mir-208, mir-20a, mir-21, mir-218, mir-223, mir-25, mir-30a-5p, mir-31, mir-330-3p, mir-373, mir-9, mir-92a, mir-942 gastric cancer mir-100, mir-103, mir-106a, mir-106b, mir-107, mir-10a, mir-10b, mir-1259, mir- 125b, mir-126, mir-1274a, mir-1303, mir-130b*, mir-135a-5p, mir-135b, mir-138, mir-143, mir-146a, mir-147, mir-148a, mir-150, mir-17, mir-17-5p, mir-181a, mir- 181a-2*, mir-181a-5p, mir-181c, mir-183, mir-185, mir-18a, mir-191, mir-192, mir- 196a, mir-196a*, mir-196a-5p, mir-196b, mir-199a, mir-199a-3p, mir-199a-5p, mir- 19a, mir-19b, mir-200b, mir-20a, mir-21, mir-214, mir-215, mir-221, mir-221*, mir- 222, mir-223, mir-224, mir-23a, mir-23b, mir-25, mir-27a, mir-27b, mir-296-5p, mir- 301a, mir-302f, mir-337-3p, mir-340*, mir-34a, mir-362-3p, mir-370, mir-374a, mir- 377, mir-421, mir-425, mir-500, mir-520c-3p, mir-544, mir-575, mir-601, mir-616*, mir-650, mir-92, mir-98, mir-99a renal cell carcinoma mir-100, mir-1233, mir-1260b, mir-146a, mir-146b, mir-16, mir-193a-3p, mir-203a, mir-21, mir-210, mir-27a, mir-362, mir-572, mir-7 esophageal cancer mir-101, mir-10b, mir-130a, mir-141, mir-143, mir-146b, mir-15a, mir-183, mir-196b, mir-200a, mir-203, mir-205, mir-21, mir-210, mir-221, mir-27a, mir-28-3p, mir-31, mir-452, mir-96, mir-99b bladder cancer mir-103a-3p, mir-10b, mir-135a, mir-137, mir-141, mir-155, mir-17-5p, mir-182, mir- 182-5p, mir-183, mir-185, mir-19a, mir-203, mir-205, mir-210, mir-221, mir-222, mir- 223, mir-23a, mir-23b, mir-26b, mir-639, mir-96 endometrial cancer mir-106a, mir-145, mir-155, mir-182, mir-200b, mir-200c, mir-205, mir-21, mir-222- 3p, mir-25, mir-93 ovarian cancer mir-106a, mir-141, mir-148b, mir-181b, mir-182, mir-200a, mir-200c, mir-205, mir- 20a, mir-21, mir-210, mir-214, mir-221, mir-224-5p, mir-23b, mir-25, mir-26a, mir- 27a, mir-27b, mir-346, mir-378, mir-424, mir-503, mir-572, mir-9, mir-96 glioma mir-106b, mir-106b-5p, mir-10b, mir-125b, mir-132, mir-155, mir-17, mir-181a, mir- 182, mir-183, mir-193b, mir-19a, mir-19b, mir-20a, mir-210, mir-214, mir-221, mir- 222, mir-224, mir-23a, mir-24, mir-24-3p, mir-25, mir-26a, mir-27a-3p, mir-27b, mir- 30a-5p, mir-30e, mir-30e*, mir-328, mir-335, mir-33a, mir-372, mir-486, mir-494, mir-497, mir-566, mir-603, mir-650, mir-675, mir-9, mir-92b, mir-93, mir-96 head and neck mir-106b, mir-134, mir-16, mir-184, mir-196a, mir-21, mir-25, mir-30a-5p, mir-31, squamous cell mir-372, mir-93 carcinoma hepatocellular mir-106b, mir-10b, mir-122, mir-1228, mir-1269, mir-128a, mir-130a, mir-130b, mir- carcinoma 146a, mir-153, mir-155, mir-17-5p, mir-181a, mir-181a-1, mir-181a-2, mir-181b, mir- 181b-1, mir-181b-2, mir-181c, mir-181d, mir-182, mir-183, mir-184, mir-190b, mir- 191, mir-20a, mir-20b, mir-21, mir-210, mir-214, mir-215, mir-216a, mir-217, mir- 221, mir-222, mir-223, mir-224, mir-23a, mir-24, mir-25, mir-27a, mir-301a, mir-30d, mir-31, mir-3127, mir-32, mir-331-3p, mir-362-3p, mir-362-5p, mir-371-5p, mir-372, mir-373, mir-423, mir-429, mir-452, mir-483-3p, mir-483-5p, mir-485-3p, mir-490- 3p, mir-494, mir-495, mir-500, mir-501, mir-501-5p, mir-519d, mir-520g, mir-574-3p, mir-590-5p, mir-630, mir-650, mir-657, mir-664, mir-885-5p, mir-9, mir-92a, mir-96 laryngeal carcinoma mir-106b, mir-16, mir-21, mir-27a, mir-423-3p medulloblastoma mir-106b, mir-17, mir-18a, mir-19a, mir-19b, mir-20a, mir-30b, mir-30d, mir-92 pituitary carcinoma mir-106b, mir-122, mir-17-5p, mir-20a, mir-493 cervical cancer mir-10a, mir-155, mir-181a, mir-181b, mir-196a, mir-19a, mir-19b, mir-205, mir-20a, mir-21, mir-215, mir-224, mir-31, mir-494, mir-590-5p, mir-92a, mir-944 pancreatic cancer mir-10a, mir-10b, mir-132, mir-15a, mir-17-5p, mir-181a, mir-18a, mir-191, mir-196a, mir-21, mir-212, mir-214, mir-221, mir-222, mir-27a, mir-301a, mir-301a-3p, mir- 367, mir-424-5p, mir-7, mir-92, mir-99a breast cancer mir-10b, mir-125a, mir-135a, mir-140, mir-141, mir-142, mir-150, mir-155, mir-17, mir-17-5p, mir-181a, mir-181b, mir-182, mir-18a, mir-18b, mir-191, mir-196a, mir- 197, mir-19a, mir-19b, mir-200a, mir-200b, mir-200c, mir-203, mir-205, mir-20a, mir- 20b, mir-21, mir-217, mir-221, mir-222, mir-224, mir-23a, mir-24, mir-24-2-5p, mir- 24-3p, mir-27a, mir-29a, mir-29b-1, mir-29b-2, mir-29c, mir-373, mir-378, mir-423, mir-429, mir-495, mir-503, mir-510, mir-520c, mir-526b, mir-96 glioblastoma mir-10b, mir-125b, mir-127-3p, mir-148a, mir-18a, mir-196a, mir-196a-1, mir-196a-2, mir-196b, mir-21, mir-210, mir-210-3p, mir-223, mir-340, mir-576-5p, mir-626, mir- 92b lung cancer mir-10b, mir-135b, mir-150, mir-155, mir-17, mir-182, mir-183-3p, mir-18a, mir-197, mir-19a, mir-19b, mir-205, mir-20a, mir-21, mir-210, mir-24, mir-30d, mir-4423, mir- 5100, mir-570, mir-663, mir-7, mir-92a nasopharyngeal mir-10b, mir-144, mir-149, mir-155, mir-18a, mir-21, mir-214, mir-24, mir-421, mir- carcinoma 663, mir-744, mir-93 non-small cell lung mir-10b, mir-125a-5p, mir-1280, mir-136, mir-140, mir-141, mir-142-3p, mir-145, cancer mir-146a, mir-150, mir-18a, mir-196a, mir-19a, mir-200a, mir-200c, mir-205, mir- 205-3p, mir-205-5p, mir-21, mir-212, mir-22, mir-221, mir-222, mir-24, mir-25, mir- 29c, mir-31, mir-328, mir-330-3p, mir-339, mir-34a, mir-375, mir-494, mir-675-5p, mir-9, mir-92b, mir-93, mir-95 oral cancer mir-10b, mir-196a-1, mir-196a-2, mir-196b, mir-21 pancreatic ductal mir-10b, mir-186, mir-18a, mir-192, mir-194, mir-196a, mir-198, mir-203, mir-21, adenocarcinoma mir-212, mir-30b-5p, mir-31, mir-34a, mir-369-5p, mir-376a, mir-541 renal clear cell mir-122, mir-155, mir-210, mir-630 carcinoma mantle cell lymphoma mir-124a, mir-155, mir-17, mir-18a, mir-19a, mir-19b, mir-20a, mir-92a acute myeloid mir-125b, mir-126-5p, mir-128, mir-155, mir-29a, mir-32, mir-331, mir-370, mir-378 leukemia follicular cancer mir-125b neuroblastoma mir-125b, mir-15a, mir-15b, mir-16-1, mir-16-2, mir-18a, mir-195, mir-19a, mir-23a, mir-421, mir-92 oral squamous cell mir-125b, mir-126, mir-146a, mir-146b, mir-155, mir-181b, mir-196a-1, mir-196a-2, carcinoma mir-196b, mir-21, mir-221, mir-222, mir-24, mir-27b, mir-31, mir-345 prostate cancer mir-125b, mir-141, mir-153, mir-155, mir-181a-1, mir-181a-2, mir-181b, mir-181b-1, mir-181b-2, mir-181c, mir-181d, mir-182, mir-182-5p, mir-183, mir-18a, mir-204, mir-20a, mir-21, mir-221, mir-223-3p, mir-31, mir-429, mir-96 mesenchymal cancer mir-125b-1-3p, mir-182 malignant melanoma mir-126, mir-141, mir-15b, mir-17, mir-17-5p, mir-182, mir-18a, mir-193b, mir-200a, mir-200b, mir-200c, mir-20a, mir-21, mir-210, mir-214, mir-221, mir-222, mir-429, mir-455-5p, mir-532-5p, mir-638, mir-92a acute lymphoblastic mir-128 leukemia osteosarcoma mir-128, mir-151-3p, mir-17, mir-181a, mir-181b, mir-181c, mir-18a, mir-191, mir- 195-5p, mir-199a-3p, mir-19a, mir-19b, mir-20a, mir-21, mir-210, mir-214, mir-221, mir-27a, mir-300, mir-320a, mir-374a-5p, mir-802, mir-9, mir-92a colon cancer mir-1290, mir-145, mir-155, mir-181a, mir-18a, mir-200c, mir-31, mir-675 liver cancer mir-1301, mir-155, mir-21, mir-221, mir-27a, mir-525-3p cervical carcinoma mir-133b, mir-21, mir-25, mir-373 squamous carcinoma mir-137, mir-155, mir-184, mir-196a, mir-203, mir-21, mir-221, mir-27a, mir-34a chordoma mir-140-3p, mir-148a clear cell renal cell mir-142-5p, mir-155, mir-21-5p cancer malt lymphoma mir-142-5p, mir-155 anaplastic thyroid mir-146b, mir-221, mir-222 carcinoma follicular thyroid mir-146b, mir-183, mir-197, mir-221, mir-346 carcinoma primary thyroid mir-146b lymphoma ovarian carcinoma mir-148b, mir-182 adult t-cell leukemia mir-150 chronic lymphocytic mir-150, mir-155 leukemia lung adenocarcinoma mir-150, mir-155, mir-31 anaplastic large-cell mir-155 lymphoma cutaneous t-cell mir-155 lymphoma diffuse large B-cell mir-155, mir-21 lymphoma gallbladder carcinoma mir-155, mir-182 rectal cancer mir-155, mir-200c, mir-21-5p, mir-34a b-cell lymphoma mir-17, mir-18a, mir-19a, mir-19b, mir-20a, mir-92a breast carcinoma mir-17, mir-18a, mir-19a, mir-19b, mir-20a, mir-24, mir-92a cholangiocarcinoma mir-17, mir-18a, mir-19a, mir-19b, mir-20a, mir-21, mir-26a, mir-92a colorectal carcinoma mir-17, mir-182, mir-191, mir-21, mir-95 nasopharyngeal cancer mir-17, mir-20a acute promyelocytic mir-181a, mir-181b, mir-92a leukemia retinoblastoma mir-181b, mir-21 colorectal mir-182 adenocarcinoma kidney cancer mir-183, mir-21, mir-210, mir-223 medullary thyroid mir-183 carcinoma esophageal mir-196a, mir-199a-3p, mir-199a-5p, mir-199b-3p, mir-200a, mir-223 adenocarcinoma gastrointestinal stromal mir-196a tumor hypopharyngeal cancer mir-203 pancreatic mir-203, mir-301a adenocarcinoma cervical squamous cell mir-205 carcinoma adrenal cortical mir-21, mir-210, mir-483-3p, mir-483-5p carcinoma head and neck cancer mir-21 hypopharyngeal mir-21 squamous cell carcinoma laryngeal squamous mir-21, mir-9, mir-93 cell carcinoma multiple myeloma mir-21 colon carcinoma mir-221, mir-23a thyroid carcinoma mir-221, mir-222 meningioma mir-224, mir-335 gastric mir-23a, mir-27a, mir-373 adenocarcinoma laryngeal cancer mir-23a small cell lung cancer mir-25 pancreatic carcinoma mir-30 lb oral carcinoma mir-31 astrocytoma mir-335 epithelial ovarian mir-372, mir-373 cancer chronic myelogenous mir-424, mir-96 leukemia hepatoblastoma mir-492

(319) TABLE-US-00021 TABLE 3 Exemplary tumor suppressive miRs Cancer Down regulated tumor suppressive miR acute leukemia mir-27a acute lymphoblastic leukemia let-7b, mir-124a, mir-142-3p acute myeloid leukemia let-7c, mir-17, mir-181a, mir-20a, mir-223, mir-26a, mir-29a, mir-30c, mir-720 acute promyelocytic leukemia let-7c, mir-107, mir-342 adrenal cortical carcinoma mir-195, mir-1974, mir-335, mir-497 anaplastic astrocytoma mir-124, mir-137 anaplastic thyroid carcinoma mir-138 astrocytoma mir-124-3p, mir-181b-5p, mir-200b, mir-3189-3p basal cell carcinoma mir-203 b-cell lymphoma mir-34a bladder cancer mir-1, mir-101, mir-1180, mir-1236, mir-124-3p, mir-125b, mir-126, mir- 1280, mir-133a, mir-133b, mir-141, mir-143, mir-144, mir-145, mir-155, mir-16, mir-18a, mir-192, mir-195, mir-200a, mir-200b, mir-200c, mir- 203, mir-205, mir-214, mir-218, mir-23b, mir-26a, mir-29c, mir-320c, mir-34a, mir-370, mir-409-3p, mir-429, mir-451, mir-490-5p, mir-493, mir-576-3p, mir-99a breast cancer let-7a, let-7a-1, let-7a-2, let-7a-3, let-7b, let-7c, let-7d, let-7e, let-7f-1, let- 7f-2, let-7g, let-7i, mir-100, mir-107, mir-10a, mir-10b, mir-122, mir-124, mir-1258, mir-125a-5p, mir-125b, mir-126, mir-127, mir-129, mir-130a, mir-132, mir-133a, mir-143, mir-145, mir-146a, mir-146b, mir-147, mir- 148a, mir-149, mir-152, mir-153, mir-15a, mir-16, mir-17-5p, mir-181a, mir-1826, mir-183, mir-185, mir-191, mir-193a-3p, mir-193b, mir-195, mir-199b-5p, mir-19a-3p, mir-200a, mir-200b, mir-200c, mir-205, mir- 206, mir-211, mir-216b, mir-218, mir-22, mir-26a, mir-26b, mir-300, mir-30a, mir-31, mir-335, mir-339-5p, mir-33b, mir-34a, mir-34b, mir- 34c, mir-374a, mir-379, mir-381, mir-383, mir-425, mir-429, mir-450b- 3p, mir-494, mir-495, mir-497, mir-502-5p, mir-517a, mir-574-3p, mir- 638, mir-7, mir-720, mir-873, mir-874, mir-92a, mir-98, mir-99a, mmu- mir-290-3p, mmu-mir-290-5p bronchioloalveolar carcinoma let-7a-1, let-7a-2, let-7a-3, let-7b, let-7c, let-7d, let-7e, let-7f-1, let-7f-2, let-7g, let-7i, mir-98 cervical cancer mir-143, mir-145, mir-17-5p, mir-203, mir-214, mir-218, mir-335, mir- 342-3p, mir-372, mir-424, mir-491-5p, mir-497, mir-7, mir-99a, mir-99b cervical carcinoma mir-100, mir-101, mir-15a, mir-16, mir-34a, mir-886-5p, mir-99a, mir- 99b cervical squamous cell carcinoma mir-106a, mir-124, mir-148a, mir-214, mir-218, mir-29a, mir-375 cholangiocarcinoma mir-101, mir-144, mir-200b, mir-200c chondrosarcoma let-7a, mir-100, mir-136, mir-145, mir-199a, mir-222, mir-30a, mir-335, mir-376a chordoma mir-1, mir-222, mir-31, mir-34a, mir-608 choriocarcinoma mir-199b, mir-218, mir-34a chronic lymphocytic leukemia mir-125b, mir-138, mir-15a, mir-15b, mir-16, mir-16-1, mir-16-1-3p, mir-16-2, mir-181a, mir-181b, mir-195, mir-223, mir-29b, mir-34b, mir- 34c, mir-424 chronic myelogenous leukemia mir-10a, mir-138, mir-146a, mir-150, mir-151, mir-155, mir-16, mir- 2278, mir-26a, mir-30e, mir-31, mir-326, mir-564 clear cell renal cell cancer mir-106a-5p, mir-135a-5p, mir-206 colon cancer let-7a-1, let-7a-2, let-7a-3, let-7b, let-7c, let-7d, let-7e, let-7f-1, let-7f-2, let-7g, let-7i, mir-100, mir-101, mir-126, mir-142-3p, mir-143, mir-145, mir-192, mir-200c, mir-21, mir-214, mir-215, mir-22, mir-25, mir-302a, mir-320, mir-320a, mir-34a, mir-34c, mir-365, mir-373, mir-424, mir- 429, mir-455, mir-484, mir-502, mir-503, mir-93, mir-98 colon carcinoma mir-186, mir-30a-5p colonic adenocarcinoma mir-627 colorectal cancer let-7a, mir-1, mir-100, mir-101, mir-124, mir-125a, mir-126, mir-129, mir-1295b-3p, mir-1307, mir-130b, mir-132, mir-133a, mir-133b, mir- 137, mir-138, mir-139, mir-139-5p, mir-140-5p, mir-143, mir-145, mir- 148a, mir-148b, mir-149, mir-150-5p, mir-154, mir-15a, mir-15b, mir-16, mir-18a, mir-191, mir-192, mir-193a-5p, mir-194, mir-195, mir-196a, mir-198, mir-199a-5p, mir-200c, mir-203, mir-204-5p, mir-206, mir-212, mir-215, mir-218, mir-22, mir-224, mir-24-3p, mir-26b, mir-27a, mir-28- 3p, mir-28-5p, mir-29b, mir-30a-3p, mir-30b, mir-320a, mir-328, mir- 338-3p, mir-342, mir-345, mir-34a, mir-34a-5p, mir-361-5p, mir-375, mir-378, mir-378a-3p, mir-378a-5p, mir-409-3p, mir-422a, mir-4487, mir-483, mir-497, mir-498, mir-518a-3p, mir-551a, mir-574-5p, mir-625, mir-638, mir-7, mir-96-5p colorectal carcinoma mir-139, mir-143, mir-145, mir-202-3p, mir-30a, mir-338-3p, mir-429, mir-451, mir-93 endometrial cancer mir-101, mir-130a, mir-130b, mir-134, mir-143, mir-145, mir-152, mir- 205, mir-223, mir-301a, mir-301b, mir-30c, mir-34a, mir-34c, mir-424, mir-449a, mir-543 endometrial serous adenocarcinoma mir-34b epithelial ovarian cancer mir-124a, mir-192, mir-193a, mir-7 esophageal adenocarcinoma mir-203 esophageal cancer mir-124, mir-126, mir-140, mir-197, mir-203, mir-218, mir-223, mir-30b, mir-375, mir-454, mir-486, mir-574-3p esophageal carcinoma mir-451 esophageal squamous cell let-7a, let-7a-1, let-7a-2, let-7a-3, let-7b, let-7c, let-7d, let-7e, let-7f-1, let- carcinoma 7f-2, let-7g, let-7i, mir-1, mir-100, mir-101, mir-126, mir-1294, mir-133a, mir-133b, mir-138, mir-143, mir-145, mir-150, mir-185, mir-195, mir- 200b, mir-203, mir-21, mir-210, mir-214, mir-218, mir-22, mir-27a, mir- 29b, mir-29c, mir-302b, mir-34a, mir-375, mir-494, mir-518b, mir-655, mir-98, mir-99a follicular lymphoma mir-202 follicular thyroid carcinoma mir-199b gallbladder carcinoma mir-146b-5p gastric adenocarcinoma mir-181b, mir-182, mir-200a, mir-302b, mir-449a, mir-9 gastric cancer let-7a, let-7b, let-7g, mir-1, mir-101, mir-103a, mir-10a, mir-10b, mir- 1207-5p, mir-122, mir-1228*, mir-124, mir-124-3p, mir-125a-3p, mir- 126, mir-1266, mir-127, mir-1271, mir-129-1-3p, mir-129-2-3p, mir-129- 3p, mir-129-5p, mir-133a, mir-133b, mir-137, mir-141, mir-143, mir-144, mir-145, mir-146a, mir-146a-5p, mir-148a, mir-148b, mir-149, mir-152, mir-155, mir-155-5p, mir-181a, mir-181b, mir-182, mir-183, mir-185, mir-194, mir-195, mir-197, mir-199a-3p, mir-200b, mir-200c, mir-202- 3p, mir-204, mir-204-5p, mir-205, mir-206, mir-210, mir-212, mir-217, mir-218, mir-22, mir-23b, mir-24, mir-26a, mir-29a, mir-29a-3p, mir-29b, mir-29b-1, mir-29b-2, mir-29c, mir-30a-5p, mir-30b, mir-31, mir-328, mir-329, mir-331-3p, mir-335-5p, mir-338, mir-338-3p, mir-34a, mir- 34b, mir-34c, mir-361-5p, mir-367, mir-375, mir-378, mir-409-3p, mir- 410, mir-429, mir-433, mir-449, mir-449a, mir-490-3p, mir-494, mir-497, mir-503, mir-506, mir-513b, mir-520d-3p, mir-542-3p, mir-622, mir-625, mir-638, mir-663, mir-7, mir-874, mir-9 gastrointestinal cancer mir-122a, mir-148a, mir-152 gastrointestinal stromal tumor mir-218, mir-221, mir-222 glioblastoma let-7g-5p, mir-100, mir-101, mir-106a, mir-124, mir-124a, mir-125a, mir- 125a-5p, mir-125b, mir-127-3p, mir-128, mir-129, mir-136, mir-137, mir- 139-5p, mir-142-3p, mir-143, mir-145, mir-146b-5p, mir-149, mir-152, mir-153, mir-195, mir-21, mir-212-3p, mir-219-5p, mir-222, mir-29b, mir-31, mir-3189-3p, mir-320, mir-320a, mir-326, mir-330, mir-331-3p, mir-340, mir-342, mir-34a, mir-376a, mir-449a, mir-483-5p, mir-503, mir-577, mir-663, mir-7, mir-7-5p, mir-873 glioma let-7a, let-7f, mir-106a, mir-107, mir-122, mir-124, mir-124-5p, mir- 124a, mir-125b, mir-128, mir-136, mir-137, mir-139, mir-143, mir-145, mir-146a, mir-146b, mir-146b-5p, mir-152, mir-15b, mir-16, mir-181a, mir-181a-1, mir-181a-2, mir-181b, mir-181b-1, mir-181b-2, mir-181c, mir-181d, mir-184, mir-185, mir-195, mir-199a-3p, mir-200a, mir-200b, mir-203, mir-204, mir-205, mir-218, mir-219-5p, mir-23b, mir-26b, mir- 27a, mir-29c, mir-320, mir-326, mir-328, mir-34a, mir-34c-3p, mir-34c- 5p, mir-375, mir-383, mir-451, mir-452, mir-483-5p, mir-495, mir-584, mir-622, mir-656, mir-7, mir-98 head and neck squamous cell let-7d, mir-1, mir-107, mir-128, mir-133a, mir-138, mir-149, mir-200c, carcinoma mir-205, mir-218, mir-27a*, mir-29a, mir-29b-1, mir-29b-2, mir-29c, mir-300, mir-34a, mir-363, mir-375, mir-874 hepatocellular carcinoma let-7a-1, let-7a-2, let-7a-3, let-7b, let-7c, let-7d, let-7e, let-7f, let-7f-1, let- 7f-2, let-7g, let-7i, mir-1, mir-100, mir-101, mir-105, mir-122, mir-122a, mir-1236, mir-124, mir-125b, mir-126, mir-127, mir-1271, mir-128-3p, mir-129-5p, mir-130a, mir-130b, mir-133a, mir-134, mir-137, mir-138, mir-139, mir-139-5p, mir-140-5p, mir-141, mir-142-3p, mir-143, mir- 144, mir-145, mir-146a, mir-148a, mir-148b, mir-150-5p, mir-15b, mir- 16, mir-181a-5p, mir-185, mir-188-5p, mir-193b, mir-195, mir-195-5p, mir-197, mir-198, mir-199a, mir-199a-5p, mir-199b, mir-199b-5p, mir- 200a, mir-200b, mir-200c, mir-202, mir-203, mir-204-3p, mir-205, mir- 206, mir-20a, mir-21, mir-21-3p, mir-211, mir-212, mir-214, mir-217, mir-218, mir-219-5p, mir-22, mir-223, mir-26a, mir-26b, mir-29a, mir- 29b-1, mir-29b-2, mir-29c, mir-302b, mir-302c, mir-30a, mir-30a-3p, mir-335, mir-338-3p, mir-33a, mir-34a, mir-34b, mir-365, mir-370, mir- 372, mir-375, mir-376a, mir-377, mir-422a, mir-424, mir-424-5p, mir- 433, mir-4458, mir-448, mir-450a, mir-451, mir-485-5p, mir-486-5p, mir- 497, mir-503, mir-506, mir-519d, mir-520a, mir-520b, mir-520c-3p, mir- 582-5p, mir-590-5p, mir-610, mir-612, mir-625, mir-637, mir-675, mir-7, mir-877, mir-940, mir-941, mir-98, mir-99a hypopharyngeal squamous cell mir-45 la, mir-504 carcinoma kidney cancer mir-1, mir-145, mir-1826, mir-199a, mir-199a-3p, mir-203, mir-205, mir- 497, mir-508-3p, mir-509-3p laryngeal squamous cell carcinoma mir-129-5p, mir-203, mir-205, mir-206, mir-24, mir-370, mir-375 liver cancer mir-101, mir-122, mir-132, mir-140-5p, mir-145, mir-148b, mir-31, mir- 338-3p, mir-433 lung adenocarcinoma mir-1297, mir-141, mir-145, mir-16, mir-200a, mir-200b, mir-200c, mir- 29b, mir-381, mir-409-3p, mir-429, mir-451, mir-511, mir-99a lung cancer let-7a-1, let-7a-2, let-7a-3, let-7b, let-7c, let-7d, let-7e, let-7f-1, let-7f-2, let-7g, let-7i, mir-1, mir-101, mir-133b, mir-138, mir-142-5p, mir-144, mir-145, mir-1469, mir-146a, mir-153, mir-15a, mir-15b, mir-16-1, mir- 16-2, mir-182, mir-192, mir-193a-3p, mir-194, mir-195, mir-198, mir- 203, mir-217, mir-218, mir-22, mir-223, mir-26a, mir-26b, mir-29c, mir- 33a, mir-34a, mir-34b, mir-34c, mir-365, mir-449a, mir-449b, mir-486- 5p, mir-545, mir-610, mir-614, mir-630, mir-660, mir-7515, mir-9500, mir-98, mir-99b lung squamous cell carcinoma mir-133a, mir-218 malignant melanoma let-7b, mir-101, mir-125b, mir-1280, mir-143, mir-146a, mir-146b, mir- 155, mir-17, mir-184, mir-185, mir-18b, mir-193b, mir-200c, mir-203, mir-204, mir-205, mir-206, mir-20a, mir-211, mir-218, mir-26a, mir-31, mir-33a, mir-34a, mir-34c, mir-376a, mir-376c, mir-573, mir-7-5p, mir-9, mir-98 malignant mesothelioma mir-126 mantle cell lymphoma mir-142-3p, mir-142-5p, mir-150, mir-223, mir-29a, mir-29b, mir-29c medullary thyroid carcinoma mir-129-5p medulloblastoma mir-124, mir-128a, mir-199b-5p, mir-206, mir-22, mir-31, mir-383 meningioma mir-128, mir-200a mesenchymal cancer mir-100, mir-141, mir-199b-5p, mir-200a, mir-200b, mir-200c, mir-29a, mir-29b-1, mir-29b-1-5p, mir-29b-2, mir-29c, mir-335, mir-429, mir-99a monocytic leukemia mir-29a, mir-29b multiple myeloma mir-137, mir-197, mir-214 nasopharyngeal cancer mir-218, mir-223, mir-29c nasopharyngeal carcinoma let-7a, let-7a-1, let-7a-2, let-7a-3, let-7b, let-7c, let-7d, let-7e, let-7f-1, let- 7f-2, let-7g, let-7i, mir-1, mir-101, mir-124, mir-138, mir-143, mir-145, mir-148a, mir-200b, mir-204, mir-216b, mir-223, mir-29c, mir-320a, mir- 324-3p, mir-34c, mir-375, mir-378, mir-451, mir-506, mir-9, mir-98 neuroblastoma let-7a-1, let-7a-2, let-7a-3, let-7b, let-7c, let-7d, let-7e, let-7f-1, let-7f-2, let-7g, let-7i, mir-124, mir-137, mir-145, mir-181c, mir-184, mir-200a, mir-29a, mir-335, mir-338-3p, mir-34a, mir-449a, mir-885-5p, mir-98 non-small cell lung cancer let-7a, let-7c, mir-1, mir-100, mir-101, mir-106a, mir-107, mir-124, mir- 125a-3p, mir-125a-5p, mir-126, mir-126*, mir-129, mir-133a, mir-137, mir-138, mir-140, mir-143, mir-145, mir-146a, mir-146b, mir-148a, mir- 148b, mir-149, mir-152, mir-153, mir-154, mir-155, mir-15a, mir-16, mir-17-5p, mir-181a-1, mir-181a-2, mir-181b, mir-181b-1, mir-181b-2, mir-181c, mir-181d, mir-184, mir-186, mir-193b, mir-195, mir-199a, mir- 204, mir-212, mir-221, mir-224, mir-26b, mir-27a, mir-27b, mir-29a, mir- 29b, mir-29c, mir-30a, mir-30b, mir-30c, mir-30d, mir-30d-5p, mir-30e- 5p, mir-32, mir-335, mir-338-3p, mir-340, mir-342-3p, mir-34a, mir-34b, mir-361-3p, mir-365, mir-373, mir-375, mir-429, mir-449a, mir-4500, mir-451, mir-4782-3p, mir-497, mir-503, mir-512-3p, mir-520a-3p, mir- 526b, mir-625*, mir-96, mir-99a oral cancer let-7d, mir-218, mir-34a, mir-375, mir-494 oral carcinoma mir-375 oral squamous cell carcinoma mir-100, mir-124, mir-1250, mir-125b, mir-126, mir-1271, mir-136, mir- 138, mir-145, mir-147, mir-148a, mir-181a, mir-206, mir-220a, mir-26a, mir-26b, mir-29a, mir-32, mir-323-5p, mir-329, mir-338, mir-370, mir- 410, mir-429, mir-433, mir-499a-5p, mir-503, mir-506, mir-632, mir-646, mir-668, mir-877, mir-9 osteosarcoma let-7a, mir-1, mir-100, mir-101, mir-122, mir-124, mir-125b, mir-126, mir-127-3p, mir-132, mir-133a, mir-141, mir-142-3p, mir-142-5p, mir- 143, mir-144, mir-145, mir-153, mir-16, mir-183, mir-194, mir-195, mir- 199a-3p, mir-204, mir-212, mir-217, mir-218, mir-22, mir-23a, mir-24, mir-26a, mir-26b, mir-29b, mir-32, mir-320, mir-335, mir-33b, mir-340, mir-34a, mir-34b, mir-34c, mir-375, mir-376c, mir-382, mir-3928, mir- 424, mir-429, mir-449a, mir-451, mir-454, mir-503, mir-519d, mir-646 ovarian cancer let-7i, mir-100, mir-124, mir-125b, mir-129-5p, mir-130b, mir-133a, mir- 137, mir-138, mir-141, mir-145, mir-148a, mir-152, mir-153, mir-155, mir-199a, mir-200a, mir-200b, mir-200c, mir-212, mir-335, mir-34a, mir- 34b, mir-34c, mir-409-3p, mir-411, mir-429, mir-432, mir-449a, mir-494, mir-497, mir-498, mir-519d, mir-655, mir-9, mir-98 ovarian carcinoma mir-100, mir-101, mir-34b, mir-34c, mir-532-5p pancreatic cancer mir-101, mir-1181, mir-124, mir-1247, mir-133a, mir-141, mir-145, mir- 146a, mir-148a, mir-148b, mir-150*, mir-150-5p, mir-152, mir-15a, mir- 198, mir-203, mir-214, mir-216a, mir-29c, mir-335, mir-34a, mir-34b, mir-34c, mir-373, mir-375, mir-410, mir-497, mir-615-5p, mir-630, mir- 96 pancreatic carcinoma mir-132, mir-375 pancreatic ductal adenocarcinoma let-7a, let-7a-1, let-7a-2, let-7a-3, let-7b, let-7c, let-7d, let-7e, let-7f-1, let- 7f-2, let-7g, let-7i, mir-126, mir-135a, mir-143, mir-144, mir-145, mir- 148a, mir-150, mir-15a, mir-16, mir-200a, mir-200b, mir-200c, mir-217, mir-218, mir-337, mir-375, mir-494, mir-615-5p, mir-98 papillary thyroid carcinoma mir-101, mir-130b, mir-138, mir-146a, mir-16, mir-195, mir-199a-3p, mir-204-5p, mir-219-5p, mir-26a, mir-34b, mir-613 primary cns lymphomas mir-145, mir-193b, mir-199a, mir-214 primary gallbladder carcinoma mir-335 primary thyroid lymphoma mir-26a prostate cancer let-7a-3p, let-7c, mir-100, mir-101, mir-105, mir-124, mir-128, mir-1296, mir-130b, mir-133a-1, mir-133a-2, mir-133b, mir-135a, mir-143, mir- 145, mir-146a, mir-154, mir-15a, mir-187, mir-188-5p, mir-199b, mir- 200b, mir-203, mir-205, mir-212, mir-218, mir-221, mir-224, mir-23a, mir-23b, mir-25, mir-26a, mir-26b, mir-29b, mir-302a, mir-30a, mir-30b, mir-30c-1, mir-30c-2, mir-30d, mir-30e, mir-31, mir-330, mir-331-3p, mir-34a, mir-34b, mir-34c, mir-374b, mir-449a, mir-4723-5p, mir-497, mir-628-5p, mir-642a-5p, mir-765, mir-940 prostate carcinoma mir-107 renal cell carcinoma let-7a, let-7d, mir-1, mir-106a*, mir-126, mir-1285, mir-129-3p, mir- 1291, mir-133a, mir-135a, mir-138, mir-141, mir-143, mir-145, mir-182- 5p, mir-199a-3p, mir-200a, mir-205, mir-218, mir-28-5p, mir-30a, mir- 30c, mir-30d, mir-34a, mir-378, mir-429, mir-509-3p, mir-509-5p, mir- 646 renal clear cell carcinoma let-7b, let-7c, mir-138, mir-141, mir-200c, mir-204, mir-218, mir-335, mir-377, mir-506 retinoblastoma mir-101, mir-183, mir-204, mir-34a, mir-365b-3p, mir-486-3p, mir-532- 5p rhabdomyosarcoma mir-203 small cell lung cancer mir-126, mir-138, mir-27a splenic marginal zone lymphoma mir-223 squamous carcinoma mir-15a, mir-16, mir-203, mir-205, mir-375 t-cell lymphoma mir-22 thyroid cancer mir-144, mir-886-3p tongue cancer mir-15b, mir-200b uterine leiomyoma mir-197 uveal melanoma mir-137, mir-144, mir-145, mir-182, mir-34a, mir-34b, mir-34c, mir-9

(320) TABLE-US-00022 TABLE 5 Summary of microRNA/MMP linked interactions in cancer. MMP Type and target microRNA molecule Cancer type Phenotype Pathway let-7 MMP-9 Melanoma Cell proliferation and migration MMP-14, ERK1/2 Pancreatic ductal NA ERK1/2 activation, activation adenocarcinoma TGF-1 signaling Focal adhesion kinase Glioblastoma Migration and invasion AKT and ERK (FAK), AKT, ERK, MMP- 2 and MMP-9 miR-9 MMP-2, MMP-9 and Uveal melanoma Migration and invasion NF-B1 signaling VEGFA MMP-14 Neuroblastoma Invasion, metastasis, and angiogenesis miR-10b MMP-9, E-cadherin and Nasopharyngeal Proliferation, migration, vimentin carcinoma cells invasion MMP-14 and uPAR Glioma Cell invasiveness MMP-2, EGFR. Glioblastoma Apoptosis invasion and EGFR pathways multiforme migration miR-15b MMP-3 Glioma Cell invasiveness MEK-ERK pathway miR-17 MMP-3 Hepatocellular Migration and invasion p-AKT carcinoma miR-21 RECK, MMP-9 Prostate cancer NA Phospho-c-Jun, MMP-2, Hepatocellular Migration and invasion MMP-9 carcinoma RECK, MMP-2 Glioma Apoptosis, migration, and invasiveness MMP-2, EGFR. Glioblastoma Apoptosis invasion and EGFR pathways multiforme migration miR-26a MMP-2 Lung cancer Migration, invasion and AKT phosphorylation metastasis miR-29b MMP-2 Colon cancer Migration MMP-2 Hepatocellular Tumor angiogenesis, VEGFR-2-signaling carcinoma invasion, and metastasis MMP-2, Mcl-1, COL1A1, Prostate cancer invasion and metastasis and COL4A1 miR-29c MMP-2 Nerve sheath tumours Cell invasion and migration miR-30d SOCS1, phospho-STAT3, Prostate cancer Proliferation and invasion STAT3 signalling MMP-2 and MMP-9 miR-34a Fra-1, p53 MMP-1 and Colon cancer Migration and invasion MMP-9 miR-92a MMP-2 and -9 Lung cancer Migration and invasion STAT3 signaling miR-101 Enhancer of zeste homolog Lung cancer Cell invasiveness 2 (EZH2), CDH1 and MMP-2 miR-106b MMP-2 Breast cancer Migration and invasion ERK signaling cascade miR-125b MMP-2 and MMP-9 Glioblastoma Invasion miR-133 MMP-14 Lung cancer Cell proliferation, migration and invasion miR-138 RhoC, MMP-2 and MMP- Cholangiocarcinoma Proliferation, migration p-ERK signaling 9 and invasion miR-139 IGF-IR and MMP-2 Colorectal cancer Migration, invasion and IGF-IR/MEK/ERK metastasis signaling miR-143 MMP-13 Prostate cancer Migration and invasion MMP-2 and MMP-9 Pancreatic cancer Migration and invasion MMP-13 Osteosarcoma Cell invasiveness miR-145 Ets1, MMP-1 and -9 Gastric cancer Invasion, metastasis, and angiogenesis miR-146a MMP-1, uPA, and uPAR Brain cancer Migration, invasion and metastasis MMP-16 Colon cancer Invasion miR-149 M MP-2 and CyclinD1 Glioma Proliferation and invasion AKT signaling miR-152 MMP-3 Glioma Cell invasiveness MEK-ERK pathway miR-18lb MMP-2 and MMP-9 Hepatocellular Migration and invasion TGF- , Smad signaling carcinomas miR-182 MMP-9, RECK Breast cancer cell invasion and colony formation ability miR-196b Vimentin, MMP-2 and Gastric cancer Migration and invasion MMP-9 miR-203 MMP-9 and Robol Glioblastoma Proliferation, migration, ERK phosphorylation and invasion miR-206 MMP-2 and MMP-9 Breast cancer Invasion and migration miR-211 MMP-9 Glioblastoma Cell invasion and multiforme migration miR-218 LEF1, MMP-2, -7 and -9 Glioblastoma Invasion multiforme miR-218 MMP-9 Gliomas Cell invasiveness IKK-/NF-B pathway miR-224 MMP-9 via targeting Human hepatocellular Migration and invasion HOXD10 carcinoma miR-338-3p SMO and MMP-9 Hepatocellular Invasion and metastasis carcinoma miR-340 MMP-2 and MMP-9 Breast cancer Tumor cell growth, migration, and invasion miR-430 ERK, MMP-2 and MMP-9 Bladder cancer Proliferation, migration and colony formation ablility miR-451 Akt1, CyclinD1, MMP-2, Glioblastoma Proliferation, invasion PI3K/AKT signaling MMP-9 and Bcl-2 and apoptosis miR-491 MMP-9 Hepatocellular Migration carcinoma miR-491-5p MMP-9 Glioblastoma Invasion multiforme miRNA-590- PI3K, Akt, MMP-2 and Bladder cancer Proliferation, migration PI3K, Akt signaling 3p MMP-9 and colony-formation miR-874 MMP-2 and -9, Aquaporin- Human gastric cancer Cell migration and 3 invasion assays and in vivo tumorigenicity miR-874 MMP-2 and uPA Non-small cell lung Tumor cell invasiveness cancer and in vivo tumor growth miR-885-5p MMP-9 Glioblastoma Invasion multiforme

(321) TABLE-US-00023 TABLE 6 Target proteases and cancers associated with their overexpression. Family Protease Location Cancer Cysteine General Intracellular, lysosomes Most Cathepsins Cathepsin K Extracellular, bone Breast Cathepsin B Extracellular and pericellular under Breast, cervix, colon, colorectal, gastric, head pathological conditions and neck, liver, lung, melanoma, ovarian, pancreatic, prostate, thyroid Cathepsin L Breast, colorectal Aspartic Cathepsin E Endosomal structures, ER, Golgi Cervical, gastric, lung, pancreas Cathepsins adenocarcinomas Cathepsin D Lysosome Breast, colorectal, ovarian Kallikreins General Intracellular, secreted Most (hK) hK1 PSA (hK 3) Prostate, ovarian hK10 Colon, ovarian, pancreatic, head and neck hK15 Ovarian, prostate Serine uPA, uPAR Membrane, Pericellular Cervical, colorectal, gastric, prostate Proteases Caspases Intracellular MMPs General Extracellular Most MMP-1, -8, -13 Breast MMP-2, -9 Breast, colorectal, lung, malignant gliomas, ovarian MMP-14 Membrane Breast ADAM Extracellular

(322) TABLE-US-00024 TABLE 7 List of selected oncogenes associated with human malignancy Gene Malignancies associated Gene Name Locus with Comments ABL1 (ABL) 9q34.1 Chronic myeloid leukemia see tyrosine kinase Abelson murine leukemia protein ABL2 1q24- acute myeloid leukemia Member of the tyrosine kinase family. (ABLL, ARG) q25 Important for synapse assembly and remodeling AKAP13 (HT31, 15q24- breast cancer Blast crisis oncogene LBC. BRX) q25 ARAF1 Xp11.4- angioimmunoblastic Serine/threonine kinase p11.2 lymphadenopathy with dysproteinemia ARHGEF5 (TIM) 7q33- Breast cancer Codes for protein that controls q35 cytoskeletal organization through regulation of small GTP-binding proteins ATF1 12q13 ATF1/EWS fusion gene Codes for cAMP-dependent associated with malignant transcription factor-1 melanoma of soft parts (MMSP) ATF1/FUS with histiocytoma. AXL 19q13.1- Chronic myelogenous transforming gene to acute leukemia q13.2 leukemia BCL2 18q21.3 Burkitt lymphoma, follicular Mediator of apoptosis. Translocation lymphoma is marker of poorer therapeutic response BRAF (BRAF1, 7q34 Hairy cell leukemia, see proto-oncogenes RAFB1) Malignant melanoma, thyroid papillary cancer, thyroid anaplastic carcinoma, bowel cancer, adenocarcinoma of lung, non-Hogkins lymphoma BRCA1 17q21 Hereditary breast-ovarian see BRCA1. cancer syndrome. Familial Breast cancer, Papillary serous carcinoma of the peritoneum (PSCP), Prostate cancer BRCA2(FANCD1) 13q12.3 Familial Breast cancer, see BRCA2 prostate cancer, pancreatic cancer BRIP1 17q22.2 Ovarian cancer, breast cancer BRCA1 interacting protein C- terminal helicase 1 which is important in normal double-strand break repair CBL (CBL2) 11q23.3 see proto-oncogenes CSF1R (CSF-1, 5q33.2- Type M4 acute myeloblastic Codes for colony-stimulating factor-1 FMS, MCSF) q33.3 leukemia and chronic receptor, otherwise known as myelomonocytic leukemia macrophage colony-stimulating factor DAPK1 (DAPK) 9q34.1 Bladder cancer Codes for death-associated protein kinase a positive mediators of apoptosis induced by gamma- interferon. DEK (D6S231E) 6p23 DEK/NUP214(DEK/CAN) Codes for DNA binding protein fusion gene associated with involved in transcriptional regulation acute myeloid leukemia and signal transduction as a component of the splicing complex that remains associated with spliced exons. DUSP6 12q22- Non-small cell lung cancer, Codes for member of mitogen- (MKP3, PYST1) q23 pancreatic cancer activated protein (MAP) kinase family and has key role in cellular signal transduction EGF see proto-oncogenes EGFR (ERBB, see proto-oncogenes ERBB1) ERBB3 (HER3) 12q13 Non-small cell lung cancer elevated ERBB3 mRNA levels in breast cancer ERG see proto-oncogenes ETS1 see proto-oncogenes ETS2 Acute myeloid leukemia Codes for a transcription factor EWSR1 (EWS, 22q12 EWS/ERG in Ewing sarcoma, Ewing sarcoma breakpoint 1 gene ES, PNE,) esthesioneuroblastoma EWS/FEV fusion gene in Ewing sarcoma, EWS/ZNF278 in small round cell sarcoma, EWS/FLI1 in Ewing sarcoma, EWS/ATF1 in malignant melanoma of soft parts (MMSP) EWS/WT1 in desmoplastic small round cell tumor FES (FPS) 15q26.1 B cell lymphoma, acute Codes for a tyrosine-specific protein promyelocytic leukemia, kinase with a role in regulating bladder carcinoma, lung immune response cancer, breast cancer, colon cancer, neuroblastoma, pre-B lymphocyte neoplasm, plasmacytoma, multiple myeloma, T cell lymphoma, sarcoma FGF4 (HSTF1, 11q13 Stomach cancer, kaposi A fibroblast growth factor Important KFGF) sarcoma in limb development. FGFR1 see proto-oncogenes FGFR10P (FOP) 6q27 FGFR1/FGFR10P2 fusion gene in non-Hodgkin lymphoma FLCN 17p11.2 Renal cancer, bowel cancer see FFCN FOS (c-fos) 14q24.3 see proto-oncogenes FRAP1 see tumor suppressors FUS (TLS) 16p11.2 see proto-oncogenes HRAS 11p15.5 see proto-oncogenes. GLI1 12q13.2- Glioma, myxoid liposarcoma, Codes for a Kruppel (Kr) zinc finger q13.3 salivary gland tumor protein GLI2 2q14 Glioma Codes for a Kruppel (Kr) zinc finger protein GPC3 Xq26 Germ cell cancer, see GPC3 Hepatocellular cancer HER2 (ERBB2, 17q21.1 Breast cancer, lung cancer see HER2. Targeted by Trastuzumab. TKR1, NEU) HGF (SF) 7q21.1 Prostate cancer, renal cancer Codes for hepatocyte growth factor (hepatopoietin A, scatter factor) which is upregulated in many malignancies IRF4 (LSIRF, 6p25- B-cell lymphoma, B-cell Codes for an interferon regulatory MUM1) p23 leukemia, Multiple myeloma factor essential for lymphocyte function JUNB 19p13.2 see proto-oncogenes KIT(SCFR) 4q12 Gastrointestinal stromal tumor Transmembrane tyrosine kinase (GISTs), mast cell leukemia, receptor for stem cell factor (SCFR) mastocytosis, seminoma and is required for haematopoiesis, dysgerminoma melanogenesis and gametogenesis. Mutations cause piebaldism. KRAS2 (RASK2) 12p12.1 see proto-oncogenes. LCK 1p35- Non-small cell lung cancer, codes for lymphocyte specific protein p34.3 Neuroblastoma, non-Hodgkin tyrosine kinase lymphoma LCO 2q14- Hepatocellular carcinoma q21 MAP3K8(TPL2, 10p11.2 Ewings sarcoma, Codes for a serine-threonine protein COT, EST) adenocarcinoma of lung, kinase. thyroid carcinoma MCF2 (DBL) Xq27 Breast cancer Codes for a GDP-GTP exchange factor that modulates the activity of small GTPases of the Rho family MDM2 12q14.3- Multiple MDM2 acts as a major regulator of q15 the tumor suppressor p53 by targeting its destruction. Direct association of p53 with the protein MDM2 results in ubiquitination and subsequent degradation of p53 MET(HGFR, 7q31 see proto-oncogenes RCCP2) MLH type genes see proto-oncogenes MMD 17q Non small cell lung cancer, Codes for monocyte to macrophage hepatocellular carcinoma, differentiation associated protein. colon cancer MOS (MSV) 8q11 Burkitt lymphoma, acute Function in man unknown. Above myeloblastic leukemia associations indirect but analogous gene to Moloney murine sarcoma virus. MRAS (RRAS3) 3q22.3 Activated in many tumors Codes for a RAS GTP-binding protein membrane-anchored, intracellular signal transducer MSH type genes see proto-oncogenes MYB (AMV) 6q22 Alterations found in more Encodes for proteins critical to than a third of human solid hematopoietic cell proliferation and tumor lines development MYC 8q24.12- Burkitt lymphoma Over A transcription factor that promotes q24.13 expression in many cell proliferation malignancies, possibly associated with angiogenic, invasive promoting properties in excess. MYCL1 (LMYC) 1p34.3 Small cell lung cancer, adenocarcinoma of lung, neuroblastoma MYCN 2p24.1 Neuroblastomas Overlaps with NMYC and is transcribed from opposite DNA strand NCOA4 (ELE1, 10q11.2 Prostate cancer Interacts with the androgen receptor ARA70, PTC3) in presence of dihydrotestosterone. NF1 type genes see tumor suppressors NMYC 2p24 Neuroblastomas, Overlaps with MYCN and is retinoblastoma transcribed from opposite DNA strand. Probably a DNA-binding protein. NRAS 1p13.2 see proto-oncogenes. NTRK1 (TRK, 1q21- see proto-oncogenes. TRKA) q22 NUP214 (CAN, 9q34.1 NUP214/DEK fusion gene Codes for nucleoporin component of D9546E) associated with acute myeloid the vertebrate nuclear pore complex. leukemia, NUP214/ABL1 associated with T-cell acute lymphoblastic leukemia (T- ALL). OVC 9p24 Ovarian adenocarcinoma Abnormal in about 40% ovarian adenocarcinoma TP53 (P53) 17p13.1 see tumor suppressors PALB2 16p12 Breast cancer see PALB2 PAX3 (HUP2) 2q35 Alveolar rhabdomyosarcoma Transcriptions factor, causes some STAT1 forms of Waardenburg syndrome and regulates RET. PDGFB (SIS) see proto-oncogenes PIM genes see proto-oncogenes PML (MYL) 15q22 see tumour suppressors PMS (PMSL) see tumour suppressors genes PPM1D (WIP1) 17q22- Breast cancer, Osteosarcoma Codes for a serine/threonine protein q23 phosphatase that attenuates apoptosis and facilitates transformation of primary cells in cooperation with RAS PTEN (MMAC1) 10q23.31 see tumor suppressors PVT1 8q24 Burkitt lymphoma RAF1 (CRAF) 3p25 Stomach cancer, renal cancer, A regulator of endothelial cell glioblastoma, laryngeal survival during angiogenesis. cancer Activated RAF counteracts apoptosis by suppressing the activation of mammalian sterile 20-like kinase (MST2). RB1 (RB) 13q14.1- Retinoblastoma, osteogenic see RB1 q14.2 sarcoma, small cell carcinoma of lung, bladder cancer RET 10q11.2 Multiple endocrine neoplasia see RET type 2a and 2b and Medullary thyroid carcinoma RRAS2 (TC21) 11pter- Teratocarcinoma, ovarian Single point mutation activates its p15.5 cancer oncogene potential ROS1 (ROS, 6q22 Glioblastoma and probably ROS1/FIG fusion protein is a tyrosine MCF3) others kinase found in astrocytoma SMAD type genes see tumor suppressors SMARCB1 22q11 see tumor suppressors (SNF5, INI1 SMURF1 7q21.1- Pancreatic cancer Codes for a HECT domain E3 q31.1 ubiquitin ligase that regulates tumor cell plasticity and motility through degradation of RhoA SRC (AVS) 20q12- hepatic metastatic bowel Intracellular communication regulator q13 cancer, colon cancer, protein. Mutations are activating, leukemia transforming, tumorigenic, and metastasis-promoting STAT1 2q32.2- Non-small cell lung cancer see STAT1 q32.3 STAT3 17q21 Epithelial cancers Codes signal protein that induces cell transformation through a combined inhibition of apoptosis and cell-cycle activation STAT5 17q11.2 Permissive for a wide range Codes signal protein that induces cell of malignancies transformation through a combined inhibition of apoptosis and cell-cycle activation TDGF1 (CRGF) 3p23- teratocarcinoma Probably codes for signaling protein p21 for mesoderm development TGFBR2 3p22 see proto-oncogenes THRA (ERBA, see proto-oncogenes EAR7 etc) TFG (TRKT3) 3q11- Papillary thyroid carcinoma Chimeric oncogene with NTRK1 q12 proto-oncogene TIF1 (TRIM24, 7q32- Fusion genes associated with Codes for transcriptional intermediary TIF1A) q34 papillary thyroid carcinoma factor 1 and myleoproliferative disorder. TNC (TN, HXB) 9q33 Neurofibromatosis type 1, see TNC Pancreatic cancer TRK 1q21- see proto-oncogenes q22 TUSC3 8p22 see tumor suppressors USP6 (TRE2) 17p13 Multiple cancers Codes for a ubiquitin-specific protease found only in primates WNT1 (INT1) 12q12- see proto-oncogenes q13 WT1 11p13 Wilms tumour, over A zinc finger DNA-binding protein expressed in breast and lung acting as a transcriptional activator or cancer, myelodysplastic repressor depending on intracellular syndrome and acute myeloid context leukemia VHL 3p26- see tumor suppressors p25

(323) TABLE-US-00025 TABLE 8 Tumor suppresor miRs that are downregulated in specific cancer types Cancer miRNA Bladder mir-1; mir-101; mir-1180; mir-1236; mir-124-3p; mir-125b; mir-126; mir-1280; mir-133a; mir-133b; mir-141; mir-143; mir-144; mir-145; mir-155; mir-16; mir-18a; mir-192; mir-195; mir-200a; mir-200b; mir-200c; mir-203; mir-205; mir-214; mir-218; mir-23b; mir-26a; mir-29c; mir-320c; mir-34a; mir-370; mir- 409-3p; mir-429; mir-451; mir-490-5p; mir-493; mir-576-3p; mir-99a Brain let-7g-5p; mir-100; mir-101; mir-106a; mir-124; mir-124a; mir-125a; mir-125a- (Astrocytoma, 5p; mir-125b; mir-127-3p; mir-128; mir-129; mir-136; mir-137; mir-139-5p; Glioblastoma, mir-142-3p; mir-143; mir-145; mir-146b-5p; mir-149; mir-152; mir-153; mir- Glioma) 195; mir-21; mir-212-3p; mir-219-5p; mir-222; mir-29b; mir-31; mir-3189-3p; mir-320; mir-320a; mir-326; mir-330; mir-331-3p; mir-340; mir-342; mir-34a; mir-376a; mir-449a; mir-483-5p; mir-503; mir-577; mir-663; mir-7; mir-7-5p; mir-873; let-7a; let-7f; mir-107; mir-122; mir-124-5p; mir-139; mir-146a; mir- 146b; mir-15b; mir-16; mir-181a; mir-181a-1; mir-181a-2; mir-181b; mir-181b- 1; mir-181b-2; mir-181c; mir-181d; mir-184; mir-185; mir-199a-3p; mir-200a; mir-200b; mir-203; mir-204; mir-205; mir-218; mir-23b; mir-26b; mir-27a; mir-29c; mir-328; mir-34c-3p; mir-34c-5p; mir-375; mir-383; mir-451; mir- 452; mir-495; mir-584; mir-622; mir-656; mir-98; mir-124-3p; mir-181b-5p; mir-200b; mir-3189-3p Breast mir-193b; let-7a; let-7a-1; let-7a-2; let-7a-3; let-7b; let-7c; let-7d; let-7e; let-7f- 1; let-7f-2; let-7g; let-7i; mir-100; mir-107; mir-10a; mir-10b; mir-122; mir- 124; mir-1258; mir-125a-5p; mir-125b; mir-126; mir-127; mir-129; mir-130a; mir-132; mir-133a; mir-143; mir-145; mir-146a; mir-146b; mir-147; mir-148a; mir-149; mir-152; mir-153; mir-15a; mir-16; mir-17-5p; mir-181a; mir-1826; mir-183; mir-185; mir-191; mir-193a-3p; mir-195; mir-199b-5p; mir-19a-3p; mir-200a; mir-200b; mir-200c; mir-205; mir-206; mir-211; mir-216b; mir-218; mir-22; mir-26a; mir-26b; mir-300; mir-30a; mir-31; mir-335; mir-339-5p; mir- 33b; mir-34a; mir-34b; mir-34c; mir-374a; mir-379; mir-381; mir-383; mir- 425; mir-429; mir-450b-3p; mir-494; mir-495; mir-497; mir-502-5p; mir-517a; mir-574-3p; mir-638; mir-7; mir-720; mir-873; mir-874; mir-92a; mir-98; mir- 99a; mmu-mir-290-3p; mmu-mir-290-5p Cervical mir-143; mir-145; mir-17-5p; mir-203; mir-214; mir-218; mir-335; mir-342-3p; mir-372; mir-424; mir-491-5p; mir-497; mir-7; mir-99a; mir-99b; mir-100; mir- 101; mir-15a; mir-16; mir-34a; mir-886-5p; mir-106a; mir-124; mir-148a; mir- 29a; mir-375 Colon/Colorectal let-7a-1; let-7a-2; let-7a-3; let-7b; let-7c; let-7d; let-7e; let-7f-1; let-7f-2; let-7g; let-7i; mir-100; mir-101; mir-126; mir-142-3p; mir-143; mir-145; mir-192; mir- 200c; mir-21; mir-214; mir-215; mir-22; mir-25; mir-302a; mir-320; mir-320a; mir-34a; mir-34c; mir-365; mir-373; mir-424; mir-429; mir-455; mir-484; mir- 502; mir-503; mir-93; mir-98; mir-186; mir-30a-5p; mir-627; let-7a; mir-1; mir- 124; mir-125a; mir-129; mir-1295b-3p; mir-1307; mir-130b; mir-132; mir- 133a; mir-133b; mir-137; mir-138; mir-139; mir-139-5p; mir-140-5p; mir-148a; mir-148b; mir-149; mir-150-5p; mir-154; mir-15a; mir-15b; mir-16; mir-18a; mir-191; mir-193a-5p; mir-194; mir-195; mir-196a; mir-198; mir-199a-5p; mir- 203; mir-204-5p; mir-206; mir-212; mir-218; mir-224; mir-24-3p; mir-26b; mir-27a; mir-28-3p; mir-28-5p; mir-29b; mir-30a-3p; mir-30b; mir-328; mir- 338-3p; mir-342; mir-345; mir-34a-5p; mir-361-5p; mir-375; mir-378; mir- 378a-3p; mir-378a-5p; mir-409-3p; mir-422a; mir-4487; mir-483; mir-497; mir- 498; mir-518a-3p; mir-551a; mir-574-5p; mir-625; mir-638; mir-7; mir-96-5p; mir-202-3p; mir-30a; mir-451 Endometrial mir-101; mir-130a; mir-130b; mir-134; mir-143; mir-145; mir-152; mir-205; mir-223; mir-301a; mir-301b; mir-30c; mir-34a; mir-34c; mir-424; mir-449a; mir-543; mir-34b Hematologic mir-125b; mir-138; mir-15a; mir-15b; mir-16; mir-16-1; mir-16-1-3p; mir-16-2; (Leukemia, mir-181a; mir-181b; mir-195; mir-223; mir-29b; mir-34b; mir-34c; mir-424; mir-10a; mir-146a; mir-150; mir-151; mir-155; mir-2278; mir-26a; mir-30e; Lymphoma, mir-31; mir-326; mir-564; mir-27a; let-7b; mir-124a; mir-142-3p; let-7c; mir- Myeloma) 17; mir-20a; mir-29a; mir-30c; mir-720; mir-107; mir-342; mir-34a; mir-202; mir-142-5p; mir-29c; mir-145; mir-193b; mir-199a; mir-214; mir-22; mir-137; mir-197 Kidney mir-1; mir-145; mir-1826; mir-199a; mir-199a-3p; mir-203; mir-205; mir-497; mir-508-3p; mir-509-3p; let-7a; let-7d; mir-106a*; mir-126; mir-1285; mir-129- 3p; mir-1291; mir-133a; mir-135a; mir-138; mir-141; mir-143; mir-182-5p; mir-200a; mir-218; mir-28-5p; mir-30a; mir-30c; mir-30d; mir-34a; mir-378; mir-429; mir-509-5p; mir-646; mir-133b; let-7b; let-7c; mir-200c; mir-204; mir-335; mir-377; mir-506 Liver mir-137; mir-138; mir-139; mir-139-5p; mir-140-5p; mir-141; mir-142-3p; mir- (Hepatocellular 143; mir-144; mir-145; mir-146a; mir-148a; mir-148b; mir-150-5p; mir-15b; Carcinoma) mir-16; mir-181a-5p; mir-185; mir-188-5p; mir-193b; mir-195; mir-195-5p; mir-197; mir-198; mir-199a; mir-199a-5p; mir-199b; mir-199b-5p; mir-200a; mir-200b; mir-200c; mir-202; mir-203; mir-204-3p; mir-205; mir-206; mir-20a; mir-21; mir-21-3p; mir-211; mir-212; mir-214; mir-217; mir-218; mir-219-5p; mir-22; mir-223; mir-26a; mir-26b; mir-29a; mir-29b-1; mir-29b-2; mir-29c; mir-302b; mir-302c; mir-30a; mir-30a-3p; mir-335; mir-338-3p; mir-33a; mir- 34a; mir-34b; mir-365; mir-370; mir-372; mir-375; mir-376a; mir-377; mir- 422a; mir-424; mir-424-5p; mir-433; mir-4458; mir-448; mir-450a; mir-451; mir-485-5p; mir-486-5p; mir-497; mir-503; mir-506; mir-519d; mir-520a; mir- 520b; mir-520c-3p; mir-582-5p; mir-590-5p; mir-610; mir-612; mir-625; mir- 637; mir-675; mir-7; mir-877; mir-940; mir-941; mir-98; mir-99a; mir-132; mir-31 Lung mir-1297; mir-141; mir-145; mir-16; mir-200a; mir-200b; mir-200c; mir-29b; mir-381; mir-409-3p; mir-429; mir-451; mir-511; mir-99a; let-7a-1; let-7a-2; let-7a-3; let-7b; let-7c; let-7d; let-7e; let-7f-1; let-7f-2; let-7g; let-7i; mir-1; mir- 101; mir-133b; mir-138; mir-142-5p; mir-144; mir-1469; mir-146a; mir-153; mir-15a; mir-15b; mir-16-1; mir-16-2; mir-182; mir-192; mir-193a-3p; mir- 194; mir-195; mir-198; mir-203; mir-217; mir-218; mir-22; mir-223; mir-26a; mir-26b; mir-29c; mir-33a; mir-34a; mir-34b; mir-34c; mir-365; mir-449a; mir- 449b; mir-486-5p; mir-545; mir-610; mir-614; mir-630; mir-660; mir-7515; mir-9500; mir-98; mir-99b; mir-133a; let-7a; mir-100; mir-106a; mir-107; mir- 124; mir-125a-3p; mir-125a-5p; mir-126; mir-126*; mir-129; mir-137; mir-140; mir-143; mir-146b; mir-148a; mir-148b; mir-149; mir-152; mir-154; mir-155; mir-17-5p; mir-181a-1; mir-181a-2; mir-181b; mir-181b-1; mir-181b-2; mir- 181c; mir-181d; mir-184; mir-186; mir-193b; mir-199a; mir-204; mir-212; mir- 221; mir-224; mir-27a; mir-27b; mir-29a; mir-30a; mir-30b; mir-30c; mir-30d; mir-30d-5p; mir-30e-5p; mir-32; mir-335; mir-338-3p; mir-340; mir-342-3p; mir-361-3p; mir-373; mir-375; mir-4500; mir-4782-3p; mir-497; mir-503; mir- 512-3p; mir-520a-3p; mir-526b; mir-625*; mir-96 Melanoma let-7b; mir-101; mir-125b; mir-1280; mir-143; mir-146a; mir-146b; mir-155; mir-17; mir-184; mir-185; mir-18b; mir-193b; mir-200c; mir-203; mir-204; mir-205; mir-206; mir-20a; mir-211; mir-218; mir-26a; mir-31; mir-33a; mir- 34a; mir-34c; mir-376a; mir-376c; mir-573; mir-7-5p; mir-9; mir-98 Oral Cancer let-7d; mir-218; mir-34a; mir-375; mir-494; mir-100; mir-124; mir-1250; mir- 125b; mir-126; mir-1271; mir-136; mir-138; mir-145; mir-147; mir-148a; mir- 181a; mir-206; mir-220a; mir-26a; mir-26b; mir-29a; mir-32; mir-323-5p; mir- 329; mir-338; mir-370; mir-410; mir-429; mir-433; mir-499a-5p; mir-503; mir- 506; mir-632; mir-646; mir-668; mir-877; mir-9 Ovarian let-7i; mir-100; mir-124; mir-125b; mir-129-5p; mir-130b; mir-133a; mir-137; mir-138; mir-141; mir-145; mir-148a; mir-152; mir-153; mir-155; mir-199a; mir-200a; mir-200b; mir-200c; mir-212; mir-335; mir-34a; mir-34b; mir-34c; mir-409-3p; mir-411; mir-429; mir-432; mir-449a; mir-494; mir-497; mir-498; mir-519d; mir-655; mir-9; mir-98; mir-101; mir-532-5p; mir-124a; mir-192; mir-193a; mir-7 Pancreatic mir-101; mir-1181; mir-124; mir-1247; mir-133a; mir-141; mir-145; mir-146a; mir-148a; mir-148b; mir-150*; mir-150-5p; mir-152; mir-15a; mir-198; mir- 203; mir-214; mir-216a; mir-29c; mir-335; mir-34a; mir-34b; mir-34c; mir-373; mir-375; mir-410; mir-497; mir-615-5p; mir-630; mir-96; mir-132; let-7a; let- 7a-1; let-7a-2; let-7a-3; let-7b; let-7c; let-7d; let-7e; let-7f-1; let-7f-2; let-7g; let-7i; mir-126; mir-135a; mir-143; mir-144; mir-150; mir-16; mir-200a; mir- 200b; mir-200c; mir-217; mir-218; mir-337; mir-494; mir-98 Prostate let-7a-3p; let-7c; mir-100; mir-101; mir-105; mir-124; mir-128; mir-1296; mir- 130b; mir-133a-1; mir-133a-2; mir-133b; mir-135a; mir-143; mir-145; mir- 146a; mir-154; mir-15a; mir-187; mir-188-5p; mir-199b; mir-200b; mir-203; mir-205; mir-212; mir-218; mir-221; mir-224; mir-23a; mir-23b; mir-25; mir- 26a; mir-26b; mir-29b; mir-302a; mir-30a; mir-30b; mir-30c-1; mir-30c-2; mir- 30d; mir-30e; mir-31; mir-330; mir-331-3p; mir-34a; mir-34b; mir-34c; mir- 374b; mir-449a; mir-4723-5p; mir-497; mir-628-5p; mir-642a-5p; mir-765; mir-940 Retinoblastoma mir-101; mir-183; mir-204; mir-34a; mir-365b-3p; mir-486-3p; mir-532-5p