Use of cellular extracts for obtaining pluripotent stem cells
09856457 ยท 2018-01-02
Assignee
Inventors
Cpc classification
C12N5/0696
CHEMISTRY; METALLURGY
International classification
Abstract
The use of a composition including at least one permeabilized nucleus of a first cell, or at least one permeabilized first cell including the nucleus and an extract of female germinal cells, or eggs, of a multicellular organism, the eggs being blocked in the metaphase II of meiosis, the extract including EGTA, for carrying out a method for obtaining pluripotent stem cells, or tissues derived from the pluripotent stem cells, or of cloning, provided that the process is not for cloning human beings.
Claims
1. A method for obtaining fully reprogrammed mammalian iPS cells comprising: incubating at least one permeabilized nucleus of a mammalian induced pluripotent stem (iPS) cell, or at least one permeabilized, isolated mammalian iPS cell comprising said nucleus, with an isolated extract of Xenopus oocytes, said oocytes blocked at metaphase II of meiosis, wherein said extract comprises EGTA; wherein the isolated mammalian iPS cell is produced by reprogramming of a mammalian somatic cell with retroviral vectors encoding Oct-4, Sox-2, Klf-4 and c-myc; wherein the method produces a higher yield of fully reprogrammed iPS cells as compared to mammalian iPS cells produced by the same method but without incubation in said extract.
2. A composition comprising: at least one permeabilized nucleus of a mammalian induced pluripotent stem (iPS) cell, or at least one permeabilized, isolated mammalian iPS cell comprising said nucleus: wherein the isolated mammalian iPS cell is produced by reprogramming of a mammalian somatic cell with retroviral vectors encoding Oct-4, Sox-2, Klf-4 and c-myc; an isolated extract of Xenopus oocytes, said oocytes blocked at metaphase II of meiosis, wherein said extract comprises EGTA.
Description
FIGURES
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
(23)
(24)
(25)
(26)
(27)
(28)
(29)
(30)
(31)
(32)
(33)
(34)
(35)
(36)
(37)
(38)
(39)
(40)
(41)
(42)
(43) Upper panel of
(44) Upper panel of
(45) Upper panel of
(46) Upper panel of
(47) Upper panel of
(48) Upper panel of
(49) Upper panel of
(50) Upper panel of
(51) Upper panel of
(52) Upper panel of
(53)
(54)
(55)
(56)
(57)
(58) Viral integration of each transgene (Oct4, Sox2, Klf4 and c-Myc) in the different cell populations was assessed by quantitative PCR amplification. The different MEF populations were harvested 21 days after infection and their DNA extracted.
(59) First bars (middle grey) correspond to infected, non-permeabilized cells (OKSM);
(60) Second bars (dark grey) correspond to infected, streptolysin-O (SLO)-permeabilized and mock-treated cells (OKSM+SLO+buffer);
(61) Third bars (light grey) corresponds to SLO-permeabilized and M phase extract-treated cells (OKSM+SLO+M phase extract).
(62) Four independent experiments are shown and errors bars represent s.e.m. (n=4).
(63) Y-axis represents the relative number of integrated transgenes, measured by Q-PCR.
(64)
(65)
(66)
(67)
(68)
(69)
(70) Bisulfite sequencing was performed in mock-treated and M-phase treated MEF nuclei and ES cells. Amplified regions are indicated by a solid blue bar. Each horizontal row of circles represents the CpG dinucleotides of an individual molecule. Solid circles depict methylated CpGs, open circles unmethylated CpGs. The parental allele origin (M: maternal; P: paternal) was determined in MEFs and iPS cells by using DNA polymorphisms between C57BL/6J and JF1 backgrounds. Blue triangles show individual CpGs that are absent due to polymorphisms.
(71)
(72)
(73)
(74)
(75) Y-axis represents the % of DNA synthesis, and X-axis represents the incubation time in min.
(76) Capacity of the isolated extract blocked in phase M to synthesize DNA with Ca2+ (diamonds), or without Ca2+ (square), is measured by incorporation of [.sup.32P]dCTP.
(77) When the extract is blocked in metaphase, it does not synthesize DNA without Ca2+, but it synthesizes DNA in presence of Ca2+.
EXAMPLES
Example 1
Extract Preparation
(78) Mitotic extracts are prepared through a procedure similar to that used for interphasic extract. Eggs should not be activated, however, and EGTA should be added to buffers to chelate traces of calcium, either present in solutions or released from intracellular stores.
(79) 1. Set the centrifuge at 1 C. Cool all tubes, adaptators, and syringes to 4 C. before starting the preparation of the extract.
(80) 2. Transfer the eggs to a glass beaker and rinse with HSB (HSB-CSF: 15 mM Hepes pH 7.6; 110 mM NaCl; 2 mM KCl; 1 mM MgSO4; 0.5 mM Na2HPO4; 2 mM NaHCO3+2 mM EGTA). It is advantageous to pool the eggs from the same frogs.
(81) 3. Add distilled water and leave the external jelly coat to swell for 5 min at room temperature.
(82) 4. Add HSB-CSF 0.3, cysteine 2%, pH 7.9 (the solution should be used within 6 hrs of preparation), and dejelly by gentle swirling at intervals. This takes 5 to 10 min and complete removal of the jelly is obtained when the eggs can be tightly packed together, slightly deformed. It is important to obtain a complete dejellification. At this stage, success depends on both the rapidity with which the preparation is done and the strict observation of the cold temperature conditions after step 10.
(83) 5. Rinse immediately at least 5 times with 100-200 ml HSB-CSF per ml of eggs. If at this point necrosis is visible in more than 20% of the eggs, do not proceed further. Transfer to 50-ml glass beaker.
(84) 6. Transfer the eggs in a large glass Petri dish for observation under a microscope. Eggs should not show any signs of spontaneous activation.
(85) 7. Transfer to a cold Ultra-clear tube. Rinse with cold XB-CSF (10 mM HEPES pH 7.7; 100 mM KCl; 1 mM MgCl2; 5% Sucrose; 1 mM DTT; 5 mM EGTA) containing 10 g/ml protease inhibitors and 100 g/ml cytochalasin B. Use 1 ml for 3 ml eggs.
(86) 8. Leave the tube in ice for 5 to 10 min to chill the eggs.
(87) 13. Remove the excess buffer and pack the eggs by centrifugation at 150 g, 45 sec, 1 C., in a Sorvall swinging rotor or equivalent.
(88) 14. Rapidly remove the excess buffer and centrifuge at 17,000 g (Sorvall HB4 swinging rotor, 10K), for 10 min at 1 C. The centrifugation crushes the eggs and the soluble content is thus exuded.
(89) 15. Withdraw the extract by puncturing the side of the tube with a 20-gauge needle inserted into a 1 to 5 ml syringe, depending on the amount of soluble extract. Insert the needle just above the black pigment layer and collect the cytoplasmic layer, avoiding the yellow lipid top layer. Transfer to a cold Ultra-clear tube. Add 10 g/ml protease inhibitors, 10 g/ml cytochalasin B, 1/20 volume Energy Mix 20 (Energy MixCSF 20: 200 g/ml Creatine Kinase; 200 mM Creatine Phosphate; 20 mM ATP; 20 mM MgCl2; +2 mM EGTA), and 5% glycerol. Mix gently.
(90) 16. Centrifuge again in the same conditions.
(91) 17. Collect the supernatant in a cold tube. If necessary, add 200 g/ml cycloheximide to prevent protein synthesis. Store at 80 C. in 100 or 200 l aliquots previously frozen in liquid nitrogen. Protein concentration in low speed extracts is around 50 mg/ml and RNA concentration, mainly in ribosomes, is 5-10 mg/ml. Aliquots should be used only once and should not be frozen again after thawing.
Example 2
Synergic Induction of Pluripotent Cells by Combined Exposure to Mitotic Egg Extracts and Transcription Factors
(92) Introduction
(93) Nuclear transfer (NT) experiments in frogs and then in mammalian eggs have demonstrated that somatic cells can be reprogrammed to pluripotency (1-4). More recently, induction of pluripotency in somatic cells by ectopic expression of the four transcription factors Oct4, Klf4, Sox2 and c-Myc (OKSM) has been used to produce induced pluripotent stem (iPS) cells, which are highly similar to embryonic stem (ES) cells. Notably, murine iPS cells have a complete developmental potential as demonstrated by their capacity to form teratomas, generate chimeras and contribute to the germline. However, the efficiencies of both iPS cell production and NT remain low and most of the obtained reprogrammed cells appear to be only partially reprogrammed. The epigenetic memory of the cell is one key barrier, which has to be overcome to efficiently reprogram differentiated cells (5). Thus, additional factors may be needed to improve reprogramming efficiency (6, 7) and many efforts have been done over the last years to optimize these procedures. It has been suggested that different reprogramming strategies could be associated to synergize their efficiencies (8). Several attempts have been made by using cellular extracts to reprogram somatic cells, but they failed to reproduce the range of effects obtained by NT.
(94) In NT experiments, reprogramming is induced by exposure of transplanted nuclei to the cytoplasm of the receiving oocyte. However, NT reprogramming appears hard to study in vitro due to the difficulty to obtain large quantities of mammalian oocytes. Xenopus eggs, which can be obtained in large amounts, can remodel the nuclear lamina of reversibly permeabilized mammalian cells (9) and Xenopus egg extracts can up-regulate Oct4 expression in cells that already express Oct4 (10), similarly to what observed when adult mouse nuclei are injected in Xenopus oocytes (11). More recently, it was reported that the replication origin pattern and chromosome organization of Xenopus erythrocyte nuclei could be remodeled by metaphase-arrested extracts (M phase extracts) from Xenopus eggs (12). The Inventors further investigated whether pre-incubation of mouse embryonic fibroblasts (MEFs) with Xenopus egg extracts could increase the efficiency of NT and iPS production. The Inventors show that M phase, but not interphase, Xenopus egg extracts increased NT efficiency and engaged MEFs into a stem cell program. They also induced a global change of MEF chromatin structure and replication properties. In particular, M phase extracts reset the level of several epigenetic marks in MEF nuclei, independently of their role in chromatin activation. Moreover, M phase extracts, but not interphase extracts, partially reprogrammed permeabilized MEFs to form colonies, which expressed pluripotency markers. Finally, iPS cell induction by ectopic expression of OSKM was 45-fold increased when MEFs were incubated in M phase Xenopus egg extracts. The resulting iPS cells were fully reprogrammed, as shown by their capacity to produce chimeras and colonize the germline.
(95) Results
(96) Pre-Treatment with M Phase Xenopus Egg Extracts Improves Efficiency of Both Nuclear Transfer and iPS Cell Production in Mammals
(97) The Inventors first asked whether M phase Xenopus egg extracts could improve the highly inefficient NT of MEFs (13). Permeabilized MEF nuclei in G1 phase were pre-incubated with M phase (
(98) The Inventors then checked whether treatment with M phase Xenopus egg extracts could also improve the efficiency of iPS cell production. The generation of iPS cells by viral-mediated expression of the OSKM transcription factors in mouse and human cells, although with low efficiency, was a breakthrough in reprogramming of somatic cells to a pluripotency state (15-19). The Inventors therefore combined OSKM over-expression and incubation with M phase Xenopus egg extracts (M-iPS cells) using the experimental strategy shown in
(99) TABLE-US-00001 TABLE 1 represents the in vitro development of embryos obtained using MEF nuclei exposed to M phase Xenopus egg extracts and injected into enucleated mouse oocytes recon- % of 2-cell embryos structed activated 2-cell 4/8-cell morula blastocyst Mitotic ES 175 154 87% ND 55% cells (134) (84) G ES cells* 39 36 28 ND 28% 11% (Zhou et al. (8) (3) 2001 G1 MEFs 263 195 140 56% 27% 11% (79) (38) (16) Mitotic ND ND ND ND ND 6% MEFs** (Li et al. 2003) MEFs + 178 84 30 27% 7% 3% interphasic (8) (2) (1) extracts MEFs + M 148 87 49 78% 67% 45% phase extracts (38) (33) (22) Percentage of embryos relative to 2-cell embryos obtained after nuclear transfer of ES nuclei and MEF nuclei that had been pre-incubated in mock buffer, interphase or M phase Xenopus egg extracts. Mitotic and G1 ES nuclei were isolated and injected as previously described (33) and mitotic MEF nuclei as in Li et al. (13). *refers to sv129/sv cell line; **refers to 129/Svpas cell line.
(100) Characterization of M-iPS Cells
(101) M-iPS cells presented an ES-like morphology and uniform expression of the pluripotency markers alkaline phosphatase, OCT4, NANOG, and SSEA1 (
(102) The Inventors then investigated the ability of M-iPS clones to differentiate. When induced to differentiate, all tested M-iPS clones formed embryoid bodies (
(103) Finally, the complete reprogramming of the M-iPS clones was demonstrated in vivo by the capacity of two different clones, one male and one female, to produce adult chimeras after injection into CD1 blastocysts (
(104) The Inventors conclude that M phase Xenopus egg extracts have a strong positive effect on the efficiency of iPS cell production. Importantly, this action is not additional but synergistic, since the reprogramming efficiency (number of GFP-positive colonies, see
(105) TABLE-US-00002 TABLE 2 represents the developmental potential of iPS cells derived from MEFs exposed to M phase Xenopus egg extracts (M phase iPS cells). Injected Number blasto- Born of % of Female Male cysts embryos chimeras chimeras chimeras chimeras Clone 233 71 31 46% 25 6 #1 (male) Clone 85 10 7 70% 3 4 #2 (female) Percentage of chimeras obtained after injection of two different clones of M phase iPS cells (one male and one female) into CD1 blastocysts and analysis of their ability to colonize the germline.
(106) Xenopus M Phase Egg Extracts Partially Reprogram Mammalian Fibroblasts
(107) To characterize the synergistic effect of M phase Xenopus egg extracts, the Inventors first asked whether this treatment alone could modify the limited proliferation potential of MEFs (24). Treatment with M phase egg extracts strongly increased the proliferation rate of MEFs during at least two cell cycles (
(108) Growth stimulation was also accompanied by expression of pluripotency cell markers, which were never observed in mock-treated cells. Indeed, alkaline phosphatase expression (a marker of partial reprogramming) was induced upon M phase treatment (
(109) Seven days after treatment with M phase egg extracts, the expression of the pluripotency markers Oct4, Nanog and Rex1 was confirmed by quantitative RT PCR (
(110) Overall, the Inventors' data suggest that M phase Xenopus egg extracts alone are sufficient to partly reprogram MEFs, as indicated by the up-regulation of pluripotency genes and down-regulation of genes normally expressed in MEFs and the rapid but transient induction of proliferation. Neither of these effects was observed when using interphase Xenopus egg extracts, in agreement with the previously reported failure to reprogram cells using Xenopus egg extracts described in (26).
(111) Treatment with M-Phase Xenopus Egg Extracts Induces Mitotic Features and Modifies the Global Epigenetic Signature
(112) The observations that only M phase and not interphasic Xenopus egg extracts had a reprogramming effect on reversely permeabilized MEFs as well as on NT efficiency indicate that the mitotic stage of the donor extract is crucial. Therefore, the inventors investigated whether exposure of MEFs at the G1 phase to M phase egg extracts could induce mitotic markers in the reprogrammed nuclei. Indeed, exposure to M phase Xenopus egg extracts drove MEF nuclei into a mitotic-like stage, accompanied by modification of the chromatin structure (
(113) Exposure to M phase egg extracts also appeared to erase the chromatin superstructure organization, as revealed by the loss of heterochromatin foci visualized by DAPI staining together with the loss of HP1 expression (
(114) The Inventors then asked whether the Xenopus egg extracts could also modify the histone methylation profiles, as histone hypomethylation has been correlated with the epigenetic plasticity of somatic mammalian cells (31). A short incubation of MEF nuclei with M phase Xenopus egg extracts globally reduced the level of H3K9me2-me3, H4K20me3 and H3K4me2-me3 as shown by western blotting (
(115) Moreover, incubation with M phase Xenopus egg extracts also induced a reduction of the global level of the histone variant H3.3, which has been recently implicated in cell identity memory during reprogramming by NT (33) (
(116) Finally, the Inventors analyzed the DNA methylation profile, another key marker of cell memory. Bisulfite sequencing was performed and showed that incubation in M phase Xenopus egg extracts for 40 minutes did not modify the DNA methylation status of the pluripotency genes Oct4 and Nanog (
(117) In summary, Xenopus M phase extracts drive MEF nuclei into a mitotic state and also remodel their chromatin structure. These results could explain the strong synergistic effect of the treatment with M phase Xenopus extract on NT and iPS cells production.
(118) MEF Nuclei are Adapted to an Embryonic Replication Program when Pre-Incubated in M Phase Xenopus Egg Extracts.
(119) The Inventors previously showed that M phase Xenopus egg extracts could reset the replication program of nuclei from differentiated Xenopus cells and allow the transition from a somatic to an embryonic profile of DNA replication (12). The Inventors thus asked whether MEF nuclei could be similarly reprogrammed. To this aim nuclei from MEFs synchronized in G1 were incubated either with interphasic Xenopus egg extracts or first exposed to M-phase egg extracts before transfer into interphasic egg extracts and then their ability to replicate DNA was assessed (
(120) Discussion
(121) Reprogramming of Mouse Embryonic Fibroblasts by Xenopus Egg Extracts
(122) The experiments described here show that a short incubation of mammalian somatic nuclei or cells with M phase Xenopus egg extracts improves the efficiency of both NT and iPS cell production. This suggests the existence of common barriers limiting the efficiency of reprogramming by NT and iPS cells that pre-incubation in M phase Xenopus egg extract might help removing these barriers. Moreover, the results presented here also emphasize that combining different strategies can improve the reprogramming of mammalian somatic cell nuclei. Neither NT nor heterocaryons can be used in combination with iPS cells due to technical limitations. However, Xenopus egg extracts can be obtained in large amount and can be used to increase the yields of iPS cells.
(123) The Inventors show that incubation with M phase Xenopus egg extracts is sufficient to improve the efficiency of NT using MEF nuclei up to the level observed with pluripotent ES cells. Furthermore, reversibly permeabilized MEFs incubated in M phase Xenopus egg extracts acquire several features of pluripotent cells, such as induction of cell proliferation, formation of colonies, expression of ES cell markers, including the expression of OCT4, one of the most stringent marker of pluripotency (34). This reprogramming activity is not stable; colonies stop growing after a couple of rapid cell cycles. However, this partial reprogramming activity is enough to increase by 45-fold the production of fully reprogrammed iPS cells by viral transduction of OKSM. This synergic effect is probably underestimated since the proportion of efficiently permeabilized MEFs does not exceed 30% in the Inventors' hands. The resulting M-iPS clones appear to be well reprogrammed since the obtained clones could efficiently produce chimeras and colonize the germline. This synergic effect suggest that incubation in Xenopus egg extracts can induce modifications of the genome features of somatic mammalian cells, thus opening a larger window of action for reprogramming by NT or OKSM expression.
(124) Importance of Exposure to Mitotic/Meiotic Conditions for Reconditioning Differentiated Nuclei
(125) The Inventors' experiments show that the mitotic state of the Xenopus egg extracts is crucial. Xenopus interphasic egg extracts neither induced reprogramming in permeabilized MEFs nor improved NT efficiency. Conversely, M phase Xenopus egg extracts induced a global mitotic signature in G1 MEF nuclei, as revealed by the phosphorylation of histone H3 on Ser 10 and remodeling of the nuclear structure. This global reorganization of chromatin at mitosis is likely to be critical for the reprogramming activity of M phase Xenopus egg extracts. Transition through mitosis has always been found to be crucial in NT experiments performed in the mouse, where zygotes temporally arrested in mitosis support nuclear reprogramming much more efficiently that interphase zygotes (35). Altogether, these results indicate that efficient reprogramming requires not only an early embryonic pluripotent context, but also transition through mitosis.
(126) Incubation of donor somatic nuclei in mitotic egg extracts could help resynchronizing the cell cycle of donor nuclei to make them compatible with an early development context. The Inventors show that MEF nuclei, like Xenopus somatic cell nuclei but differently from sperm nuclei, are not competent to replicate their genome in interphasic Xenopus egg extracts. The requirement of a mitotic reprogramming phase may explain why, in NT experiments, nuclei from half-cleaved embryos develop much better than nuclei from normal blastulae (36). Indeed, such nuclei were derived from embryos that failed to divide during the 1.sup.st cleavage, implying that they should have gone through a mitotic stage before entering in S phase. In mouse, inefficient development occurs when nuclei are transferred into pre-activated oocytes, whereas the best developmental rates are observed when activation occurs 1-3 hours after nuclei transfer (37). The Inventors' observations provide an explanation to these data by showing that mitotic, but not interphasic Xenopus egg extracts can reprogram differentiated cells.
(127) M Phase Xenopus Egg Extracts Remodel the Global Organization of Somatic Mammalian Genomes
(128) In addition to the cell cycle synchronization effects, conditioning nuclei in a mitotic embryonic context may facilitate reprogramming of gene expression. During mitosis, most pre-existing transcription and replication factors are erased from chromatin (38). For instance, TBP, the main component of the transcription machinery which is required for transcription by all three polymerases, as well as TFIIB are removed from the chromatin of somatic cell nuclei incubated in egg extracts, together with the disappearance of the nucleoli (39). The Inventors' experiments show that M phase Xenopus egg extracts efficiently induce a global mitotic signature in G1 MEF nuclei, as revealed by the loss of HP1, phosphorylation of histone H3 on Ser 10 and remodeling of the nuclear structure. Interestingly, marks associated with transcriptional repression (H3K9me2, H3K9me3, H4K20me3) and with active chromatin (acetyl H4K8, acetyl H3K9, H3K4me3, H3K4me2) are both reduced in chromatin of MEF nuclei incubated with M phase extracts. This event is reminiscent of the atypical bivalent epigenetic signature of ES cells (40) and could promote reprogramming by resetting the memory of the somatic nuclei. Histone demethylation also appears to be an interesting feature of the action of the M phase Xenopus egg extracts. However, the reduction of epigenetic marks is not complete, suggesting that some defined nuclear structures could remain after incubation with M phase extracts.
(129) The Inventors' results show that pre-incubation with M phase Xenopus egg extracts can recapitulate reprogramming events occurring during NT. Indeed, they explain the global epigenetic modifications that have been described during reprogramming of mammalian somatic nuclei injected in non-activated, metaphase II mammalian oocytes (29, 30, 41). Thus, Xenopus egg extracts could provide a powerful tool to biochemically study molecular events occurring during NT.
(130) The global reorganization of chromatin at mitosis is likely to be crucial for the reprogramming activity by M phase Xenopus egg extracts. These extracts have the advantage of providing all the genetic and epigenetic factors involved in mitosis as well as in pluripotency, as opposed to reprogramming through ectopic expression of a few genes. The combination of both methods leads to a strong synergistic effect, demonstrating the evolutionary conservation of reprogramming circuits.
(131) Material and Methods
(132) Cells and Media
(133) MEFs were derived from 13.5E wild type mouse embryos or from C57BL/6J-JF1 embryos hemizygous for the OCT4-GFP transgenic allele. Gonads, internal organs and heads were removed before MEF isolation. MEFs were then expanded in high-glucose DMEM (Invitrogen) supplemented with 10% ES-tested fetal bovine serum (cat N S1810, Biowest), 2 mM L-glutamine (Invitrogen), 1 mM sodium pyruvate (Sigma). MEFs were used up to passage 5. OCT4-GFP mice were initially created by Pr. Schler (42) and obtained from Pr. Surani (Wellcome Trust/Cancer Research UK Gurdon Institute, Cambridge). The ES cell line CGR8 was obtained from Dr C. Crozet (Institut de Gntique Humaine, Montpellier). ES cells were grown on 0.1% gelatin without feeders. They were cultured at 37 C. in 5% CO.sub.2 in ES medium: GMEM supplemented with 10% fetal calf serum, 0.1 mM -mercaptoethanol, 1 mM sodium pyruvate, 1% non-essential amino acids (Gibco), 2 mM L-glutamine, in the presence of 1000 U/ml LIF (ES-GRO).
(134) Xenopus Egg Extract Preparation and Replication Reactions
(135) Xenopus mitotic and interphasic egg extracts as well as demembranated sperm nuclei were prepared and used as described in Lemaitre et al. (12), Menut et al. (43) and the detailed protocol available at www.igh.cnrs.fr/equip/mechali/. MEF nuclei were prepared from confluent MEFs at early passages (up to P5) following the procedure described for Xenopus erythrocyte nuclei (12). Briefly, MEFs were trypsinized and washed twice with PBS. MEFs were incubated in hypotonic buffer (10 mM KHEPES pH7.5; 2 mM KCl; 1 mM DTT; 2 mM MgCl.sub.2; 1 mM PMSF; protease inhibitors) for 1 hour. Swelled cells were then homogenized with 20 to 30 strokes and then incubated in hypotonic buffer containing 0.2% Triton X-100 on ice for 3 minutes. Nuclei were washed twice in isotonic buffer (10 mM KHEPES, 25 mM KCl, 2 mM MgCl.sub.2, 75 mM sucrose and protease inhibitors). Nuclei were finally centrifuged through a 0.7M sucrose cushion and resuspended in isotonic buffer supplemented with 20% sucrose. Sperm nuclei and MEF nuclei (1000 nuclei/l and 500 nuclei/l respectively) were incubated in S phase or M phase (CSF) extracts. DNA synthesis was measured by [.sup.32P]dCTP incorporation in Xenopus interphasic egg extracts as previously described (43). Nuclei transfer from M phase extracts to interphasic extracts was performed as described previously (12).
(136) Streptolysin-O Permeabilization and M Phase Extract Treatment
(137) MEFs were permeabilized with streptolysin-O (SLO) mainly as described by Taranger et al. (44). Briefly, MEFs were trypsinized, washed twice in PBS and then resuspended in cold Ca.sup.2+ and Mg.sup.2+-free Hanks' Balanced Salt Solution (HBSS) at 1000 cells/l with 250 ng/l SLO (Sigma S0149). Cells were incubated at 37 C. with gentle agitation for 50 min and then washed twice with ice cold HBSS. Permeabilized cells were incubated in M phase Xenopus egg extracts or buffer (1000 cells/l of extracts) for 40 min, washed twice in HBSS and resealed on gelatin in complete ES medium supplemented with 2 mM CaCl.sub.2 for 2 hours and then cultured in complete ES medium.
(138) M Phase-Extract Treated iPS Cells Production
(139) Constructs in pMXs retroviral vectors encoding Oct4, Sox2, Klf4 and c-Myc (obtained from Addgene) were transfected in Platinum HEK cells using the Lipofectamine 2000 transfection reagent (Invitrogen), according to the manufacturer's recommendations. 30 l of Lipofectamine 2000 were added to 750 l OPTIMEM and mixed with 12 g DNA that had been diluted into 750 l OPTIMEM and incubated for 5 min. After 20 min incubation at 20 C., the DNA/Lipofectamine 2000 mixture was added drop by drop to Platinum HEK cells. 48 h after transfection, supernatants were collected, filtered through 0.45 m Millex-HV (Millipore) filters and supplemented with 12 g/ml polybrene. OCT4-GFP MEFs were seeded on 0.1% gelatin at a density of 8.10.sup.5 cells in 56 cm.sup.2 Petri dishes and the four virus containing supernatants were pooled in equal amounts and added to the MEFs. 18 hours later, supernatants were removed and cells cultured in complete ES medium. Five-six hours later, cells were trypsinized and permeabilized with SLO as described above and then incubated either in mock buffer (HBSS) or in Xenopus M phase egg extracts for 40 min. After treatment, cells were washed twice and plated (8.10.sup.5 cells per 56 cm.sup.2) in gelatin-covered dishes with ES medium supplemented with 2 mM CaCl.sub.2. After 2 hours, medium was removed and replaced by complete ES medium until appearance of OCT4-GFP positive colonies. M phase extract-treated OCT4-GFP positive colonies were mechanically isolated, individual cells dissociated and plated onto feeders for analysis that was performed after at least 15 passages on feeders.
(140) Nuclear Transfer
(141) Nuclear transfer experiments were performed mainly as described in Zhou et al. (45). Briefly, permeabilized MEF nuclei from confluent (B6129) MEFs were freshly prepared as described above and either directly injected into enucleated, metaphase II mouse oocytes or pre-incubated in M phase or interphasic Xenopus egg extracts for 40 min. Before injection, pre-incubated nuclei were washed twice in M16 medium to eliminate the Xenopus egg extract. Before injection, the efficiency of treatment and chromatin integrity were assessed by visually inspecting the nuclei with a phase contrast microscope. (B6129) metaphase ES cells were isolated as described in Zhou et al. (45).
(142) Differentiation of ES Cells or M Phase Extract-Treated iPS Cells.
(143) ES cells or M phase extract-treated iPS cells were dissociated into single cell suspensions with 0.05% trypsin/EDTA and plated at low density in non-adherent bacterial Petri dishes with standard ES culture medium (without LIF). After 2 days, medium was replaced with ES culture medium supplemented with 0.5 M retinoic acid to induce differentiation of embryoid bodies.
(144) Reprogramming Efficiency
(145) Reprogramming efficiency after M-phase extracts treatment was analyzed seven days after infection. The number of OCT4-GFP positive colonies induced by the different treatments was counted under a fluorescent microscope and compared with the number of colonies obtained from non-permeabilized OKSM-infected MEFs from the same infection experiment. Alkaline phosphatase staining was performed using the Alkaline Phosphatase Detection Kit from Sigma Diagnostics according to the manufacturer's procedure. For immunofluorescence, cells in culture were washed once in PBS and then fixed in 3% paraformaldehyde at room temperature (RT) for 15 minutes, washed with PBS and permeabilized with PBS/0.2% Triton X-100 for 5 min. Cells were then washed three times in PBS with 2% BSA for 10 minutes, incubated with anti-OCT-3/-4 (C-10) (Santa-Cruz, sc-5279), anti-NANOG (Abcam, ab21603) or anti-SSEA1 (clone 16MC480) (Abcam, ab16285) antibodies for 1 hr and then with the secondary antibody for 1 h after 3 washes in PBS. DNA was stained with DAPI. Immunofluorescence analysis of M phase extract- or mock-treated MEF nuclei was performed by spinning the treated nuclei onto coverslips by centrifugation at 100 g after having been 10-fold diluted in XB buffer (XB: 100 mM KCl, 0.1 mM CaCl.sub.2, 1 mM MgCl.sub.2, 10 mM KOH-HEPES [pH 7.7], 50 mM sucrose supplemented with protease inhibitors) as described previously (43).
(146) Quantitative Reverse Transcriptase (RT)-PCR Analysis
(147) For transcriptional analysis, total RNA was isolated from whole cell populations using the RNAeasy Mini Kit and RT was performed using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems). Quantitative PCR was performed on a Lightcycler 480 apparatus using the Lightcycler 480 SYBR Green I Master kit from Roche. Quantification data were normalized to the average expression of the endogenous Hprt1/Gapdh and -Actin genes within the log-linear phase of the amplification curve obtained for each primer set using the Ct method. All samples were prepared in 2 to 3 biological repeats.
(148) TABLE-US-00003 PrimersforQuantitativeRT-PCR: Oct4 (SEQIDNO:1) Fw:ttctggcgccggttacagaaccatactcga (SEQIDNO:2) Rev:gaggaagccgacaacaatgagaaccttcag Rex1 (SEQIDNO:3) Fw:cagctcctgcacacagaaga (SEQIDNO:4) Rev:actgatccgcaaacacctg Nanog (SEQIDNO:5) Fw:ttcttgcttacaagggtctgc (SEQIDNO:6) Rev:agaggaagggcgaggaga Zfpm2 (SEQIDNO:7) Fw:gcgaagacgtggagttcttt (SEQIDNO:8) Rev:ggctgtccccatctgattc -Actin (SEQIDNO:9) Fw:gccggcttacactgcgcttctt (SEQIDNO:10) Rev:ttctggcccatgcccaccat Gapdh (SEQIDNO:11) Fw:tggcaaagtggagattgttgc (SEQIDNO:12) Rev:aagatggtgatgggcttcccg Hprt1 (SEQIDNO:13) Fw:tcctcctcagaccgcttt (SEQIDNO:14) Rev:cctggttcatcgctaatc Sox1 (SEQIDNO:15) Fw:gtgacatctgcccccatc (SEQIDNO:16) Rev:gaggccagtctggtgtcag Sox17 (SEQIDNO:17) Fw:ctttatggtgtgggccaaag (SEQIDNO:18) Rev:ggtcaacgccttccaagact Sox7 (SEQIDNO:19) Fw:gcggagctcagcaagatg (SEQIDNO:20) Rev:gggtctcttctgggacagtg Brachyury (SEQIDNO:21) Fw:cagcccacctactggctcta (SEQIDNO:22) Rev:gagcctggggtgatggta Klf4 (SEQIDNO:23) Fw:gagttcctcacgccaacg (SEQIDNO:24) Rev:cgggaagggagaagacact
(149) DNA Microarrays Analysis
(150) Total double strand cDNAs from ES cells, MEFs and M-iPS cells was hybridized on Nimblegen mouse expression 135K arrays and results were analyzed with the free trial Arraystar software. Normalization was calculated with the RMA algorithm (46) implemented in Bioconductor. The experiments were performed in triplicates.
(151) Gene-by-gene tests for differential expression between paired cell types were performed using a moderated t-statistic (47). P-values were adjusted using the procedure of Benjamini and Hochberg for controlling the False Discovery Rate (FDR) (48). Differentially expressed genes between the paired cell types were identified using adjusted p values below 1%.
(152) Bisulfite Sequencing
(153) DNA extraction and bisulfite sequencing of mock-treated and M-phase treated MEF nuclei, M-iPS cells and CGR8 ES cells were performed as previously described (49). Before DNA extraction, GFP positive M-iPS cells were sorted with a Facsaria cytometer to avoid contamination by feeder cells. DNA polymorphisms between the C57BL/6J and JF1 backgrounds were used for allele discrimination in MEF and M-iPS cells.
(154) TABLE-US-00004 Primers: Bis-Oct4: (SEQIDNO:25) Fw:TTAGAGGATGGTTGAGTGGGTTTGTAAGGAT (SEQIDNO:26) Rev:CCAATCCCACCCTCTAACCTTAACCTCTAA (theseprimersamplifyonlytheendogenous copyofOct-4.) Bis-Nanog (SEQIDNO:27) Fw:TAAATTGGGTATGGTGGTAGATAAGTTTGG (SEQIDNO:28) Rev:TAAAAAACATCCTCTAATCTAAAAACATCC Bis-Snrpn (SEQIDNO:29) Fw:ATTGGTGAGTTAATTTTTTGGA (SEQIDNO:30) Rev:ACAAAACTCCTACATCCTAAAA
(155) Generation of Chimeras
(156) Chimeras were produced by injecting (B6-JF1) M-iPS cells into CD1 blastocysts that were subsequently implanted into pseudo-pregnant CD1 females. M phase extract-treated iPS clones were sexed by karyotyping.
(157) Purification and Analysis of Chromatin Fractions
(158) Permeabilized MEF nuclei were incubated in M phase Xenopus egg extracts for 40 min, diluted in 5 volumes of XB buffer and pelleted by centrifugation at 500 g through a 0.7M sucrose cushion for 10 min. Nuclear pellets were resuspended in XB with 0.2% Triton X-100 and incubated on ice for 5 min. Chromatin pellets were recovered by centrifugation at 5000 g for 5 min, adjusted in Laemmli buffer and analyzed by SDS-PAGE. Western blot analysis was performed using the following antibodies: anti-ser10 phosphorylated histone H3 (Ozyme, 9701S), anti-histone H3 (Abcam, ab1791), anti-HP1 (Millipore, MAB3584 or 2616), anti-histone variant H3.3 (Abcam, ab62642), anti-Lamin B1 (Abcam, ab16048), anti-H3K4me2 (Abcam, Ab7766), anti-H3K4me3 (Abcam, Ab1012), anti-H3K9me2 (Millipore, 07-441), anti-H3K9me3 (Upstate), anti-H4K20me3 (Abcam, ab9053), anti-H4K8acetyl (Abcam, ab1760), anti-H3K27me3 (Millipore, 07-449), anti-H3K9acetyl (Abcam, ab4441) and anti-acetyl H3 (Millipore 06-599).
(159) Viral Integration
(160) All the cell populations (not infected MEFs, infected MEFs and MEFs that have been infected, permeabilized and incubated with M phase Xenopus egg extracts or buffer) were harvested 21 days after infection and total DNA was extracted with the DNEasy kit according to the manufacturer's procedure. Quantitative PCR was then performed as described above. Quantification data were normalized to the average of two genomic regions and relative to the DNA of not infected MEFs.
(161) TABLE-US-00005 Primers: DNAOct4 (SEQIDNO:31) Fw:aagttggcgtggagactttg (SEQIDNO:32) Rev:tctgagttgctttccactcg DNAKlf4 (SEQIDNO:33) Fw:gctcctctacagccgagaatc (SEQIDNO:34) Rev:atgtccgccaggttgaag DNASox2 (SEQIDNO:35) Fw:tcaagaggcccatgaacg (SEQIDNO:36) Rev:ttgctgatctccgagttgtg DNAcMyc (SEQIDNO:37) Fw:gctggagatgatgaccgagt (SEQIDNO:38) Rev:atcgcagatgaagctctggt DNAgenomic1 (SEQIDNO:39) Fw:gtcaccgtttgtgccgaa (SEQIDNO:40) Rev:agctgaaatgagaccgattatgg DNAgenomic2 (SEQIDNO:41) Fw:gagtcaaagagtggtgaaggagttagt (SEQIDNO:42) Rev:agctgacgggccttctaagtc
REFERENCES OF EXAMPLE 2
(162) 1. Yamanaka S & Blau H M (2010) Nuclear reprogramming to a pluripotent state by three approaches. (Translated from eng) Nature 465(7299):704-712 (in eng). 2. Jaenisch R & Young R (2008) Stem cells, the molecular circuitry of pluripotency and nuclear reprogramming. (Translated from eng) Cell 132(4):567-582 (in eng). 3. Hochedlinger K & Jaenisch R (2006) Nuclear reprogramming and pluripotency. (Translated from eng) Nature 441(7097):1061-1067 (in eng). 4. Gurdon J B & Melton D A (2008) Nuclear reprogramming in cells. (Translated from eng) Science 322(5909):1811-1815 (in eng). 5. Maherali N, et al. (2007) Directly reprogrammed fibroblasts show global epigenetic remodeling and widespread tissue contribution. (Translated from eng) Cell Stem Cell 1(1):55-70 (in eng). 6. Feng B, Ng J H, Heng J C, & Ng H H (2009) Molecules that promote or enhance reprogramming of somatic cells to induced pluripotent stem cells. (Translated from eng) Cell Stem Cell 4(4):301-312 (in eng). 7. Huangfu D, et al. (2008) Induction of pluripotent stem cells by defined factors is greatly improved by small-molecule compounds. (Translated from eng) Nat Biotechnol 26(7):795-797 (in eng). 8. Gurdon J & Murdoch A (2008) Nuclear transfer and iPS may work best together. (Translated from eng) Cell Stem Cell 2(2):135-138 (in eng). 9. Alberio R, Johnson A D, Stick R, & Campbell K H (2005) Differential nuclear remodeling of mammalian somatic cells by Xenopus laevis oocyte and egg cytoplasm. (Translated from eng) Exp Cell Res 307(1):131-141 (in eng). 10. Hansis C, Barreto G, Maltry N, & Niehrs C (2004) Nuclear reprogramming of human somatic cells by xenopus egg extract requires BRG1. (Translated from eng) Curr Biol 14(16):1475-1480 (in eng). 11. Byrne J A, Simonsson S, Western P S, & Gurdon J B (2003) Nuclei of adult mammalian somatic cells are directly reprogrammed to oct-4 stem cell gene expression by amphibian oocytes. (Translated from eng) Curr Biol 13(14):1206-1213 (in eng). 12. Lemaitre J M, Danis E, Pasero P, Vassetzky Y, & Mechali M (2005) Mitotic remodeling of the replicon and chromosome structure. Cell 123:1-15. 13. Yang X, et al. (2007) Nuclear reprogramming of cloned embryos and its implications for therapeutic cloning. (Translated from eng) Nat Genet. 39(3):295-302 (in eng). 14. Li X, Li Z, Jouneau A, Zhou Q, & Renard J P (2003) Nuclear transfer: progress and quandaries. (Translated from eng) Reprod Biol Endocrinol 1:84 (in eng). 15. Takahashi K & Yamanaka S (2006) Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 126(4):663-676. 16. Yu J, et al. (2007) Induced pluripotent stem cell lines derived from human somatic cells. (Translated from eng) Science 318(5858):1917-1920 (in eng). 17. Hochedlinger K & Plath K (2009) Epigenetic reprogramming and induced pluripotency. (Translated from eng) Development 136(4):509-523 (in eng). 18. Wernig M, et al. (2007) In vitro reprogramming of fibroblasts into a pluripotent ES-cell-like state. Nature 448(7151):318-324. 19. Park I H, et al. (2008) Reprogramming of human somatic cells to pluripotency with defined factors. (Translated from eng) Nature 451(7175):141-146 (in eng). 20. Kanai-Azuma M, et al. (2002) Depletion of definitive gut endoderm in Sox17-null mutant mice. (Translated from eng) Development 129(10):2367-2379 (in eng). 21. Beddington R S, Rashbass P, & Wilson V (1992) Brachyurya gene affecting mouse gastrulation and early organogenesis. (Translated from eng) Dev Suppl: 157-165 (in eng). 22. Niimi T, Hayashi Y, Futaki S, & Sekiguchi K (2004) SOX7 and SOX17 regulate the parietal endoderm-specific enhancer activity of mouse laminin alpha1 gene. (Translated from eng) J Biol Chem 279(36):38055-38061 (in eng). 23. Pevny L H, Sockanathan S, Placzek M, & Lovell-Badge R (1998) A role for SOX1 in neural determination. (Translated from eng) Development 125(10):1967-1978 (in eng). 24. Todaro G J & Green H (1963) Quantitative studies of the growth of mouse embryo cells in culture and their development into established lines. (Translated from eng) J Cell Biol 17:299-313 (in eng). 25. Hanna J, et al. (2009) Direct cell reprogramming is a stochastic process amenable to acceleration. (Translated from eng) Nature 462(7273):595-601 (in eng). 26. Bru T, et al. (2008) Rapid induction of pluripotency genes after exposure of human somatic cells to mouse ES cell extracts. (Translated from eng) Exp Cell Res 314(14):2634-2642 (in eng). 27. Panorchan P, Schafer B W, Wirtz D, & Tseng Y (2004) Nuclear envelope breakdown requires overcoming the mechanical integrity of the nuclear lamina. (Translated from eng) J Biol Chem 279(42):43462-43467 (in eng). 28. Moir R D, Puglia K V, & Willis I M (2000) Interactions between the tetratricopeptide repeat-containing transcription factor TFIIIC131 and its ligand, TFIIIB70. Evidence for a conformational change in the complex. (Translated from eng) J Biol Chem 275(34):26591-26598 (in eng). 29. Wang F, Kou Z, Zhang Y, & Gao S (2007) Dynamic reprogramming of histone acetylation and methylation in the first cell cycle of cloned mouse embryos. (Translated from eng) Biol Reprod 77(6):1007-1016 (in eng). 30. Maalouf W E, Alberio R, & Campbell K H (2008) Differential acetylation of histone H4 lysine during development of in vitro fertilized, cloned and parthenogenetically activated bovine embryos. (Translated from eng) Epigenetics 3(4):199-209 (in eng). 31. Baxter J, et al. (2004) Histone hypomethylation is an indicator of epigenetic plasticity in quiescent lymphocytes. (Translated from eng) Embo J 23(22):4462-4472 (in eng). 32. Santos F, et al. (2003) Epigenetic marking correlates with developmental potential in cloned bovine preimplantation embryos. (Translated from eng) Curr Biol 13(13):1116-1121 (in eng). 33. Ng R K & Gurdon J B (2008) Epigenetic memory of an active gene state depends on histone H3.3 incorporation into chromatin in the absence of transcription. (Translated from eng) Nat Cell Biol 10(1):102-109 (in eng). 34. Hanna J H, Saha K, & Jaenisch R (2010) Pluripotency and cellular reprogramming: facts, hypotheses, unresolved issues. (Translated from eng) Cell 143(4):508-525 (in eng). 35. Egli D, Rosains J, Birkhoff G, & Eggan K (2007) Developmental reprogramming after chromosome transfer into mitotic mouse zygotes. (Translated from eng) Nature 447(7145):679-685 (in eng). 36. Gurdon J B & Laskey R A (1970) The transplantation of nuclei from single cultured cells into enucleate frogs' eggs. (Translated from eng) J Embryol Exp Morphol 24(2):227-248 (in eng). 37. Wakayama T, Tateno H, Mombaerts P, & Yanagimachi R (2000) Nuclear transfer into mouse zygotes. (Translated from eng) Nat Genet 24(2):108-109 (in eng). 38. Egli D, Birkhoff G, & Eggan K (2008) Mediators of reprogramming: transcription factors and transitions through mitosis. (Translated from eng) Nat Rev Mol Cell Biol 9(7):505-516 (in eng). 39. Kikyo N, Wade P A, Guschin D, Ge H, & Wolffe A P (2000) Active Remodeling of Somatic Nuclei in Egg Cytoplasm by the Nucleosomal ATPase ISWI. Science 289(5488):2360-2363. 40. Bernstein B E, et al. (2006) A bivalent chromatin structure marks key developmental genes in embryonic stem cells. (Translated from eng) Cell 125(2):315-326 (in eng). 41. Bui H T, Van Thuan N, Wakayama T, & Miyano T (2006) Chromatin remodeling in somatic cells injected into mature pig oocytes. (Translated from eng) Reproduction 131(6):1037-1049 (in eng). 42. Yeom Y I, et al. (1996) Germline regulatory element of Oct-4 specific for the totipotent cycle of embryonal cells. (Translated from eng) Development 122(3):881-894 (in eng). 43. Menut S, Lemaitre J M, Hair A, & Mchali M (1999) DNA replication and chromatin assembly using Xenopus egg extracts. Advances in Molecular Biology: A comparative Methods Approach to the Study of Ooocytes and Embryos, ed Richter J D (Oxford University Press), pp 196-226. 44. Taranger C K, et al. (2005) Induction of dedifferentiation, genomewide transcriptional programming, and epigenetic reprogramming by extracts of carcinoma and embryonic stem cells. (Translated from eng) Mol Biol Cell 16(12):5719-5735 (in eng). 45. Zhou Q, Jouneau A, Brochard V, Adenot P, & Renard J P (2001) Developmental potential of mouse embryos reconstructed from metaphase embryonic stem cell nuclei. (Translated from eng) Biol Reprod 65(2):412-419 (in eng). 46. Irizarry R A, et al. (2003) Exploration, normalization, and summaries of high density oligonucleotide array probe level data. (Translated from eng) Biostatistics 4(2):249-264 (in eng). 47. Smyth G K (2004) Linear models and empirical bayes methods for assessing differential expression in microarray experiments. (Translated from eng) Stat Appl Genet Mol Biol 3:Article3 (in eng). 48. Benjamini Y & Hochberg Y (1995) Controlling the false discovery rate: a practical and powerful approach to multiple testing. JRSSB 57:289-300. 49. Arnaud P, et al. (2006) Stochastic imprinting in the progeny of Dnmt3L/ females. (Translated from eng) Hum Mol Genet. 15(4):589-598 (in eng).