CHIMERIC SWITCH RECEPTORS IN NK CELLS

Abstract

Multiple myeloma (MM) is an incurable hematological cancer, in which immune checkpoint inhibition (ICI) with monoclonal antibodies (mAbs) has failed due to uncontrollable immune responses in combination therapies and lack of efficacy in monotherapies. NK cells have effector activity within the TME, under continuous ligand exposure. NK cell dysfunctionality may occur due to interaction of PD1 and its ligand PD-L1. We created NK cell specific PD1-based chimeric switch receptors (PD1-CSR) by employing signaling domains of DAP10, DAP12 and CD3 to revert NK cell inhibition and retarget ICI. PD1-CSR modified NK cells showed increased degranulation, cytokine secretion and cytotoxicity upon recognition of PDL1+ target cells.

Claims

1. An NK cell specific PD1-based chimeric switch receptor.

2. An NK cell comprising the chimeric switch receptor of claim 1, which chimeric switch receptor optionally contains at least one signaling domain from DAP10, DAP12, NKp46 or CD3.

3. The NK cell of claim 2 wherein the chimeric switch receptor comprises amino acids 1-170 of PD1 (SEQ ID NO: 2), an 85 amino acid long hinge region (SEQ ID NO 3), amino acids 153-220 of CD28 (SEQ ID NO: 4) and amino acids 52-164 of the CD3 protein (SEQ ID NO: 5).

4. The NK cell of claim 2 wherein the chimeric switch receptor comprises amino acids 1-170 of PD1 (SEQ ID NO 2) fused together with amino acids 239-304 of the NKp46 protein (SEQ ID NO 7).

5. The NK cell of claim 2 wherein the chimeric switch receptor comprises amino acids 1 to 170 of PD1 (SEQ ID NO: 2) fused to full length DAP10 (AA 19-93) (SEQ ID NO: 6).

6. The NK cell of claim 2 wherein the chimeric switch receptor comprises amino acids 1 to 170 of PD1 (SEQ ID NO: 2) fused to the full length DAP12 (AA 22-113) (SEQ ID NO: 7) protein.

7. The NK cell of claim 2 wherein the chimeric switch receptor comprises amino acids 1 to 212 of PD1 (SEQ ID NO: 11) fused together with AA 77-93 of DAP10 (SEQ ID NO: 12)

8. The NK cell of claim 2 wherein the chimeric switch receptor comprises amino acids 1 to 212 of PD1 (SEQ ID NO: 11) fused together with amino acids 73-113 of DAP12 (SEQ ID NO 13).

9. The NK cell of claim 2 wherein the chimeric switch receptor comprises a signaling domain and the signaling domain is truncated, preferably wherein the signaling domain is truncated to omit the transmembrane region.

10. The NK cell of claim 2 wherein the chimeric switch receptor comprises amino acids 52-164 of the CD3 protein (SEQ ID NO: 5).

11. The NK Cell of claim 2 wherein the chimeric switch receptor comprises amino acids 239-304 of the NKp46 protein (SEQ ID NO 7).

12. The NK cell of claim 2 wherein the NK cell comprises the DAP 10 construct of SEQ ID NO 14.

13. The NK cell of claim 2 wherein the NK cell comprises the DAP 12 construct of SEQ ID NO 15.

14. The NK cell of claim 2 wherein the NK cell comprises the DAP 10 construct of SEQ ID NO 16.

15. The NK cell of claim 2 wherein the NK cell comprises the DAP 12 construct of SEQ ID NO 17.

16. A method of treating multiple myeloma in a patient in need thereof comprising administering an NK cell specific PD1-based chimeric switch receptor.

17. The method of claim 16 wherein the chimeric switch receptor comprises at least one signaling domain from DAP10, DAP12, NKp46 or CD3.

18. The method of claim 17 wherein the chimeric switch receptor comprises amino acids 1-170 of PD1 (SEQ ID NO: 2), an 85 amino acid long hinge region (SEQ ID NO 3), amino acids 153-220 of CD28 (SEQ ID NO: 4) and amino acids 52-164 of the CD3 protein (SEQ ID NO: 5).

19. The method of claim 17 wherein the chimeric switch receptor comprises amino acids 1-170 of PD1 (SEQ ID NO 2) fused together with amino acids 239-304 of the NKp46 protein (SEQ ID NO 7).

20. The method of claim 17 wherein the chimeric switch receptor comprises amino acids 1 to 170 of PD1 (SEQ ID NO: 2) fused to the full length DAP10 (AA 19-93) (SEQ ID NO: 6).

21. The method of claim 17 wherein the chimeric switch receptor comprises amino acids 1 to 170 of PD1 (SEQ ID NO: 2) fused to the full length DAP12 (AA 22-113) (SEQ ID NO: 7) protein.

22. The method of claim 17 wherein the chimeric switch receptor comprises amino acids 1 to 212 of PD1 (SEQ ID NO: 11) fused together with amino acids 77-93 of DAP10 (SEQ ID NO: 12).

23. The method of claim 17 wherein the chimeric switch receptor comprises amino acids 1 to 212 of PD1 (SEQ ID NO: 11) fused together with amino acids 73-113 of DAP12 (SEQ ID NO 13).

24. The method of claim 17 wherein the signaling domain is truncated to omit the transmembrane region.

25. The method of claim 17 wherein the chimeric switch receptor comprises amino acids 52-164 of the CD3 protein (SEQ ID NO: 5).

26. The method of claim 17 wherein the chimeric switch receptor comprises amino acids 239-304 of the NKp46 protein (SEQ ID NO 7).

27. The method of claim 17 wherein the chimeric switch receptor comprises the DAP 10 construct of SEQ ID NO 14.

28. The method of claim 17 wherein the chimeric switch receptor comprises the DAP 12 construct of SEQ ID NO 15.

29. The method of claim 17 wherein the chimeric switch receptor comprises the DAP 10 construct of SEQ ID NO 16.

30. The method of claim 17 wherein the chimeric switch receptor comprises the DAP 12 construct of SEQ ID NO 17.

31. A genetic engineering construct comprising SEQ ID NO 5, SEQ ID NO 7, SEQ ID NO 14, SEQ ID NO 15, SEQ ID NO 16, or SEQ ID NO 17.

32. A nucleic acid encoding an NK cell specific PD1-based chimeric switch receptor.

33. A cell comprising a nucleic acid encoding an exogenous chimeric switch receptor.

34. The cell of claim 33, wherein the chimeric switch receptor comprises at least one signaling domain from DAP10, DAP12, NKp46 or CD3.

Description

DESCRIPTION OF THE FIGURES

[0015] FIGS. 1A-F are Table and Vector Maps and graphs showing that PD1-based chimeric switch receptors are stably expressed in NK-92 cells.

[0016] FIGS. 2A-B are graphs showing that PD1-CSR.sup.+ NK-92 cells increase degranulation, cytokine production and killing of PD-L1.sup.+ target cells.

[0017] FIGS. 3A-G are images and graphs showing PD1-CSR.sup.+ NK-92 cells increase cytotoxicity against PD-L1.sup.+ tumor spheroids.

[0018] FIGS. 4A-I show graphs showing PD1-CSR.sup.+ pNK cells increase degranulation and cytokine production against PD-L1.sup.+ target cells.

[0019] FIGS. 5A-M are graphs showing that PD1-CSR.sup.+ pNK cells increase degranulation and cytokine production against PD-L1.sup.+ autologous tumor samples.

[0020] FIGS. 6A-B are flow cytometry plots showing the expression of ligands for activating NK cell receptors are not altered on target cell lines.

[0021] FIGS. 7A-D are graphs showing PD1-CSR.sup.+ NK-92 cells increase degranulation and cytokine production against PD-L1.sup.+ target cells.

[0022] FIGS. 8A-E are graphs showing that NK-92 cells stably express PD1-CSR and show no differences in PD-L1 independent degranulation.

[0023] FIGS. 9A-E are graphs showing that PD1-CSR.sup.+ NK-92 cells do not increase killing of PD-L1.sup.+ Raji cells.

[0024] FIGS. 10A-E are graphs showing that PD1-CSR.sup.+ NK-92 increase killing of tumor spheroids, but do not show altered proliferation.

[0025] FIG. 11 consists of graphs showing the expression of activating and inhibitory NK cell receptors on PD1-CSR.sup.+ pNK compared to unmodified pNK cells.

[0026] FIGS. 12A-L are graphs showing PD1-CSR.sup.+ pNK cells increase degranulation against PD-L1.sup.+ Raji cells with and without the addition of Rituximab.

[0027] FIGS. 13A-F are graphs showing that PD1-CSR-PD1.sup.dim pNK cells do not increase degranulation towards PD-L1.sup.+ Raji cells.

[0028] FIGS. 14A-C are graphs showing PD1-CSR.sup.+ pNK cells do not impact target cell killing but maintain proliferation compared to PD1.sup.+ WT cells.

[0029] FIGS. 15A-B are graphs showing that CD38.sup.+CD138.sup.+ malignant plasma cells express ligands for activating NK cell receptors.

[0030] FIG. 16 is A map of the vector LeGO_MCS-GSG-T2A-eGFP

DETAILED DESCRIPTION OF THE INVENTION

[0031] Multiple myeloma (MM) is an incurable hematological cancer, in which immune checkpoint inhibition (ICI) with monoclonal antibodies (mAbs) has failed due to uncontrollable immune responses in combination therapies and lack of efficacy in monotherapies. Although NK cell specific checkpoint targets such as NKG2A and KIRs are currently being evaluated in clinical trials, the clinical impact of NK cells on the PD1 cascade is less well understood compared to T cells. Furthermore, while NK cells have effector activity within the TME, under continuous ligand exposure, NK cell dysfunctionality may occur due to interaction of PD1 and its ligand PD-L1. Due to abovementioned factors, we designed novel NK cell specific PD1-based chimeric switch receptors (PD1-CSR) by employing signaling domains of DAP10, DAP12 and CD3 to revert NK cell inhibition and retarget ICI. PD1-CSR modified NK cells showed increased degranulation, cytokine secretion and cytotoxicity upon recognition of PD-L1.sup.+ target cells. Additionally, PD1-CSR.sup.+ NK cells infiltrated and killed tumor spheroids. While primary NK cells (pNK), expressing native PD1, showed decreased degranulation and cytokine production against PD-L1.sup.+ target cells by two-fold, PD1-CSR.sup.+ pNK cells demonstrated increased activity upon PD-L1.sup.+ target cell recognition and enhanced antibody-dependent cellular cytotoxicity. PD1-CSR.sup.+ pNK cells from patients with MM increased degranulation and cytokine expression against autologous CD138.sup.+PD-L1.sup.+ malignant plasma cells. Taken together, the present results demonstrate that PD1-CSR.sup.+ NK cells enhance and sustain potent anti-tumor activity in a PD-L1.sup.+ microenvironment and thus represent a promising strategy to advance adoptive NK cell-based immunotherapies towards PD-L1.sup.+ cancers.

Methods

Cells

[0032] All cell lines were purchased from ATCC. The B cell lymphoma cell line Raji (ATCC CCL-86) and the renal cell carcinoma cell line 786-0 (ATCC CRL-1932) were maintained in RPMI medium (Gibco), supplemented with 10% FBS (Gibco). NK-92 cells (ATCC CRL-2407) were maintained in SCGM (CellGenix), supplemented with 20% FBS (Gibco). Cell lines were split every 2-3 days. Interleukin-2 (R&D) was added at a final concentration of 500 U/ml to the cell culture medium of NK-92 cells.

PBMC and Primary NK Cell Isolation and Culture

[0033] Peripheral blood mononuclear cells (PBMCs) were obtained from buffy coats.

[0034] According to institutional guidelines ethical permits were not required for healthy donors due to de-identification of donors. Ethical permits were granted for work with patient derived PBMCs and bone marrow samples (permit numbers: 2019-04973 and 2020-02119). PBMC isolation was performed with LymphoPrep (Fresenius Kabi) according to the manufacturer's recommendations. Isolated PBMCs were cultured in SCGM medium (CellGenix), supplemented with 5% human serum (Biowittaker). CD3 Ab (Miltenyi, clone OKT3) was added to the culture at a final concentration of 10 ng/ml on the day of isolation. Interleukin (IL)-2 (R&D) was added to the culture at a final concentration of 500 U/ml on days 1 to 4 (daily), and then five times/week. pNK cells were isolated from PBMCs by negative selection and magnetic separation according to the manufacturer's recommendations (Miltenyi, 130-092-657). pNK cells were cultured in SCGM medium (CellGenix), supplemented with 10% human serum. IL-21 (ImmunoTools) was added on the day of isolation at a concentration of 20 ng/ml. IL-2 (R&D) was added daily to the culture at a final concentration of 1,000 U/ml.

[0035] Isolation of bone marrow mononuclear cells (BM MNC)

[0036] Bone marrow aspirates were obtained from patients with MM after obtaining informed consent and according to our ethical permit (permit numbers: 2019-04973 and 2020-02119). BM MNC were isolated using Ficoll-Paque (Sigma-Aldrich) according to the manufacturer's recommendations. Isolated BM MNC were passaged in RPMI medium (Gibco), supplemented with 10% FBS (Gibco).

Generation of Chimeric Switch Receptors

[0037] For the generation of PD1-based CSR, the canonical human cDNA sequence was used without further modification or codon optimization. A truncated version of PD1 (amino acid (AA) 1-211) (SEQ ID NO: 1), which lacks the intracellular signaling domains, was designed and is hereafter referred to as PD1.sub.EC-TM CSR. The PD1-CD28-CD3 CSR consists of AA 1-170 of PD1 (SEQ ID NO: 2), an 85AA long hinge region, (SEQ ID NO 3) the AA sequence 153-220 of CD28 (SEQ ID NO: 4) and AA 52-164 of the CD3 protein (SEQ ID NO: 5). PD1-CD28-CD3 CSR is shown in SEQ ID NO: 6. For the PD1-NKp46 CSR, PD1 AA 1-170 (SEQ ID NO 2) was fused together with AA 239-304 of the NKp46 protein (SEQ ID NO 7). PD1-NKp46 CSR is shown as SEQ ID NO: 8). NKp46 lacks an intracellular signaling domain but can associate with ITAM-bearing CD3 homodimers or CD3/FcRI heterodimers through oppositely charged residues within the transmembrane region [19]. In the PD1.sub.EcDAP10.sub.TM-IC and PD1.sub.EcDAP12.sub.TM-IC constructs, PD1 protein from AA 1 to 170 (SEQ ID NO: 2) was fused to the full length DAP10 (AA 19-93) (SEQ ID NO: 9) or DAP12 (AA 22-113) (SEQ ID NO: 10) protein. In the PD1.sub.EC-TMDAP10.sub.IC and PD1.sub.EC-TMDAP12.sub.IC CSR the PD1 AA sequence 1 to 212 (SEQ ID NO: 11) was fused together with AA 77-93 of DAP10 (SEQ ID NO: 12) or AA 73-113 of DAP12 (SEQ ID NO 13). PD1.sub.EC-TMDAP10.sub.IM-IC is shown in SEQ ID NO: 14 PD1.sub.EcDAP12.sub.TM-IC is shown in SEQ ID NO: 15. PD1.sub.EC-TMDAP10.sub.IC is shown in SEQ ID NO 16 and PD1.sub.EC-TMDAP12.sub.IC is shown in SEQ ID NO: 17. The designed constructs were cloned into the LeGoiG2 or LeGo_T2A-eGFP vector, upstream of the IRES or T2A under the control of the SFFV promoter. The LeGo_T2A-eGFP vector was designed by replacing the IRES of the LeGoG2 vector with a T2A sequence (LeGO-iG2 and LeGo-G2 were a kind gift from Dr B. Fehse) The LeGo_T2A-eGFP is shown in FIG. 16. These plasmids were used to produce VSV-G-pseudotyped lentiviral vectors.

TABLE-US-00001 TheLeGoiG2(Addgeneplasmid27341)vectorissetforthbelowasSEQIDNO:18. (SEQIDNO:18) gtcgacggatcgggagatctcccgatcccctatggtgcactctcagtacaatctgctctgatgccgcatagttaa gccagtatctgctccctgcttgtgtgttggaggtcgctgagtagtgcgcgagcaaaatttaagctacaacaaggcaaggctt gaccgacaattgcatgaagaatctgcttagggttaggcgttttgcgctgcttcgcgatgtacgggccagatatacgcgttga cattgattattgactagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttacataa cttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagta acgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatc atatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatggga ctttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtgg atagcggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgg gactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagc agcgcgttttgcctgtactgggtctctctggttagaccagatctgagcctgggagctctctggctaactagggaacccactg cttaagcctcaataaagcttgccttgagtgcttcaagtagtgtgtgcccgtctgttgtgtgactctggtaactagagatccctc agacccttttagtcagtgtggaaaatctctagcagtggcgcccgaacagggacttgaaagcgaaagggaaaccagagga gctctctcgacgcaggactcggcttgctgaagcgcgcacggcaagaggcgaggggcggcgactggtgagtacgccaaaa attttgactagcggaggctagaaggagagagatgggtgcgagagcgtcagtattaagcgggggagaattagatcgcgat gggaaaaaattcggttaaggccagggggaaagaaaaaatataaattaaaacatatagtatgggcaagcagggagctag aacgattcgcagttaatcctggcctgttagaaacatcagaaggctgtagacaaatactgggacagctacaaccatcccttc agacaggatcagaagaacttagatcattatataatacagtagcaaccctctattgtgtgcatcaaaggatagagataaaa gacaccaaggaagctttagacaagatagaggaagagcaaaacaaaagtaagaccaccgcacagcaagcggccggccg cgctgatcttcagacctggaggaggagatatgagggacaattggagaagtgaattatataaatataaagtagtaaaaatt gaaccattaggagtagcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaataggagc tttgttccttgggttcttgggagcagcaggaagcactatgggcgcagcgtcaatgacgctgacggtacaggccagacaatt attgtctggtatagtgcagcagcagaacaatttgctgagggctattgaggcgcaacagcatctgttgcaactcacagtctgg ggcatcaagcagctccaggcaagaatcctggctgtggaaagatacctaaaggatcaacagctcctggggatttggggttg ctctggaaaactcatttgcaccactgctgtgccttggaatgctagttggagtaataaatctctggaacagatttggaatcac acgacctggatggagtgggacagagaaattaacaattacacaagcttaatacactccttaattgaagaatcgcaaaacca gcaagaaaagaatgaacaagaattattggaattagataaatgggcaagtttgtggaattggtttaacataacaaattggct gtggtatataaaattattcataatgatagtaggaggcttggtaggtttaagaatagtttttgctgtactttctatagtgaatag agttaggcagggatattcaccattatcgtttcagacccacctcccaaccccgaggggacccgacaggcccgaaggaatag aagaagaaggtggagagagagacagagacagatccattcgattagtgaacggatcggcactgcgtgcgccaattctgca gacaaatggcagtattcatccacaattttaaaagaaaaggggggattggggggtacagtgcaggggaaagaatagtaga cataatagcaacagacatacaaactaaagaattacaaaaacaaattacaaaaattcaaaattttcgggtttattacaggg acagcagagatccagtttggttagtaccgggcccgctctagtcgaggtcgacggtatcgataagctcgcttcacgagattc cagcaggtcgagggacctaataacttcgtatagcatacattatacgaagttatattaagggttccaagcttaagcggccgg ccgctgaaagaccccacctgtaggtttggcaagctagctgcagtaacgccattttgcaaggcatggaaaaataccaaacc aagaatagagaagttcagatcaagggcgggtacatgaaaatagctaacgttgggccaaacaggatatctgcggtgagca gtttcggccccggcccggggccaagaacagatggtcaccgcagtttcggccccggcccgaggccaagaacagatggtcc ccagatatggcccaaccctcagcagtttcttaagacccatcagatgtttccaggctcccccaaggacctgaaatgaccctgc gccttatttgaattaaccaatcagcctgcttctcgcttctgttcgcgcgcttctgcttcccgagctctataaaagagctcacaa cccctcactcggcgcgccagtcctccgattgactgagtcgcccggatcccagtgtggtggtacgggaattcctgcaggcctc gacgagggccggcgcgccgcggccgctacgtaaattccgccccccccccccctctccctcccccccccctaacgttactgg ccgaagccgcttggaataaggccggtgtgcgtttgtctatatgttattttccaccatattgccgtcttttggcaatgtgagggc ccggaaacctggccctgtcttcttgacgagcattcctaggggtctttcccctctcgccaaaggaatgcaaggtctgttgaatg tcgtgaaggaagcagttcctctggaagcttcttgaagacaaacaacgtctgtagcgaccctttgcaggcagcggaaccccc cacctggcgacaggtgcctctgcggccaaaagccacgtgtataagatacacctgcaaaggcggcacaaccccagtgcca cgttgtgagttggatagttgtggaaagagtcaaatggctctcctcaagcgtattcaacaaggggctgaaggatgcccagaa ggtaccccattgtatgggatctgatctggggcctcggtgcacatgctttacatgtgtttagtcgaggttaaaaaaacgtctag gccccccgaaccacggggacgtggttttcctttgaaaaacacgatgataatatggccacaaccatggtgagcaagggcga ggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcg agggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggccc accctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaag tccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggt gaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctgggg cacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaact tcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacgg ccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcac atggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaaagcggccggccgcc agcacagtggtcgaaattcgtcgagggacctaataacttcgtatagcatacattatacgaagttatacatgtttaagggttc cggttccactaggtacaattcgatatcaagcttatcgataatcaacctctggattacaaaatttgtgaaagattgactggtat tcttaactatgttgctccttttacgctatgtggatacgctgctttaatgcctttgtatcatgctattgcttcccgtatggctttcat tttctcctccttgtataaatcctggttgctgtctctttatgaggagttgtggcccgttgtcaggcaacgtggcgtggtgtgcact gtgtttgctgacgcaacccccactggttggggcattgccaccacctgtcagctcctttccgggactttcgctttccccctccct attgccacggcggaactcatcgccgcctgccttgcccgctgctggacaggggctcggctgttgggcactgacaattccgtg gtgttgtcggggaaatcatcgtcctttccttggctgctcgcctgtgttgccacctggattctgcgcgggacgtccttctgctac gtcccttcggccctcaatccagcggaccttccttcccgcggcctgctgccggctctgcggcctcttccgcgtcttcgccttcgc cctcagacgagtcggatctccctttgggccgcctccccgcatcgataccgtcgacctcgatcgagacctagaaaaacatgg agcaatcacaagtagcaatacagcagctaccaatgctgattgtgcctggctagaagcacaagaggaggaggaggtgggt tttccagtcacacctcaggtacctttaagaccaatgacttacaaggcagctgtagatcttagccactttttaaaagaaaagg ggggactggaagggctaattcactcccaacgaagacaagatatccttgatctgtggatctaccacacacaaggctacttcc ctgattggcagaactacacaccagggccagggatcagatatccactgacctttggatggtgctacaagctagtaccagttg agcaagagaaggtagaagaagccaatgaaggagagaacacccgcttgttacaccctgtgagcctgcatgggatggatga cccggagagagaagtattagagtggaggtttgacagccgcctagcatttcatcacatggcccgagagctgcatccggact gtactgggtctctctggttagaccagatctgagcctgggagctctctggctaactagggaacccactgcttaagcctcaata aagcttgccttgagtgcttcaagtagtgtgtgcccgtctgttgtgtgactctggtaactagagatccctcagacccttttagtc agtgtggaaaatctctagcagcatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcg tttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggact ataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccg cctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagc tgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaag acacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttctt gaagtggtggcctaactacggctacactagaagaacagtatttggtatctgcgctctgctgaagccagttaccttcggaaa aagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgc agaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaaggg attttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtata tatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccata gttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcga gacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaa ctttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttg ttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcga gttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagt gttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtac tcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgcca catagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagat ccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaaca ggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattat tgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgc gcacatttccccgaaaagtgccacctgac ThevectorLeGO-MCS-GSG-T2A-eGFPissetforthbelowasSEQIDNO:19: (SEQIDNO:19) gtcgacggatcgggagatctcccgatcccctatggtgcactctcagtacaatctgctctgatgccgcatagttaag ccagtatctgctccctgcttgtgtgttggaggtcgctgagtagtgcgcgagcaaaatttaagctacaacaaggcaaggcttga ccgacaattgcatgaagaatctgcttagggttaggcgttttgcgctgcttcgcgatgtacgggccagatatacgcgttgacatt gattattgactagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttacataacttacgg taaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaat agggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaag tacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttg gcagtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgac tcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgt cgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagcgcgttttgcctgt actgggtctctctggttagaccagatctgagcctgggagctctctggctaactagggaacccactgcttaagcctcaataaag cttgccttgagtgcttcaagtagtgtgtgcccgtctgttgtgtgactctggtaactagagatccctcagacccttttagtcagtgt ggaaaatctctagcagtggcgcccgaacagggacttgaaagcgaaagggaaaccagaggagctctctcgacgcaggact cggcttgctgaagcgcgcacggcaagaggcgaggggcggcgactggtgagtacgccaaaaattttgactagcggaggct agaaggagagagatgggtgcgagagcgtcagtattaagcgggggagaattagatcgcgatgggaaaaaattcggttaag gccagggggaaagaaaaaatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctgg cctgttagaaacatcagaaggctgtagacaaatactgggacagctacaaccatcccttcagacaggatcagaagaacttag atcattatataatacagtagcaaccctctattgtgtgcatcaaaggatagagataaaagacaccaaggaagctttagacaagat agaggaagagcaaaacaaaagtaagaccaccgcacagcaagcggccggccgcgctgatcttcagacctggaggagga gatatgagggacaattggagaagtgaattatataaatataaagtagtaaaaattgaaccattaggagtagcacccaccaagg caaagagaagagtggtgcagagagaaaaaagagcagtgggaataggagctttgttccttgggttcttgggagcagcagga agcactatgggcgcagcgtcaatgacgctgacggtacaggccagacaattattgtctggtatagtgcagcagcagaacaat ttgctgagggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagaatcctg gctgtggaaagatacctaaaggatcaacagctcctggggatttggggttgctctggaaaactcatttgcaccactgctgtgcc ttggaatgctagttggagtaataaatctctggaacagatttggaatcacacgacctggatggagtgggacagagaaattaaca attacacaagcttaatacactccttaattgaagaatcgcaaaaccagcaagaaaagaatgaacaagaattattggaattagata aatgggcaagtttgtggaattggtttaacataacaaattggctgtggtatataaaattattcataatgatagtaggaggcttggta ggtttaagaatagtttttgctgtactttctatagtgaatagagttaggcagggatattcaccattatcgtttcagacccacctccca accccgaggggacccgacaggcccgaaggaatagaagaagaaggtggagagagagacagagacagatccattcgatt agtgaacggatcggcactgcgtgcgccaattctgcagacaaatggcagtattcatccacaattttaaaagaaaaggggggat tggggggtacagtgcaggggaaagaatagtagacataatagcaacagacatacaaactaaagaattacaaaaacaaattac aaaaattcaaaattttcgggtttattacagggacagcagagatccagtttggttagtaccgggcccgctctagtcgaggtcga cggtatcgataagctcgcttcacgagattccagcaggtcgagggacctaataacttcgtatagcatacattatacgaagttata ttaagggttccaagcttaagcggccgctgaaagaccccacctgtaggtttggcaagctagctgcagtaacgccattttgcaa ggcatggaaaaataccaaaccaagaatagagaagttcagatcaagggcgggtacatgaaaatagctaacgttgggccaaa caggatatctgcggtgagcagtttcggccccggcccggggccaagaacagatggtcaccgcagttteggccccggcccg aggccaagaacagatggtccccagatatggcccaaccctcagcagtttcttaagacccatcagatgtttccaggctccccca aggacctgaaatgaccctgcgccttatttgaattaaccaatcagcctgcttctcgcttctgttegcgcgcttctgcttcccgagct ctataaaagagctcacaacccctcactcggcgcgccagtcctccgattgactgagtcgcccGGATCCGCCACC ATGGCTAAGCTAGGAAGCGGAGAGGGCAGAGGCAGTCTGCTGACATGCGG TGACGTGGAAGAGAATCCCGGCCCTgtgagcaagggcgaggagctgttcaccggggggtgccc atcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctac ggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctac ggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtc caggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctgg tgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaa cagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgagg acggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaacc actacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgacc gccgccgggatcactctcggcatggacgagctgtacaagTAAGAATTCgtcgagggacctaataacttcgtatagc atacattatacgaagttatacatgtttaagggttccggttccactaggtacaattcgatatcaagcttatcgataatcaacctctgg attacaaaatttgtgaaagattgactggtattcttaactatgttgctccttttacgctatgtggatacgctgctttaatgcctttgtatc atgctattgcttcccgtatggctttcattttctcctccttgtataaatcctggttgctgtctctttatgaggagttgtggcccgttgtca ggcaacgtggcgtggtgtgcactgtgtttgctgacgcaacccccactggttggggcattgccaccacctgtcagctcctttcc gggactttcgctttccccctccctattgccacggcggaactcatcgccgcctgccttgcccgctgctggacaggggctcggc tgttgggcactgacaattccgtggtgttgtcggggaaatcatcgtcctttccttggctgctcgcctgtgttgccacctggattctg cgcgggacgtccttctgctacgtcccttcggccctcaatccagcggaccttccttcccgcggcctgctgccggctctgcggc ctcttccgcgtcttcgccttcgccctcagacgagtcggatctccctttgggccgcctccccgcatcgataccgtcgacctcgat cgagacctagaaaaacatggagcaatcacaagtagcaatacagcagctaccaatgctgattgtgcctggctagaagcacaa gaggaggaggaggtgggttttccagtcacacctcaggtacctttaagaccaatgacttacaaggcagctgtagatcttagcc actttttaaaagaaaaggggggactggaagggctaattcactcccaacgaagacaagatatccttgatctgtggatctaccac acacaaggctacttccctgattggcagaactacacaccagggccagggatcagatatccactgacctttggatggtgctaca agctagtaccagttgagcaagagaaggtagaagaagccaatgaaggagagaacacccgcttgttacaccctgtgagcctg catgggatggatgacccggagagagaagtattagagtggaggtttgacagccgcctagcatttcatcacatggcccgagag ctgcatccggactgtactgggtctctctggttagaccagatctgagcctgggagctctctggctaactagggaacccactgct taagcctcaataaagcttgccttgagtgcttcaagtagtgtgtgcccgtctgttgtgtgactctggtaactagagatccctcaga cccttttagtcagtgtggaaaatctctagcagcatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgc gttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaaccc gacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggat acctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcg ctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaac ccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctac agagttcttgaagtggtggcctaactacggctacactagaagaacagtatttggtatctgcgctctgctgaagccagttacctt cggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagatta cgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaa gggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatat atgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttg cctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacc cacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttat ccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccatt gctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatga tcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactc atggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtc attctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaact ttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaac ccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgcc gcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggtta ttgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgcc acctgac

[0038] The above vector LeGO-MCS-GSG-T2A-eGFP has been generated by replacing the sequence of the LeGO-G2 vector (Addgene 25917) with the following sequence between the BamH1 and EcoR1 restriction sites:

TABLE-US-00002 (SEQIDNO:22) GGATCCGCCACCATGGCTAAGCTAGGAAGCGGAGAGGGCAGAGGCAGTCT GCTGACATGCGGTGACGTGGAAGAGAATCCCGGCCCTgtgagcaagggcg aggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgac gtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccac ctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccg tgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttc agccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccat gcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggca actacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaac cgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggg gcacaagctggagtacaactacaacagccacaacgtctatatcatggccg acaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatc gaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccat cggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagt ccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctg gagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaa gTAAGAATTC
Generation of PD-L1.sup.+ and PD-L1.sup. Target Cell Lines

[0039] Raji cells were transfected with PD-L1 plasmid (GenScript, OHu22144), using the Amaxa Cell Line Nucleofector kit V (Lonza, VCA-1003) according to the manufacturer's recommendations. PD-L1 protein was knocked out in 786-0 cells with CRISPR-Cas9 technology according to previously published protocols [21]. Two different guide RNAs were used to generate KO1 (guide RNA sequence: TACCGCTGCATGATCAGCTATGG) (SEQ ID NO: 20) and KO2 (guide RNA sequence: TACCATACTCTACCACATATAGG) (SEQ ID NO: 21) to ensure obtained results were due to PD-L1 KO and not unwanted off-target alterations associated with CRISPR technology.

Production of Lentiviral Vectors

[0040] Lentiviruses were generated by calcium-phosphate based transfection (Sigma, CAPHOS-1KT) of either 110.sup.6 HEK293FT cells (CRISPR plasmids) or 1410.sup.6 HEK293FT cells (PD1-CSR plasmids) according to the manufacturer's recommendations. Briefly, the plasmids of interest were co-transfected with the envelope plasmid pCMV-VSV-G and two packaging plasmids, pDMLg/pPRE and pRSV-Rev to produce VSV-G-pseudotyped lentiviruses. For the transduction of NK cells, lentiviruses were concentrated prior to freezing with the Lenti-X concentrator according to the manufacturer's recommendations (Takara Bio, 631232). All lentiviruses were titrated on HEK293FT cells. Briefly, 510.sup.4 cells per well of a 24-well plate were seeded in medium, containing different amounts of concentrated virus, in the presence of 8 g/l protamine sulfate (Sigma-Aldrich P3369-10G). Cells were spinoculated for one hour at 1000g and 32 C. after which incubation for 6 hours at 37 C. and 5% CO.sub.2 followed. Protamine-sulfate containing medium was then replaced with fresh medium. Green fluorescent protein (GFP) percentage was analysed by flow cytometry three days post-transduction. Lentiviral titer was calculated with the formula

[00001]$\frac{\%\mathrm{of}\mathrm{GFP}\mathrm{positive}\mathrm{cells}50.}{\mathrm{viral}\mathrm{supernatant}\mathrm{in}\mathrm{ml}}$

Lentiviral Transduction of NK-92, pNK Cells and 786-0) Cells

[0041] NK cells were transduced as described previously [24]. pNK cells were isolated from healthy donor PBMCs. Briefly, cells were seeded at 510.sup.5 cells/ml in viral supernatant at an MOI of 4 (NK-92) or 15 (pNK) in the presence of (5Z)-7-Oxozeanol (Biotechne) and 8 g/l protamine sulfate (Sigma-Aldrich P3369-10G). Cells were spinoculated for one hour at 1,000g and 32 C. after which incubation for five hours at 37 C. and 5% CO.sub.2 followed. Protamine-sulfate containing medium was then replaced with fresh medium, containing IL-2 at a final concentration of 500 U/ml (NK-92) or 1000 U/ml (pNK) (R&D 202-IL-500). 786-0 cells were plated at a density of 3,300 cells/cm.sup.2 in the presence of viral supernatant and 8 g/l protamine sulfate (Sigma-Aldrich P3369-10G). Cells were spinoculated for one hour at 800g and 32 C. after which incubation for five hours at 37 C. and 5% CO.sub.2 followed. Medium was then replaced with fresh medium. GFP, PD1 and PD-L1 expression were analysed three days after transduction. Cells were sorted using BD FACS AriaFusion.

Flow Cytometry

[0042] The following mAb were used for flow cytometry analysis: CD56 (clone NCAM1), CD16 (clone 3G8) CD3 (clone SK3), CD11b (clone ICRF44), CD14 (clone MOP9) PD1 (clone EH12.1), PD-L1 (clone MIH1), PD-L2 (clone MIH18), CD138 (clone MI15) MICA/B (clone 6D4), CD155 (clone TX24), NKG2A (clone 131411), NKp44 (clone p44-8), TIM3 (clone 7D3), TIGIT (clone 741182), DNAM1 (clone DX11) from BD Biosciences; HLA-ABC (clone W6/32), CD38 (clone HIT2), NKp30 (clone p30-15), NKp46 (9E2/NKp46), LAG3 (clone 11C3C65), NKG2D (clone 1D11), CD112 (clone TX31) from BioLegend; CD158a/h/g (clone HP-MA4), CD158e (clone DX9) from Thermofisher, CD158B (clone GL183) from Invitrogen, ULBP256 (clone 165903) from R&D. All antibodies were titrated prior to usage. Briefly, cells were collected and washed once in PBS. Cells were stained with Aqua live dead cell staining (ThermoFisher) for 20 minutes at 4 C., in the dark. Cells were washed once with PBS, containing 2% FBS. Surface staining was performed for 25 minutes at 4 C., in the dark. Cells were washed with PBS, containing 2% FBS, centrifuged and fixed with 1% paraformaldehyde for 10 minutes. Acquisition was performed the following day with Beckman Coulter Cytoflex flow cytometers. Analysis was performed with FlowJo analysis software version 10. Gates wereunless otherwise specifiedplaced based on the unstained control or FMO (fluorescence minus one).

NK Cell Degranulation Assay and Evaluation of IFN and TNF Intracellular Staining

[0043] 0.0310.sup.6 786-O cells were seeded in a flat 96-well plate 24 hours before the assay to allow cells to attach. 0.1510.sup.6 NK-92 or pNK cells were co-incubated with either 0.1510.sup.6 Raji cells or 786-O cells in a final volume of 200 l at 37 C. and 5% CO.sub.2 for four hours in the presence of CD107a antibody (BioLegend, clone H4A3). Where indicated, Rituximab was added to the co-culture at a final concentration of 2.5 g/ml. As controls, 0.1510.sup.6 NK-92 or pNK cells were incubated alone or with phorbol 12-myristate 13-acetate (PMA) and ionomycin (0.5 g/mL, Sigma-Aldrich), together with CD107a antibody for 4 hours. After one hour of incubation, monensin (GolgiStop, BD Biosciences) was added to cultures to inhibit protein transportation. Subsequently, surface staining with CD56 (clone NCAM16.2), CD16 (clone 3G8), CD3 (clone UCHT1) and PD1 (clone EH12.1) was performed for 25 min at 4 C., in the dark. For intracellular staining of IFN (clone B27) and TNF (clone MAb11) (all from BD Bioscience) cells were washed with PBS followed by fixation and permeabilization with cytofix/cytoperm (BD Biosciences). Cell were incubated for 30 min at RT with intracellular antibodies. Cells were washed and resuspended in PBS. Acquisition was performed with Beckman Coulter Cytoflex or BD Symphony flow cytometers. Analysis was performed with FlowJo analysis software version 10. Gates were placed on the unstimulated samples for the readout of CD107a, IFN and TNF.

Chromium Release Assay

[0044] NK cell cytotoxicity was measured in a standard .sup.51Cr-release assay against tumor target cells. Briefly, target cells were labeled with 100 L sodium chromate (PerkinElmer) for one hour at 37 C., after which they were washed three times with PBS. NK cells were mixed with the labeled target cells at different effector to target ratios and incubated for four hours. 20 L of the supernatant was transferred to LumaPlate-96 and subsequently analyzed with a MicroBeta2 counter (PerkinElmer).

Live Cell Imaging Assays

[0045] Live cell imaging was performed as recently described [25]. Briefly, 310.sup.4 PD-L1.sup.+ 786-O WT or PD-L1.sup. 786-O KO cells that were previously transduced to express the fluorescent protein tdTomato were seeded per well in a low-attachment 96-well plate and incubated at 37 C., 5% CO.sub.2 for 72 hours to allow spheroids to form spontaneously. Prior to analysis, 310.sup.3 NK-92 or pNK cells were added to the culture. The number of killed target cells was monitored by imaging every four hours over 48 hours (NK-92) to seven days (pNK) using an IncuCyte S3 Live Cell Analysis System (Sartorius). Percent of killing was quantified as decrease of red intensity and normalized to the red fluorescence intensity at the beginning of the assay with the formula

[00002]$\frac{\mathrm{red}\mathrm{cell}\mathrm{count}\mathrm{at}\mathrm{timepoint}x}{\mathrm{red}\mathrm{cell}\mathrm{count}\mathrm{at}\mathrm{timepoint}i}.$

Proliferation Assays

[0046] NK-92 and pNK cells were labelled with Cell Trace Violet (ThermoFisher) according to the manufacturer's recommendations. Cells were cultured alone or co-cultured in the presence of PD-L1.sup.+ 786-O WT or PD-L1.sup. 786-O KO cells at an effector to target ratio of 1:1. Acquisition was performed with Beckman coulter Cytoflex flow cytometers. Analysis was performed with FlowJo analysis software version 10.

Statistical Analysis

[0047] The Student's t test was used to compare the means of two groups. Two-way ANOVA test was used to compare the means between several groups. p<0.05 was determined as statistically significant (*), p<0.01 (**), p<0.001 (***), p<0.0001 (****) as statistically highly significant. Statistical analysis was performed with GraphPad Prism software version 9 (GraphPad, La Jolla, USA).

Results

Expression of PD1-Based Chimeric Switch Receptors in NK-92 Cells

[0048] Initially, six different CSR constructs were generated with the purpose of determining optimal signaling in NK cells. All CSR expressed the unmodified human PD1 extracellular domain fused with various activating intracellular domains. Specifically, DAP10, DAP12, CD3 and NKp46 were utilized. Furthermore, a control coding for a truncated, signaling-deficient PD1 construct was generated (FIG. 1A, B). PD1 surface expression among the untransduced or empty vector transduced NK-92 cell lines remained below 2% of the total population. After sorting, all other transduced cell lines stably expressed the transgenes as confirmed by positive PD1 staining. As expected, expression levels differed between the constructs (FIG. 1 C). Importantly, neither PD-L1 nor PD-L2 expression was detected in NK-92 wildtype (WT) cells (FIG. 1 D).

[0049] FIG. 1A-D are Table and Vector Maps showing that PD1-based chimeric switch receptors are stably expressed in NK-92 cells. FIGS. 1A-B show Table and vector maps depicting the design of the truncated PD1 receptor (PD1.sub.EcTM) and six chimeric switch receptors (CSR) with different signaling domains. FIG. 1C shows NK-92 cells containing different PD1-CSR and sorted for positive PD1 surface staining. FIG. 1 D shows PD-L1 and PD-L2 expression on NK-92 cells. FIG. 1E shows PD1, PD-L1 and PD-L2 expression on PD-L1.sup.+ Raji and PD-L1.sup. Raji WT cells. FIG. 1F shows PD1, PD-L1 and PD-L2 expression on PD-L1.sup.+ 786-O WT and PD-L1.sup. 786-O KO cells.

Generation of Target Cell Lines

[0050] To study the function of the PD1-CSR.sup.+ NK-92 cell lines, PD-L1.sup.+ and PD-L1.sup. target cell lines were generated. As target cell lines 786-O and Raji cells were chosen, with the first expressing PD-L1 and the latter being devoid of PD-L1. The target cell lines were chosen due to their different potential to activate NK cells. Based on these cell lines, PD-L1 knock-out 786-O (786-O KO) cell lines and a PD-L1.sup.+ Raji cell line were generated. Hereafter, the target cell lines are referred to as PD-L1.sup.+ 786-O WT, PD-L1.sup. 786-O KO1, PD-L.sup. 786-O KO2, PD-L1.sup.+ Raji and PD-L1.sup. Raji WT. Neither of the target cell lines expressed PD1 or PD-L2 (FIG. 1 E, F). FIG. 1E shows that PD1, PD-L1 and PD-L2 expression on PD-L1.sup.+ Raji and PD-L1.sup. Raji WT cells. FIG. 1 F shows that PD1, PD-L1 and PD-L2 expression on PD-L1.sup.+ 786-O WT and PD-L1.sup. 786-O KO cells.

[0051] The genetic modification of the target cell lines did not alter the expression of other ligands for activating NK cell receptors (FIG. 6A, B). FIGS. 6A-B show flow cytometry plots depict the expression of ligands for activating NK cell receptors on Raji WT and PD-L1.sup.+ Raji cells as well as 786-O WT, 786-O KO1 and 786-O KO2 cell lines compared to a staining control.

PD1-CSR Transduced NK-92 Cell Lines Show Superior Degranulation and Cytokine Secretion

[0052] To evaluate the induction of degranulation and cytokine expression, CD107a, IFN and TNF expression by all generated PD1-CSR.sup.+ NK-92 cell lines and controls was assessed against PD-L1.sup.+ 786-O WT and PD-L1.sup. 786-O KO cell lines (FIG. 2A, FIG. 7A). Generally, 786-O cells are resistant to NK cell mediated cytotoxicity and the PD1-CSR.sup.+ NK-92 cells were tested for their ability to circumvent the resistance. In line with this, CD107a, IFN and TNF expression by NK-92 WT and PD1.sub.EcTM.sup.+ NK-92 remained below 10% against both PD-L1.sup.+ 786-O WT and PD-L1.sup. 786-O KO cell lines, with no significant differences between the three target cell lines. FIG. 2A shows the percentage of CD107a, IFN and TNF by different PD1-CSR.sup.+ NK-92 cells against PD-L1.sup.+ 786-O WT and two PD-L1.sup. 786-O KO cell lines. Each data point represents the mean (+/SD) of three independent experiments performed in triplicates. FIG. 7A shows flow cytometry plots depicting the gating strategy for degranulation assays.

[0053] The PD1-CD28-CD3 and PD1.sub.EcTMDAP12.sub.IC transduced NK-92 cell lines showed a three- to four-fold increase in CD107a expression and corresponding increase in IFN and TNF expression against PD-L1.sup.+ 786-O WT compared to both PD-L1.sup. 786-O KO cell lines. CD107a, IFN and TNF production was 1.5-fold higher by PD1.sub.ECDAP10.sub.TM-IC.sup.+ NK-92 against PD-L1.sup.+ 786-O WT cells. CD107a, IFN and TNF expression by PD1.sub.ECDAP12.sub.TM-IC.sup.+ NK-92 cells showed the highest degranulation against PD-L1.sup.+ 786-O WT cells among the PD1-CSR.sup.+ NK-92 cell lines, approaching 50% (+/12%), 30% (+/8.5%) and 30% (+/8.5%), respectively. Notably, PD1-NKp46 and PD1.sub.EcTMDAP10.sub.IC expressing NK-92 cell lines did not show increased CD107a nor IFN or TNF expression against PD-L1.sup.+ 786-O WT compared to PD-L1.sup. 786-O KO cell lines. To conclude, PD1-CD28-CD3, PD1.sub.EcDAP10.sub.TM-IC.sup.+, PD1.sub.EcDAP12.sub.TM-IC.sup.+ and PD1.sub.EcTMDAP12.sub.IC.sup.+ NK-92 cells increased degranulation and cytokine expression against PD-L1.sup.+ 786-O WT cells which are inherently resistant to NK cell mediated cytotoxicity.

PD1-CSR Transduced NK-92 Cell Lines Show Superior Degranulation and Cytokine Secretion Against PD-L1.SUP.+ Raji Cells

[0054] To extend these results to a cell line that is already highly susceptible to NK cell killing, all generated PD1-CSR.sup.+ NK-92 cell lines were assessed against PD-L1.sup.+ Raji cells and PD-L1.sup. Raji WT cells (FIG. 7 B-D). FIGS. 7B-D show the percentage and MFI of CD107a (B), IFN (C) and TNF (D) by different PD1-CSR.sup.+ NK-92 cells against PD-L1.sup.+ Raji cells and PD-L1.sup. Raji WT cells. Each data point represents the mean (+/SD) of three independent experiments performed in triplicates. Statistical significance (* p<0.05; ** p<0.01) was determined with a two-way ANOVA test. NK92 WT and PD1.sub.EcTM.sup.+ NK92 cells showed a high CD107a, IFN and TNF expression against both PD-L1.sup. Raji WT cells and PD-L1.sup.+ Raji cells with values reaching up to 80% (+/7%), 70% (+/6%) and 70% (+/1.2%), respectively. Despite the high baseline values, the expression of CD107a, IFN and TNF by PD1-CD28-CD3, PD1.sub.EcTMDAP10.sub.IC.sup.+, PD1.sub.EcDAP12.sub.TM-IC.sup.+ and PD1.sub.EcTMDAP12.sub.IC.sup.+ NK-92 cells was significantly higher against PD-L1.sup.+ Raji cells compared to PD-L1.sup. Raji WT cells. PD1-NKp46 and PD1.sub.EcDAP10.sub.TM-IC expressing NK-92 cell lines did not increase CD107a, IFN or TNF expression against PD-L1.sup.+ Raji cells compared to PD-L1.sup. Raji WT cells. Taken together, PD1-CD28-CD3, PD1.sub.EcTMDAP10.sub.IC.sup.+, PD1.sub.EcDAP12.sub.TM-IC.sup.+ and PD1.sub.EcTMDAP12.sub.IC.sup.+ NK-92 cells increased degranulation and cytokine expression against PD-L1.sup.+ Raji cells.

Receptor-Independent Degranulation and Cytokine Production by PD1-CSR.SUP.+ NK-92 Cells

[0055] To confirm that the induction of CD107a, IFN and TNF expression is based on PD1-PD-L1 interaction, degranulation and cytokine expression by unstimulated or maximal chemically (PMA/Iono) stimulated PD1-CSR.sup.+ NK-92 cell lines was measured (FIG. 8A-C). FIGS. 8A-C show the percentage of CD107a (A), IFN (B) and TNF (C) expression of unstimulated or maximal chemically stimulated with phorbol-myristate-acetate (PMA) PD1-CSR.sup.+ NK-92 cells. No significant differences in CD107a, IFN or TNF expression by unstimulated PD1-CSR.sup.+ NK-92 cell lines was observed. However, chemical stimulation of PD1-CD28-CD3.sup.+ and PD1-NKp46.sup.+ NK-92 cells resulted in reduced CD107a, but not IFN or TNF expression, compared to NK-92 WT cells. The other PD1-CSR.sup.+ NK-92 cells did not show differences in CD107a, IFN or TNF expression after chemical stimulation compared to NK-92 WT cells. PD1 positivity decreased in the PD1-NKp46.sup.+ NK-92 cell line in the absence of stimulation as well as after chemical stimulation or target cell recognition. After chemical stimulation or recognition of PD-L1.sup.+ target cells, PD1 surface expression also decreased in the PD1.sub.EcDAP 12.sub.TM-IC expressing cell line and remained stable for the other PD1-CSR.sup.+ NK-92 cell lines (FIG. 8D-E). FIGS. 8D-E show PD1 surface expression in PD1-CSR.sup.+ NK92 cells in unstimulated cells, maximal chemically stimulated (PMA) cells or during co-culture with target cells. Each data point represents the mean (+/SD) of three independent experiments performed in duplicates. Statistical significance (* p<0.05; ** p<0.01) was determined with a two-way ANOVA test. Taken together, PD1.sub.EcTMDAP10.sub.IC.sup.+ and PD1.sub.EcTMDAP12.sub.IC.sup.+ NK-92 cells showed a stable PD1 surface staining, a higher CD107a, IFN and TNF expression upon PD-L1.sup.+ target cell recognition and no alteration in degranulation or cytokine secretion in the unstimulated or maximal chemically stimulated controls compared to NK-92 WT cells. Genetic modification did not alter the expression of other activating and inhibitory NK cell receptors on mock-transduced, PD1.sub.EcTM, PD1.sub.EcTMDAP10.sub.IC and PD1.sub.EcTMDAP 12.sub.IC transduced NK92 cells (FIG. 9A) FIG. 9A shows flow ctometry plots depict the expression of activating and inhibitory NK cell receptors on NK92 WT and PD1-CSR.sup.+ NK92 cell lines compared to a staining control. Therefore, PD1.sub.EcTMDAP10.sub.IC and PD1.sub.EcTMDAP 12.sub.IC CSR were chosen for the following assays.

PD1.sub.EcTMDAP10.sub.IC.sup.+ and PD1.sub.EcTMDAP12.sub.IC.sup.+ NK-92 Cells Show Higher Killing of PD-L1.sup.+ 786-O WT cells

[0056] Since PD1.sub.EcTMDAP10.sub.IC.sup.+ and PD1.sub.EcTMDAP12.sub.IC.sup.+ NK-92 cells showed higher efficacy, we explored whether these cells would also directly kill tumor target cells. Killing of .sup.51Cr labelled PD-L1.sup.+ 786-O WT or PD-L1.sup. 786-O KO cells by either NK-92 WT, PD1.sub.EcTM.sup.+, PD1.sub.EcTMDAP10.sub.IC.sup.+ or PD1.sub.EcTMDAP12.sub.IC.sup.+ NK-92 cell lines was assessed at different effector to target (E:T) ratios (FIG. 2B). There was no significant difference in killing of PD-L1.sup.+ 786-O WT cells compared to both PD-L1.sup. 786-O KO cell lines by either NK-92 WT or PD1.sub.EcTM.sup.+ NK92 cells. PD1.sub.EcTMDAP10.sub.IC.sup.+ NK-92 cells increased killing of PD-L1.sup.+ 786-O WT cells two-fold compared to both PD-L1.sup. 786-O KO cell lines. Similarly, PD1.sub.EcTMDAP12.sub.IC.sup.+ NK-92 cells increased killing of PD-L1.sup.+ 786-O WT cells by two-fold at higher E:T ratios and 3.5 fold at lower E:T ratios compared to PD-L1.sup. 786-O KO cells. FIG. 2B shows the killing of PD-L1.sup.+ 786-O WT versus PD-L1.sup. 786-O KO1 and PD-L1.sup. 786-O KO2 cells by NK-92 WT, PD1.sub.EcTM.sup.30, PD1.sub.EcTMDAP10.sub.IC.sup.+ or PD1.sub.EcTMDAP12.sub.IC.sup.+ NK-92 cells. Each data point represents the mean (+/SD) of three independent experiments performed in quadruplets. Statistical significance (* p<0.05; ** p<0.01) was determined with a two-way ANOVA test. No significant difference in killing of PD-L1.sup.+ Raji compared to PD-L1.sup. Raji WT cells was observed by either of the PD1-CSR.sup.+ NK-92 cells (FIG. 9B-E). FIG. 9B shows flow ctometry plots depict the expression of activating and inhibitory NK cell receptors on NK92 WT and PD1-CSR.sup.+ NK92 cell lines compared to a staining control. FIGS. 9C-E show the killing of PD-L1.sup.+ Raji versus PD-L1.sup. Raji WT by NK-92 WT, PD1.sub.EcTM.sup.+, PD1.sub.EcTMDAP10.sub.IC.sup.+ or PD1.sub.EcTMDAP12.sub.IC.sup.+ NK-92 cells. Each data point represents the mean (+/SD) of three independent experiments performed in triplicates.

PD1.sub.EcTMDAP10.sub.IC.sup.+ and PD1.sub.EcTMDAP12.sub.IC.sup.+ NK-92 Show Increased Killing of Large PD-L1.sup.+ 786-O WT Tumor Spheroids

[0057] Since 786-O cells can form large tumor spheroids with diameters reaching up to one millimeter, the ability of PD1.sub.EcTMDAP10.sub.IC.sup.+ and PD1.sub.EcTMDAP12.sub.IC.sup.+ NK-92 cells to kill PD-L1.sup.+ 786-O WT cells was tested in the 3D co-culture model as it more accurately resembles the TME than a 2D co-culture model. For this purpose, PD-L1.sup.+ 786-O WT and both PD-L1.sup. 786-O KO cell lines were further transduced to express the red fluorescence protein tdTomato. Killing of 786-O spheroids was assessed based on the decrease of red fluorescence intensity as captured with the IncuCyte live cell imager (FIG. 3A-D;) and by flow cytometry (FIG. 3 E-F). FIGS. 3A-D show killing of PD-L.sup.+ 786-O WT versus PD-L1.sup. 786-O KO1 and PD-L1.sup. 786-O KO2 tumor spheroids by NK-92 WT, PD1.sub.EcTM.sup.+, PD1.sub.EcTMDAP10.sub.IC.sup.+ or PD1.sub.EcTMDAP12.sub.IC.sup.+ NK-92 cells. Each data point represents the mean (+/SD) of six independent experiments performed in duplicates. Red fluorescence intensity decreased from 100% to 70% (+/11%) in PD-L1.sup.+ 786-O WT and PD-L1.sup. 786-O KO cell lines over a 48 hours period when NK-92 WT or PD1.sub.EcTM.sup.+ NK-92 cells were added to the tumor spheroids, with no significant differences between the three target cell lines. PD1.sub.EcTMDAP10.sub.IC.sup.+ NK-92 cells resulted in a reduction of red fluorescence intensity from 100% to 35% (+/10%) in the PD-L1.sup.+ 786-O WT cells and from 100% to 60% (+/9%) in the PD-L1.sup. 786-O KO cell lines, with statistical significance between the PD-L1.sup.+ and PD-L1.sup. target cell lines. Similarly, there was a significant decrease in red fluorescence intensity in PD-L1.sup.+ 786-O WT cells (100% to 45% (+/7%)) compared to PD-L1.sup. 786-O KO cell lines (100% to 65% (+/8%)) when PD1.sub.EcTMDAP12.sub.IC.sup.+ NK-92 cells were added. The tumor spheroids were therafter harvested, washed and dissociated to assess spheroid killing by flow cytometry (FIG. 3 E-F; FIG. 10A). In FIGS. 3E-G, Tumor spheroids were collected, washed, dissociated and analysed by flow cytometry. Displayed is the gating strategy (E), the percentage of 786-O.sup.dim cells per spheroid (F) and percentage of CD45.sup.+ NK-92 cells per spheroid (G). Each data point represents the mean (+/SD) of three independent experiments performed in duplicates. Statistical significance (* p<0.05; ** p<0.01; *** p<0.001) was determined with a two-way ANOVA test. FIG. 10A shows the percentage of 786-O.sup.bright cells per spheroid (A) and the total number of CD45.sup.+ PD1-CSR.sup.+ NK-92 cells per spheroid (B). Each data point represents the mean (+/SD) of three independent experiments performed in duplicates. Statistical significance (* p<0.5) was determined with a two-way ANOVA test. Live 786-O cells showed a high expression of tdTomato and were classified as 786-O.sup.bright while dying 786-O cells gradually lost tdTomato expression and were classified as 786-O.sup.dim cells. As expected, both PD1.sub.EcTMDAP10.sub.IC.sup.+ and PD1.sub.EcTMDAP12.sub.IC.sup.+ NK-92 cells, but not NK-92 WT or PD1.sub.EcTM.sup.+ NK-92 cells, led to a significant increase in the 786-O.sup.dim population and corresponding decrease in the 786-O.sup.bright population against the PD-L1.sup.+ 786-O WT but not PD-L1.sup. 786-O KO cell lines. Furthermore, the percentage and total amount of CD45.sup.+ cells within the 786-O tumor spheroids was assessed (FIG. 3 G, FIG. 10B). FIG. 10B shows the percentage of 786-O.sup.bright cells per spheroid (A) and the total number of CD45.sup.+ PD1-CSR.sup.+ NK-92 cells per spheroid (B). Each data point represents the mean (+/SD) of three independent experiments performed in duplicates. Statistical significance (* p<0.5) was determined with a two-way ANOVA test. There was a statistically significant difference in the percentage of CD45.sup.+ cells within the PD-L1.sup. 786-O WT spheroid compared to the PD-L1.sup. 786-O KO spheroids when PD1.sub.EcTMDAP10.sub.IC.sup.+ and PD1.sub.EcTMDAP12.sub.IC.sup.+ NK-92 cells were added. However, no statistical significant difference was observed for the absolute numbers of CD45.sup.+ cells. Lastly, proliferation of PD1-CSR.sup.+ NK-92 cells was measured. No significant differences in proliferation of PD1.sub.EC-TMDAP10.sub.IC.sup.+ or PD1.sub.EC-TMDAP12.sub.IC.sup.+ NK-92 cells compared to WT or PD1.sub.EC-TM.sup.+ NK-92 cells were observed when cultured alone (FIG. 10 C), exposed one-time to PD-L1.sup.+ 786-O WT cells (FIG. 10 D) or repetitively exposed to PD-L1.sup.+ 786-O WT cells (FIG. 10 E). FIGS. 10C-E show the proliferation of PD1-CSR.sup.+ NK-92 cells without stimulation (C), stimulated once with PD-L1.sup.+ 786-O WT cells (D) or stimulated on two consecutive days with PD-L1.sup.+ 786-O WT cells (E). Displayed is the mean fluorescence intensity (MFI) of CTV at the indicated timepoints. Each data point represents the mean (+/SD) of one experiment performed in duplicates.

[0058] In summary, both PD1.sub.Ec-TMDAP10.sub.IC.sup.+ and PD1.sub.Ec-TMDAP12.sub.IC.sup.+ NK-92 cells increased killing of large PD-L1.sup.+ 786-O WT tumor spheroids over a 48 hours period.

PD1.sub.EcTMDAP10.sub.IC.sup.+ and PD1.sub.EcTMDAP12.sub.IC.sup.+ pNK Cells Increase Degranulation and Cytokine Expression Against PD-L1.sup.+ Raji Cells

[0059] With the aim to implement PD1-CSR for adoptive cell therapies, the function of PD1.sub.EcTMDAP10.sub.IC and PD1.sub.EcTMDAP12.sub.IC constructs in pNK cells, isolated from healthy donor PBMCs, was tested. While PD1 surface expression in untransduced pNK cells or mock-transduced (empty vector) pNK cells remained below 5%, its expression increased on average to 42% (+/22%), 52% (+/17%) and 45% (+/16%) in the pNK cells transduced with either PD1.sub.EcTM, PD1.sub.EcTMDAP10.sub.IC or PD1.sub.EcTMDAP12.sub.IC CSR, respectively (FIG. 4A). FIG. 4A shows PD1 surface expression on untransduced or transduced CD56.sup.+ CD3.sup. pNK cells. Each dot represents PD1 surface expression on one individual donor (n=12). The mean of all 12 donors is displayed. Two separate levels of PD1 surface expression were observed and CD56.sup.+ CD16.sup.+ pNK cells were classified as either PD1.sup.dim or PD 1.sup.bright (FIG. 4 B). FIG. 4B shows a gating strategy for degranulation assays. WT and empty vector transduced cells were gated on PD 1.sup.dim population while PD1-CSR.sup.+ cells were gated on the PD 1.sup.high population. The expression of the main activating and inhibitory NK cell receptors on PD1.sup.+ PD1-CSR.sup.+ pNK cells compared to PD1.sup.+ WT or mock-transduced pNK cells from three different donors was measured by flow cytometry (FIG. 11). FIG. 11 shows flow ctometry plots depict the expression activating and inhibitory NK cell receptors on WT or PD1-CSR+ pNK cells from three different donors. Although inter-individual differences in receptor expression were observed, the genetic modification of pNK cells with PD1-CSR did not cause any consistent intra-individual phenotypic changes of pNK cells. CD107a, IFN and TNF expression were measured in a degranulation assay against PD-L1.sup.+ Raji cells and PD-L1.sup. Raji WT cells (FIG. 4 C-E, FIG. 12A-L, FIG. 13A-C). FIGS. 12A-L show the percentage of CD107a (A-D), IFN (E-H) or TNF (I-L) against PD-L1.sup.+ Raji cells or PD-L1.sup. Raji WT cells by PD1.sup.dim WT or mock-transduced pNK cells or PD 1.sup.high PD1-CSR.sup.+ pNK cells vs PD 1.sup.negative pNK cells with or without the addition of Rituximab. Each dot represents the mean of one donor performed in duplicates or triplicates (n=8). Colour code refers to the same donor. The mean+/SD of all 8 donors is displayed. Statistical significance (* p<0.05; ** p<0.01) was determined with a two-way ANOVA test. FIGS. 13A-C show the percentage of CD107a (A), IFN (B) or TNF (C) against PD-L1.sup.+ Raji cells or PD-L1.sup. Raji WT cells by PD1.sup.dim WT or mock-transduced pNK cells or PD 1.sup.dim PD1-CSR.sup.+ pNK cells vs PD 1.sup.negative pNK cells with or without the addition of Rituximab. Each dot represents the mean of one donor performed in duplicates or triplicates (n=8). Colour code refers to the same donor. The mean+/SD of all 8 donors is displayed. To facilitate direct comparison, the fold ratio of CD107a, IFN and TNF expression against PD-L1.sup.+ Raji cells compared to PD-L1.sup. Raji WT cells is displayed, with numbers below one indicating a reduction and numbers above one an increase upon PD-L1 engagement in the respective parameter (FIGS. 4C-E). FIGS. 4C-E show the Ratio of CD107a (C), IFN (D) and TNF (E) expression by different PD-CSR.sup.+ pNK cells against PD-L1.sup.+ Raji cells vs PD-L1.sup. Raji WT cells. Each dot represents the mean of one individual donor, performed in duplicates (n=8) The mean+/SD of all 8 donors is displayed. PD 1.sup.dim pNK cells from WT or mock-transduced pNK cells showed a lower CD107a expression against PD-L1.sup.+ Raji cells, significantly reducing the ratio below one. On the contrary, PD1.sup.bright PD1.sub.EcTM.sup.+ pNK cells increased degranulation against PD-L1.sup.+ Raji cells compared to WT or mock-transduced pNK cells, raising the ratio to one. PD1.sup.bright PD1.sub.EcTMDAP10.sub.IC.sup.+ and PD1.sup.bright PD1.sub.EcTMDAP12.sub.IC.sup.+ pNK cells significantly increased CD107a expression against PD-L1.sup.+ Raji cells compared to PD-L1.sup. Raji WT cells, raising the ratio to 1.5. Similarly, the ratio of IFN and TNF expression against PD-L1.sup.+ Raji cells compared to PD-L1.sup. Raji WT cells was higher than one for the PD1.sup.bright PD1.sub.EcTMDAP10.sub.IC.sup.+ and PD1.sup.bright PD1.sub.EcTMDAP12.sub.IC.sup.+ pNK cells but not PD1.sup.bright PD1.sub.EcTM.sup.+ pNK cells or PD1.sup.dim WT or PD1.sup.dim mock-transduced pNK cells. In conclusion, PD1.sub.EcTM.sup.+ pNK cells blocked native PD1-PD-L1 mediated pNK cell inhibition, while both PD1.sub.EcTMDAP10.sub.IC.sup.+ and PD1.sub.EcTMDAP12.sub.IC.sup.+ pNK cells reverted inhibition into an increased degranulation and cytokine expression against PD-L1.sup.+ Raji cells.

PD1.sub.EcTMDAP10.sub.IC.sup.+ and PD1.sub.EcTMDAP12.sub.IC.sup.+ pNK Cells Increase Degranulation and Cytokine Expression Against PD-L1.sup.+ Raji Cells Together with ADCC

[0060] After demonstrating functionality of PD1.sub.EcTMDAP10.sub.IC and PD1.sub.EcTMDAP12.sub.IC CSR in pNK cells, their ability to synergize with CD16 mediated ADCC was tested to evaluate their potential in combinatorial treatment approaches. The percentages of CD107a, IFN and TNF expression against PD-L1.sup.+ Raji cells and PD-L1.sup. Raji WT cells with or without the addition of the anti-CD20 mAb Rituximab were measured (FIG. 4 F-H, FIG. 12). FIGS. 4F-H show the Percentage of CD107a (F), IFN (G) and TNF (H) expression by different PD-CSR.sup.+ pNK cells against PD-L1.sup.+ Raji cells. Each dot represents the mean of one individual donor, performed in duplicates (n=8) The mean+/SD of all 8 donors is displayed. Rituximab increased CD107a, IFN and TNF expression against PD-L1.sup.+ Raji cells in both PD1.sup.dim WT and mock-transduced pNK cells compared to no ADCC. Likewise, PD1.sup.bright PD.sub.EcTM, PD1.sub.EcTMDAP10.sub.IC.sup.+ and PD1.sub.EcTMDAP12.sub.IC.sup.+ pNK cells showed increased CD107a, IFN and TNF expression with the addition of Rituximab compared to no ADCC. Overall, PD1.sup.bright PD1.sub.EcTMDAP10.sub.IC.sup.+ and PD1.sub.EcTMDAP12.sub.IC.sup.+ pNK showed the highest increase in CD107a, IFN and TNF expression with values reaching up to 72% (+/12%), 63% (+/12%) and 51% (+/19%), respectively, compared to WT or mock-transduced pNK cells with values approaching 42% (+/28), 26% (+/12) and 11% (+/8%), respectively. Compared to PD1.sup.bright PD1-CSR.sup.+ pNK cells, PD1.sup.dim PD1.sub.EcTMDAP10.sub.IC.sup.+ and PD1.sub.EcTMDAP12.sub.IC.sup.+ pNK cells did not increase degranulation and cytokine production against PD-L1.sup.+ Raji cells but equalized it to the CD107a, IFN and TNF expression levels against PD-L1.sup. Raji cells (FIGS. 13A-C). In conclusion, both PD1.sub.EcTMDAP10.sub.IC.sup.+ and PD1.sub.EcTMDAP12.sub.IC.sup.+ pNK cells increased degranulation and cytokine expression against PD-L1.sup.+ Raji cells with or without the addition of Rituximab and thus reverted native PD1 mediated NK cell inhibition.

PD1.sub.EcTMDAP12.sub.IC.sup.+ pNK Cells Increase Degranulation and Cytokine Expression Against PD-L1.sup.+ 786-O WT Cells

[0061] To extend these results, degranulation and cytokine expression of PD1-CSR.sup.+ pNK cells was also measured against PD-L1.sup.+ 786-O WT and PD-L1.sup. 786-O KO cells (FIGS. 13D-F). FIGS. 13D-F show the percentage of CD107a (D), IFN (E) or TNF (F) against PD-L1.sup.+ 786-O WT cells or PD-L1.sup. 786-O KO1 cells by different PD1.sup.negative vs PD 1.sup.dim vs PD 1.sup.high PD1-CSR.sup.+ pNK cells. Experiment was performed with one donor in triplicates. Statistical significance (* p<0.05; ** p<0.01) was determined with a two-way ANOVA test.

[0062] Similar to the data from NK92 cell lines, WT or mock-transduced pNK cells showed a low expression of CD107a, IFN and TNF against both PD-L1.sup.+ 786-O WT and PD-L1.sup. 786-O KO cells, with no significant differences between the target cell lines. Compared to that PD1.sup.bright PD1.sub.EcTMDAP12.sub.IC.sup.+ pNK cells, but not PD1.sup.dim PD1.sub.EcTMDAP12.sub.IC.sup.+ pNK cells, significantly increased CD107a, IFN and TNF expression against PD-L1.sup. 786-O WT cells compared to PD-L1.sup. 786-O KO cells. While PD1.sub.EcTM.sup.+ and PD1.sub.EcTMDAP10.sub.IC.sup.+ pNK cells did not correlate with a higher CD107a expression, they showed a higher IFN and TNF expression against both PD-L1.sup.+ 786-O WT and PD-L1.sup. 786-O KO cells. All in all, PD1.sup.bright PD1.sub.EcTMDAP 12.sub.IC.sup.+ pNK cells increased degranulation and cytokine expression against PD-L1.sup.+ 786-O WT cells.

PD1.sub.EcTMDAP10.sub.IC.sup.+ and PD1.sub.EcTMDAP12.sub.IC.sup.+ pNK Cells do not Alter Killing of PD-L1.sup.+ Target Cells
A) Next, the ability of the PD1-CSR enriched pNK cells to kill PD-L1.sup.+ and PD-L1.sup. target cells in a 2D and 3D co-culture model was assessed. No difference in killing of PD-L1.sup.+ Raji cells compared to PD-L1.sup. Raji WT cells by PD1.sub.EcTMDAP10.sub.IC.sup.+ or PD1.sub.EcTMDAP12.sub.IC.sup.+ pNK cells from three different donors compared to WT, mock-transduced or PD1.sub.EcTM.sup.+ pNK cells was observed (FIG. 41, FIG. 14A). FIG. 4I shows the killing of PD-L1.sup.+ Raji cells versus PD-L1.sup. Raji WT cells by different PD-CSR.sup.+ pNK cells at an E:T of 1:1. Displayed are data from 3 independent donors with each data point representing the mean (+/SD) of one experiment performed in triplicates. Statistical significance was determined with a Students t test (* p<0.05, ** p<0.01, *** p<0.001, **** p<0.0001). FIG. 14A shows killing of PD-L1.sup.+ Raji cells versus PD-L1.sup. Raji WT cells by different PD1-CSR.sup.+ pNK cells. Displayed are data from 3 independent donors with each data point representing the mean (+/SD) of one experiment performed in triplicates. Similarly, neither PD1.sub.EcTMDAP10.sub.IC.sup.+ nor PD1.sub.EcTMDAP12.sub.IC.sup.+ pNK cells increased killing of PD-L1.sup.+ 786-O WT tumor spheroids compared to PD-L1.sup. 786-O KO tumor spheroids (FIG. 14 B). FIG. 14B shows the killing of PD-L1.sup.+ 786-O WT versus PD-L1.sup. 786-O KO1 tumor spheroids by different PD1-CSR.sup.+ pNK cells. Displayed are data from one donor, representative of a total of four donors assessed. Each data point represents the mean (+/SD) of one experiment performed in triplicates. However, this lack of killing ability might be due to the fact that pNK cells were not sorted for high expression of PD1-CSR prior to use. Finally, the proliferative capacity of PD1-CSR.sup.+ pNK cells was measured (FIG. 14C). FIG. 14C shows the proliferation of PD1.sup.dim WT pNK cells or different PD1.sup.bright PD1.sup.+ CSR-pNK cells versus PD1.sup.negative pNK cells in co-culture with PD-L1.sup.+ Raji cells. Each dot represents the mean of one donor performed in triplicates (n=4). The mean+/SD of all 4 donors is displayed. Statistical significance (* p<0.05; ** p<0.01) was determined with a two-way ANOVA test. PD 1.sup.dim WT pNK cells showed a lower proliferation rate compared to PD1.sup.negative WT pNK cells. In contrast, PD1.sup.bright PD1-CSR.sup.+ pNK cells increased the proliferation rate above the value observed in PD1.sup.dim WT pNK cells closer to the value observed in PD1.sup.negative pNK cells. All in all, pNK cells, enriched with PD1.sub.EcTMDAP10.sub.IC.sup.+ and PD1.sub.EcTMDAP12.sub.IC.sup.+ pNK cells, did not show an increased killing of PD-L1.sup.+ tumor target cells.
PD1.sub.EcTMDAP10.sub.IC.sup.+ and PD1.sub.EcTMDAP12.sub.IC.sup.+ pNK Cells from Patients with Newly Diagnosed MM Increase Degranulation and Cytokine Production Against Autologous PD-L1.sup.+ Tumor Samples

[0063] After establishing that both PD1.sub.EcTMDAP10.sub.IC.sup.+ and PD1.sub.EcTMDAP12.sub.IC.sup.+ pNK cells from healthy donors increased degranulation and cytokine expression against PD-L1.sup.+ tumor cell lines, their function in pNK cells from patients with MM against autologous bone marrow mononuclear cells (BM MNC) was evaluated. For this, PBMCs from three patients with newly diagnosed MM were expanded for 13 days prior to transduction with lentiviral vectors, encoding PD1.sub.EcTM, PD1.sub.EcTMDAP10.sub.IC and PD1.sub.EcTMDAP12.sub.IC CSR. Degranulation was performed on day 4 after transduction with approximately 40% CD56.sup.+CD3.sup. pNK cells among the expanded PBMCs (FIG. 5A). FIG. 5A contains flow cytometry plots show the gating strategy of BM MNC (upper panel) and PBMCs (lower panel) from newly diagnosed MM patients. CD138 expression on BM MNC, indicative of malignant plasma cells, was measured by flow cytometry and only detected in BM MNC from donor 1 (MM1 BM MNC), but not donor 2 (MM2 BM MNC) or donor 3 (MM3 BM MNC). A more detailed phenotypic analysis of BM MNC from donor 1 and donor 2 is provided in figure S10. PD-L1 and PD-L2 expression was detected on CD138.sup.+ cells, but only at very low levels on CD138.sup. BM MNCs (FIG. 5A, FIGS. 15A-B). FIGS. 15A-B show that specifically, BM MNC were gated on single cells and thereafter live lineage.sup.+ (lin.sup.+) cells or live lineage.sup. (lin.sup.) cells. Lin.sup.+ cells are defined as CD3.sup.+ CD11b.sup.+ CD14.sup.+ cells. The live lin.sup. cells were further classified based on the expression of CD38 and CD138 cells to be able to distinguish double positive malignant plasma cells. Thus, the expression of NK cell ligands was analysed on three different cell populations, namely live lin.sup.+ cells versus live lin.sup. CD38.sup.CD138.sup. cells versus live lin.sup. CD38.sup.+CD138.sup.+ cells, for donor 1. Since no malignant plasma cells could be detected in the BM MNC from donor 2 only two cell populations, namely live lin.sup.+ cells versus live lin.sup. CD38.sup.CD138.sup. cells were further analysed. The histograms depict the MFI of different NK cell ligands on the above described cell populations. The percentage of PD1.sup.bright cells on CD56.sup.+CD3.sup. pNK cells ranged between 7% to 20% depending on the CSR construct and donor (FIG. 5 B, F, J). FIG. 5 B shows the Percentage of PD1.sup.bright cells among CD56.sup.+CD3.sup. pNK cells from MM donor 1. FIG. 5F shows the percentage of PD1.sup.bright cells among CD56.sup.+CD3.sup. pNK cells from MM donor 2 FIG. 5J shows the percentage of PD1.sup.bright cells among CD56.sup.+CD3.sup. pNK cells from MM donor 3 Both PD 1 bright PD1.sub.EcTMDAP10.sub.IC.sup.+ and PD1.sub.EcTMDAP12.sub.IC.sup.+ pNK cells from donor 1 increased CD107a, IFN and TNF expression significantly against autologous BM MNC two- to three fold compared to PD1.sup.negative pNK cells (FIG. 5 C-E). FIG. 5 C-E show the percentage of CD107a (C), IFN (D) and TNF (E) by different PD1.sup.negative vs PD1.sup.bright PD1-CSR.sup.+ pNK cells from donor 1 against autologous BM MNC. PD1.sup.bright PD1.sub.EcTMDAP10.sub.IC.sup.+ and PD1.sub.EcTMDAP12.sub.IC.sup.+ pNK cells from donor 2 did not increase CD107a expression, but showed an increased IFN and TNF expression compared to PD1.sup.negative pNK cells (FIG. 5 G-I). FIG. 5 G-I show the percentage of CD107a (G), IFN (H) and TNF (I) by different PD 1.sup.negative vs PD1.sup.bright PD-CSR.sup.+ pNK cells from donor 2 against autologous BM MNC. PD1.sup.bright PD1.sub.EcTMDAP10.sub.IC.sup.+ and PD1.sub.EcTMDAP12.sub.IC.sup.+ pNK cells from donor 3 did not increase CD107a, IFN or TNF expression, but showed a slight decreased IFN response (FIG. 5 K-M). FIG. 5 K-M show the percentage of CD107a (K), IFN (L) and TNF (M) by different PD1.sup.negative vs PD 1.sup.bright PD-CSR.sup.+ pNK cells from donor 3 against autologous BM MNC. Displayed are data from each donor with each data point representing the mean (+/SD) of one experiment performed in duplicates. Statistical significance was determined with a Students t test (* p<0.05, ** p<0.01). These data confirm that PD1.sub.EcTMDAP10.sub.IC.sup.+ and PD1.sub.EcTMDAP12.sub.IC.sup.+ pNK augment degranulation and cytokine expression against autologous CD138.sup.+ PD-L1.sup.+ malignant bone marrow cells.

DISCUSSION

[0064] In this paper, we demonstrate that PD1-based CSR revert NK cell inhibition imposed by PD1-PD-L1 engagement and, hence, are able to skew the response towards NK cell activation. The results emphasize that replacement of the ITIM and ITSM domain of PD1 by either an ITAM or YINM motif confers a higher degranulation and cytokine production by both NK-92 and pNK cells towards PD-L1 expressing target cells in 2D and 3D tumor co-culture models. Most importantly, pNK cells from patients with MM were successfully transduced to express PD1.sub.EcTMDAP10.sub.IC or PD1.sub.EcTMDAP12.sub.IC CSR and showed higher degranulation and cytokine expression against autologous CD138.sup.+ PD-L1.sup.+ tumor samples.

[0065] Different to CAR, the present CSR shall enhance NK cell cytotoxicity in concert with general target cell recognition and tip the balance towards activation in an immunosuppressive TME. The aim in the present study was to design CSR that are not activating NK cells towards healthy tissue where PD1 ligands are abundantly expressed and can explain common side-effects of immune-checkpoint blockade with mAb [26]. Therefore, the human canonical sequence of PD1 without any further modification was employed. Furthermore, only one signaling domain was used compared to the second and third generation CARs that are designed with different costimulatory domains. Whether PD-L1 targeting CAR NK cells would, however, cause severe side-effects is yet not elucidated. PD-L1 targeting high-affinity NK-92 cells (PD-L1-t-haNK) showed promising preclinical results and are currently in early phase clinical trials (NCT04050709, NCT04847466, NCT04927884) [27]. The results and toxicity profile of these PD-L1 CAR expressing NK-92 cells are eagerly awaited. However, employing the extracellular domain of PD1, instead of the single-chain fragment targeting PD-L1, poses the advantage of recognizing both PD-L1 and PD-L2. In humans, PD-L2 is mainly expressed on professional antigen-presenting cells and over-expressed in cancer cells as well as stromal and epithelial cells of several tumor types [28]. Targeting both PD1 ligands was associated with a better clinical outcome in lung cancer [29]. Besides PD1, NK cells express a plethora of canonical checkpoints that are important both for control of activation as well as retention of educated state upon adoptive transfer [30, 31]. The surface retained checkpoints include NKG2A, T cell immunoreceptor with Ig and ITIM domains (TIGIT), Lymphocyte Activating Gene 3 (LAG3), T cell immunoglobulin domain and mucin domain 3 (TIM3) as well as inhibitory KIRs. It is conceivable that some of these receptors could also be engineered in a similar fashion as described here for PD1. PD1-CSR.sup.+ pNK cells from MM patient number 3 showed a decrease in IFN production against autologous BM MNCs. Unfortunately, we were not able to determine the factors leading to this small but significant reduction in cytokine expression. Taken the complexity of the immunosuppressive TME into account, it is conceivable that PD1-CSR expressing NK cells might be inhibited by other soluble or receptor-mediated factors. A solution could be the combination of PD1-CSR.sup.+ pNK cells with other immune checkpoint targeting therapies. Monalizumab, a monoclonal antibody against NKG2A that is widely used in clinical trials, promoted both NK and CD8.sup.+ T cell anti-cancer functions, especially in combination with PD1-PD-L1 blockade [30]. In line with this, disruption of NKG2A in primary NK cells improved NK cell cytotoxicity against primary MM cells [32].

[0066] Blockade of immune checkpoint receptors such as PD1 or TIGIT with mAb was shown to restore NK cell effector functions against tumor cells [15, 33]. However, the majority of available antibodies merely blocks the PD1-PD-L1 interaction and does not induce ADCC to enhance NK cell functions. So far, avelumab is the only PD-L1-targeting antibody available with ADCC function [34]. To date, no clinical study evaluated the combination of avelumab with adoptive NK cell therapy. Here, we show that both PD1.sub.EcTMDAP10.sub.IC and PD1.sub.EcTMDAP12.sub.IC revert PD1 based NK cell inhibition, with PD1.sub.EcTMDAP12.sub.IC.sup.+ cells eliciting a higher increase. In line with our present findings, a PD1-NKG2D CSR with 4-1BB costimulatory domain enhanced killing of PD-L1.sup.+ target cells, but did not increase cytokine release [35]. NKG2D is a type-II transmembrane protein that dimerizes and forms a hexameric structure with four DAP10 molecules [36]. Moreover, a DAP12 based CAR increased both target cell killing and IFN production by pNK cells [37]. The effector cell functionality of CAR-DAP12 transduced NK cells was higher than CAR-CD3 transduced cells. Both PD1-CSR constructs were able to revert NK cell hypofunctionality induced by native PD1-PD-L1 signaling. However, this increase was only observed in transduced PD1.sup.bright pNK cells. In contrast, PD1.sup.dim cells blocked native PD1-PD-L1 engagement and restored degranulation and cytokine secretion. With 5-10% of PD1.sup.bright cells within the NK cell product, we have not observed an overall higher target cell killing.

[0067] The present findings indicate that PD1-CSR.sup.+ pNK cells could be employed in combinatorial treatment approaches such as in combination with mAb. Therefore, the ability of PD1-CSR.sup.+ pNK to engage in ADCC was studied and demonstrated that both PD1.sub.EcTMDAP10.sub.IC.sup.+ and PD1.sub.EcTMDAP12.sub.IC.sup.+ synergistically increased degranulation against PD-L1.sup.+ Raji cells in combination with Rituximab. Another mAb that is known to work mainly via ADCC is Daratumumab that targets CD38 expressed on malignant plasma cells [38]. Daratumumab is approved as a frontline therapy in patients with newly diagnosed MM [39]. Furthermore, NK cell based therapies are currently in early-phase clinical trials for MM (NCT04558853, EudraCT: 2020-000994-26) [40, 41]. The results of these trials are eagerly awaited. We envision an indication for PD1-CSR.sup.+ pNK cells in patients with MM, a disease in which immune checkpoint blockade with mAb has failed. Monotherapy with the monoclonal PD1 antibody nivolumab in heavily pretreated MM patients only led to a stable disease without significant disease regression [42]. Two phase III clinical trials, studying the combinatorial application of PD1 receptor blockade by pembrolizumab with an immunomodulatory drug (IMiD) and dexamethasone (Keynote-183, Keynote-185), had to be suspended in 2017 due to dissatisfactory interim results, revealing increased death rates among patients that were enrolled in the experimental arm [43, 44]. Specifically, severe cardiac events, myocarditis and pneumonia were higher in the group that received pembrolizumab, causing increased death rates. Studies are ongoing to determine patient cohorts, combination regimens and treatment agents to efficiently target the PD1-PD-L1 axis in MM and improve patient outcome. Recently, avelumab showed a good toxicity profile but unfortunately no clinical benefit in combination with radiotherapy for relapsed or refractory MM [45]. Promisingly, our preclinical data show that both PD1.sub.EcTMDAP10.sub.IC.sup.+ and PD1.sub.EcTMDAP12.sub.IC.sup.+ pNK cells from newly diagnosed MM patients increase degranulation and cytokine production against autologous PD-L1.sup.+ CD138.sup.+ BM MNC while sparing PD-L1.sup. CD138.sup. samples. However, PD1-CSR.sup.+ pNK cells could potentially also target PD-L1 expressed on other cells of the TME such as myeloid-derived suppressor cells (MDSC) or tumor-associated macrophages (TAM) and thus re-shape the TME via increased cytokine expression or reduction of pro-tumorigenic cell numbers. Further studies to advance PD1-CSR.sup.+ pNK cells for the treatment of MM; e.g., in combination with Daratumumab, are warranted. Specifically, PD1-CSR should be tested in pNK cells from a larger cohort of patients with MM to confirm our observations reported here.

[0068] In conclusion, we have here demonstrated that PD1.sub.EcTMDAP10.sub.IC.sup.+ and PD1.sub.EcTMDAP12.sub.IC.sup.+ CSR revert PD1-PD-L1 induced NK cell inhibition. PD1-CSR.sup.+ NK cells hence represent a feasible approach for future adoptive NK cell-based immunotherapy platforms in human cancer treatment.

TABLE-US-00003 SEQIDNOS SEQIDNO:1 PD1.sub.EcTMSEQIDNO1 SEQIDNO:2 AA1-170ofPD1SEQIDNO2 SEQIDNO:3 AlonghingeregionSEQIDNO3 SEQIDNO:4 AAsequence153-220ofCD28SEQIDNO4 SEQIDNO:5 AA52-164oftheCD3proteinSEQIDNO5 SEQIDNO:6 PD1-CD28-CD3zSEQIDNO6 SEQIDNO:7 AA239-304oftheNKp46proteinSEQIDNO7 SEQIDNO:8 PD1-NKp46SEQIDNO8 SEQIDNO:9 fulllengthDAP10(AA19-93)SEQIDNO9 SEQIDNO:10 DAP12(AA22-113)SEQIDNo:10 SEQIDNO:11 PD1AAsequence1to212SEQIDNO11 SEQIDNO:12 AA77-93ofDAP10SEQIDNO12 SEQIDNO:13 AA73-113ofDAP12SEQIDNO13 SEQIDNO:14 PD1EcDAP10TM-ICSEQIDNO14 SEQIDNO:15 PD1EcDAP12TM-ICSEQIDNO15 SEQIDNO:16 PD1EcTMDAP10ICSEQIDNO:16 SEQIDNO:17 PD1EcTMDAP12ICSEQIDNO17 SEQIDNO:18 LeGO-iG2(Addgeneplasmid27341)SEQIDNO18 SEQIDNO:19 LeGO-MCS-GSG-T2A-eGFPSEQIDNO19 SEQIDNO:20: KO1(guideRNAsequenceTACCGCTGCATGATCAGCTATGG) (SEQIDNO:20) SEQIDNO:21 KO2(guideRNAsequence:TACCATACTCTACCACATATAGG) (SEQIDNO:21) SEQIDNO:22 SequenceinsertedintoVectorMAPforvectorLeGO_MCS-GSG-T2A- eGFP PD1.sub.EcTMPD1.sub.EcTM SEQIDNO1 ggatccgccaccatgcagatcccacaggcgccctggccagtcgtctgggcggtgctacaactgggctggcggccaggatggttcttag actccccagacaggccctggaacccccccaccttctccccagccctgctcgtggtgaccgaaggggacaacgccaccttcacctgca gcttctccaacacatcggagagcttcgtgctaaactggtaccgcatgagccccagcaaccagacggacaagctggccgccttccccg aggaccgcagccagcccggccaggactgccgcttccgtgtcacacaactgcccaacgggcgtgacttccacatgagcgtggtcaggg cccggcgcaatgacagcggcacctacctctgtggggccatctccctggcccccaaggcgcagatcaaagagagcctgcgggcagag ctcagggtgacagagagaagggcagaagtgcccacagcccaccccagcccctcacccaggccagccggccagttccaaaccctggt ggttggtgtcgtgggcggcctgctgggcagcctggtgctgctagtctgggtcctggccgtcatctgctcccgggccgcacgagggaca ataggagccaggcgcaccggccagcccctgaaggagtctagataagaattc SEQIDNo2 ATGCAGATCCCACAGGCGCCCTGGCCAGTCGTCTGGGCGGTGCTACAACTGGGCTGGCGGCCAGGAT GGTTCTTAGACTCCCCAGACAGGCCCTGGAACCCCCCCACCTTCTCCCCAGCCCTGCTCGTGGTGACC GAAGGGGACAACGCCACCTTCACCTGCAGCTTCTCCAACACATCGGAGAGCTTCGTGCTAAACTGGTA CCGCATGAGCCCCAGCAACCAGACGGACAAGCTGGCCGCCTTCCCCGAGGACCGCAGCCAGCCCGGC CAGGACTGCCGCTTCCGTGTCACACAACTGCCCAACGGGCGTGACTTCCACATGAGCGTGGTCAGGG CCCGGCGCAATGACAGCGGCACCTACCTCTGTGGGGCCATCTCCCTGGCCCCCAAGGCGCAGATCAA AGAGAGCCTGCGGGCAGAGCTCAGGGTGACAGAGAGAAGGGCAGAAGTGCCCACAGCCCACCCCA GCCCCTCACCCAGGCCAGCCGGCCAGTTCCAAACCCTGGTG SEQIDNo3 CCACCACGACGCCAGCGCCGCGACCACCAACACCGGCGCCCACCATCGCGTCGCAGCCCCTGTCCCT GCGCCCAGAGGCGTGCCGGCCAGCGGCGGGGGGCGCAGTGCACACGAGGGGGCTGGACTTCGCCC CTAGGAAAATTGAAGTTATGTATCCTCCTCCTTACCTAGACAATGAGAAGAGCAATGGAACCATTATCC ATGTGAAAGGGAAACACCTTTGTCCAAGTCCCCTATTTCCCGGACCTTCTAAGCCC SEQIDNo4 TTTTGGGTGCTGGTGGTGGTTGGTGGAGTCCTGGCTTGCTATAGCTTGCTAGTAACAGTGGCCTTTAT TATTTTCTGGGTG SEQIDNo5 AGGAGTAAGAGGAGCAGGCTCCTGCACAGTGACTACATGAACATGACTCCCCGCCGCCCCGGGCCCA CCCGCAAGCATTACCAGCCCTATGCCCCACCACGCGACTTCGCAGCCTATCGCTCCAGAGTGAAGTTC AGCAGGAGCGCAGACGCCCCCGCGTACCAGCAGGGCCAGAACCAGCTCTATAACGAGCTCAATCTAG GACGAAGAGAGGAGTACGATGTTTTGGACAAGAGACGTGGCCGGGACCCTGAGATGGGGGGAAAG CCGAGAAGGAAGAACCCTCAGGAAGGCCTGTACAATGAACTGCAGAAAGATAAGATGGCGGAGGCC TACAGTGAGATTGGGATGAAAGGCGAGCGCCGGAGGGGCAAGGGGCACGATGGCCTTTACCAGGGT CTCAGTACAGCCACCAAGGACACCTACGACGCCCTTCACATGCAGGCCCTGCCCCCTCGCTAA SEQIDNO6 ggatccgccaccatgcagatcccacaggcgccctggccagtcgtctgggcggtgctacaa 60 ctgggctggcggccaggatggttcttagactccccagacaggccctggaacccccccacc 120 ttctccccagccctgctcgtggtgaccgaaggggacaacgccaccttcacctgcagcttc 180 tccaacacatcggagagcttcgtgctaaactggtaccgcatgagccccagcaaccagacg 240 gacaagctggccgccttccccgaggaccgcagccagcccggccaggactgccgcttccgt 300 gtcacacaactgcccaacgggcgtgacttccacatgagcgtggtcagggcccggcgcaat 360 gacagcggcacctacctctgtggggccatctccctggcccccaaggcgcagatcaaagag 420 agcctgcgggcagagctcagggtgacagagagaagggcagaagtgcccacagcccacccc 480 agcccctcacccaggccagccggccagttccaaaccctggtgctcgaggctaagcccacc 540 acgacgccagcgccgcgaccaccaacaccggcgcccaccatcgcgtcgcagcccctgtcc 600 ctgcgcccagaggcgtgccggccagcggcggggggcgcagtgcacacgagggggctggac 660 ttcgcccctaggaaaattgaagttatgtatcctcctccttacctagacaatgagaagagc 720 aatggaaccattatccatgtgaaagggaaacacctttgtccaagtcccctatttcccgga 780 ccttctaagcccttttgggtgctggtggtggttggtggagtcctggcttgctatagcttg 840 ctagtaacagtggcctttattattttctgggtgaggagtaagaggagcaggctcctgcac 900 agtgactacatgaacatgactccccgccgccccgggcccacccgcaagcattaccagccc 960 tatgccccaccacgcgacttcgcagcctatcgctccagagtgaagttcagcaggagcgca 1020 gacgcccccgcgtaccagcagggccagaaccagctctataacgagctcaatctaggacga 1080 agagaggagtacgatgttttggacaagagacgtggccgggaccctgagatggggggaaag 1140 ccgagaaggaagaaccctcaggaaggcctgtacaatgaactgcagaaagataagatggcg 1200 gaggcctacagtgagattgggatgaaaggcgagcgccggaggggcaaggggcacgatggc 1260 ctttaccagggtctcagtacagccaccaaggacacctacgacgcccttcacatgcaggcc 1320 ctgccccctcgctaagaattc 1341 SequenceIDNo7 Gagacgggactccagaaagaccatgccctctgggatcacactgcccagaatctccttcggatgggcctggcctttctagtcctggtgg ctctagtgtggttcctggttgaagactggctcagcaggaagaggactagagagcgagccagcagagcttccacttgggaaggcagga gaaggctgaacacacagactctttga SEQIDNO8PD1-NKp46PD1-NKp46 GGATCCGCCACCATGCAGATCCCACAGGCGCCCTGGCCAGTCGTCTGGGCGGTGCTACAACTGGGCT GGCGGCCAGGATGGTTCTTAGACTCCCCAGACAGGCCCTGGAACCCCCCCACCTTCTCCCCAGCCCTG CTCGTGGTGACCGAAGGGGACAACGCCACCTTCACCTGCAGCTTCTCCAACACATCGGAGAGCTTCGT GCTAAACTGGTACCGCATGAGCCCCAGCAACCAGACGGACAAGCTGGCCGCCTTCCCCGAGGACCGC AGCCAGCCCGGCCAGGACTGCCGCTTCCGTGTCACACAACTGCCCAACGGGCGTGACTTCCACATGA GCGTGGTCAGGGCCCGGCGCAATGACAGCGGCACCTACCTCTGTGGGGCCATCTCCCTGGCCCCCAA GGCGCAGATCAAAGAGAGCCTGCGGGCAGAGCTCAGGGTGACAGAGAGAAGGGCAGAAGTGCCCA CAGCCCACCCCAGCCCCTCACCCAGGCCAGCCGGCCAGTTCCAAACCCTGGTGctcgaggagacgggactcc agaaagaccatgccctctgggatcacactgcccagaatctccttoggatgggcctggcctttctagtcctggtggctctagtgtggttcc tggttgaagactggctcagcaggaagaggactagagagcgagccagcagagcttccacttgggaaggcaggagaaggctgaacac acagactctttgatctagagaattc SequenceIDNo9 cagacgactccaggagagagatcatcactccctgccttttaccctggcacttcaggctcttgttccggatgtgggtccctctctctgccg ctcctggcaggcctcgtggctgctgatgcggtggcatcgctgctcatcgtgggggcggtgttcctgtgcgcacgcccacgccgcagccc cgcccaagaagatggcaaagtctacatcaacatgccaggcaggggctga SequenceIDNo10 Ctccgtcctgtccaggcccaggcccagagcgattgcagttgctctacggtgagcccgggcgtgctggcagggatcgtgatgggagac ctggtgctgacagtgctcattgccctggccgtgtacttcctgggccggctggtccctcgggggcgaggggctgcggaggcagcgaccc ggaaacagcgtatcactgagaccgagtcgccttatcaggagctccagggtcagaggtcggatgtctacagcgacctcaacacacaga ggccgtattacaaatga SequenceIDNo11 atgcagatcccacaggcgccctggccagtcgtctgggcggtgctacaactgggctggcggccaggatggttcttagactccccagaca ggccctggaacccccccaccttctccccagccctgctcgtggtgaccgaaggggacaacgccaccttcacctgcagcttctccaacac atcggagagcttcgtgctaaactggtaccgcatgagccccagcaaccagacggacaagctggccgccttccccgaggaccgcagcc agcccggccaggactgccgcttccgtgtcacacaactgcccaacgggcgtgacttccacatgagcgtggtcagggcccggcgcaatg acagcggcacctacctctgtggggccatctccctggcccccaaggcgcagatcaaagagagcctgcgggcagagctcagggtgaca gagagaagggcagaagtgcccacagcccaccccagcccctcacccaggccagccggccagttccaaaccctggtggttggtgtcgt gggcggcctgctgggcagcctggtgctgctagtctgggtcctggccgtcatctgctcccgggccgcacgagggacaataggagccag gcgcaccggccagcccctgaaggag SequenceIDNo12 agccccgcccaagaagatggcaaagtctacatcaacatgccaggcaggggctga SequenceIDNo13 Ggggctgcggaggcagcgacccggaaacagcgtatcactgagaccgagtcgccttatcaggagctccagggtcagaggtcggatgt ctacagcgacctcaacacacagaggccgtattacaaatga SEQIDNO:14PD1.sub.EcDAP10.sub.TM-IC GGATCCGCCACCATGCAGATCCCACAGGCGCCCTGGCCAGTCGTCTGGGCGGTGCTACAACTGGGCT GGCGGCCAGGATGGTTCTTAGACTCCCCAGACAGGCCCTGGAACCCCCCCACCTTCTCCCCAGCCCTG CTCGTGGTGACCGAAGGGGACAACGCCACCTTCACCTGCAGCTTCTCCAACACATCGGAGAGCTTCGT GCTAAACTGGTACCGCATGAGCCCCAGCAACCAGACGGACAAGCTGGCCGCCTTCCCCGAGGACCGC AGCCAGCCCGGCCAGGACTGCCGCTTCCGTGTCACACAACTGCCCAACGGGCGTGACTTCCACATGA GCGTGGTCAGGGCCCGGCGCAATGACAGCGGCACCTACCTCTGTGGGGCCATCTCCCTGGCCCCCAA GGCGCAGATCAAAGAGAGCCTGCGGGCAGAGCTCAGGGTGACAGAGAGAAGGGCAGAAGTGCCCA CAGCCCACCCCAGCCCCTCACCCAGGCCAGCCGGCCAGTTCCAAACCCTGGTGctcgagcagacgactccag gagagagatcatcactccctgccttttaccctggcacttcaggctcttgttccggatgtgggtccctctctctgccgctcctggcaggcct cgtggctgctgatgcggtggcatcgctgctcatcgtgggggcggtgttcctgtgcgcacgcccacgccgcagccccgcccaagaagat ggcaaagtctacatcaacatgccaggcaggggctgatctagagaattc SEQIDNO:15 PD1.sub.EcDAP12.sub.TM-IC GGATCCGCCACCATGCAGATCCCACAGGCGCCCTGGCCAGTCGTCTGGGCGGTGCTACAACTGGGCT GGCGGCCAGGATGGTTCTTAGACTCCCCAGACAGGCCCTGGAACCCCCCCACCTTCTCCCCAGCCCTG CTCGTGGTGACCGAAGGGGACAACGCCACCTTCACCTGCAGCTTCTCCAACACATCGGAGAGCTTCGT GCTAAACTGGTACCGCATGAGCCCCAGCAACCAGACGGACAAGCTGGCCGCCTTCCCCGAGGACCGC AGCCAGCCCGGCCAGGACTGCCGCTTCCGTGTCACACAACTGCCCAACGGGCGTGACTTCCACATGA GCGTGGTCAGGGCCCGGCGCAATGACAGCGGCACCTACCTCTGTGGGGCCATCTCCCTGGCCCCCAA GGCGCAGATCAAAGAGAGCCTGCGGGCAGAGCTCAGGGTGACAGAGAGAAGGGCAGAAGTGCCCA CAGCCCACCCCAGCCCCTCACCCAGGCCAGCCGGCCAGTTCCAAACCCTGGTGctcgagctccgtcctgtcca ggcccaggcccagagcgattgcagttgctctacggtgagcccgggcgtgctggcagggatcgtgatgggagacctggtgctgacagt gctcattgccctggccgtgtacttcctgggccggctggtccctcgggggcgaggggctgcggaggcagcgacccggaaacagcgtat cactgagaccgagtcgccttatcaggagctccagggtcagaggtcggatgtctacagcgacctcaacacacagaggccgtattacaa atgatctagagaattc SEQIDNO:16 PD1.sub.EcTMDAP10.sub.IC Ggatccgccaccatgcagatcccacaggcgccctggccagtcgtctgggcggtgctacaactgggctggcggccaggatggttctta gactccccagacaggccctggaacccccccaccttctccccagccctgctcgtggtgaccgaaggggacaacgccaccttcacctgc agcttctccaacacatcggagagcttcgtgctaaactggtaccgcatgagccccagcaaccagacggacaagctggccgccttcccc gaggaccgcagccagcccggccaggactgccgcttccgtgtcacacaactgcccaacgggcgtgacttccacatgagcgtggtcagg gcccggcgcaatgacagcggcacctacctctgtggggccatctccctggcccccaaggcgcagatcaaagagagcctgcgggcaga gctcagggtgacagagagaagggcagaagtgcccacagcccaccccagcccctcacccaggccagccggccagttccaaaccctg gtggttggtgtcgtgggcggcctgctgggcagcctggtgctgctagtctgggtcctggccgtcatctgctcccgggccgcacgagggac aataggagccaggcgcaccggccagcccctgaaggagtctagaagccccgcccaagaagatggcaaagtctacatcaacatgcca ggcaggggctgagaattc SEQIDNO:17 PD1.sub.EcTMDAP12.sub.IC ggatccgccaccatgcagatcccacaggcgccctggccagtcgtctgggcggtgctacaactgggctggcggccaggatggttcttag actccccagacaggccctggaacccccccaccttctccccagccctgctcgtggtgaccgaaggggacaacgccaccttcacctgca gcttctccaacacatcggagagcttcgtgctaaactggtaccgcatgagccccagcaaccagacggacaagctggccgccttccccg aggaccgcagccagcccggccaggactgccgcttccgtgtcacacaactgcccaacgggcgtgacttccacatgagcgtggtcaggg cccggcgcaatgacagcggcacctacctctgtggggccatctccctggcccccaaggcgcagatcaaagagagcctgcgggcagag ctcagggtgacagagagaagggcagaagtgcccacagcccaccccagcccctcacccaggccagccggccagttccaaaccctggt ggttggtgtcgtgggcggcctgctgggcagcctggtgctgctagtctgggtcctggccgtcatctgctcccgggccgcacgagggaca ataggagccaggcgcaccggccagcccctgaaggagtctagaggggctgcggaggcagcgacccggaaacagcgtatcactgaga ccgagtcgccttatcaggagctccagggtcagaggtcggatgtctacagcgacctcaacacacagaggccgtattacaaatgagaat tc SEQIDNO:18 LeGoiG2(Addgeneplasmid27341) gtcgacggatcgggagatctcccgatcccctatggtgcactctcagtacaatctgctctgatgccgcatagttaagccagtatctgctcc ctgcttgtgtgttggaggtcgctgagtagtgcgcgagcaaaatttaagctacaacaaggcaaggcttgaccgacaattgcatgaagaa tctgcttagggttaggcgttttgcgctgcttcgcgatgtacgggccagatatacgcgttgacattgattattgactagttattaatagtaa tcaattacggggtcattagttcatagcccatatatggagttccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaa cgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaatgggtggagtatt tacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcc tggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgcggt tttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgtttt ggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggagg tctatataagcagcgcgttttgcctgtactgggtctctctggttagaccagatctgagcctgggagctctctggctaactagggaaccca ctgcttaagcctcaataaagcttgccttgagtgcttcaagtagtgtgtgcccgtctgttgtgtgactctggtaactagagatccctcagac ccttttagtcagtgtggaaaatctctagcagtggcgcccgaacagggacttgaaagcgaaagggaaaccagaggagctctctcgacg caggactcggcttgctgaagcgcgcacggcaagaggcgaggggcggcgactggtgagtacgccaaaaattttgactagcggaggct agaaggagagagatgggtgcgagagcgtcagtattaagcgggggagaattagatcgcgatgggaaaaaattcggttaaggccagg gggaaagaaaaaatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagaaac atcagaaggctgtagacaaatactgggacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatacagt agcaaccctctattgtgtgcatcaaaggatagagataaaagacaccaaggaagctttagacaagatagaggaagagcaaaacaaa agtaagaccaccgcacagcaagcggccggccgcgctgatcttcagacctggaggaggagatatgagggacaattggagaagtgaa ttatataaatataaagtagtaaaaattgaaccattaggagtagcacccaccaaggcaaagagaagagtggtgcagagagaaaaaa gagcagtgggaataggagctttgttccttgggttcttgggagcagcaggaagcactatgggcgcagcgtcaatgacgctgacggtac aggccagacaattattgtctggtatagtgcagcagcagaacaatttgctgagggctattgaggcgcaacagcatctgttgcaactcac agtctggggcatcaagcagctccaggcaagaatcctggctgtggaaagatacctaaaggatcaacagctcctggggatttggggttg ctctggaaaactcatttgcaccactgctgtgccttggaatgctagttggagtaataaatctctggaacagatttggaatcacacgacct ggatggagtgggacagagaaattaacaattacacaagcttaatacactccttaattgaagaatcgcaaaaccagcaagaaaagaat gaacaagaattattggaattagataaatgggcaagtttgtggaattggtttaacataacaaattggctgtggtatataaaattattcata atgatagtaggaggcttggtaggtttaagaatagtttttgctgtactttctatagtgaatagagttaggcagggatattcaccattatcgt ttcagacccacctcccaaccccgaggggacccgacaggcccgaaggaatagaagaagaaggtggagagagagacagagacagat ccattcgattagtgaacggatcggcactgcgtgcgccaattctgcagacaaatggcagtattcatccacaattttaaaagaaaagggg ggattggggggtacagtgcaggggaaagaatagtagacataatagcaacagacatacaaactaaagaattacaaaaacaaattac aaaaattcaaaattttcgggtttattacagggacagcagagatccagtttggttagtaccgggcccgctctagtcgaggtcgacggtat cgataagctcgcttcacgagattccagcaggtcgagggacctaataacttcgtatagcatacattatacgaagttatattaagggttcc aagcttaagcggccggccgctgaaagaccccacctgtaggtttggcaagctagctgcagtaacgccattttgcaaggcatggaaaaa taccaaaccaagaatagagaagttcagatcaagggcgggtacatgaaaatagctaacgttgggccaaacaggatatctgcggtgag cagtttcggccccggcccggggccaagaacagatggtcaccgcagtttcggccccggcccgaggccaagaacagatggtccccaga tatggcccaaccctcagcagtttcttaagacccatcagatgtttccaggctcccccaaggacctgaaatgaccctgcgccttatttgaat taaccaatcagcctgcttctcgcttctgttcgcgcgcttctgcttcccgagctctataaaagagctcacaacccctcactcggcgcgcca gtcctccgattgactgagtcgcccggatcccagtgtggtggtacgggaattcctgcaggcctcgacgagggccggcgcgccgcggcc gctacgtaaattccgccccccccccccctctccctcccccccccctaacgttactggccgaagccgcttggaataaggccggtgtgcgt ttgtctatatgttattttccaccatattgccgtcttttggcaatgtgagggcccggaaacctggccctgtcttcttgacgagcattcctagg ggtctttcccctctcgccaaaggaatgcaaggtctgttgaatgtcgtgaaggaagcagttcctctggaagcttcttgaagacaaacaac gtctgtagcgaccctttgcaggcagcggaaccccccacctggcgacaggtgcctctgcggccaaaagccacgtgtataagatacacc tgcaaaggcggcacaaccccagtgccacgttgtgagttggatagttgtggaaagagtcaaatggctctcctcaagcgtattcaacaag gggctgaaggatgcccagaaggtaccccattgtatgggatctgatctggggcctcggtgcacatgctttacatgtgtttagtcgaggtt aaaaaaacgtctaggccccccgaaccacggggacgtggttttcctttgaaaaacacgatgataatatggccacaaccatggtgagca agggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcg agggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcg tgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccga aggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccc tggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagc cacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgt gcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtc cgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatgga cgagctgtacaagtaaagcggccggccgccagcacagtggtcgaaattcgtcgagggacctaataacttcgtatagcatacattatac gaagttatacatgtttaagggttccggttccactaggtacaattcgatatcaagcttatcgataatcaacctctggattacaaaatttgtg aaagattgactggtattcttaactatgttgctccttttacgctatgtggatacgctgctttaatgcctttgtatcatgctattgcttcccgtat ggctttcattttctcctccttgtataaatcctggttgctgtctctttatgaggagttgtggcccgttgtcaggcaacgtggcgtggtgtgca ctgtgtttgctgacgcaacccccactggttggggcattgccaccacctgtcagctcctttccgggactttcgctttccccctccctattgcc acggcggaactcatcgccgcctgccttgcccgctgctggacaggggctcggctgttgggcactgacaattccgtggtgttgtcgggga aatcatcgtcctttccttggctgctcgcctgtgttgccacctggattctgcgcgggacgtccttctgctacgtcccttcggccctcaatcca gcggaccttccttcccgcggcctgctgccggctctgcggcctcttccgcgtcttcgccttcgccctcagacgagtcggatctccctttggg ccgcctccccgcatcgataccgtcgacctcgatcgagacctagaaaaacatggagcaatcacaagtagcaatacagcagctaccaat gctgattgtgcctggctagaagcacaagaggaggaggaggtgggttttccagtcacacctcaggtacctttaagaccaatgacttaca aggcagctgtagatcttagccactttttaaaagaaaaggggggactggaagggctaattcactcccaacgaagacaagatatccttg atctgtggatctaccacacacaaggctacttccctgattggcagaactacacaccagggccagggatcagatatccactgacctttgg atggtgctacaagctagtaccagttgagcaagagaaggtagaagaagccaatgaaggagagaacacccgcttgttacaccctgtga gcctgcatgggatggatgacccggagagagaagtattagagtggaggtttgacagccgcctagcatttcatcacatggcccgagagc tgcatccggactgtactgggtctctctggttagaccagatctgagcctgggagctctctggctaactagggaacccactgcttaagcct caataaagcttgccttgagtgcttcaagtagtgtgtgcccgtctgttgtgtgactctggtaactagagatccctcagacccttttagtcag tgtggaaaatctctagcagcatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccata ggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcg tttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtgg cgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagc ccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaa caggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaagaacagtattt ggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtg gtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagt ggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagtttta aatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttc gttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccg cgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaacttta tccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgcta caggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgt tgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcac tgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcg gcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgt tcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatct tttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttg aatactcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaa ataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgac(SEQIDNO:18) SEQIDNO:19: LeGO-MCS-GSG-T2A-eGFP gtcgacggatcgggagatctcccgatcccctatggtgcactctcagtacaatctgctctgatgccgcatagttaagccagtatctgctccc tgcttgtgtgttggaggtcgctgagtagtgcgcgagcaaaatttaagctacaacaaggcaaggcttgaccgacaattgcatgaagaatct gcttagggttaggcgttttgcgctgcttcgcgatgtacgggccagatatacgcgttgacattgattattgactagttattaatagtaatcaatt acggggtcattagttcatagcccatatatggagttccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccc cgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaa ctgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatg cccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacat caatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaa cgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagcg cgttttgcctgtactgggtctctctggttagaccagatctgagcctgggagctctctggctaactagggaacccactgcttaagcctcaata aagcttgccttgagtgcttcaagtagtgtgtgcccgtctgttgtgtgactctggtaactagagatccctcagacccttttagtcagtgtggaa aatctctagcagtggcgcccgaacagggacttgaaagcgaaagggaaaccagaggagctctctcgacgcaggactcggcttgctga agcgcgcacggcaagaggcgaggggcggcgactggtgagtacgccaaaaattttgactagcggaggctagaaggagagagatgg gtgcgagagcgtcagtattaagcgggggagaattagatcgcgatgggaaaaaattcggttaaggccagggggaaagaaaaaatataa attaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagaaacatcagaaggctgtagacaaa tactgggacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatacagtagcaaccctctattgtgtgcatca aaggatagagataaaagacaccaaggaagctttagacaagatagaggaagagcaaaacaaaagtaagaccaccgcacagcaagcg gccggccgcgctgatcttcagacctggaggaggagatatgagggacaattggagaagtgaattatataaatataaagtagtaaaaattg aaccattaggagtagcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaataggagctttgttccttg ggttcttgggagcagcaggaagcactatgggcgcagcgtcaatgacgctgacggtacaggccagacaattattgtctggtatagtgca gcagcagaacaatttgctgagggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaaga atcctggctgtggaaagatacctaaaggatcaacagctcctggggatttggggttgctctggaaaactcatttgcaccactgctgtgcctt ggaatgctagttggagtaataaatctctggaacagatttggaatcacacgacctggatggagtgggacagagaaattaacaattacaca agcttaatacactccttaattgaagaatcgcaaaaccagcaagaaaagaatgaacaagaattattggaattagataaatgggcaagtttgt ggaattggtttaacataacaaattggctgtggtatataaaattattcataatgatagtaggaggcttggtaggtttaagaatagtttttgctgta ctttctatagtgaatagagttaggcagggatattcaccattatcgtttcagacccacctcccaaccccgaggggacccgacaggcccga aggaatagaagaagaaggtggagagagagacagagacagatccattcgattagtgaacggatcggcactgcgtgcgccaattctgc agacaaatggcagtattcatccacaattttaaaagaaaaggggggattggggggtacagtgcaggggaaagaatagtagacataatag caacagacatacaaactaaagaattacaaaaacaaattacaaaaattcaaaattttcgggtttattacagggacagcagagatccagtttg gttagtaccgggcccgctctagtcgaggtcgacggtatcgataagctcgcttcacgagattccagcaggtcgagggacctaataacttc gtatagcatacattatacgaagttatattaagggttccaagcttaagcggccgctgaaagaccccacctgtaggtttggcaagctagctgc agtaacgccattttgcaaggcatggaaaaataccaaaccaagaatagagaagttcagatcaagggcgggtacatgaaaatagctaacg ttgggccaaacaggatatctgcggtgagcagtttcggccccggcccggggccaagaacagatggtcaccgcagtttcggccccggc ccgaggccaagaacagatggtccccagatatggcccaaccctcagcagtttcttaagacccatcagatgtttccaggctcccccaagg acctgaaatgaccctgcgccttatttgaattaaccaatcagcctgcttctcgcttctgttcgcgcgcttctgcttcccgagctctataaaaga gctcacaacccctcactcggcgcgccagtcctccgattgactgagtcgcccGGATCCGCCACCATGGCTAAGCT AGGAAGCGGAGAGGGCAGAGGCAGTCTGCTGACATGCGGTGACGTGGAAGAGA ATCCCGGCCCTgtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaac ggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaa gctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagca cgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgc cgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctgggg cacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatc cgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgc ccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtga ccgccgccgggatcactctcggcatggacgagctgtacaagTAAGAATTCgtcgagggacctaataacttcgtatagcataca ttatacgaagttatacatgtttaagggttccggttccactaggtacaattcgatatcaagcttatcgataatcaacctctggattacaaaatttg tgaaagattgactggtattcttaactatgttgctccttttacgctatgtggatacgctgctttaatgcctttgtatcatgctattgcttcccgtatg gctttcattttctcctccttgtataaatcctggttgctgtctctttatgaggagttgtggcccgttgtcaggcaacgtggcgtggtgtgcactgt gtttgctgacgcaacccccactggttggggcattgccaccacctgtcagctcctttccgggactttcgctttccccctccctattgccacgg cggaactcatcgccgcctgccttgcccgctgctggacaggggctcggctgttgggcactgacaattccgtggtgttgtcggggaaatc atcgtcctttccttggctgctcgcctgtgttgccacctggattctgcgcgggacgtccttctgctacgtcccttcggccctcaatccagcgg accttccttcccgcggcctgctgccggctctgcggcctcttccgcgtcttcgccttcgccctcagacgagtcggatctccctttgggccg cctccccgcatcgataccgtcgacctcgatcgagacctagaaaaacatggagcaatcacaagtagcaatacagcagctaccaatgctg attgtgcctggctagaagcacaagaggaggaggaggtgggttttccagtcacacctcaggtacctttaagaccaatgacttacaaggca gctgtagatcttagccactttttaaaagaaaaggggggactggaagggctaattcactcccaacgaagacaagatatccttgatctgtgg atctaccacacacaaggctacttccctgattggcagaactacacaccagggccagggatcagatatccactgacctttggatggtgcta caagctagtaccagttgagcaagagaaggtagaagaagccaatgaaggagagaacacccgcttgttacaccctgtgagcctgcatgg gatggatgacccggagagagaagtattagagtggaggtttgacagccgcctagcatttcatcacatggcccgagagctgcatccggac tgtactgggtctctctggttagaccagatctgagcctgggagctctctggctaactagggaacccactgcttaagcctcaataaagcttgc cttgagtgcttcaagtagtgtgtgcccgtctgttgtgtgactctggtaactagagatccctcagacccttttagtcagtgtggaaaatctcta gcagcatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctg acgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagct ccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctca cgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgcctta tccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcga ggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaagaacagtatttggtatctgcgctctgctgaa gccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcag attacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaaggg attttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaact tggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgt agataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatc agcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccggg aagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatg gcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccga tcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgctt ttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataat accgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgaga tccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggc aaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggtt attgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctga c SEQIDNO:20 KO1guideRNAsequence TACCGCTGCATGATCAGCTATGG SEQIDNO:21 KO2guideRNAsequence: TACCATACTCTACCACATATAGG SEQIDNO:22SequenceinsertedintoVectorMAPforvectorLeGO_MCS-GSG-T2A-eGFP GGATCCGCCACCATGGCTAAGCTAGGAAGCGGAGAGGGCAGAGGCAGTCTGCTGACATGCGGTGAC GTGGAAGAGAATCCCGGCCCTgtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacgg cgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcac caccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatg aagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaag acccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacat cctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaact tcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtg ctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggag ttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagTAAGAATTC

REFERENCES

[0069] 1. Ren, D., et al., Predictive biomarkers and mechanisms underlying resistance to PD1 PD-L1 blockade cancer immunotherapy. Mol Cancer, 2020. 19 (1): p. 19. [0070] 2. Kumpers, C., et al., Immune Cell Infiltration of the Primary Tumor, Not PD-L1 Status, Is Associated With Improved Response to Checkpoint Inhibition in Metastatic Melanoma. Front Med (Lausanne), 2019. 6: p. 27. [0071] 3. Zhu, H., et al., EGFRvIII-CAR-T Cells with PD-1 Knockout Have Improved Anti-Glioma Activity. Pathol Oncol Res, 2020. 26 (4): p. 2135-2141. [0072] 4. Rupp, L. J., et al., CRISPR Cas9-mediated PD-1 disruption enhances anti-tumor efficacy of human chimeric antigen receptor T cells. Sci Rep, 2017. 7 (1): p. 737. [0073] 5. McGowan, E., et al., PD-1 disrupted CAR-T cells in the treatment of solid tumors: Promises and challenges. Biomed Pharmacother, 2020. 121: p. 109625. [0074] 6. Wei, J., et al., PD-1 silencing impairs the anti-tumor function of chimeric antigen receptor modified T cells by inhibiting proliferation activity. J Immunother Cancer, 2019. 7 (1): p. 209. [0075] 7. Malmberg, K. J., et al., Natural killer cell-mediated immunosurveillance of human cancer. Semin Immunol, 2017. 31: p. 20-29. [0076] 8. Fauriat, C., et al., Regulation of human NK-cell cytokine and chemokine production by target cell recognition. Blood, 2010. 115 (11): p. 2167-76. [0077] 9. Lanier, L. L., Up on the tightrope: natural killer cell activation and inhibition. Nat Immunol, 2008. 9 (5): p. 495-502. [0078] 10. Wu, J., et al., DAP 10 and DAP12 form distinct, but functionally cooperative, receptor complexes in natural killer cells. J Exp Med, 2000. 192 (7): p. 1059-68. [0079] 11. Lanier, L. L., DAP 10-and DAP12-associated receptors in innate immunity. Immunol Rev, 2009. 227 (1): p. 150-60. [0080] 12. Liu, E., et al., Use of CAR-Transduced Natural Killer Cells in CD19-Positive Lymphoid Tumors. N Engl J Med, 2020. 382 (6): p. 545-553. [0081] 13. Xie, G., et al., CAR-NK cells: A promising cellular immunotherapy for cancer. EBioMedicine, 2020. 59: p. 102975. [0082] 14. Liu, Y., et al., Increased expression of programmed cell death protein 1 on NK cells inhibits NK-cell-mediated anti-tumor function and indicates poor prognosis in digestive cancers. Oncogene, 2017. 36 (44): p. 6143-6153. [0083] 15. Benson, D. M., Jr., et al., The PD-1 PD-L1 axis modulates the natural killer cell versus multiple myeloma effect: a therapeutic target for CT-011, a novel monoclonal anti-PD-1 antibody. Blood, 2010. 116 (13): p. 2286-94. [0084] 16. Concha-Benavente, F., et al., PD-L1 Mediates Dysfunction in Activated PD-1(+) NK Cells in Head and Neck Cancer Patients. Cancer Immunol Res, 2018. 6 (12): p. 1548-1560. [0085] 17. Davis, Z., et al., Low-density PD-1 expression on resting human natural killer cells is functional and upregulated after transplantation. Blood Adv, 2021. 5 (4): p. 1069-1080. [0086] 18. Wagner, A. K., et al., PD-1 expression on mouse intratumoral NK cells and its effects on NK cell phenotype. iScience, 2022. 25 (10): p. 105137. [0087] 19. Pessino, A., et al., Molecular cloning of NKp46: a novel member of the immunoglobulin superfamily involved in triggering of natural cytotoxicity. J Exp Med, 1998. 188 (5): p. 953-60. [0088] 20. Weber, K., et al., A multicolor panel of novel lentiviral gene ontology (LeGO) vectors for functional gene analysis. Mol Ther, 2008. 16 (4): p. 698-706. [0089] 21. Ran, F. A., et al., Genome engineering using the CRISPR-Cas9 system. Nat Protoc, 2013. 8 (11): p. 2281-2308. [0090] 22. Stewart, S. A., et al., Lentivirus-delivered stable gene silencing by RNAi in primary cells. RNA, 2003. 9 (4): p. 493-501. [0091] 23. Dull, T., et al., A third-generation lentivirus vector with a conditional packaging system. J Virol, 1998. 72 (11): p. 8463-71. [0092] 24. Sutlu, T., et al., Inhibition of intracellular antiviral defense mechanisms augments lentiviral transduction of human natural killer cells: implications for gene therapy. Hum Gene Ther, 2012. 23 (10): p. 1090-100. [0093] 25. Schwietzer, Y. A., et al., A tractable microscopy-and flow cytometry-based method to measure natural killer cell-mediated killing and infiltration of tumor spheroids, in Methods in Cell Biology. 2022, Academic Press. [0094] 26. Martins, F., et al., Adverse effects of immune-checkpoint inhibitors: epidemiology, management and surveillance. Nat Rev Clin Oncol, 2019. 16 (9): p. 563-580. [0095] 27. Fabian, K. P., et al., PD-L1 targeting high-affinity NK (t-haNK) cells induce direct antitumor effects and target suppressive MDSC populations. J Immunother Cancer, 2020. 8 (1). [0096] 28. Yearley, J. H., et al., PD-L2 Expression in Human Tumors: Relevance to Anti-PD-1 Therapy in Cancer. Clin Cancer Res, 2017. 23 (12): p. 3158-3167. [0097] 29. Brito, A. B. C., M. P. G. Camandaroba, and V. C. C. de Lima, Anti-PD1 versus anti-PD-L1 immunotherapy in first-line therapy for advanced non-small cell lung cancer: A systematic review and meta-analysis. Thorac Cancer, 2021. 12 (7): p. 1058-1066. [0098] 30. Andre, P., et al., Anti-NKG2A mAb Is a Checkpoint Inhibitor that Promotes Anti-tumor Immunity by Unleashing Both T and NK Cells. Cell, 2018. 175 (7): p. 1731-1743 e13. [0099] 31. Cao, Y., et al., Immune checkpoint molecules in natural killer cells as potential targets for cancer immunotherapy. Signal Transduct Target Ther, 2020. 5 (1): p. 250. [0100] 32. Bexte, T., et al., CRISPR-Cas9 based gene editing of the immune checkpoint NKG2A enhances NK cell mediated cytotoxicity against multiple myeloma. Oncoimmunology, 2022. 11 (1): p. 2081415. [0101] 33. Zhang, Q., et al., Blockade of the checkpoint receptor TIGIT prevents NK cell exhaustion and elicits potent anti-tumor immunity. Nat Immunol, 2018. 19 (7): p. 723-732. [0102] 34. Julia, E. P., et al., Avelumab, an IgG1 anti-PD-L1 Immune Checkpoint Inhibitor, Triggers NK Cell-Mediated Cytotoxicity and Cytokine Production Against Triple Negative Breast Cancer Cells. Front Immunol, 2018. 9: p. 2140. [0103] 35. Guo, C., et al., Structure-based rational design of a novel chimeric PD1-NKG2D receptor for natural killer cells. Mol Immunol, 2019. 114: p. 108-113. [0104] 36. Garrity, D., et al., The activating NKG2D receptor assembles in the membrane with two signaling dimers into a hexameric structure. Proc Natl Acad Sci USA, 2005. 102 (21): p. 7641-6. [0105] 37. Topfer, K., et al., DAP 12-based activating chimeric antigen receptor for NK cell tumor immunotherapy. J Immunol, 2015. 194 (7): p. 3201-12. [0106] 38. Nijhof, I. S., et al., Preclinical Evidence for the Therapeutic Potential of CD38-Targeted Immuno-Chemotherapy in Multiple Myeloma Patients Refractory to Lenalidomide and Bortezomib. Clin Cancer Res, 2015. 21 (12): p. 2802-10. [0107] 39. Mateos, M. V., et al., Daratumumab plus Bortezomib, Melphalan, and Prednisone for Untreated Myeloma. N Engl J Med, 2018. 378 (6): p. 518-528. [0108] 40. Alici, E., et al., Autologous antitumor activity by NK cells expanded from myeloma patients using GMP-compliant components. Blood, 2008. 111 (6): p. 3155-62. [0109] 41. Alici, E., et al., Anti-myeloma activity of endogenous and adoptively transferred activated natural killer cells in experimental multiple myeloma model. Exp Hematol, 2007. 35 (12): p. 1839-46. [0110] 42. Lesokhin, A. M., et al., Nivolumab in Patients With Relapsed or Refractory Hematologic Malignancy: Preliminary Results of a Phase Ib Study. J Clin Oncol, 2016. 34 (23): p. 2698-704. [0111] 43. Mateos, M. V., et al., Pembrolizumab plus pomalidomide and dexamethasone for patients with relapsed or refractory multiple myeloma (KEYNOTE-183): a randomised, open-label, phase 3 trial. Lancet Haematol, 2019. 6 (9): p. e459-e469. [0112] 44. Usmani, S. Z., et al., Pembrolizumab plus lenalidomide and dexamethasone for patients with treatment-naive multiple myeloma (KEYNOTE-185): a randomised, open-label, phase 3 trial. Lancet Haematol, 2019. 6 (9): p. e448-e458. [0113] 45. Kazandjian, D., et al., Avelumab, a PD-L1 Inhibitor, in Combination with Hypofractionated Radiotherapy and the Abscopal Effect in Relapsed Refractory Multiple Myeloma. Oncologist, 2021. 26 (4): p. 288-e541.