Swine dysentery vaccine

09855322 · 2018-01-02

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention relates to a composition comprising Brachyspira hyodysenteriae bacteria, particularly in the field of immunization against swine dysentery. The composition of the invention comprises bacteria from at least two genetically diverse strains of B. hyodysenteriae. The invention relates also to the composition of the invention for use as a vaccine, preferably a universal vaccine against swine dysentery caused by B. hyodysenteriae.

Claims

1. A composition comprising an inactivated Brachyspira hyodysenteriae strain deposited at the Collection Nationale de Cultures de Microrganismes (CNCM), Institut Pasteur under the registration number CNCM I-4720, CNCM I-4721, or CNCM I-4722, a buffer solution, and an immune response-enhancing amount of an adjuvant, wherein the Brachyspira hyodysenteriae strain is inactivated by treatment with formaldehyde and the adjuvant is selected from the group consisting of aluminum hydroxide, aluminum phosphate gel, calcium phosphate gel, a virosome, polylactide co-glycolide, monophosphoryl lipid A, and a gold particle.

2. The composition of claim 1, wherein the treatment with formaldehyde comprises adding the formaldehyde to cultured live pellets of the strain and incubating with agitation.

3. The composition of claim 2, wherein the formaldehyde is added at a final concentration of 0.5%.

4. The composition of claim 2, wherein the incubating with agitation is carried out at 37 C. for 18 hours.

5. The composition of claim 1, wherein the strain is present at a concentration of 10.sup.7 to 10.sup.12 bacteria per mL.

6. An emulsion comprising an inactivated Brachyspira hyodysenteriae strain deposited at the Collection Nationale de Cultures de Microrganismes (CNCM), Institut Pasteur under the registration number CNCM I-4720, CNCM I-4721, or CNCM I-4722, wherein the Brachyspira hyodysenteriae strain is inactivated by a chemical, heat, or radiation.

7. The emulsion of claim 6, wherein the emulsion is an oil-in-water emulsion or a water-in-oil emulsion.

8. The emulsion of claim 6, wherein the bacterial strain is inactivated by treatment with formaldehyde.

9. The emulsion of claim 6, further comprising an antiseptic and/or antifungal agent.

10. The emulsion of claim 6, further comprising thimerosal.

11. The emulsion of claim 6, wherein the emulsion comprises the inactivated Brachyspira hyodysenteriae strain deposited at the Collection Nationale de Cultures de Microrganismes (CNCM), Institut Pasteur under the registration number CNCM I-4720.

12. The emulsion of claim 5, wherein the strain is present at a concentration of 10.sup.7 to 10.sup.12 bacteria per mL.

13. A polyvalent vaccine comprising an effective concentration of a mixture of inactivated Brachyspira hyodysenteriae strains deposited at the Collection Nationale de Cultures de Microrganismes (CNCM), Institut Pasteur under the registration numbers CNCM I-4720, CNCM I-4721, and CNCM I-4722 and an immune response-enhancing amount of an adjuvant, wherein the strains are inactivated by treatment with formaldehyde.

14. The vaccine of claim 13, wherein the adjuvant is selected from the group consisting of aluminum hydroxide, aluminum phosphate gel, calcium phosphate gel, a virosome, polylactide co-glycolide, monophosphoryl lipid A, and a gold particle.

15. The vaccine of claim 13, wherein the strains are present at a final concentration of 10.sup.9 bacteria per mL.

16. A surfactant based formulation comprising an inactivated Brachyspira hyodysenteriae strain deposited at the Collection Nationale de Cultures de Microrganismes (CNCM), Institut Pasteur under the registration number CNCM I-4720, CNCM I-4721, or CNCM I-4722, wherein the Brachyspira hyodysenteriae strain is inactivated by a chemical, heat, or radiation.

17. The surfactant based formulation of claim 16, wherein the bacterial strain is inactivated by treatment with formaldehyde.

18. The surfactant based formulation of claim 16, further comprising an antiseptic and/or antifungal agent.

19. The surfactant based formulation of claim 16, further comprising thimerosal.

20. The surfactant based formulation of claim 16, wherein the strain is present at a concentration of 10.sup.7 to 10.sup.12 bacteria per mL.

Description

BRIEF DESCRIPTION OF THE FIGURES

(1) FIG. 1. Dendrogram of the 44 B. hyodysenteriae MLVA types found in the present study and clustered using UPGMA. Roman numerals I to VI indicate clonal complexes defined at the single-locus variant level. The scale bar represents genetic distance as the absolute number of differences in marker alleles among genotypes. Bootstrap values of 40% are shown.

(2) FIG. 2. MLVA types (circled) and relationships found among them according to the goeBURST algorithm. Solid lines show the single locus variant level, dashed lines show the double-locus variant level, and dotted lines show the triple-locus variant level. Groups at the single-locus variant level are indicated by roman numerals I to VI.

(3) FIG. 3. Selection of the strains of the universal vaccine of the examples (Type 3 (e.g. strain with deposit number CNCM I-4720), Type 14 (e.g. the strain with deposit number CNCM I-4721) and Type 20 (e.g. the strain with deposit number CNCM I-4722). The ancestral type strain of the referred clonal complexes (II, V and I) was selected. The selected strains are detected in a proportion of at least 1% with respect to the total of detected strains in Spain.

(4) FIG. 4. Survival curves comparing the groups vaccinated with the autovaccine (dark grey), universal vaccine (black) and non-vaccinated (control, light grey), using the Log Rank test at =0.05.

(5) FIG. 5. Elimination of B. hyodysenteriae over the time post-challenge (percentage of positives rectal swabs per week) (black, autovaccine; dark grey, universal vaccine; light grey, non-vaccinated animals (control)).

(6) FIG. 6. Incubation period (number of days between the challenge and the appearance of diarrhoea or faecal shedding of the bacteria) in the different groups (black, autovaccine; dark grey, universal vaccine; light grey, non-vaccinated animals (control)).

(7) FIG. 7. Percentage of pigs with diarrhoea (panel A) and bloody diarrhoea (panel B) after challenge (black, autovaccine; dark grey, universal vaccine; light grey, non-vaccinated animals (control)).

(8) FIG. 8. Average daily gain (ADG) on the post-challenge days (black, autovaccine; dark grey, universal vaccine; light grey, non-vaccinated animals (control)).

(9) FIG. 9. Daily weight gain (DWG) in the first 9 days after challenge (day 0 to day 9) (black, autovaccine; dark grey, universal vaccine; light grey, non-vaccinated animals (control)).

(10) FIG. 10. Measurement of the antibody response (the absorbance at 450 nm directly correlates to amount of antibody produced) of the hiperimmunized rabbits with A, B and C strains against LPS of strain A (CNM 1-4720) along the experiment (potency assay).

(11) FIG. 11. Measurement of the antibody response (the absorbance at 450 nm directly correlates to amount of antibody produced) of the hiperimmunized rabbits with A, B and C strains against LPS of strain B (CNM 1-4721) along the experiment (potency assay).

(12) FIG. 12. Measurement of the antibody response (the absorbance directly correlates to amount of antibody produced) of the hiperimmunized rabbits with A, B and C strains against LPS of strain C (CNM 1-4722) along the experiment (potency assay).

DETAILED DESCRIPTION OF THE INVENTION

Composition of the Invention

(13) The present invention relates to a composition comprising bacteria from at least two genetically diverse strains of Brachyspira hyodysenteriae. The term genetically diverse as used in the present invention refers to a defined set of genetic, measurable diverse characteristics in the genetic makeup of a species. To determine the diversity of microorganisms in defined environments (ecosystems) or to identify the spread of particular strains between hosts, genetic typing techniques which have the ability to distinguish diverse organisms of the same species are deployed. Importantly, when one is comparing the diversity of a single species between different ecosystems a robust statistical approach that allows an objective assessment is required. To this end, indices of diversity have been defined mathematically that are based on the frequency with which organisms of a particular type occur in a population or can be discriminated by a given typing tool (Grundmann, H. et al., Journal of Clinical Microbiology (2001), 39:4190-4192).

(14) A relatively high diversity among B. hyodysenteriae isolates has been classically described. The ability to understand the epidemiology of SD and to progress to its control depends on the availability of reliable strain typing methods to characterize the isolates. Based on the analysis of semi-purified lipopolysaccharides (LPS), four different serotypes were identified by Baum & Joens (Baum, D. H. et al., Infection and immunity (1979), 25:792-796), although further studies finally differentiated a total of 11 serogroups that included several serotypes (Hampson, D. J. et al., Epidemiology and Infection (1989), 102:75-84; Hampson, D. J. et al., Epidemiology and Infection (1990), 105:79-85; Hampson, D. J. et al., Swine dysentery. In: Intestinal Spirochaetes in Domestic Animals and Humans, pp. 175-209, edited by D. J. Hampson & T. B. Stanton. Wallingford: CAB International, 1997).

(15) Differences in the geographical distribution of B. hyodysenteriae were demonstrated soon after. Reference strains from USA were classified within serotypes 1 and 2 while a higher variability regarding serotype classification was described for isolates from Europe and Australia (Harris et al., Swine Dysentery. In: Straw, B. E., D'Allaire, S. D., Mengeling, W. D. & Taylor, D. J. (Eds.) Disease of Swine. Iowa State University Press (1999), Ames Iowa USA, pp. 579-600). However, there is almost no recent information regarding serotype distribution of B. hyodysenteriae isolates. As a consequence of cross reactions, the techniques required to determine the serotype are slow and cumbersome to perform and give inconclusive results in a very high number of the isolates. For that reason, these techniques have been replaced by several molecular methods.

(16) Different typing tools have been developed to discriminate between B. hyodysenteriae field isolates and provide a better understanding of the molecular epidemiology of the pathogen. Among them, a useful tool for strain typing of pathogenic microorganisms that has been introduced during the last few years is the multi-locus variable-number tandem-repeat analysis or MLVA. It has been developed as an important epidemiologic tool for strain typing of pathogenic microorganisms. MLVA is based on the PCR amplification of a number of well-selected and characterized loci that contain short repeat sequences (multiple loci of minisatellites called variable numbers of tandem repeats (VNTRs)). This sort of minisatellite consists of unique direct head-to-tail DNA repeats which can be found in all bacterial genomes and can be used to define specific isolates of bacterial species. In addition, VNTRs have been used to infer the bacterial population structure and phylogeny of diverse bacteria species. Within each repeat sequence locus the number of repeat copies can vary between different strains. By measuring the size of each PCR amplified loci, the number of repeat units can be deduced. Hidalgo and colleagues developed and tested a multiple-locus variable-number tandem-repeat analysis (MLVA) method that could be used in basic veterinary diagnostic microbiology laboratories equipped with PCR technology or in more advanced laboratories with access to capillary electrophoresis. Based on eight loci, and when performed on isolates from different farms in different countries, as well as type and reference strains, the developed MLVA technique was highly discriminatory (Hunter and Gaston discriminatory index, 0.938 [95% confidence interval, 0.9175 to 0.9584]) while retaining a high phylogenetic value. Using the technique, the species was shown to be diverse (44 MLVA types from 172 isolates and strains), although isolates were stable in herds over time. The population structure appeared to be clonal. The finding of B. hyodysenteriae MLVA type 3 in piggeries in three European countries, as well as other, related, strains in different countries, suggests that spreading of the pathogen via carrier pigs is likely. MLVA overcomes drawbacks associated with previous typing techniques for B. hyodysenteriae and is a powerful method for epidemiologic and population structure studies on this important pathogenic spirochete (Hidalgo, A. et al., Journal of Clinical Microbiology (2010), 48(8):2859-2865).

(17) The inventors and their collaborators have applied this method on an international collection of B. hyodysenteriae isolates, including 115 Spanish field isolates as well as reference strains and isolates from Australia, Canada, E.E.U.U., UK and The Netherlands.

(18) MLVA analysis reveals that Spanish field isolates of B. hyodysenteriae are heterogeneous and that the population has a clonal structure. A total number of 15 MLVA types were identified among Spanish isolates. Moreover, isolates with the same MLVA type were identified in Spain, UK and The Netherlands. On the other hand, it was concluded that isolates from Australia or EEUU have no common MLVA with Spanish isolates.

(19) By grouping MLVA types at the single-locus variant level, a total number of six clonal complexes (I to VI) were established (FIG. 2).

(20) The composition of the invention may comprise two, or three, or four, or five, or more genetically diverse strains. Preferably, the genetic diversity of the strains of the composition of the invention is conferred by selecting the at least two genetically diverse strains of Brachyspira hyodysenteriae from different clonal complexes. Clonal complex as used in the present invention refers to the several groups established by grouping the MLVA types at the single-locus variant level, as described above. More preferably at least one strain belongs to clonal complex II, and/or at least one strain belongs to clonal complex V, and/or at least one strain belongs to clonal complex I.

(21) In the composition of the present invention, the genetically diverse strains preferably belong to the ancestral type from the clonal complex.

(22) The common ancestor within each clonal complex was predicted using the goeBUST algorithm available at goeburst.phyloviz.net/#Software, a global implementation of the eBURST algorithm. For more details see publications Feil et al., 2004 and Francisco et al., 2009, free at goeburst.phyloviz.net/#Publications.

(23) The composition of the present invention may further comprise a strain which belongs to a third clonal complex. Preferably, the third clonal complex is selected from the group consisting of clonal complex I, clonal complex II and clonal complex V.

(24) Accordingly, the composition of the present invention comprises at least two, preferably three, genetically diverse strains of Brachyspira hyodysenteriae, wherein at least one of the strains belong to clonal complex I, and/or at least one of the strains belong to clonal complex II and/or at least one of the strains belong to clonal complex V.

(25) Preferably, the composition of the invention comprises three genetically diverse strains of Brachyspira hyodysenteriae wherein one of the strains belong to clonal complex I, one of the strains belong to clonal complex II and one of the strains belong to clonal complex V.

(26) Preferably, in the composition of the present invention at least one of the strains is the strain deposited within the Collection Nationale de Cultures de Microorganismes (CNCM), Institut Pasteur, on Mar. 14, 2013, with registration number CNCM I-4720, at least one of the strains is the strain deposited on the same date within the CNCM with registration number CNCM I-4721 and/or at least one of the strains is the strain deposited on the same date within the CNCM with registration number CNCM I-4722.

(27) Accordingly, the present invention also provides the strains deposited within the Collection Nationale de Cultures de Microorganismes (CNCM), Institut Pasteur, on Mar. 14, 2013, with registration numbers CNCM I-4720, CNCM I-4721 and CNCM I-4722.

(28) The strain with registration number CNCM I-4720 belongs to clonal complex II. The strain with registration number CNCM I-4721 belongs to clonal complex V. The strain with registration number CNCM I-4722 belongs to clonal complex I.

(29) In the composition of the present invention the genetically diverse strains are preferably epidemiologically relevant. In the context of the present invention, epidemiologically relevant means that the strains are at least detected in a proportion of 1-100%, preferably at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 50%, at least 75%, at least 90% or 100% with respect to the total of detected strains in a region of interest. Preferably, the genetically diverse strains are at least 1% detected with respect to the total of detected strains in a region of interest. In the context of the present invention, detected means that said strains were identified in the region of interest. The detection of the bacteria Brachyspira hyodysenteriae can be done e.g. in rectal swabs, colonic mucosa and/or faecal samples from pigs. For example, the samples can be cultured and the DNA can be extracted following previously reported methods (see e.g. Hidalgo, A. et al., Journal of Clinical Microbiology (2010), 48(8):2859-2865). The presence of B. hyodysenteriae can be detected by PCR methods. The presence of B. hyodysenteriae can be also confirmed by streaking bacteriology swabs taken from faeces or the colonic walls of pigs onto selective agar plates. After incubation of the plates in anaerobic environment, the presence of low flat spreading growth of spirochaetes on the plate, and hemolysis around the growth can be recorded (La, T. et al., Veterinary Microbiology (2004), 102:97-109). Alternatively, the presence of B. hyodysenteriae can be performed by suspending the samples in PBS and detecting the presence of the bacteria with an indirect immunofluorescence test (IFT) (see e.g. Diego, R. et al., Vaccine (1995), 13(7):663-667). Other methods of detecting the presence of B. hyodysenteriae known in the art can be employed.

(30) The term region of interest as employed in the present invention refers to a demarcated area of the Earth, i.e. to a geographical region or a geographical area wherein the presence of B. hyodysenteriae is assessed. There is no specific limitation to the geographical region of interest. It can vary from thousands of kilometers at continental level to a few kilometers at local level. For example, the region of interest can be part of a country, a whole country or more than one country. Preferably, the region of interest is a country or a group of countries. For example, the region of interest can be Europe. Preferably, the region of interest can be Spain, more preferably Iberian Peninsula Spanish territory, in particular Castilla y Len, Andalucia and/or Extremadura. Other preferred regions of interest are Italy, The Netherlands, United Kingdom, Australia, Canada and/or United States.

(31) Moreover, the bacteria comprising the composition of the present invention may be inactivated, i.e. they may be chemically or physically inactivated. The inactivation comprises killing the bacteria with chemicals, heat, and/or radiation. The bacteria of the composition can be inactivated by any inactivation procedure known in the art. Preferably, the bacteria of the composition of the invention are inactivated by treating the bacteria with formaldehyde. Most preferably, the formaldehyde is injected in to the bacteria culture at 0.5% and it is then incubated overnight (18 hours, approx.) at 37 C. with light agitation.

(32) According to the present invention, the bacteria of the composition, which are preferably inactivated, may be present in a concentration of at least between 10.sup.7 and 10.sup.12 bacteria/mL, preferably in a concentration of at least 10.sup.7, or 10.sup.8, or 5.Math.10.sup.8, or 10.sup.9, or 10.sup.10, or 10.sup.11 or 10.sup.12 bacteria/mL, preferably in a concentration of between 10.sup.8 and 10.sup.10 bacteria/mL, more preferably in a concentration of between 10.sup.8 and 10.sup.9 bacteria/mL, even more preferably in a concentration of 5.Math.10.sup.8 bacteria/mL.

(33) If the composition comprises bacteria belonging to two strains, they may be present in the composition in a ratio of 1:(0.5-2). If the composition comprises bacteria belonging to three strains, they may be present in the composition in a ratio of 1:(0.5-2):(0.5-2). If the composition comprises bacteria belonging to four strains, they may be present in the composition in a ratio of 1:(0.5-2):(0.5-2):(0.5-2). If the composition comprises bacteria belonging to five strains, they may be present in the composition in a ratio of 1:(0.5-2):(0.5-2):(0.5-2):(0.5-2). Preferably, the composition comprises bacteria in an equal mixture of the selected strains, namely in a ratio of 1:1, 1:1:1, 1:1:1:1, 1:1:1:1:1, depending on how many different strains the composition comprises. In this context, ratio means number of bacteria/mL.

(34) The concentration of bacteria in the composition can be calculated using any method known in the art. For example, Neubauer chamber counting can be used to estimate the number of bacteria present in the composition of the invention.

(35) The composition of the present invention comprises preferably a total amount of 10.sup.8 to 10.sup.9 inactivated bacteria/mL in an equal mixture of the selected strains, wherein the bacteria belong to three genetically diverse strains of Brachyspira hyodysenteriae, wherein one of the strains belong to clonal complex I, one of the strains belong to clonal complex II and one of the strains belong to clonal complex V, and wherein preferably the genetically diverse strains are epidemiologically relevant in a region of interest, i.e. are present in Spain in at least a proportion of 1% with respect to the total of detected strains.

(36) Preferably, the genetically diverse strains that are epidemiologically relevant in a region of interest are each present in a proportion of at least 9% with respect to the total of detected strains. Preferably, one of the strains is present in a proportion of at least 13% with respect to the total of detected strains. More preferably two of the strains are present in a proportion of at least 13% with respect to the total of detected strains. Most preferably, one of the strains is present in a proportion of at least 24% with respect to the total of detected strains.

(37) The composition of the present invention may further comprise an adjuvant. An adjuvant is a component that potentiates the immune response to an antigen and/or modulates it towards the desired immune responses. It may be an inorganic or organic chemical, macromolecule or whole cells of certain killed bacteria which enhances the immune response to given antigen. In the context of the present invention, the adjuvant that may be present in the composition of the invention can be any suitable adjuvant which e.g. enhances, accelerates and prolongs the specific immune response as known in the current art.

(38) Adjuvants may include for instance: Mineral salts, e.g., aluminium hydroxide and aluminium or calcium phosphate gels. Oil emulsions and surfactant based formulations, e.g., MF59 (microfluidised detergent stabilised oil-in-water emulsion), QS21 (purified saponin), AS02 [SBAS2] (oil-in-water emulsion+MPL+QS-21), Montanide ISA-51, ISA-720, IMS (stabilised water-in-oil emulsion). Particulate adjuvants, e.g., virosomes (unilamellar liposomal vehicles incorporating influenza haemagglutinin), AS04 ([SBAS4] Al salt with MPL), ISCOMS (structured complex of saponins and lipids), polylactide co-glycolide (PLG). Microbial derivatives (natural and synthetic), e.g., monophosphoryl lipid A (MPL), Detox (MPL+M. Phlei cell wall skeleton), AGP [RC-529] (synthetic acylated monosaccharide), DC_Chol (lipoidal immunostimulatory able to self organise into liposomes), OM-174 (lipid A derivative), CpG motifs (synthetic oligonucleotides containing immunostimulatory CpG motifs), modified LT and CT (genetically modified bacterial toxins to provide non-toxic adjuvant effects). Endogenous human immunomodulators, e.g., hGM-CSF or hIL-12 (cytokines that can be administered either as protein or plasmid encoded), Immudaptin (C3d tandem array) Inert vehicles, such as gold particles towards the desired response to vaccine antigens.

(39) The most preferred adjuvants are aluminum salts (aluminum hydroxide or aluminum phosphate) and mineral oils. When inoculated they produce a small granuloma that allows the delayed liberation of the antigen (long lasting antigenic stimulation) and the attraction of antigen-presenting cells. This increases the immune response. For example, the adjuvant may be HAVLOGEN or Montanide. Most preferably, the adjuvant may be a commercial oil adjuvant such as Montanide IMS 251 C VG (SEPPIC).

(40) The adjuvant is preferably present in the final composition in a concentration in the final formula of 5 to 50% vol/vol respect to final injection volume, preferably 5%, 10%, 20%, 25%, 30%, 40%, 50% or more (vol/vol, i.e. volume with respect to final injection volume). More preferably, the concentration of adjuvant in the final formula is 20% vol/vol (i.e. volume with respect to final injection volume).

(41) The composition of the invention may additionally comprise other components. For example, the composition may comprise antiseptic and/or antifungal agents. For example, the composition may further comprise Thimerosal (Sigma), also known as Thiomersal. Preferably, Thimerosal is comprised in an amount of 0.005 to 1 g per 100 ml, preferably in an amount of 0.5, or 0.3 or 0.1, or 0.05, or 0.03, or 0.02, or 0.01 or 0,005 g per 100 ml. More preferably, thimerosal is comprised in an amount of 0.01 g per 100 ml. Further, the composition of the invention may also comprise buffer solutions such as salts. Preferably, the composition of the invention may comprise a buffer in a concentration of 0.01 to 0.5 M, preferably in a concentration of 0.5M, or 0.4M, or 0.3M, or 0.2M, or 0.1M, or 0.05M, or 0.01M. The buffer may be any suitable buffer described in the art. For example, the buffer may be phosphate buffered saline (PBS) or sodium acetate. Preferably, the buffer is sodium acetate 0.1M.

(42) Vaccine of the Invention

(43) The composition of the present invention may be preferably used as a vaccine. A vaccine is a biological preparation that improves immunity to a particular disease. According to the present invention, the vaccine is preferably a vaccine against swine dysentery (SD). Preferably, swine dysentery is caused by Brachyspira hyodysenteriae.

(44) The composition of the invention for use as a vaccine (from now on, the vaccine of the invention) may be suitable for administration to swine in a particular geographical region of interest. As described above, the region of interest is not particularly limited, and may comprise one or more countries. For example, the region of interest can be Europe. Preferably, the region of interest can be Spain, more preferably Iberian Peninsula Spanish territory, in particular Castilla y Len, Andalucia and/or Extremadura. Other preferred regions of interest are Italy, The Netherlands, United Kingdom, Australia, Canada and/or United States.

(45) The vaccine of the invention may be administered before the infection, and/or shortly after it. For example, the vaccine of the invention may be administered 1 to 20 days after the outbreak of the disease, preferably 1, or 2, or 3, or 4, or 5, or 6, or 7, or 8, or 9, or 10, or 15, or 20 days after the outbreak of the infection. The vaccine may also be administered 1-4 weeks after the outbreak of the disease, preferably 1, 2, 3 or 4 weeks after the outbreak of the infection.

(46) The vaccine of the invention may be administered by parenteral administration and/or oral administration. Preferably, the vaccine of the invention is administered by parenteral administration, more preferably by subcutaneous and/or intramuscular and/or intradermal administration, and even more preferably by intramuscular administration. For example, the vaccine of the invention may be injected intramuscularly into the neck muscles of swine.

(47) The administered dosage of the vaccine of the invention may range from 1 mL to 5 mL. For example, one dosage of the vaccine of the invention may be 1 mL. For example, one dosage of the vaccine of the invention may be 2 mL.

(48) The administered dosage of the vaccine of the invention may comprise between 10.sup.7 and 10.sup.12 bacteria/dose, preferably between 10.sup.8 and 10.sup.10 bacteria/dose, more preferably 10.sup.9 bacteria/dose. The administered dosage of the vaccine of the invention may comprise between 10.sup.8 and 10.sup.9 bacteria/mL. The administered dosage of the vaccine of the invention may comprise 10.sup.9 bacteria/mL. The administered dosage of the vaccine of the invention may comprise 5.Math.10.sup.8 bacteria/mL in 2 mL/dose.

(49) Accordingly, the preferred total number of bacteria per dose which may be administrated to swine is 10.sup.9 bacteria.

(50) The vaccine of the present invention is preferably an injectable vaccine.

(51) Vaccination Protocol

(52) According to the present invention, the vaccine of the invention may be preferably administered to the swine after weaning, most preferably two weeks after weaning. For example, the swine may be vaccinated since the fourth week of life. According to the present invention, the swine may be vaccinated twice (revaccinated). The swine are preferably revaccinated two weeks after the first vaccination. For example, the swine may be vaccinated two weeks after weaning, e.g. at the age of four weeks. Then, the second vaccine (revaccination) may take place at the age of six weeks (i.e. two weeks after the first vaccine was administered). For example, the swine may be vaccinated two weeks after weaning, e.g. at the age of five weeks. Then, the second vaccine (revaccination) may take place at the age of seven weeks. For example, the swine may be vaccinated two weeks after weaning, e.g. at the age of six weeks. Then, the second vaccine (revaccination) may take place at the age of eight weeks. Vaccination for the first time at the age of four weeks is preferred.

(53) Weaning can occur at 21 days of age (La, T. et al., Veterinary Microbiology (2004), 102:97-109). Weaning can also occur at 15 days of age, or at any other age, depending on the heard.

(54) Thus, the present invention provides the following items:

(55) 1. A composition comprising bacteria from at least two genetically diverse strains of Brachyspira hyodysenteriae.

(56) 2. The composition according to item 1, wherein the bacteria are inactivated.

(57) 3. The composition according to items 1 and/or 2, wherein the bacteria are present in a concentration of at least between 10.sup.8 and 10.sup.9 of total bacteria/mL.

(58) 4. The composition according to one or more of the preceding items, wherein the genetic diversity is conferred by selecting the at least two genetically diverse strains of Brachyspira hyodysenteriae from different clonal complexes.

(59) 5. The composition according to one or more of the preceding items, wherein at least one strain belongs to clonal complex II.

(60) 6. The composition according to one or more of the preceding items, wherein at least one strain belongs to clonal complex V.

(61) 7. The composition according to one or more of the preceding items, wherein at least one strain belongs to clonal complex I.

(62) 8. The composition according to one or more of the preceding items, wherein the genetically diverse strains are detected in a proportion of at least 1% in a region of interest with respect to the total of detected strains.

(63) 9. The composition according to item 8, wherein the region of interest is Spain.

(64) 10. The composition according to one or more of the preceding items, wherein the genetically diverse strains belong to the ancestral type from each clonal complex.

(65) 11. The composition according to one or more of the preceding items, wherein the composition further comprises a strain which belongs to a third clonal complex.

(66) 12. The composition according to item 11 wherein the third clonal complex is selected from the group comprising clonal complex I, clonal complex II and clonal complex V.

(67) 13. The composition according to one or more of the preceding items, wherein at least one of the strains belong to clonal complex I, at least one of the strains belong to clonal complex II and/or at least one of the strains belong to clonal complex V.

(68) 14. The composition according to item 13 wherein at least one of the strains is the strain with deposit number CNCM I-4720, at least one of the strains is the strain with deposit number CNCM I-4721 and/or at least one of the strains is the strain with deposit number CNCM I-4722.

(69) 15. The composition according to one or more of the preceding items further comprising an adjuvant.

(70) 16. The composition according to item 15, wherein the adjuvant is selected from the group consisting of aluminum salts (preferably aluminum hydroxide and/or aluminum phosphate) and mineral oils.

(71) 17. The composition according to item 16, wherein the adjuvant is an oil adjuvant, preferably Montanide 251 C VG.

(72) 18. A composition according to one or more of the preceding items for use as a vaccine.

(73) 19. The composition according to item 18, wherein the vaccine is a vaccine against swine dysentery.

(74) 20. The composition according to item 19, wherein the swine dysentery is caused by Brachyspira hyodysenteriae.

(75) 21. The composition according to one or more of items 18 to 20, wherein the vaccine is suitable for administration to swine in a region of interest.

(76) 22. The composition according to item 21, wherein the region of interest is Spain.

(77) 23. The composition according to one or more of items 18 to 22, wherein the genetically diverse strains are detected in a proportion of at least 1% with respect to the total of detected strains in a region of interest.

(78) 24. The composition according to one or more of items 18 to 23, wherein the vaccine is administered by parenteral administration.

(79) 25. The composition according to item 24, wherein the vaccine is administered by intra-muscular administration.

(80) 26. The composition according to one or more of items 18 to 25, wherein the swine are vaccinated two weeks after weaning.

(81) 27. The composition according to item 26, wherein the swine are revaccinated two weeks after the first vaccination.

(82) 28. A method for producing a composition according to one or more of items 1 to 27, comprising selecting at least two genetically different strains and mixing them in equal quantity to achieve a concentration of at least between 10.sup.8 and 10.sup.9 of total bacteria/mL.

(83) 29. The method according to item 28, wherein the at least two genetically different strains are also epidemiologically relevant.

(84) 30. The method according to one or more of items 28 to 29, further comprising the inactivation of the bacteria.

(85) 31. The method according to one or more of items 28 to 30 wherein the genetic diversity is conferred by selecting each strain from different clonal complexes.

(86) 32. The method according to one or more of items 29 to 31, wherein the epidemiologic relevance is conferred by selecting strains that are detected in a proportion of at least 1% with respect to the total of detected strains in a region of interest.

(87) 33. The method according to item 32, wherein the region of interest is Spain.

EXAMPLES

Example 1. Multiple-Locus Variable-Number Tandem-Repeat Analysis of Brachyspira hyodysenteriae

(88) MVLA Analysis

(89) A set of 172 porcine B. hyodysenteriae isolates and strains was used in this study, including the three reference strains B204.sup.R (ATCC 31212), B234.sup.R (ATCC 31287) and WA1.sup.R (ATCC 49526) and the type strain B78.sup.T (ATCC 27164).

(90) Duplicates of the B204.sup.R and B78.sup.T strains were obtained from the bacterial collections held at the University of Len and Murdoch University. The strains and field isolates were from Spain (n=115), Australia (n=36), Canada (n=3), the United States (n=7), the United Kingdom (n=4), and Netherlands (n=7) and had been recovered from the 1970s to 2009. Twenty-three isolates were recovered from Iberian pigs, a local Spanish breed. These pigs contribute to the preservation of the dehesa, a specific Mediterranean ecosystem located in the western regions of the country (Castilla y Len, Extremadura, and Andalucia), where they are traditionally reared in extensive units. The field isolates were recovered from different herds, except for 26 Spanish isolates that were additionally isolated from 11 herds on different sampling occasions. B. hyodysenteriae isolates from the University of Len and Murdoch University bacterial collections were identified and cultured, and DNA was extracted in each supplying laboratory by previously reported methods. Working dilutions of extracted DNA were prepared by adjusting them to 1 to 20 ng/L using a NanoDrop 1000 UV-Vis spectrophotometer (Thermo Scientific, Wilmington, Del.).

(91) Identification of Tandem Repeats and Primer Design

(92) The chromosomal DNA sequence of B. hyodysenteriae WA1.sup.R was retrieved from GenBank (accession no. NC_012225) and investigated for potential tandem repeats using the default parameters of the Tandem Repeat Finder program, available as a Web service (tandem.bu.edu/). (The selected tandem-repeat loci were ranked by consensus length, and those with lengths between 25 and 300 bp were used to design primers within the flanking regions. Loci were named Bhyo, followed by the repeat length ranking number (from 1 to 23), separated by an underscore.

(93) Tandem-Repeat Screening and MLVA Setup

(94) In a preliminary step, DNA extracted from B. hyodysenteriae strain B204.sup.R was used to estimate the empirical annealing temperature of the 23 selected primer pairs in a gradient PCR. The PCR was run in a Mastercycler Gradient (Eppendorf Scientific Inc., Westbury, N.Y.) with an initial step of 95 C. for 5 min, followed by 30 cycles of a three-step cycle protocol consisting of 94 C. for 30 s, 568 C. for 30 s, and 72 C. for 1 min and a final extension step of 72 C. for 10 min. To screen the usefulness of the 23 selected loci as epidemiological markers, DNA samples of B. hyodysenteriae strains B204.sup.R and B78.sup.T and isolates 3, 19, 23, 53, 64, H9, and H72, which have been shown to have genetic differences by PFGE and RAPD in a previous investigation (Hidalgo, . et al., Epidemiology & Infection (2010), 138:76-85), were used. In addition, tandem-repeat data generated for B. hyodysenteriae strain WA1.sup.R were taken into account. Each locus was amplified individually, and the length of the product was analyzed by conventional agarose gel electrophoresis using a 100-bp DNA ladder (Invitrogen, Carlsbad, Calif.). Loci were selected according to their length polymorphism and their ability to generate amplicons for most of the DNA samples tested. To confirm the length of the PCR product, as well as the number of repeats, the consensus patterns, and the sizes of the flanking regions, amplicons were purified using the AxyPrep PCR Cleanup kit (Axygen Biosciences, Union City, Calif.) and sequenced by using fluorescently labeled dideoxynucleotide technology according to the manufacturer's recommendations (Applied Biosystems, Foster City, Calif.). On this basis, eight VNTR loci were selected to be used in the final typing tool.

(95) PCR Amplifications for MLVA

(96) The isolates obtained with the bacterial collection selected for this study were analyzed by independently amplifying the eight selected VNTR loci in a Mastercycler apparatus (Eppendorf). The primers for PCR and thermocycling conditions used are described in Table 1. PCR mixtures were prepared using 0.2-mL sterile tubes containing 1PCR buffer (20 mM Tris HCl [pH 8.4], 50 mM KCl), 5 mM MgCl.sub.2, 1 U of Platinum Taq DNA polymerase (Invitrogen), 200 M deoxynucleoside triphosphate mix (Invitrogen), 0.2 M each forward and reverse primers, 2 L of the DNA working dilution, and sterile distilled water up to a final volume of 50 PCR products were resolved in agarose gels, and their allelic sizes were estimated using a 100-bp DNA ladder (Invitrogen). Amplicons of alleles not detected in the setup step were sequenced as described above. In addition, in order to ensure the repeatability of the technique, 28 DNA samples were randomly selected and tested again. Reproducibility between laboratories was assessed by independent determination of the VNTR types of 14 isolates at the University of Len and Murdoch University.

(97) TABLE-US-00001 TABLE1 PrimersforPCRandthermocyclingconditions Primer Sequence Thermocyclingprogram Bhyo_6 SEQIDNO.1:F, 30 (94 C.for20s,52 C. AAATATAACTCATATTCATAACAAG for20s,72 C.for30s), SEQIDNO.2:R, 72 C.for5min AGAGAACTTCAAAAAACTTC Bhyo_7 SEQIDNO.3:F, 30 (94 C.for20s,59.5 C. AGTAATAAATTAAAAAATCTCTAGGGTGG for20s,72 C.for30s), SEQIDNO.4:R, 72 C.for5min GGTTTGGTAGAACAATCTGC Bhyo_12 SEQIDNO.5:F, 30 (94 C.for30s,59 C. CGTATGATTATTTTACTTGTCAG for30s,74 C.for40s) SEQIDNO.6:R, TTTTATTACAGCAACTTTACTC Bhyo_17 SEQIDNO.7:F, 30 (94 C.for30s,59 C. TTTTTGCCATAAATATCTCTC for30s,74 C.for40s) SEQIDNO.8:R,GAAATGCCGTCCTTCTTAG Bhyo_21 SEQIDNO.9:F, 30 (94 C.for20s,52 C. AAAATAATGATGAAGTATCTAATG for20s,72 C.for30s), SEQIDNO.10:R, 72 C.for5min AAGTATCAGGTAAAGGTAAATC Bhyo_22 SEQIDNO.11:F, 30 (94 C.for30s,55 C. AGATTAAAAACTGACGGAG for30s,72 C.for60s), SEQIDNO.12:R, 72 C.for5min AGCACAAGAACCTTCAAAC Bhyo_10 SEQIDNO.13:F, 30 (94 C.for30s,55 C. CTCTCTTTTATATTTTTTATTATAGTTG for30s,72 C.for40s), SEQIDNO.14:R, 72 C.for5min TTGATGAAATTAGACCATTC Bhyo_23 SEQIDNO.15:F, 30 (94 C.for30s,55 C. CACCCTTTAGACTTATTATTTTATTTTG for30s,72 C.for40s), SEQIDNO.16:R,TTGTTCTGCGTGCGTGTAG 72 C.for5min

(98) The eight primer pairs used in the individual PCRs were grouped into two sets (set 1 and set 2); labeled fluorescently with 6-carboxyfluorescein (6-FAM), VIC, PET, or NED (Applied Biosystems) at the 5-end of the forward primers; and pooled prior to performing a multiplex PCR using the Qiagen Multiplex PCR kit according to the manufacturer's recommendations (Qiagen, Germantown, Md.).

(99) TABLE-US-00002 TABLES 2 and 3 Primer sets Final Primer Fluorescence concentration Primer set 1 Bhyo_7 6-FAM 0.25 M Bhyo_12 VIC 0.25 M Bhyo_17 NED 0.15 M Bhyo_22 PET 0.15 M Primer set 2 Bhyo_6 6-FAM 0.25 M Bhyo_10 PET 0.25 M Bhyo_21 VIC 0.15 M Bhyo_23 NED 0.15 M

(100) A 25 l volume was used for multiplex PCR amplification with a thermal cycling protocol of 95 C. for 15 min; 30 three-step cycles of 94 C. for 30 s, 55/53 C. (set 1/set 2) for 90 s, and 72 C. for 90 s; and a final extension step of 72 C. for 10 min. Multiplex PCR products were diluted 1:10 in distilled water before 1 l of this dilution was mixed with 0.5 l of 1200 LIZ Size Standard (Applied Biosystems) and 10.5 l of formamide. After the mixture was heated for 3 min at 96 C. and rapidly cooled on ice, GeneScan analysis was performed using an ABI 3730 DNA analyzer (Applied Biosystems). The freely available program Peak Scanner Software v 1.0 (Applied Biosystems) was used to size the PCR fragments for each locus.

(101) Data Analysis

(102) The number of repeats was calculated according to the following formula:
Number of repeats=[Fragment size (bp)Flanking regions (bp)]/Repeat size (bp).

(103) The results were approximated to the nearest lower integer and sequentially scored (Bhyo_6, Bhyo_7, Bhyo_12, Bhyo_17, Bhyo_21, Bhyo_22, Bhyo_10, and Bhyo_23) to create a numerical profile that defined each strain. When PCR amplification was undetectable, the assigned number of repeats was 99. MLVA profiles were ascribed to MLVA types by assigning a whole number. Isolates were considered genetically identical when the numerical profiles for all eight loci matched. The Hunter-Gaston diversity index was used to measure the polymorphism of individual loci and the index of discrimination of the MLVA typing method for the eight combined VNTR loci (Hunter, P. R. and M. A. Gaston, Journal of Clinical Microbiology (1988), 26:2465-2466). Approximate 95% confidence intervals (CI) were calculated as described by Grundmann et al. (Journal of Clinical Microbiology (2001), 39:4190-4192). Redundant isolates (n=26) were removed prior to calculating the previous indexes. The Sequence Type Analysis and Recombinational Tests (START2) program, available for free at pubmlst.org/software/analysis/start2/, was used to analyze the MLVA profiles and types of the spirochetes tested. A phylogenetic tree of the MLVA types was constructed based on the unweighted-pair group method using average linkages (UPGMA) clustering strategy. A bootstrap analysis for 1,000 replicates was undertaken using FreeTree at web.natur.cuni.cz/flegr/programs/freetree.htm. The goeBURST algorithm, available at goeburst.phyloviz.net/#Software, a global implementation of the eBURST algorithm (Feil, E. J. et al., Journal of Bacteriology (2004), 186:1518-1530.), was used to identify groups of related genotypes of B. hyodysenteriae at single-, double-, and triple-locus variant levels. Population structure was tested as proposed by Smith et al. (Proceedings of the National Academy of Sciences U.S.A (1993), 90:4384-4388), taking into account the modifications proposed by Haubold et al. (Genetics (1998), 150:1341-1348.) for the calculation of the critical value (LMC) of the distribution of the variance of the pairwise differences (VD), and expressed as a standardized index of association (ISA).

(104) Results

(105) Identification of VNTR Markers

(106) Investigation of the chromosomal sequence of B. hyodysenteriae WA1.sup.R with the Tandem Repeat Finder program identified 404 repeats in tandem through the whole chromosome, with 135 repeats/Mbp. Subsequent selection of the most suitable tandem-repeat markers decreased the number to be included in the MLVA to 23, which were consecutively named Bhyo_1 to Bhyo_23 and used to design primers within the flanking regions. Fifteen loci that were monomorphic or failed to amplify all or most of the nine selected isolates with the specific primers were discarded. The remaining eight loci were polymorphic, with different allele sizes. Sequencing of the PCR products confirmed that the length polymorphism was due to differences in the copy number of tandem repeats and that the consensus pattern, its period size, and the flanking regions were stable (Table 4). Therefore, eight loci (Bhyo_6, Bhyo_7, Bhyo_12, Bhyo_17, Bhyo_21, Bhyo_22, Bhyo_10, and Bhyo_23) were included in the MLVA scheme for B. hyodysenteriae. These loci were distributed from position 1236667 to position 2949421 of the WA1R genome (Table 4). Four loci, Bhyo_6, Bhyo_10, Bhyo_21, and Bhyo_22, were placed in open reading frames encoding hypothetical proteins, while the other four were located in intergenic regions. Bhyo_7 was placed between the genes for methyl-accepting chemotaxis protein McpA and a hypothetical protein. Bhyo_12 was between the genes for a putative glycosyltransferase family 2 protein and a hypothetical protein. Bhyo_17 was between the genes for glycerol 3-phosphate dehydrogenase and ferredoxin. Bhyo_23 was between the genes for a hypothetical protein and putative RarR, predicted to be a permease

(107) TABLE-US-00003 TABLE 4 Features of the loci included in the MLVA Size (bp) Flanking Locus of repeat region Position Bhyo_6 156 78 1236667-1237672 Bhyo_7 135 177 1818959-1819765 Bhyo_10 111 88 1754196-1755095 Bhyo_12 105 59 2949083-2949421 Bhyo_17 76 175 1690628-1691034 Bhyo_21 33 195 1396843-1397034 Bhyo_22 30 153 2597474-2597543 Bhyo_23 26 102 1838685-1838736
MLVA Typing

(108) The set of eight VNTR markers was used to type the full collection of 174 B. hyodysenteriae strains and isolates recovered from pigs in several countries (including the duplicates of B78.sup.T and B204.sup.R). The strains and isolates were efficiently amplified, and the lengths of the PCR products were converted into numbers of repeats. Sequencing of new alleles that were identified at this stage confirmed that the length differences represented variations in the number of the previously detected repeat motifs. The marker Bhyo_10 was the most diverse VNTR, with eight different numbers of repeats (99, 2, 3, 5, 6, 7, 8, and 10), with an assigned number of repeats of 99 because of a lack of amplification. Seven numbers of repeats were detected for locus Bhyo_17, while markers Bhyo_6, Bhyo_7, and Bhyo_21 each presented six numbers of repeats. Loci Bhyo_12 and Bhyo_22 showed a discontinuous distribution of four numbers of repeats. VNTR marker Bhyo_23 showed less diversity, with only two different numbers of repeats, 1 and 2, detected. An accurate estimation of the degree of polymorphism of the loci was achieved by means of the Hunter-Gaston diversity index, with the discrimination powers of the loci ranging from 0.141 to 0.764. Locus Bhyo_10 was the most discriminatory, with a value of 0.764, followed by loci Bhyo_7, Bhyo_6, Bhyo_17, and Bhyo_21, with values of 0.761, 0.718, 0.71, and 0.699, respectively. Loci Bhyo_12 and Bhyo_23 had diversity indexes of 0.472 and 0.318, respectively, while the most conserved locus was Bhyo_22, with a polymorphism index of 0.141.

(109) The Hunter-Gaston discriminatory index of the MLVA typing method at eight loci for 146 strains and isolates from different herds was 0.938 (95% CI, 0.9175 to 0.9584). Analysis of the combination of the eight VNTR loci for all of the B. hyodysenteriae isolates and strains showed 44 MLVA types, which differed by at least one repeat for one of the eight loci among two different types. The MLVA types of the reference strains were type 35 for WA1.sup.R, type 23 for B204.sup.R, and type 10 for B234.sup.R, while the type strain B78.sup.T was assigned to MLVA type 28. Analysis of the different MLVA types in each country showed the existence of considerable diversity. There were 15 types (1, 2, 3, 5, 9, 11, 12, 13, 14, 18, 19, 20, 22, 24, and 37) found among the 89 Spanish isolates from different herds, 16 types (15, 16, 17, 25, 26, 31, 32, 33, 34, 35, 36, 38, 39, 42, 43, and 44) among the 36 Australian isolates, 2 types (21 and 27) for the three Canadian isolates, 3 types (3, 6 and 41) for the seven from Netherlands, 4 types (3, 8, 29, and 30) for the four strains from the United Kingdom, and 6 types (4, 7, 10, 23, 28, and 40) for the seven isolates and strains from the United States. MLVA type 3 was shared by isolates from Spain, the United Kingdom, and Netherlands. The MLVA types were stable for the herds where more than one isolate was recovered on different sampling occasions. B. hyodysenteriae strain WA1.sup.R showed a mismatch for locus Bhyo_6 between the length of the PCR product, 780 bp (four numbers of repeats), and the data derived from the sequenced genome, 1,092 bp (six numbers of repeats). Isolates and strains included in the repeatability and reproducibility tests had the same MLVA types at the different testing times. Moreover, each of the duplicates of the B. hyodysenteriae type and reference strains, B78.sup.T and B204.sup.R, from the University of Len and Murdoch University collections, generated the same MLVA patterns.

(110) MLVA Types and Bacterial Population Analysis

(111) An evolutionary tree based on MLVA profiles and constructed according to the UPGMA clustering strategy for the 44 MLVA types of B. hyodysenteriae determined in this study is shown in FIG. 1. MLVA type relationships at the single-, double-, and triple locus variant levels depicted with the goeBURST algorithm are shown in FIG. 2. Six clonal complexes (I to VI) were established at the single-locus variant level. Three new groups appeared when investigating double-locus variants, while three single locus variant groups (II, III, and IV) were clustered together at this level. When high-level edges were displayed to study relationships at the triple-locus variant level, a large cluster appeared which included groups I to IV, and group V was expanded by two more types. MLVA types 4, 5, 10, and 15 were not linked with any of the other types detected at any of the levels studied. Population linkage disequilibrium was detected for the 146 isolates from different herds (I.sup.S.sup.A=0.1359; P<0.001) and for the different MLVA types (I.sup.S.sup.A=0.0336; P=0.005).

Example 2: Selection and Culture of the Universal Vaccine Strains

(112) Three Brachyspira hyodysenteriae strains were selected, each of which belongs to different clonal complexes (clonal complexes I, II and V). Each genetically diverse selected strain belongs to the ancestral type from each clonal complex. Moreover, each selected strain is at least 1% detected with respect to the total of detected strains in Spain (FIG. 3). The strains are the ones deposited within the Collection Nationale de Cultures de Microorganismes (CNCM), Institut Pasteur, on Mar. 14, 2013, with registration numbers CNCM I-4720, CNCM I-4721 and CNCM I-4722.

(113) The strain with registration number CNCM I-4720 belongs to clonal complex II. The strain with registration number CNCM I-4721 belongs to clonal complex V. The strain with registration number CNCM I-4722 belongs to clonal complex I.

(114) CNCM I-4720 is 24.7% detected with respect to the total of detected strains in Iberian Peninsula Spanish territory. CNCM I-4721 is 13.5% detected with respect to the total of detected strains in Iberian Peninsula Spanish territory. CNCM I-4722 is 9% detected with respect to the total of detected strains in Iberian Peninsula Spanish territory.

(115) The isolated bacteria (free from contaminants) are inoculated in agar-blood plates. The plates are kept in anaerobic conditions at 39.5 C. for 4-5 days, until hemolysis in the whole plate is observed. Agar fragments at the hemolysis borders and they are inoculated in a new agar-blood plate, incubated in the same conditions. Bacteria are passed to a new agar-blood plate and, in parallel, to a Fastidious Anaerobe Agar (FAA) plate, and bacteria are cultured in the same conditions during 3-4 days. The bacteria can then be transferred to liquid growth medium, and cultured.

(116) For fermentation, bacteria are incubated in approx. 4 L of suitable culture medium (such as Brain Heart Infusion media from Merck) at 38.5 C. with light agitation (50 rpm) in an oxygen-free atmosphere. The fermentation occurs until the optical density is approx. 1.6 (or until there are around 10.sup.9 UFC/mL (usually between 15 and 30 hours)).

Example 3: Inactivation of the Bacteria

(117) After fermentation, 4 L (approx.) of culture are pumped into a sterile flask and centrifuged (27000 rpm, 10 minutes). Resulting pellets are suspended in 1 L sodium acetate buffer 0.1 M. The inactivation of the culture is carried out with an injection of formaldehyde at 0.5% and incubation during 24 hours at 37 C. with light agitation (50 rpm). Next day the suspension is centrifuged and resuspended in sterile sodium acetate 0.1 M. The antigen (10.sup.9-10.sup.10 bacteria/mL, approx.) is kept at 4 C. until mixing with adjuvant and excipients for vaccine manufacturing.

Example 4: Vaccine Formula (Universal Vaccine of the Invention)

(118) The vaccine comprises the following components. The term antigen refers to the above-mentioned selected Brachyspira hyodysenteriae strains, and the final concentration of antigen is 10.sup.9 bacteria/mL in an equal mixture of the three selected strains.

(119) TABLE-US-00004 Percentage/final Quantity (for concentration Component 2 L of vaccine) in the vaccine Antigen 200 mL 10.sup.9 bacteria/mL Montanide IMS 400 mL .sup.20% 251 C VG (Seppic) Thimerosal 5% 4 mL 0.01% (Sigma) Sodium acetate 1400 mL 0.1M (Boente)

(120) The components were mixed by agitation at 4 C. overnight.

Example 5: Comparison Between an Efficient Autovaccine and the Universal Vaccine of the Invention

(121) The following conditions were used:

(122) 1.The pigs used in this example came from a farm free of spirochaetal infections and with low health status, due to the difficulty to achieve a good challenge in pigs with high health status.

(123) 2.The diet was manipulated in order to induce a very high dysbiosis in the intestine. The importance of diet in swine dysentery is also well known. In this experiment the feed was mixed with a 50% of soy flour that had 46% of protein. Pigs received this diet from the day of the challenge on (10 days in total).

(124) 3.The strain used for the challenge was the reference strain B204 (ATCC Number: 31212). The strain was previously passed three times in pigs to fully maintain its pathogenicity and to verify that the experimental infection would be appropriate. This ensures that the strain used has a high pathogenicity and causes a severe disease in infected pigs.

(125) The following three groups of six pigs each were used: Group 1 (autovaccine): piglets were vaccinated via intramuscular (i.m.) with the autovaccine (inactivated B204 and adjuvant, same protocol as above but with inactivated B204 as antigen) at 6 weeks of life and revaccinated at 8 weeks of life. Each dose contained 10.sup.9 bacteria. Group 2 (universal vaccine): piglets were vaccinated via i.m. with the universal vaccine (the polyvalent inactivated and adjuvanted vaccine, comprising the three selected field strains). The vaccination protocol was the same as above (piglets were vaccinated at 6 weeks of life and revaccinated at 8 weeks). The dose was also 10.sup.9 bacteria in an equal mixture of the three selected strains. Group 3 (control group, unvaccinated): the same adjuvant (without bacterial antigen) was injected i.m. to piglets at 6 and 8 weeks of life (same protocol as above).

(126) Vaccination and revaccination were performed in the farm. The piglets were kept on the farm until the 10.sup.th week of age and were then moved to the experimental facilities of the University of Len. Piglets belonging to the three experimental groups were mixed among them in these facilities.

(127) The experimental infection was made 3 weeks after the second dose, when piglets were 11 weeks old. Every pig of each group received 100 mL of a fresh culture of B204 type strain containing 10.sup.9 bacteria/mL orally during 3 consecutive days. The diet was modified at first day of challenge, as mentioned above.

(128) Since the first day of challenge (PID 1) pigs were daily sampled by collecting rectal swabs and faecal shedding of B. hyodysenteriae was monitored by microbiological culture. From PID 1 on, general health status and presence or diarrhoea and characteristics of the faeces were also recorded.

(129) Results:

(130) 1.Mortality

(131) TABLE-US-00005 MORTALITY Dead pigs PID (total) % (post-infection days) Group 1 (Universal vaccine) 1 (6) 14.2 29 Group 2 (Autovaccine) 1 (6) 14.2 29 Group 3 (Control) 3 (6) 50 7, 9, 13

(132) In the group of pigs vaccinated with the universal vaccine, one piglet died in the 17.sup.th day after experimental infection. In this case, death was caused by pneumonia. The death pig had not eliminated Brachyspira hyodysenteriae in faeces before its death.

(133) Mortality caused by swine dysentery was the same in the group of pigs vaccinated with the universal vaccine and those vaccinated with the autovaccine (1 pig in each group) and three times lower than in the unvaccinated pigs of the control group (3 pigs died).

(134) Given the Odds ratio, mortality risk was 6 times higher in those animals from the control group as compared with those vaccinated with the universal vaccine or with the autovaccine (OR=6; CI 95% 0.28-246.02).

(135) In both groups of vaccinated pigs (those vaccinated with the universal vaccine and those vaccinated with the autovaccine) the death of the pig occurred at day 29 post-challenge, whereas in the control group the three pigs died on days 7, 9 and 13 post-challenge (FIG. 4).

(136) As expected, no difference was observed between survival curves of vaccinated with the universal vaccine and autovaccinated animals (p=0.9372).

(137) 2.Incubation Period

(138) TABLE-US-00006 INCUBATION PERIOD Mean Standard Minimum Maximum Mode (days) deviation (days) (days) (days) Group 1 5.8 2.28 3 8 8 (Universal vaccine) Group 2 7.6 2.07 4 9 8 (Autovaccine) Group 3 4 2.283 1 6 6 (Control)

(139) The incubation period, defined as the number of days between the challenge and the appearance of diarrhoea or faecal shedding of the bacteria was significantly longer in those pigs from the control group as compared with autovaccinated animals (F=7.36; p=0.024). This incubation period was also higher for vaccinated pigs as compared with controls. No statistically significant differences were found between both groups of vaccinated and autovaccinated pigs (F=1.7; p=0.228) (FIG. 6).

(140) 3.Diarrhoea and Bloody Diarrhoea

(141) TABLE-US-00007 DIARRHOEA Days with Days with bloody Days diarrhoea diarrhoea sampled Total days (%) Total days (%) Group 1 (Universal vaccine) 167 58 (34.73) 20 (11.97) Group 2 (Autovaccine) 160 63 (39.35) 11 (6.85) Group 3 (Control) 122 64 (52.46) 35 (28.69)

(142) The proportion of days with diarrhoea was significantly higher in the control group as compared with vaccinated pigs with the universal vaccine (Chi.sup.2=8.37; p=0.004) and with autovaccinated pigs (Chi.sup.2=4.27; p=0.038).

(143) A similar result regarding the proportion of days with bloody diarrhea was obtained. The value was significantly higher in the control group as compared with vaccinated group with the universal vaccine (Chi.sup.2=7.25; p=0.007) and autovaccinated group (Chi.sup.2=16.6; p<0.001).

(144) In addition, the bloody diarrhoea began earlier in the control group (two days post challenge). In this group all pigs had bloody diarrhoea on day 6 post-challenge and for 5 days the bloody diarrhoea affected more than 50% of pigs (FIG. 7, panel A and panel B).

(145) No statistically significant differences were found between vaccinated with the universal vaccine and autovaccinated pigs in the proportion of days with diarrhoea (Chi.sup.2=0.57; p=0.45) nor with bloody diarrhoea (Chi.sup.2=1.92; p=0.165).

(146) 4.Average Daily Gain

(147) TABLE-US-00008 Average daily gain at 9 days post-challenge ADG Standard (kg) deviation Group 1 0.05 0.249 (Universal vaccine) Group 2 0.27 0.372 (Autovaccine) Group 3 0.29 0.308 (Control)

(148) In the first 9 days after challenge, almost no weight gain was observed in pigs from the vaccinated with the universal vaccine group and a mean daily gain of 0.27 kg was determined in animals from the autovaccinated group. However, no significant differences were demonstrated when comparing both groups. These groups showed no weight loss at any time during the whole trial.

(149) TABLE-US-00009 Average daily gain at 24 days post-challenge ADG Standard (kg) deviation Group 1 0.24 0.263 (Universal vaccine) Group 2 0.13 0.212 (Autovaccine) Group 3 0.20 0.185 (Control)

(150) Animals from the control group showed a clear loss of weight during the first 9 days after challenge. The average weight loss was 0.29 kg/day. After these 9 days, significant differences were not found in the average daily gain (ADG) of survivor pigs of the control group compared with that of pigs of vaccinated with the universal vaccine and autovaccinated groups (FIGS. 8 and 9).

(151) Animals from the autovaccinated group showed the lower average daily gain when analyzing at 24 days post challenge, probably as a consequence of the longer incubation period of the disease in these animals. On the other hand, animals from the vaccinated with the universal vaccine and control groups showed a clear recovery of daily weight gain at this moment since they were affected previously by clinical disease.

CONCLUSIONS

(152) The objective of the study was to compare the effectiveness of a universal vaccine (in this case composed by three selected strains, none of which was the strain causing the infection) with that of an autovaccine in very stringent conditions. The infection of pigs with B204 strain using three daily doses of 10.sup.9 bacteria and inducing a high dysbiosis in the intestine causes severe swine dysentery and a mortality of 50% of untreated pigs in the control group. There are no differences in the effectiveness of the universal vaccine and the autovaccine in the reduction of mortality caused by swine dysentery. There are not statistically significant differences in the effectiveness of the universal vaccine and the autovaccine in the reduction of clinical signs of swine dysentery (diarrhoea and bloody diarrhoea). There was no weight loss in pigs vaccinated with the universal vaccine neither in those vaccinated with the autovaccine.

(153) The effectiveness of the universal vaccine is comparable with the effectiveness of an effective autovaccine. The universal vaccine has a good cost/benefit relationship for the control of swine dysentery in field conditions, considering the tested effectiveness of the autovaccines.

Example 6. Lipopolysaccharide (LPS) ELISA Study of Hiperimmunized Rabbits

(154) The aim of the following study was to show the qualitative differences found between the serological immune response of each of the three strains (A, B and C, see below for the exact reference) contained in the trivalent Brachyspira hyodysenteriae vaccine formula (universal vaccine).

(155) Material and Methods

(156) For the experiment, nine rabbits were separated in three groups of three animals and each group was intravenous inoculated with one of the strains during six days (D1, D2, D3, D4, D5 and D10 of the study) with 0.5 mL of the bacterial suspension. Thus, for each bacteria was necessary the preparation of 0.5 ml3 animals per strain6 days=9 ml of 10.sup.10 bacteria/mL culture.

(157) The inoculum was prepared from a pure liquid culture of each strain in 100 ml BHI (Brain Heart Infusion) with 6% BFS (Bovine Fetal Serum). Liquid culture was centrifuged and washed three times with PBS Buffer; initial suspension (growth to 10.sup.9 bacteria/mL aprox.) was concentrated ten times to a final suspension 10.sup.10 bacteria/mL.

(158) Blood was collected days D15, D18, D21, D24, D27 and D36 from each animal. Sera were sent immediately to Aquiln facilities for antibody analysis.

(159) ELISA plates were coated separately with 0.5 g LPS antigen of each strain, obtained as described in Hassan et al. (Antibody response to experimental Salmonella typhimurium infection in chickens measured by ELISA (1990). Vet rec. 126(21):519-22) and ELISA was performed following the method for Salmonella described by Collazos (Aportaciones al diagnstico y control de la salmonelosis porcina (2008). Tesis Doctoral. Universidad de Len).

(160) TABLE-US-00010 ELISA Laboratory Deposit designation ID code A H57 CNCM I - 4720 B H170 CNCM I - 4721 C H219 CNCM I - 4722
Results

(161) The results can be seen on FIGS. 10, 11 and 12. Differences between ELISA plates coated with LPS coming from the three spirochaete strains against sera of a group of rabbits hiperimmunized with these three strains separately can be observed. It has been demonstrated that the sera immune response produced by each of the spirochaete strain here used (A, B and C) is different depending on whether the LPS coating of the ELISA plate is homologous or heterologous to the sera strain (see FIGS. 10, 11 and 12). These results confirm the fact that genetically separated strains show a specific antibody production. Accordingly, the inventors have been able to surprisingly detect differences in the immune response/animal's antibody production due to immunization with the bacteria that were selected on the basis of their genetic diversity, as described in the application, and this genetic diversity criteria is not functional sequence-driven. These unexpected results justify the inclusion of several antigenic patterns in the vaccine formula, especially taking into account that the genetic criteria used is not gene-driven, but just based in genomic polymorphism.

(162) Further Items of the Present Invention

(163) 1. A composition comprising bacteria from at least two genetically diverse strains of Brachyspira hyodysenteriae.

(164) 2. The composition according to item 1, wherein the bacteria are inactivated.

(165) 3. The composition according to items 1 and/or 2, wherein the bacteria are present in a concentration of between 10.sup.8 and 10.sup.9 of total bacteria/mL.

(166) 4. The composition according to one or more of the preceding items, wherein the genetic diversity is conferred by selecting the at least two genetically diverse strains of Brachyspira hyodysenteriae from different clonal complexes.

(167) 5. The composition according to one or more of the preceding items, wherein at least one strain belongs to clonal complex II, and/or wherein at least one strain belongs to clonal complex V, and/or wherein at least one strain belongs to clonal complex I.

(168) 6. The composition according to one or more of the preceding items, wherein the genetically diverse strains are detected in a proportion of at least 1% with respect to the total of detected strains in a region of interest.

(169) 7. The composition according to item 6, wherein the region of interest is preferably Spain.

(170) 8. The composition according to one or more of the preceding items, wherein the genetically diverse strains belong to the ancestral type from each clonal complex.

(171) 9. The composition according to one or more of the preceding items, wherein the composition further comprises a strain which belongs to a third clonal complex, and wherein the third clonal complex is selected from the group consisting of clonal complex I, clonal complex II and clonal complex V.

(172) 10. The composition according to one or more of the preceding items, wherein at least one of the strains belong to clonal complex I, at least one of the strains belong to clonal complex II and/or at least one of the strains belong to clonal complex V.

(173) 11. The composition according to item 10 wherein at least one of the strains is the strain with deposit number CNCM I-4720, at least one of the strains is the strain with deposit number CNCM I-4721 and/or at least one of the strains is the strain with deposit number CNCM I-4722.

(174) 12. The composition according to one or more of the preceding items further comprising an adjuvant, preferably selected from the group consisting of aluminum salts (preferably aluminum hydroxide and/or aluminum phosphate) and mineral oils.

(175) 13. The composition according to item 12, wherein the adjuvant is an oil adjuvant, preferably Montanide IMS 251 C VG.

(176) 14. A composition according to one or more of the preceding items for use as a vaccine, preferably against swine dysentery, wherein the swine dysentery is optionally caused by Brachyspira hyodysenteriae.

(177) 15. The composition according to item 14, wherein the vaccine is suitable for administration to swine in a region of interest.

(178) 16. The composition according to item 15, wherein the region of interest is Spain.

(179) 17. The composition according to one or more of items 14 to 16, wherein the vaccine is administered by parenteral administration, preferably by intra-muscular administration.

(180) 18. The composition according to one or more of items 14 to 17, wherein the swine are vaccinated two weeks after weaning and, optionally, revaccinated two weeks after the first vaccination.

(181) 19. The composition according to one or more of items 15 to 18, wherein the total number of bacteria per dose administrated to swine is between 10.sup.8 and 10.sup.9 bacteria, preferably 10.sup.9 bacteria.

(182) 20. A bacteria strain selected from strains deposited at the Collection Nationale de Cultures de Microorganismes (CNCM), Institut Pasteur with registration numbers CNCM I-4720, CNCM I-4721 and CNCM I-4722.