Human lambda light chain mice
09850462 ยท 2017-12-26
Assignee
Inventors
- Lynn Macdonald (Harrison, NY)
- Sean Stevens (Del Mar, CA)
- Cagan Gurer (Chappaqua, NY)
- Andrew J. Murphy (Croton-on-Hudson, NY)
- Karolina A. Meagher (Yorktown Heights, NY, US)
Cpc classification
C07K16/462
CHEMISTRY; METALLURGY
A01K2217/072
HUMAN NECESSITIES
A01K67/0275
HUMAN NECESSITIES
C12N5/0606
CHEMISTRY; METALLURGY
A01K2267/01
HUMAN NECESSITIES
A01K2217/15
HUMAN NECESSITIES
C07K2317/14
CHEMISTRY; METALLURGY
C07K16/00
CHEMISTRY; METALLURGY
C07K2317/24
CHEMISTRY; METALLURGY
C07K2317/64
CHEMISTRY; METALLURGY
C12N15/8509
CHEMISTRY; METALLURGY
C07K16/461
CHEMISTRY; METALLURGY
C07K2317/10
CHEMISTRY; METALLURGY
A01K2267/0381
HUMAN NECESSITIES
A01K67/0278
HUMAN NECESSITIES
A01K2217/05
HUMAN NECESSITIES
International classification
A01K67/00
HUMAN NECESSITIES
C12N15/10
CHEMISTRY; METALLURGY
C07K16/00
CHEMISTRY; METALLURGY
Abstract
Genetically modified mice are provided that express human variable (hV) sequences, including mice that express hV sequences from an endogenous mouse light chain locus, mice that express hV sequences from an endogenous mouse light chain locus, and mice that express hV sequences from a transgene or an episome wherein the hV sequence is linked to a mouse constant sequence. Mice are provided that are a source of somatically mutated human variable sequences useful for making antigen-binding proteins. Compositions and methods for making antigen-binding proteins that comprise human variable sequences, including human antibodies, are provided.
Claims
1. A genetically modified mouse embryonic stem (ES) cell having a genome comprising an immunoglobulin locus comprising human V and J gene segments operably linked to a mouse C gene such that a mouse derived from the ES cell expresses an immunoglobulin light chain that comprises a human variable domain derived from the V and J gene segments fused with a mouse constant domain.
2. The ES cell of claim 1, wherein the ES cell has a genome that comprises one or more human heavy chain V, D, and J segments.
3. The ES cell claim 2, wherein the one or more human heavy chain V, D, and J segments are at an endogenous mouse heavy chain locus.
4. The ES cell of claim 1, wherein the ES cell has a genome comprising a replacement at the endogenous mouse heavy chain variable locus of one or more endogenous heavy chain V, D, and J segments with one or more human heavy chain V, D, and J segments.
5. The ES cell of claim 1, wherein the human V and J gene segments comprise a human J1 gene segment.
6. The ES cell of claim 1, wherein the human V and J gene segments comprise four human J gene segments.
7. The ES cell of claim 6, wherein the four human J gene segments are J1, J2, J3 and J7.
8. The ES cell of claim 1, wherein the human V and J gene segments comprise at least 12 human V gene segments.
9. The ES cell of claim 8, wherein the 12 human V gene segments include human V3-1, V4-3, V2-8, V3-9, V3-10, V2-11 and V3-12.
10. The ES cell of claim 1, wherein the human V and J gene segments comprise at least 28 human V gene segments.
11. The ES cell of claim 10, wherein the 28 human V gene segments include human V2-14, V3-16, V2-18, V3-19, V3-21, V3-22, V2-23, V3-25 and V3-27.
12. The ES cell of claim 1, wherein the human V and J gene segments comprise at least 40 human V gene segments.
13. The ES cell of claim 12, wherein the 40 human V gene segments include human V5-52, V1-51, V9-49, V1-47, V7-46, V5-45, V1-44, V1-44, V7-43 and V1-40.
Description
BRIEF DESCRIPTION OF THE FIGURES
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
(23)
(24)
DETAILED DESCRIPTION
(25) Although specific features of various embodiments are discussed in detail, the descriptions of the specific aspects, embodiments, and examples do not limit the subject matter of the claims; it is the claims that describe the scope of the invention. All terms and phrases used in this disclosure include the meanings normally ascribed to them in the art.
(26) The term contiguous includes reference to occurrence on the same nucleic acid molecule, e.g., two nucleic acid sequences are contiguous if they occur on the same nucleic molecule but are interrupted by another nucleic acid sequence. For example, a rearranged V(D)J sequence is contiguous with a constant region gene sequence, although the final codon of the V(D)J sequence is not followed immediately by the first codon of the constant region sequence. In another example, two V gene segment sequences are contiguous if they occur on the same genomic fragment, although they may be separated by sequence that does not encode a codon of the V region, e.g., they may be separated by a regulatory sequence, e.g., a promoter or other noncoding sequence. In one embodiment, a contiguous sequence includes a genomic fragment that contains genomic sequences arranged as found in a wild-type genome.
(27) The phrase derived from when used concerning a variable region derived from a cited gene or gene segment includes the ability to trace the sequence back to a particular unrearranged gene segment or gene segments that were rearranged to form a gene that expresses the variable domain (accounting for, where applicable, splice differences and somatic mutations).
(28) The phrase functional when used concerning a variable region gene segment or joining gene segment refers to usage in an expressed antibody repertoire; e.g., in humans V gene segments 3-1, 4-3, 2-8, etc. are functional, whereas V gene segments 3-2, 3-4, 2-5, etc. are nonfunctional.
(29) A heavy chain locus includes a location on a chromosome, e.g., a mouse chromosome, wherein in a wild-type mouse heavy chain variable (V.sub.H), heavy chain diversity (D.sub.H), heavy chain joining (J.sub.H), and heavy chain constant (C.sub.H) region DNA sequences are found.
(30) A locus includes a location on a chromosome, e.g., a mouse chromosome, wherein in a wild-type mouse variable (V), joining (J), and constant (C) region DNA sequences are found.
(31) A locus includes a location on a chromosome, e.g., a mouse chromosome, wherein in a wild-type mouse variable (V), joining (J), and constant (C) region DNA sequences are found.
(32) The term unrearranged includes the state of an immunoglobulin locus wherein V gene segments and J gene segments (for heavy chains, D gene segments as well) are maintained separately but are capable of being joined to form a rearranged V(D)J gene that comprises a single V,(D),J of the V(D)J repertoire.
Mice Expressing Human Variable Domains
(33) Mice that express antibodies that are fully human, or partly human and partly mouse, have previously been reported. VELOCIMMUNE genetically engineered mice comprise a replacement of unrearranged V(D)J gene segments at endogenous mouse loci with human V(D)J gene segments. VELOCIMMUNE mice express chimeric antibodies having human variable domains and mouse constant domains (see, e.g., U.S. Pat. No. 7,605,237). Most other reports concern mice that express fully human antibodies from fully human transgenes in mice that have disabled endogenous immunoglobulin loci.
(34) Antibody light chains are encoded by one of two separate loci: kappa () and lambda (). Mouse antibody light chains are primarily of the type. Mice that make mouse antibodies, and modified mice that make fully human or chimeric human-mouse antibodies, display a bias in light chain usage. Humans also exhibit light chain bias, but not so pronounced as in mice; the ratio of light chains to light chains in mice is about 95:5, whereas in humans the ratio is about 60:40. The more pronounced bias in mice is not thought to severely affect antibody diversity, because in mice the variable locus is not so diverse in the first instance. This is not so in humans. The human light chain locus is richly diverse.
(35) The human light chain locus extends over 1,000 kb and contains over 80 genes that encode variable (V) or joining (J) segments (
(36) The light chain locus in humans is similar in structure to the locus of both mice and humans in that the human light chain locus has several variable region gene segments that are capable of recombining to form a functional light chain protein. The human light chain locus contains approximately 70 V gene segments and 7 J-C gene segment pairs. Only four of these J-C gene segment pairs appear to be functional. In some alleles, a fifth J-C gene segment pair is reportedly a pseudo gene (C6). The 70 V gene segments appear to contain 38 functional gene segments. The 70 V sequences are arranged in three clusters, all of which contain different members of distinct V gene family groups (clusters A, B and C;
(37) In stark contrast, the mouse light chain locus contains only two or three (depending on the strain) mouse V region gene segments (
(38) According published maps of the mouse light chain locus, the locus consists essentially of two clusters of gene segments within a span of approximately 200 kb (
(39) The mouse light chain locus is strikingly different. The structure and number of gene segments that participate in the recombination events leading to a functional light chain protein from the mouse locus is much more complex (
(40) Exploiting the rich diversity of the human light chain locus in mice would likely result in, among other things, a source for a more complete human repertoire of light chain V domains. Previous attempts to tap this diversity used human transgenes containing chunks of the human light chain locus randomly incorporated into the mouse genome (see, e.g., U.S. Pat. No. 6,998,514 and U.S. Pat. No. 7,435,871). Mice containing these randomly integrated transgenes reportedly express fully human light chains, however, in some cases, one or both endogenous light chain loci remain intact. This situation is not desirable as the human light chain sequences contend with the mouse light chain ( or ) in the expressed antibody repertoire of the mouse.
(41) In contrast, the inventors describe genetically modified mice that are capable of expressing one or more light chain nucleic acid sequences directly from a mouse light chain locus, including by replacement at an endogenous mouse light chain locus. Genetically modified mice capable of expressing human light chain sequences from an endogenous locus may be further bred to mice that comprise a human heavy chain locus and thus be used to express antibodies comprising V regions (heavy and light) that are fully human. In various embodiments. The V regions express with mouse constant regions. In various embodiments, no endogenous mouse immunoglobulin gene segments are present and the V regions express with human constant regions. These antibodies would prove useful in numerous applications, both diagnostic as well as therapeutic.
(42) Many advantages can be realized for various embodiments of expressing binding proteins derived from human V and J gene segments in mice. Advantages can be realized by placing human sequences at an endogenous light chain locus, for example, the mouse or locus. Antibodies made from such mice can have light chains that comprise human V domains fused to a mouse C.sub.L region, specifically a mouse C or C region. The mice will also express human V domains that are suitable for identification and cloning for use with human C.sub.L regions, specifically C and/or C regions. Because B cell development in such mice is otherwise normal, it is possible to generate compatible V domains (including somatically mutated V domains) in the context of either C or C regions.
(43) Genetically modified mice are described that comprise an unrearranged V gene segment at an immunoglobulin or light chain locus. Mice that express antibodies that comprise a light chain having a human V domain fused to a C and/or C region are described.
Sterile Transcripts of the Immunoglobulin Light Chain Locus
(44) Variations on the theme of expressing human immunoglobulin sequences in mice are reflected in various embodiments of genetically modified mice capable of such expression. Thus, in some embodiments, the genetically modified mice comprise certain non-coding sequence(s) from a human locus. In one embodiment, the genetically modified mouse comprises human V and J gene segments at an endogenous light chain locus, and further comprises a human light chain genomic fragment. In a specific embodiment, the human light chain genomic fragment is a non-coding sequence naturally found between a human V gene segment and a human J gene segment.
(45) The human and mouse light chain loci contain sequences that encode sterile transcripts that lack either a start codon or an open reading frame, and that are regarded as elements that regulate transcription of the light chain loci. These sterile transcripts arise from an intergenic sequence located downstream or 3 of the most proximal V gene segment and upstream or 5 of the light chain intronic enhancer (Ei) that is upstream of the light chain constant region gene (C). The sterile transcripts arise from rearrangement of the intergenic sequence to form a VJ1 segment fused to a C.
(46) A replacement of the light chain locus upstream of the C gene would remove the intergenic region encoding the sterile transcripts. Therefore, in various embodiments, a replacement of mouse light chain sequence upstream of the mouse C gene with human light chain gene segments would result in a humanized mouse light chain locus that contains human V and J gene segments but not the light chain intergenic region that encodes the sterile transcripts.
(47) As described herein, humanization of the endogenous mouse light chain locus with human light chain gene segments, wherein the humanization removes the intergenic region, results in a striking drop in usage of the light chain locus, coupled with a marked increase in light chain usage. Therefore, although a humanized mouse that lacks the intergenic region is useful in that it can make antibodies with human light chain variable domains (e.g., human or K domains), usage from the locus decreases.
(48) Also described is humanization of the endogenous mouse light chain locus with human V and J gene segments coupled with an insertion of a human intergenic region to create a V locus that contains, with respect to transcription, between the final human V gene segment and the first human J gene segment, a intergenic region; which exhibits a B cell population with a higher expression than a locus that lacks the intergenic region. This observation is consistent with a hypothesis that the intergenic regiondirectly through a sterile transcript, or indirectlysuppresses usage from the endogenous light chain locus. Under such a hypothesis, including the intergenic region would result in a decrease in usage of the endogenous light chain locus, leaving the mouse a restricted choice but to employ the modified ( into ) locus to generate antibodies.
(49) In various embodiments, a replacement of mouse light chain sequence upstream of the mouse C gene with human light chain sequence further comprises a human light chain intergenic region disposed, with respect to transcription, between the 3 untranslated region of the 3 most V gene segment and 5 to the first human J gene segment. Alternatively, such an intergenic region may be omitted from a replaced endogenous light chain locus (upstream of the mouse C gene) by making a deletion in the endogenous light chain locus. Likewise, under this embodiment, the mouse generates antibodies from an endogenous light chain locus containing human light chain sequences.
Approaches to Engineering Mice to Express Human V Domains
(50) Various approaches to making genetically modified mice that make antibodies that contain a light chain that has a human V domain fused to an endogenous C.sub.L (e.g. C or C) region are described. Genetic modifications are described that, in various embodiments, comprise a deletion of one or both endogenous light chain loci. For example, to eliminate mouse light chains from the endogenous antibody repertoire a deletion of a first V-J-C gene cluster and replacement, in whole or in part, of the V-J gene segments of a second gene cluster with human V-J gene segments can be made. Genetically modified mouse embryos, cells, and targeting constructs for making the mice, mouse embryos, and cells are also provided.
(51) The deletion of one endogenous V-J-C gene cluster and replacement of the V-J gene segments of another endogenous V-J-C gene cluster employs a relatively minimal disruption in natural antibody constant region association and function in the animal, in various embodiments, because endogenous C genes are left intact and therefore retain normal functionality and capability to associate with the constant region of an endogenous heavy chain. Thus, in such embodiments the modification does not affect other endogenous heavy chain constant regions dependent upon functional light chain constant regions for assembly of a functional antibody molecule containing two heavy chains and two light chains. Further, in various embodiments the modification does not affect the assembly of a functional membrane-bound antibody molecule involving an endogenous heavy chain and a light chain, e.g., a hV domain linked to a mouse C region. Because at least one functional C gene is retained at the endogenous locus, animals containing a replacement of the V-J gene segments of an endogenous V-J-C gene cluster with human V-J gene segments should be able to make normal light chains that are capable of binding antigen during an immune response through the human V-J gene segments present in the expressed antibody repertoire of the animal.
(52) A schematic illustration (not to scale) of a deleted endogenous mouse V-J-C gene cluster is provided in
(53) Genetically modifying a mouse to render endogenous gene segments nonfunctional, in various embodiments, results in a mouse that exhibits exclusively light chains in its antibody repertoire, making the mouse useful for evaluating the role of light chains in the immune response, and useful for making an antibody repertoire comprising V domains but not V domains.
(54) A genetically modified mouse that expresses a hV linked to a mouse C gene having been recombined at the endogenous mouse light chain locus can be made by any method known in the art. A schematic illustration (not to scale) of the replacement of the endogenous mouse V2-V3-J2 gene segments with human V and J gene segments is provided in
(55) Thus, this first approach positions one or more hV gene segments at the endogenous light chain locus contiguous with a single hJ gene segment (
(56) Further modifications to the modified endogenous light chain locus can be achieved with using similar techniques to insert more hV gene segments. For example, schematic illustrations of two additional targeting constructs (+16- and +12- Targeting Vectors) used for progressive insertion of addition human hV gene segments are provided in
(57) The above approaches to insert human light chain gene segments at the mouse locus, maintains the enhancers positioned downstream of the C2-J4-C4 gene segments (designated Enh 2.4, Enh and Enh 3.1
(58) Compositions and methods for making a mouse that expresses a light chain comprising hV and J gene segments operably linked to a mouse C gene segment, are provided, including compositions and method for making a mouse that expresses such genes from an endogenous mouse light chain locus. The methods include selectively rendering one endogenous mouse V-J-C gene cluster nonfunctional (e.g., by a targeted deletion), and employing a hV and J gene segments at the endogenous mouse light chain locus to express a hV domain in a mouse.
(59) Alternatively, in a second approach, human light chain gene segments may be positioned at the endogenous light chain locus. The genetic modification, in various embodiments, comprises a deletion of the endogenous light chain locus. For example, to eliminate mouse light chains from the endogenous antibody repertoire a deletion of the mouse V and J gene segments can be made. Genetically modified mouse embryos, cells, and targeting constructs for making the mice, mouse embryos, and cells are also provided.
(60) For the reasons stated above, the deletion of the mouse V and J gene segments employs a relatively minimal disruption. A schematic illustration (not to scale) of deleted mouse V and J gene segments is provided in
(61) Thus, a second approach positions one or more human V gene segments are positioned at the mouse light chain locus contiguous with a single human J gene segment (12/1- Targeting Vector,
(62) In various embodiments, modifications to this approach can be made to add gene segments and/or regulatory sequences to optimize the usage of the human light chain sequences from the mouse locus within the mouse antibody repertoire.
(63) In a third approach, one or more hV gene segments are positioned at the mouse light chain locus contiguous with four hJ gene sequences (12/4- Targeting Vector
(64) In a third approach, one or more hV gene segments are positioned at the mouse light chain locus contiguous with a human intergenic sequence and a single hJ gene sequence (12()1- Targeting Vector,
(65) In a fourth approach, one or more hV gene segments are positioned at the mouse light chain locus contiguous with a human intergenic sequence four hJ gene sequences (12()4- Targeting Vector
(66) All of the above approaches to insert human light chain gene segments at the mouse locus, maintain the intronic enhancer element upstream of the C gene (designated Ei, FIG. 4B and
(67) In various embodiments, genetically modified mouse comprise a knockout of the endogenous mouse light chain locus. In one embodiment, the light chain locus is knocked out by a strategy that deletes the region spanning V2 to J2, and the region spanning V1 to C1 (
Lambda Domain Antibodies from Genetically Modified Mice
(68) Mice comprising human sequences at either the mouse or light chain locus will express a light chain that comprises a hV region fused to a mouse C.sub.L (C or C) region. These are advantageously bred to mice that (a) comprise a functionally silenced light chain locus (e.g., a knockout of the endogenous mouse or light chain locus); (b) comprise an endogenous mouse L light chain locus that comprises hV and hJ gene segments operably linked to an endogenous mouse C gene; (c) comprise an endogenous mouse light chain locus that comprises hV and hJ gene segments operably linked to an endogenous mouse C gene; and, (d) a mouse in which one allele comprises hVs and hJs; the other allele comprising hVs and hJs; one allele comprising hVs and hJs and one allele silenced or knocked out, or both alleles comprising hVs and hJs; and, two heavy chain alleles that each comprise hV.sub.Hs, hD.sub.Hs, and hJ.sub.Hs.
(69) The antibodies that comprise the hV domains expressed in the context of either C or C are used to make fully human antibodies by cloning the nucleic acids encoding the hV domains into expression constructs that bear genes encoding human C. Resulting expression constructs are transfected into suitable host cells for expressing antibodies that display a fully hV domain fused to hCG.
EXAMPLES
(70) The following examples are provided so as to describe how to make and use methods and compositions of the invention, and are not intended to limit the scope of what the inventors regard as their invention. Unless indicated otherwise, temperature is indicated in Celsius, and pressure is at or near atmospheric.
Example I
Deletion of the Mouse Immunoglobulin Light Chain Loci
(71) Various targeting constructs were made using VELOCIGENE technology (see, e.g., U.S. Pat. No. 6,586,251 and Valenzuela et al. (2003) High-throughput engineering of the mouse genome coupled with high-resolution expression analysis, Nature Biotech. 21(6):652-659) to modify mouse genomic Bacterial Artificial Chromosome (BAC) libraries to inactivate the mouse K and light chain loci.
(72) Deletion of the Mouse Light Chain Locus.
(73) DNA from mouse BAC clone RP23-135k15 (Invitrogen) was modified by homologous recombination to inactivate the endogenous mouse light chain locus through targeted deletion of the V-J-C gene clusters (
(74) Briefly, the entire proximal cluster comprising V1-J3-C3-J1-C1 gene segments was deleted in a single targeting event using a targeting vector comprising a neomycin cassette flanked by loxP sites with a 5 mouse homology arm containing sequence 5 of the V1 gene segment and a 3 mouse homology arm containing sequence 3 of the C1 gene segment (
(75) A second targeting construct was prepared to precisely delete the distal endogenous mouse gene cluster containing V2-J2-C2-J4-C4 except that the targeting construct contained a 5 mouse homology arm that contained sequence 5 of the V2 gene segment and a 3 mouse homology arm that contained sequence 5 to the endogenous C2 gene segment (
(76) Deletion of the Mouse Light Chain Locus.
(77) Several targeting constructs were made using similar methods described above to modify DNA from mouse BAC clones RP23-302g12 and RP23-254m04 (Invitrogen) by homologous recombination to inactivate the mouse light chain locus in a two-step process (
(78) Briefly, the J gene segments (1-5) of the endogenous mouse light chain locus were deleted in a single targeting event using a targeting vector comprising a hygromycin-thymidine kinase (hyg-TK) cassette containing a single loxP site 3 to the hyg-TK cassette (
(79) Thus, two modified endogenous light chain loci ( and ) containing intact enhancer and constant regions were created for progressively inserting unrearranged human germline gene segments in a precise manner using targeting vectors described below.
Example II
Replacement of Mouse Light Chain Loci with a Human Light Chain Mini-Locus
(80) Multiple targeting vectors were engineered for progressive insertion of human gene segments into the endogenous mouse and light chain loci using similar methods as described above. Multiple independent initial modifications were made to the endogenous light chain loci each producing a chimeric light chain locus containing hV and J gene segments operably linked to mouse light chain constant genes and enhancers.
(81) A Human Mini-Locus Containing 12 Human V and One Human J Gene Segment.
(82) A series of initial targeting vectors were engineered to contain the first 12 consecutive human V gene segments from cluster A and a hJ1 gene segment or four hJ gene segments using a human BAC clone named RP11-729g4 (Invitrogen).
(83) For a first set of initial targeting vectors, a 124,125 bp DNA fragment from the 729g4 BAC clone containing 12 hV gene segments and a hJ1 gene segment was engineered to contain a PI-SceI site 996 bp downstream (3) of the hJ1 gene segment for ligation of a 3 mouse homology arm. Two different sets of homology arms were used for ligation to this human fragment; one set of homology arms contained endogenous mouse sequences from the 135k15 BAC clone (
(84) For the 12/1- Targeting Vector (
(85) Thus, the 12/1- Targeting Vector included, from 5 to 3, a 5 homology arm containing 24 kb of mouse genomic sequence 5 of the endogenous locus, a 5 Frt site, a neomycin cassette, a 3 Frt site, 123 kb of human genomic sequence containing the first 12 consecutive hV gene segments and a hJ1 gene segment, a PI-SceI site, and a 3 homology arm containing 28 kb of mouse genomic sequence including the endogenous C2-J4-C4 gene segments, the mouse enhancer 2.4 sequence and additional mouse genomic sequence downstream (3) of the enhancer 2.4 (
(86) In a similar fashion, the 12/1- Targeting Vector (
(87) Homologous recombination with either of these two initial targeting vectors created a modified mouse light chain locus ( or ) containing 12 hV gene segments and a hJ1 gene segment operably linked to the endogenous mouse light chain constant gene and enhancers (C or C2 and Ei/E3 or Enh 2.4/Enh 3.1) gene which, upon recombination, leads to the formation of a chimeric light chain.
(88) A Human Mini-Locus with 12 Human V and Four Human Gene Segments.
(89) In another approach to add diversity to a chimeric light chain locus, a third initial targeting vector was engineered to insert the first 12 consecutive human V gene segments from cluster A and hJ1, 2, 3 and 7 gene segments into the mouse light chain locus (
(90) This ligation resulted in a third targeting vector for insertion of human sequences into the endogenous light chain locus, which included, from 5 to 3, a 5 mouse homology arm containing 23 kb of genomic sequence 5 of the endogenous mouse locus, an I-Ceul site, a 5 Frt site, a neomycin cassette, a 3 Frt site, a 123 kb fragment containing the first 12 hV gene segments, a 1 kb fragment containing hJ1, 2, 3 and 7 gene segments, a PI-SceI site and a 3 homology arm containing 28 kb of mouse genomic sequence including the endogenous the mouse C gene, Ei and E3 and additional mouse genomic sequence downstream (3) of E3 (
(91) A Human Mini-Locus with an Integrated Human Light Chain Sequence.
(92) In a similar fashion, two additional targeting vectors similar to those engineered to make an initial insertion of human gene segments into the endogenous light chain locus (
(93) Both targeting vectors containing the human genomic sequence were made using the modified RP11-729g4 BAC clone described above (
(94) Briefly, the 2366j12 BAC clone is about 132 kb in size and contains hV gene segments 1-6, 1-5, 2-4, 7-3, 5-2, 4-1, human genomic sequence down stream of the V gene segments, hJ gene segments 1-5, the hC and about 20 kb of additional genomic sequence of the human locus. This clone was first targeted with a targeting vector containing a hygromycin cassette flanked by Frt sites and a NotI site downstream (3) of the 3 Frt site. The homology arms for this targeting vector contained human genomic sequence 5 and 3 of the V gene segments within the BAC clone such that upon homologous recombination with this targeting vector, the V gene segments were deleted and a NotI site was engineered 133 bp downstream of the hV4-1 gene segment (
(95) Double targeted 729g4 and 2366j12 clones were digested with NotI and AsiSI yielding one fragment containing the neomycin cassette and hV gene segments and another fragment containing the 23 kb genomic fragment of the human locus containing the intergenic region between the V4-1 and J1 gene segments, either a hJ1 gene segment or a genomic fragment containing hJ1, J2, J3 and J7 gene segments, the PI-SceI site and the chloroamphenicol cassette, respectively. Ligation of these fragments generated two unique BAC clones containing from 5 to 3 the hV gene segments, the human genomic sequence between the V4-1 and J1 gene segments, either a hJ1 gene segment or a genomic fragment containing hJ1, J2, J3 and J7 gene segments, a PI-SceI site and a chloroamphenicol cassette (
Example III
Engineering Additional Human V Genes Segments into a Human Light Chain Mini-Locus
(96) Additional hV gene segments were added independently to each of the initial modifications described in Example 2 using similar targeting vectors and methods (
(97) Introduction of 16 Additional Human V Gene Segments.
(98) Upstream (5) homology arms used in constructing targeting vectors for adding 16 additional hV gene segments to the modified light chain loci described in Example 2 contained mouse genomic sequence 5 of either the endogenous or light chain loci. The 3 homology arms were the same for all targeting vectors and contained human genomic sequence overlapping with the 5 end of the human sequence of the modifications as described in Example 2.
(99) Briefly, two targeting vectors were engineered for introduction of 16 additional hV gene segments to the modified mouse light chain loci described in Example 2 (
(100) In a similar fashion, the +16- Targeting Vector was also used to introduce the 16 additional hV gene segments to the other initial modifications described in Example 2 that incorporated multiple hJ gene segments with and without an integrated human sequence (
(101) Introduction of 12 Additional Human V Gene Segments.
(102) Additional hV gene segments were added independently to each of the modifications described above using similar targeting vectors and methods. The final locus structure resulting from homologous recombination with targeting vectors containing additional hV gene segments are shown in
(103) Briefly, a targeting vector was engineered for introduction of 12 additional hV gene segments to the modified mouse and light chain loci described above (
(104) In a similar fashion, the +12- Targeting Vector was also used to introduce the 12 additional hV gene segments to the other initial modifications that incorporated multiple hJ gene segments with and without an integrated human sequence (
Example IV
Identification of Targeted ES Cells Bearing Human Light Chain Gene Segments
(105) Targeted BAC DNA made according to the foregoing Examples was used to electroporate mouse ES cells to create modified ES cells for generating chimeric mice that express human light chain gene segments. ES cells containing an insertion of unrearranged human light chain gene segments were identified by a quantitative TAQMAN assay. Specific primers sets and probes were design for insertion of human sequences and associated selection cassettes (gain of allele, GOA), loss of endogenous mouse sequences and any selection cassettes (loss of allele, LOA) and retention of flanking mouse sequences (allele retention, AR). For each additional insertion of human sequences, additional primer sets and probes were used to confirm the presence of the additional human sequences as well as the previous primer sets and probes used to confirm retention of the previously targeted human sequences. Table 1 sets forth the primers and associated probes used in the quantitative PCR assays. Table 2 sets forth the combinations used for confirming the insertion of each section of human light chain gene segments in ES cell clones.
(106) ES cells bearing the human light chain gene segments are optionally transfected with a construct that expresses FLP in order to remove the Frt'ed neomycin cassette introduced by the insertion of the targeting construct containing human V5-52-V1-40 gene segments (
(107) TABLE-US-00001 TABLE 1 Primer SEQ ID NO: Probe SEQ ID NO: hL2F 2 hL2P 24 hL2R 3 hL3F 4 hL3P 25 hL3R 5 NeoF 6 NeoP 26 NeoR 7 61hJ1F 8 61hJ1P 27 61hJ1R 9 67hT1F 10 67hT1P 28 67hT1R 11 67hT3F 12 67hT3P 29 67hT3R 13 HygF 14 HygP 30 HygR 15 MKD2F 16 MKD2P 31 MKD2R 17 MKP8F 18 MKP8P 32 MKP8R 19 MKP15F 20 MKP15P 33 MKP15R 21 MK20F 22 MKP4R 23 68h2F 34 68h2P 38 68h2R 35 68h5F 36 68h5P 39 68h5R 37 mL1F 75 mL1P 83 mL1R 76 mL2F 77 mL2P 84 mL2R 78 mL11F 79 mL11P 85 mL11R 80 mL12F 81 mL12P 86 mL12R 82
(108) TABLE-US-00002 TABLE 2 Forward/Reverse Modification Assay Primer Set Probe Sequence Location Insertion of GOA hL2F/hL2R hL2P hV3-12-hV3-1 12 hV hL3F/hL3R hL3P & hJ1 61hJ1F/61hJ1R 61hJ1P hJ sequence NeoF/NeoR NeoP Neomycin cassette LOA MK20F/MKP4R /ox511//oxP sequence of inactivated locus HygF/HygR HygP Hygromycin cassette from inactivated locus mL1F/mL1R mL1P Mouse V1-C1 mL2F/mL2R mL2P Cluster mL11F/mL11R mL11P Mouse V2-C2 mL12F/mL12R mL12P Cluster AR/LOA MKD2F/MKD2R MKD2P Mouse sequence in 5 V locus MKP15F/MKP15R MKP15P Mouse sequence in 3 V locus Insertion of GOA 67hT1F/67hT1R 67hT1P hV3-27-hV3-12 16 hV 67hT3F/67hT3R 67hT3P HygF/HygR HygP Hygromycin cassette LOA NeoF/NeoR NeoP Neomycin cassette mL1F/mL1R mL1P Mouse v1-C1 mL2F/mL2R mL2P Cluster mL11F/mL11R mL11P Mouse V2-C2 mL12F/mL12R mL12P Cluster AR hL2F/hL2R hL2P hV3-12-hV3-1 hL3F/hL3R hL3P AR/LOA MKD2F/MKD2R MKD2P Mouse sequence in 5 V locus MKP15F/MKP15R MKP15P Mouse sequence in 3 V locus Insertion of GOA 68h2F/68h2R 68h2P hV5-52-hv1 40 12 hV 68h5F/68h5R 68h5P NeoF/NeoR NeoP Neomycin cassette HygF/HygR HygP Hygromycin cassette mL1F/mL1R mL1P Mouse V1-C1 LOA mL2F/mL2R mL2P Cluster mL11F/mL11R mL11P Mouse V2-C2 mL12F/mL12R mL12P Cluster hL2F/hL2R hL2P hV3-12-hV3-1 AR hL3F/hL3R hL3P 67hT1F/67hT1R 67hT1P hV3-27-hV3-12 67hT3F/67hT3R 67hT3P AR/LOA MKD2F/MKD2R MKD2P Mouse sequence in 5 V locus MKP15F/MKP15R MKP15P Mouse sequence in 3 V locus
Example V
Generation of Mice Expressing Human Light Chains from an Endogenous Light Chain Locus
(109) Targeted ES cells described above were used as donor ES cells and introduced into an 8-cell stage mouse embryo by the VELOCIMOUSE method (see, e.g., U.S. Pat. No. 7,294,754 and Poueymirou et al. (2007) F0 generation mice that are essentially fully derived from the donor gene-targeted ES cells allowing immediate phenotypic analyses Nature Biotech. 25(1):91-99. VELOCIMICE (F0 mice fully derived from the donor ES cell) independently bearing human gene segments were identified by genotyping using a modification of allele assay (Valenzuela et al., supra) that detected the presence of the unique human gene segments (supra).
(110) : Light Chain Usage of Mice Bearing Human Light Chain Gene Segments.
(111) Mice homozygous for each of three successive insertions of hV gene segments with a single hJ gene segment (
(112) Briefly, spleens were harvested from groups of mice (ranging from three to seven animals per group) and grinded using glass slides. Following lysis of red blood cells (RBCs) with ACK lysis buffer (Lonza Walkersville), splenocytes were stained with fluorescent dye conjugated antibodies specific for mouse CD19 (Clone 1D3; BD Biosciences), mouse CD3 (17A2; Biolegend), mouse Ig (187.1; BD Biosciences) and mouse Ig (RML-42; Biolegend). Data was acquired using a BD LSR II flow cytometer (BD Biosciences) and analyzed using FLOWJO software (Tree Star, Inc.). Table 3 sets forth the average percent values for B cells (CD19.sup.+), light chain (CD19.sup.+Ig.sup.+Ig.sup.), and light chain (CD19.sup.+Ig.sup.Ig.sup.+) expression observed in splenocytes from groups of animals bearing each genetic modification.
(113) In a similar experiment, B cell contents of the splenic compartment from mice homozygous for a first insertion of 12 hV and four hJ gene segments including a human V-J genomic sequence operably linked to the mouse C gene (bottom of
(114) In another experiment, B cell contents of the spleen and bone marrow compartments from mice homozygous for 40 hV and four hJ gene segments including a human V-J genomic sequence operably linked to the mouse C gene (bottom of
(115) Briefly, two groups (N=3 each, 9-12 weeks old, male and female) of wild type and mice homozygous for 40 hV and four hJ gene segments including a human V-J genomic sequence operably linked to the mouse C gene were sacrificed and spleens and bone marrow were harvested. Bone marrow was collected from femurs by flushing with complete RPMI medium (RPMI medium supplemented with fetal calf serum, sodium pyruvate, Hepes, 2-mercaptoethanol, non-essential amino acids, and gentamycin). RBCs from spleen and bone marrow preparations were lysed with ACK lysis buffer (Lonza Walkersville), followed by washing with complete RPMI medium. 110.sup.6 cells were incubated with anti-mouse CD16/CD32 (2.4G2, BD Biosciences) on ice for 10 minutes, followed by labeling with a selected antibody panel for 30 min on ice.
(116) Bone marrow panel: anti-mouse FITC-CD43 (1B11, BioLegend), PE-ckit (2B8, BioLegend), PeCy7-IgM (11/41, eBioscience), PerCP-Cy5.5-IgD (11-26c.2a, BioLegend), APC-B220 (RA3-6B2, eBioscience), APC-H7-CD19 (ID3, BD) and Pacific Blue-CD3 (17A2, BioLegend).
(117) Bone marrow and spleen panel: anti-mouse FITC-Ig (187.1, BD), PE-Ig (RML-42, BioLegend), PeCy7-IgM (11/41, ebioscience), PerCP-Cy5.5-IgD (11-26c.2a, BioLegend), Pacific Blue-CD3 (17A2, BioLegend), APC-B220 (RA3-6B2, eBioscience), APC-H7-CD19 (ID3, BD).
(118) Following staining, cells were washed and fixed in 2% formaldehyde. Data acquisition was performed on a FACSCANTOII flow cytometer (BD Biosciences) and analyzed with FLOWJO software (Tree Star, Inc.).
(119) TABLE-US-00003 TABLE 3 Genotype % B cells % Ig.sup.+ % Ig.sup.+ Wild Type 46.2 91.0 3.6 12 hV + hJ1 28.3 10.4 62.5 12 hV VJ hJ1 12.0 11.0 67.5 12 hV VJ 4hJ 41.8 17.2 68.4 28 hV + hJ1 22.0 13.3 51.1 40 hV + hJ1 28.2 24.3 53.0
(120) TABLE-US-00004 TABLE 4 Genotype % B cells % Ig.sup.+ % Ig.sup.+ Wild Type 49.8 91.2 3.5 40 hV VJ 4hJ 33.3 41.6 43.1
(121) TABLE-US-00005 TABLE 5 % % % % % B Mature Immature Immature Immature Genotype cells B cells B cells Ig.sup.+ B cells Ig.sup.+ B cells Wild Type 62.2 9.2 12.0 79.0 8.84 40hV VJ 4hJ 60.43 2.59 7.69 38.29 43.29
(122) Human V Gene Usage in Mice Bearing Human Light Chain Gene Segments.
(123) Mice heterozygous for a first insertion of human sequences (hV3-12-hV3-1 and hJ1,
(124) Briefly, spleens were harvested and perfused with 10 mL RPMI-1640 (Sigma) with 5% HI-FBS in sterile disposable bags. Each bag containing a single spleen was then placed into a STOMACHER (Seward) and homogenized at a medium setting for 30 seconds. Homogenized spleens were filtered using a 0.7 m cell strainer and then pelleted with a centrifuge (1000 rpm for 10 minutes) and RBCs were lysed in BD PHARM LYSE (BD Biosciences) for three minutes. Splenocytes were diluted with RPMI-1640 and centrifuged again, followed by resuspension in 1 mL of PBS (Irvine Scientific). RNA was isolated from pelleted splenocytes using standard techniques known in the art.
(125) RT-PCR was performed on splenocyte RNA using primers specific for human hV gene segments and the mouse C gene (Table 6). PCR products were gel-purified and cloned into pCR2.1-TOPO TA vector (Invitrogen) and sequenced with primers M13 Forward (GTAAAACGAC GGCCAG; SEQ ID NO:55) and M13 Reverse (CAGGAAACAG CTATGAC; SEQ ID NO:56) located within the vector at locations flanking the cloning site. Eighty-four total clones derived from the first and third insertions of human sequences were sequenced to determine hV gene usage (Table 7). The nucleotide sequence of the hV-hJ1-mC junction for selected RT-PCR clones is shown in
(126) In a similar fashion, mice homozygous for a third insertion of human light chain gene sequences (i.e. 40 hV gene segments and four hJ gene segments including a human V-J genomic sequence, bottom of
(127) In a similar fashion, mice homozygous for a first insertion of human light chain gene segments (12 hV gene segments and hJ1,
(128) Multiple hV gene segments rearranged to h1 were observed from the RT-PCR clones from mice bearing human light chain gene segments at the endogenous mouse light chain locus. The nucleotide sequence of the hV-hJ-mC2 junction for selected RT-PCR clones is shown in
(129) TABLE-US-00006 TABLE6 SEQ Sequence(5-3) IDNO: 5 hV Primer VLL-1 CCTCTCCTCCTCACCCTCCT 40 VLL-1n ATGRCCDGSTYYYCTCTCCT 41 VLL-2 CTCCTCACTCAGGGCACA 42 VLL-2n ATGGCCTGGGCTCTGCTSCT 43 VLL-3 ATGGCCTGGAYCSCTCTCC 44 VLL-4 TCACCATGGCYTGGRYCYCMYTC 45 VLL-4.3 TCACCATGGCCTGGGTCTCCTT 46 VLL-5 TCACCATGGCCTGGAMTCYTCT 47 VLL-6 TCACCATGGCCTGGGCTCCACTACTT 48 VLL-7 TCACCATGGCCTGGACTCCT 49 VLL-8 TCACCATGGCCTGGATGATGCTT 50 VLL-9 TAAATATGGCCTGGGCTCCTCT 51 VLL-10 TCACCATGCCCTGGGCTCTGCT 52 VLL-11 TCACCATGGCCCTGACTCCTCT 53 3 Mouse C Primer mIgKC3-1 CCCAAGCTTACTGGATGGTGGGAAGATGGA 54
(130) TABLE-US-00007 TABLE 7 Observed No. hV of Clones 3-1 2 4-3 3 2-8 7 3-9 4 3-10 3 2-14 1 3-19 1 2-23 7 3-25 1 1-40 9 7-43 2 1-44 2 5-45 8 7-46 3 9-49 6 1-51 3
(131) TABLE-US-00008 TABLE 8 Clone hV hJ 1-3 1-44 7 1-5 1-51 3 2-3 9-49 7 2-5 1-40 1 2-6 1-40 7 3b-5 3-1 7 4a-1 4-3 7 4a-5 4-3 7 4b-1 1-47 3 5-1 3-10 3 5-2 1-40 7 5-3 1-40 7 5-4 7-46 2 5-6 1-40 7 5-7 7-43 3 6-1 1-40 1 6-2 1-40 2 6-7 1-40 3 7a-1 3-10 7 7a-2 9-49 2 7a-7 3-10 7 7b-2 7-43 3 7b-7 7-46 7 7b-8 7-43 3 11a-1 5-45 2 11a-2 5-45 7
(132)
(133)
(134)
(135) Homozygous mice bearing modified endogenous loci containing 12 hV gene segments and hJ1 were also able to produce human gene segments operably linked to an endogenous mouse C gene and produce B cells that expressed reverse chimeric light chains containing hV regions linked to mouse C regions. These rearrangements further demonstrate that human light chain gene segments placed at the other light chain locus (i.e., the locus) were able to independently rearrange human gene segments in multiple, independent B cells in these mice. Further, the modifications to the endogenous light chain locus demonstrate that the insertion of human gene segments did not render any of the hV and/or hJ1 gene segments inoperable or prevent the chimeric locus from recombining the hV and hJ1 gene segments during B cell development. Further, these mice also made functional antibodies containing human V-J gene segments operably linked to a mouse C region as part of the endogenous immunoglobulin light chain repertoire.
(136) As shown in this Example, mice bearing human light chain gene segments at the endogenous and light chain loci are capable of rearranging human light chain gene segments and expressing them in the context of a mouse C and/or C region as part of the normal antibody repertoire of the mouse because a functional light chain is required at various checkpoints in B cell development in both the spleen and bone marrow. Further, early subsets of B cells (e.g., pre-, pro- and transitional B cells) demonstrate a normal phenotype in these mice as compared to wild type littermates (
Example VI
Breeding of Mice Expressing Human Light Chains from an Endogenous Light Chain Locus
(137) To optimize the usage of the human gene segments at an endogenous mouse light chain locus, mice bearing the unrearranged human gene segments are bred to another mouse containing a deletion in the opposing endogenous light chain locus (either or ). For example, human gene segments positioned at the endogenous locus would be the only functional light chain gene segments present in a mouse that also carried a deletion in the endogenous light chain locus. In this manner, the progeny obtained would express only human light chains as described in the foregoing examples. Breeding is performed by standard techniques recognized in the art and, alternatively, by commercial companies, e.g., The Jackson Laboratory. Mouse strains bearing human light chain gene segments at the endogenous locus and a deletion of the endogenous light chain locus are screened for presence of the unique reverse-chimeric (human-mouse) light chains and absence of endogenous mouse light chains.
(138) Mice bearing an unrearranged human light chain locus are also bred with mice that contain a replacement of the endogenous mouse heavy chain variable gene locus with the human heavy chain variable gene locus (see U.S. Pat. No. 6,596,541, Regeneron Pharmaceuticals, the VELOCIMMUNE genetically engineered mouse). The VELOCIMMUNE mouse includes, in part, having a genome comprising human heavy chain variable regions operably linked to endogenous mouse constant region loci such that the mouse produces antibodies comprising a human heavy chain variable region and a mouse heavy chain constant region in response to antigenic stimulation. The DNA encoding the variable regions of the heavy chains of the antibodies can be isolated and operably linked to DNA encoding the human heavy chain constant regions. The DNA can then be expressed in a cell capable of expressing the fully human heavy chain of the antibody. Upon a suitable breeding schedule, mice bearing a replacement of the endogenous mouse heavy chain locus with the human heavy chain locus and an unrearranged human light chain locus at the endogenous light chain locus is obtained. Antibodies containing somatically mutated human heavy chain variable regions and human light chain variable regions can be isolated upon immunization with an antigen of interest.
Example VII
Generation of Antibodies from Mice Expressing Human Heavy Chains and Human Light Chains
(139) After breeding mice that contain the unrearranged human light chain locus to various desired strains containing modifications and deletions of other endogenous Ig loci (as described above), selected mice are immunized with an antigen of interest.
(140) Generally, a VELOCIMMUNE mouse containing one of the single rearranged human germline light chain regions is challenged with an antigen, and lymphatic cells (such as B-cells) are recovered from serum of the animals. The lymphatic cells may be fused with a myeloma cell line to prepare immortal hybridoma cell lines, and such hybridoma cell lines are screened and selected to identify hybridoma cell lines that produce antibodies containing human heavy chain and human light chain that are specific to the antigen used for immunization. DNA encoding the variable regions of the heavy chains and the light chains may be isolated and linked to desirable isotypic constant regions of the heavy chain and light chain. Due to the presence of the additional hV gene segments as compared to the endogenous mouse locus, the diversity of the light chain repertoire is dramatically increased and confers higher diversity on the antigen-specific repertoire upon immunization. The resulting cloned antibody sequences may be subsequently produced in a cell, such as a CHO cell. Alternatively, DNA encoding the antigen-specific chimeric antibodies or the variable domains of the light and heavy chains may be isolated directly from antigen-specific lymphocytes (e.g., B cells).
(141) Initially, high affinity chimeric antibodies are isolated having a human variable region and a mouse constant region. As described above, the antibodies are characterized and selected for desirable characteristics, including affinity, selectivity, epitope, etc. The mouse constant regions are replaced with a desired human constant region to generate the fully human antibody containing a somatically mutated human heavy chain and a human light chain derived from an unrearranged human light chain locus of the invention. Suitable human constant regions include, for example wild type or modified IgG1, IgG2, IgG3, or IgG4.