Use of carboxylic acids and furanic molecules for esterification

09834531 ยท 2017-12-05

Assignee

Inventors

Cpc classification

International classification

Abstract

A process for recovering and using an organic/carboxylic acid or furanic molecule by means of making an ester of a free carboxylic acid or furanic molecule with an alcohol in carbon dioxide (CO.sub.2) without the presence of any other acid catalyst at a reaction temperature and pressure that corresponds to supercritical, critical or near critical conditions for the alcohol and/or CO.sub.2 is described. The process can constitute part of a general process of refining carboxylic acids derived from a fermentation broth or use in the production of a variety of chemical compounds, such as C.sub.4 platform compounds or polymers.

Claims

1. A process for recovering and converting a carboxylic acid or a furanic molecule comprising: a) converting an aldose sugar to a sugar acid either by a chemical or biological means; b) bio-transforming said sugar acid to a keto-acid intermediate or furanic molecule in a solution; c) adjusting pH value of said solution containing said keto-acid intermediate or furanic molecule to a pH of less than 5 so as to generate free acids; and d) reacting said free acids with an alcohol and CO.sub.2 in the substantial absence of any other acid catalyst, to generate an ester of said carboxylic acid, keto-acid intermediate or furanic molecule.

2. The process according to claim 1, wherein said process further comprises drying said solution containing said keto-acid intermediate or furanic molecule.

3. The process according to claim 1, wherein said carboxylic acid is selected from the group consisting of: aldaric acids, aldonic acids, or uronic acids of a hexose or a pentose, and a mixture thereof.

4. The process according to claim 3, wherein said aldaric acid is selected from the group consisting of: allaric acid, altraric acid, glucaric acid, galactaric acid, mannaric acid, gularic acid, idaric acid, talaric acid, xylaric acid, lyxaric acid, arabinaric acid, and ribaric acid.

5. The process according to claim 3, wherein said aldonic acid is selected from the group consisting of: allonic acid, altronic acid, gluconic acid, galactonic acid, mannonic acid, gulonic acid, idonic acid, talonic acid, xylonic acid, lyxonic acid, arabonic acid, and ribonic acid.

6. The process according to claim 3, wherein said uronic acid is selected from the group consisting of: alluronic acid, altruronic acid, glucuronic acid, galacturonic acid, mannuronic acid, guluronic acid, iduronic acid, taluronic acid, xyluronic acid, lyxuronic acid, araburonic acid, and riburonic acid.

7. The process according to claim 1, wherein said furanic molecule is an organic molecule having a 5-carbon heterocycle.

8. The process according to claim 1, wherein said chemical means of converting said aldose sugar is an oxidative operation with either nitric acid or a noble metallic catalyst.

9. The process according to claim 1, wherein said biological means of converting said aldose sugar is a bio-transformation.

10. The process according to claim 1, wherein said sugar acid is bio transformed to a keto-acid intermediate using one or more enzymes selected from an enolase superfamily.

11. The process according to claim 10, wherein said enzyme is at least: a glucarate dehydratase, gluconate dehydratase, altronate dehydratase, or a mixture thereof.

12. The process according to claim 1, wherein said keto-acid intermediate is a molecule that has a methylene carbon atom adjacent to a ketone functional group.

13. The process according to claim 1, wherein said alcohol has an R-group of C.sub.1-C.sub.20 that is at least a saturated, unsaturated, cyclic, or aromatic species.

14. The process according to claim 1, wherein said alcohol is a C.sub.2-C.sub.6-diol.

15. The process according to claim 1, wherein the solution in step b) is at a pH in a range between about 1.5 and about 4.5.

16. The process according to claim 1, wherein said process further comprising purifying said ester to at least 90% purity.

17. A process for making esters comprising: oxidizing an aldose sugar to form a sugar acid, and reacting said sugar acid with an alcohol and CO.sub.2 to form a corresponding ester, according to one of the following reaction pathways; ##STR00005## ##STR00006## wherein in pathways a)-d) said sugar acid is biotransformed into a keto-acid intermediate or furanic molecule in a solution, and said solution containing said keto-acid intermediate or furanic molecule has a pH of less than 5 so as to generate free acids.

Description

BRIEF DESCRIPTION OF FIGURES

(1) FIG. 1 is a schematic diagram illustrating an extraction of organic acids from a fermentation broth mixture and downstream processing as practiced conventionally.

(2) FIG. 2 is a schematic diagram illustrating an iteration of the present process for esterifying an organic carboxylic acid derived from fermentation broth, and further downstream processes that can isolate the resulting esters and/or generate other compounds from such esters.

(3) FIG. 3 is a schematic diagram showing an example of ester production using succinic acid derived from fermentation, and a downstream process in which Na and Mg salts are recycled back into the fermentation reactor, in accordance with another embodiment of the present process.

(4) FIG. 4 is a diagram that illustrates CO.sub.2-assisted esterification of free succinic acid in various alcohols that are converted to corresponding dimethyl, diethyl, or dibutyl esters, according to the present invention.

(5) FIG. 5 is a diagram that illustrates CO.sub.2-assisted esterification of other polycarboxylic acids.

(6) FIG. 6 shows a series of reaction diagrams that summarize variations in temperature for CO.sub.2-assisted esterification of free succinic acid derived from fermentation broth.

(7) FIG. 7 shows a series of reaction diagrams that summarize variations in initial operational pressure for CO.sub.2-assisted esterification of free carboxylic acid according to the invention.

(8) FIG. 8 shows a series of reaction diagrams that summarize variations in temperature, and reaction times for CO.sub.2-assisted esterification of free carboxylic acid according to the invention.

(9) FIG. 9 shows a series of reaction diagrams that summarize the reaction results of succinic acids and their Mg.sup.2+ and Ca.sup.2+ salts.

(10) FIG. 10 shows a graph of the dehydration of glucaric acid using two clone strains. The two clones expressed the same enzyme and performed at similar activity levels.

DETAILED DESCRIPTION OF THE INVENTION

Section IDescription

(11) The present process modifies a conventional extraction of carboxylic acids-derived from fermentation. As compared to the process shown in FIG. 1, the present approach has several advantages; such as, contrary to convention, one can avoid a need to neutralize the fermentation broth. In another aspect of the present disclosure, FIG. 2 is a schematic representation showing a general process of extracting carboxylic acids from fermentation broth that includes a version of the present esterification reaction integrated with further processes that can utilize the resulting esters. As shown, fermentation broth 1 from a reactor is filtered (ultra) 3 to remove biomaterials such as cell mass, and yield carboxylic acids including their salts, by products and other compounds. All of these materials are then dried 3a to make an unrefined mixture 5. This dried mixture of materials is then reacted 7 in a liquid system with an alcohol (ROH; R=alkyl C.sub.1-C.sub.12) and CO.sub.2 at an elevated operational reaction temperature and pressure to yield either monoesters or diesters, or a mixture of both. Only the carboxylic acids react in solution. The resulting mixture 9 is filtered 11 to separate the esters 13 and other by-products 15. The esters are soluble while other by-product compounds are insoluble. The by-products include carbonate salts of calcium, magnesium, or sodium, which can be recovered and recycled 17 back into the fermentation reactor 19. This recycling can lead to significant cost savings and improves the efficiency of the overall fermentation and extraction process. The esters can be processed subsequently either by distillation 21, hydrogenation 23, or hydrogenolysis treatment 25, respectively, to separate the esters, produce C.sub.4 platform compounds, such as the hydrogenation products (e.g., BDO, GBL, NMP, etc.), and biofuels (e.g., ethane, ethanol, butane, butanol, propane, propanol, etc.).

(12) As used herein the term biofuels refers to a gaseous, liquid, or solid substance that is used as a fuel, which is produced from renewable biological resources such as plant, cellulosic, or agricultural biomass or derivatives thereof. In particular, a biofuel refers to a material that can be used in or as a transportation fuel in internal combustion engines, to power certain machinery, or energy generation applications. For instance, propanol and butanol can be a gasoline additive much the same as ethanol. Butane and propane in liquefied petroleum gas (LPG) and ethane in natural gas can be adapted as fuels in certain transportation systems. Other biologically-derived hydrocarbons, like octanol/octane, or alkanes heavier than C.sub.5 or C.sub.6 may also be biofuels.

A

(13) The present disclosure describes, in part, a process for recovering and using an carboxylic acid from a fermentation broth. The process includes a method of esterifying free carboxylic acids. As used herein the term free carboxylic acid refers to a carboxylic acid compound that is at least 50% in its protonated state when in solution, at or below its pKa value. The present invention involves the discovery of a simple but effective way of producing esters from organic acids that are otherwise costly and difficult to isolate.

(14) The recovery process and esterification method can be applied to producing chemical feedstock molecules from free carboxylic acids derived from a fermentation broth. An advantage of the present invention is that one can use free carboxylic acids directly from a fermentation broth and generate corresponding esters therefrom without the need to isolate or purify the acids from the fermentation broth, as is necessary in conventional extractions from broth. In comparison to certain fermentation processes that neutralize or convert the carboxylic acids to their salts, the present process provides an easier way to isolate and extract carboxylic acids from a fermentation broth. The present process eliminates a need for titration and neutralization of the fermentation broth that can precipitate metal salts, and certain purification steps to produce a stock platform chemical. The free carboxylic acids are converted into esters, which are simpler to process and extract by distillation or other purification techniques without the use of expensive and complicated chromatographic separation columns or resins. For instance in a conventional process, one would need to use ion exchange chromatography to isolate the acids. A small amount of salts may unavoidably carry-over after the ion exchange. Hence, one may require multiple units of operation to purify the acid to an acceptable quality level. With each added operational unit the costs of the overall process increases. Moreover, in synthesizing the ester of the acid, one can recover the salt as a carbonate or hydroxide, which can be used to regenerate the fermentation broth, and minimize waste. By converting the organic acids to their corresponding esters, we can avoid such issues.

(15) Conventionally, esters are produced when carboxylic acids are heated with alcohols in the presence of an acid catalyst. The mechanism for the formation of an ester from an acid and an alcohol are the reverse of the steps for the acid-catalyzed hydrolysis of an ester. The reaction can go in either direction depending on the conditions used. In a typical esterification process, a carboxylic acid does not react with an alcohol unless a strong acid is used as a catalyst. The catalyst is usually concentrated sulfuric acid or hydrogen chloride. Protonation makes the carbonyl group more electrophilic and enables it to react with the alcohol, which is a weak nucleophile.

(16) In general terms, the present esterification method involves a reaction of fermentation-derived, free organic carboxylic acid with an alcohol in a carbon dioxide (CO.sub.2)-predominant atmosphere in substantial absence of any other acid catalyst to produce esters. The esterification reaction is performed in solution under conditions that are either at supercritical, critical or near critical temperatures and/or pressures for at least one of the alcohol or CO.sub.2. Under such conditions, we believe that CO.sub.2 self-generates or functions in situ as an acid catalyst, and regenerates back after the esterification reaction is completed. It is believed that a reactive intermediate (monoalkylcarbonic acid) is being made in situ in large enough quantities to drive esterification and affect ester production. This intermediate, having a similar pKa (e.g., 4-5) as the free carboxylic acid, functions as a carbonic acid, which is much weaker than the usual strong acids. The observed trend of greater ester conversion at higher temperatures adduces a relatively large energy of activation for this process. As used herein, the term substantial absence refers to a condition in which an acid catalyst is either largely or completely absent, or is present in de minimnis or trace amount of less than catalytic efficacy. In other words, no other acid catalyst is present, or is present at a level less than 10%, 5%, 3%, or 1% weight/weight relative to the carboxylic acid in the reaction.

(17) An advantageous feature of the inventive process is that activation of the free carboxylic acid as an acyl halide (e.g., fluoride, chloride, bromide) or by using strong mineral acids is unnecessary. Acyl halides are inconvenient to use because these species are inherently reactive, have issues with stability, waste treatment, and can be cumbersome and costly to make.

(18) In the present process, carbon dioxide functioning as a catalyst instead of the usual strong acids removes the need to introduce a strong acid into the esterification reaction. This feature can circumvent the usual need to adjust pH values in order to remove the catalyzing acid, enabling a simpler and cleaner synthesis. One can simply proceed to filter the resultant product to remove alkali or alkaline earth metal carbonate or other salts. A cleaner product will save costs in purification and downstream processing for conversion to other chemical feedstock.

(19) The process described herein is a more environmentally benign way of producing esters. As it is believed that the carbon dioxide can self-generate an acid catalyst in situ in the presence of the alcohol during the esterification reaction, the present method does not require the use or addition of another acid catalyst species. In other words, the reaction kinetics with CO.sub.2 alone can drive the esterification in the substantial absence of any other acid catalyst. To reiterate, the present process does not require activation of free acids as, for example, an acyl chloride or by strong acids (i.e., Fischer esterification).

(20) In general, the esterification is conducted at an operational or reaction temperature between about 150 C. to about 250 C., at a reaction pressure of between about 400 psi and 2,500 psi or 3,000 psi (gauge), for an extended period, such as about 4 hours, up to about 12 hours. Typically, the temperature can be in a range between about 170 C. or 190 C. to about 230 C. or 245 C. (e.g., 175 C., 187 C., 195 C. or 215 C.), and the operational pressure is between about 900 psi or 950 psi and about 2,200 psi or 2,400 psi (e.g., 960 psi, 980 psi, 1020 psi or 1050 psi). Alternatively, the temperature can be in a range between about 180 C. to about 245 C. (e.g., about 185 C. or 200 C. or 210 C. to about 220 C. or 235 C. or 240 C.), and the operational pressure is between about 1000 psi and 2.350 psi (e.g., 1,100 psi, 1,200 psi, 1,550 psi, 1,750 psi, 1,810 psi, or 1,900 psi). Other temperatures may be within a range, for example, from about 160 C. or 185 C. to about 210 C. or 225 C., and other operational pressures may be within a range, for example, from about 1,150 psi or 1,500 psi to about 1,800 psi or 2,000 psi.

(21) These reaction temperatures and pressures correspond to supercritical, critical or near critical conditions for the alcohol(s) or CO.sub.2. Table 1 lists, for purpose of illustration, critical parameters for some common solvents (i.e., methanol, ethanol, 1-propanol, 1-butanol, water, and CO.sub.2).

(22) TABLE-US-00001 TABLE 1 Critical Data for Select Substances (Yaws, C. L., Chemical Properties Handbook. In McGraw-Hill: 1999; pp 1-29.) Substance Molecular Critical Temp. Critical Pressure Critical Density Name Weight (K)/ C. (bar)/psi (g/cm.sup.3) Methanol 32.042 512.58/239.43 80.96/1174.226 0.2720 Ethanol 46.069 516.25/243.10 63.84/925.920 0.2760 1-Propanol 60.095 537.4/264.25 51.02/739.983 0.2754 1-Butanol 74.122 563.0 0.3/289.85.sup. 45.0 4.0/652.671.sup. 0.3710 Water 18.015 647.13/373.98 220.55/3198.807 0.3220 Carbon 44.010 304.19/31.04 73.82/1070.669 0.4682 dioxide
At conditions above the critical point (i.e., critical temperature and pressure), the fluid exists in a supercritical phase where it exhibits properties that are in between those of a liquid and a gas. More specifically, supercritical fluids (SCFs) have a liquid-like density and gas-like transport properties (i.e., diffusivity and viscosity). This can be seen in Table 2, wherein the typical values of these properties are compared between the three fluid typesconventional liquids, supercritical fluids, and gases.

(23) TABLE-US-00002 TABLE 2 Comparison of Typical Physical Property Values of Liquids, Supercritical Fluids, and Gases. Property Liquid SCF Gas Density (g/mL) 1 0.3 10.sup.3 Diffusivity (cm2/s) 5 10.sup.6 10.sup.3 0.1 Viscosity (Pa .Math. s) 10.sup.3 10.sup.4 10.sup.5
Likewise, near critical refers to the conditions at which either the temperature or pressure of at least the alcohol species or CO.sub.2 gas is below but within 150K (e.g., within 50-100K), or 220 psi (e.g., within 30-150 psi) of their respective critical points. It is believed that as temperatures and pressures reach near critical, critical or supercritical conditions, the solubility of the reagents are enhanced, which promotes the esterification reaction. In other words, the CO.sub.2 gas, alcohol, and acid species are better able to interact under near critical, critical or supercritical conditions than under less rigorous conditions. The reaction does not require that both the alcohol species and CO.sub.2 gas be at near-critical, critical or supercritical conditions; rather, the reaction is operative as long as either one of the species satisfies such a condition.

(24) If the present esterification reactions are operated at higher temperatures and greater pressures, up to about 250 C. and about 3,000 psi (gauge), respectively, for reaction times of up to about 10 or 12 hours, one can produce significant amounts of ester product at relatively greater selectivity and level of purity within a shorter reaction time than before, which was about 18-20 hours. At lower operational temperatures (<190 C.), formation of monoester molecules of polycarboxylic acids is more prevalent, while reactions at temperatures 190 C. or 195 C., will convert preferentially the polycarboxylic acids to diesters. By selecting a temperature in a higher range from about 190 C. or 195 C. or 200 C. to about 245 C. or 250 C., one can preferentially drive the reaction to a greater rate of diester conversion. The esterification can yield a minimum of about 50%, desirably about 65% or 70%, of a diester of the carboxylic acid. Reactions that are performed at or near supercritical operating conditions tend to produce better results. When operated at or near critical conditions of about 230 C. or about 240 C. for methanol and about 31 C./1000 psi for CO.sub.2, one is able to achieve conversions rates of about 90% or better, typically about 93% or 95%. One can achieve greater yields by adjusting the permutations of different combinations of temperature and reaction times (e.g., higher temperatures and shorter reaction times (e.g., less than 10 or 12 hours, between 4 and 8 hours) or vice versa), which can be an advantage over current approaches. With optimization, esterification conducted at 250 C. under either the same or greater CO.sub.2 pressure, the yield would be nearly quantitative (i.e., 95% yield), for example, up to about 98%, 99%, or 99.9% conversion.

(25) As the accompanying Examples will show, variation in reaction conditions suggests that one can generate more diester product with higher temperatures and/or protracted reaction times. As stated before, however, different permutations in temperature can influence the duration of the esterification reactions to produce the same amount of ester product. The reactions according to the present method are not conducive to a significant degree of side product formation; hence one can avoid cyclization of the carboxylic acids and other starting reagents. Potential dangers of decarboxylization at high temperatures (i.e., >145 C. or >150 C.) are not observed in the present method.

(26) Using an amount of the alcohol solvent in excess of the carboxylic acid, one can produce a very clean esterification. The present synthesis process produces very clean ester products at about 70%-72% initial purity, without generation of significant amounts of side products such as low molecular weight acidsacetic or formic acidmolecular rearrangements or cyclic products, which one could normally find in standard acid catalyzed esterification at high temperatures. The esters can be refined to achieve about 90-98% purity. The purification can be accomplished, for instance, by means of crystallization, chromatography, or distillation.

(27) Typically, the resulting ester products can be either monoesters or diesters, or form a mixture of both. One can control the reaction to drive the esterification toward either one ester form or another. For instance, one may select an operational temperature and pressure that preferentially drives the esterification reaction towards formation of diester molecules. Likewise, one can control whether esters are formed from either a single carboxylic acid species (e.g., succinic acid) or a mixture of multiple different kinds carboxylic acids (e.g., acetic, citric, lactic, malic, maleic, succinic acids) that may be present and derivable from fermentation broth. In other words, one can use a variety of different kinds of carboxylic acids in accord with the present esterification reaction to produce a variety of different esters. These esters, in turn, can be isolated, further modified in downstream chemical processes and converted, in certain embodiments, into useful compounds such as for pharmaceutical, cosmetic, food or feed ingredient, polymer materials or biofuels. For instance, succinic esters can be converted into a polymer, such as polybutylene succinate (PBS).

(28) In the present esterification process, both the catalyst (CO.sub.2) and the esterification reagent (alcohol) are present in large excess relative to the amount of free carboxylic acid. CO.sub.2 should be in the gas phase during the reaction phase, regardless of its origin (e.g., gas tank or dry ice), as the reaction is conducted at high temperatures. Addition of solid CO.sub.2 is strategic in the case where sealed pressure reactors are used, in that it allows for slow sublimation of gaseous CO.sub.2 formation as the reaction apparatus is being assembled. This can minimize CO.sub.2 loss. In a CO.sub.2 (i.e., CO.sub.2-containing) atmosphere, the concentration of CO.sub.2 in the reaction atmosphere can be at least 10% or 15% by volume, favorably about 25% or 30%, preferably greater than 50%. For better reaction results, the concentration of CO.sub.2 should be maximized. Desirable concentrations of CO.sub.2 are from about 75% or 80% to about 99.9% by volume, typically between about 85% and about 98%. Nitrogen (N.sub.2) gas or air is permissible in the reactor, but preferably the concentration of gases other than CO.sub.2 is kept at either a minor percentage (<50%) or de minimis amount.

(29) Any liquid alcohol with an R-group of C.sub.1-C.sub.20 can serve as the solvent reagent or first alcohol species. The R-group can be saturated, unsaturated, or aromatic. A mixture of different kinds of alcohols (e.g., C.sub.1-C.sub.12) can also be used in the reaction, but will produce a corresponding mixture of different esters depending on the particular R-group. Certain lower alcohol species with C.sub.1-C.sub.6 alkyl groups are preferred as the reagent in the first esterification with CO.sub.2 in view of their common availability, inexpensiveness, and mechanistic simplicity in the esterification reaction. Further, alcohols such as methanol, ethanol, propanol, or butanol are preferred because of parameters such as their comparatively simple structure and that the reactions are more easily controlled with respect to the supercritical, critical or near critical temperatures and pressures of these alcohol species. Alternatively, in some embodiments, the alcohol can also be a C.sub.2-C.sub.6-diol. Esterification with a diol can generate monomers or low molecular weight oligomers that can be readily polymerized.

(30) One can use a variety of different carboxylic acids, for example, selected from: a) monocarboxylic acids: formic acid, acetic acid, propionic acid, lactic acid, butyric acid, isobutyric acid, valeric acid, hexanoic acid, heptanoic acid, decanoic acid, lauric acid, myristic acid, and C.sub.15-C.sub.18 fatty acids; b) dicarboxylic acids: fumaric acid, itaconic acid, malic acid, succinic acid, maleic acid, malonic acid, glutaric acid, glucaric acid, oxalic acid, adipic acid, pimelic acid, suberic acid, azelaic acid, sebacic acid, dodecanedioic acid, glutaconic acid, ortho-phthalic acid, isophthalic acid, terephthalic acid; or c) tricarboxylic acids: citric acid, isocitric acid, aconitic acid, tricarballylic acid, and trimesic acid. The carboxylic acids can include a mix of associated alkali or alkaline earth metal (e.g., sodium, potassium, or magnesium) salts of these carboxylic acids. Desirably, the acid is a dicarboyxlic or tricarboxylic acid.

B

(31) The present esterification process can be integrated into fermentation-based production of carbon chain feedstocks and to provide a more convenient method of generating esters from carboxylic acids derived from a renewable source. The process can reduce the amount of waste by means of recycling of by-products back into the fermentation broth, either in a continuous or batch process. We have also found that in the present esterification process, when free carboxylic acid is reacted with an alcohol and CO.sub.2 absent any other acid catalyst, the free protonated form of the carboxylic acids has greater solubility in the alcohol solvent than their corresponding salts. Performed under similar reaction conditions, the esterification reaction using the free carboxylic acid as a reagent will yield about 2-3 times greater amount of ester product than the reaction that uses the salt species as a reagent. This result can be seen when one compares the reaction of accompanying FIG. 4B (free acid) with that of FIG. 6A (acid salt), and in Table 4, Examples 2 and 3 (acid salt), with Examples 5 and 6 (free acid), respectively. It is believed that solubility is a factor for the difference. For instance, since the solubility of magnesium salts in methanol and ethanol are significantly better than that of calcium salts, product yield from a reaction of a calcium salt is much lower than that produced from a starting reagent of a corresponding magnesium salt.

(32) Through the distillation process one can concentrate the esters by driving off the alcohol, and then filter the by-products resultant from ester synthesis. Further distillation of a mixed-acid ester product mixture according to the boiling points of the different ester species, permits one to separate the various individual esters. For instance, Table 3 provides boiling points for a sample of common esters that may be present in an ester product mixture according to the present invention.

(33) TABLE-US-00003 TABLE 3 Boiling Points for Some Common Esters Ester Species Boiling Point ( C.) methyl-acetate 56.9 methyl-formate 32 methyl-lactate 145 dimethyl-malate 104-108 (1 mm Hg) dimethyl-succinate 200 trimethyl-citrate 176 (16 mm Hg) ethyl-acetate 77.1 ethyl-formate 54.0 ethyl-lactate 151-155 diethyl-malate 281.6 diethyl-succinate 217-218 triethyl-citrate 235 (150 mm Hg)

(34) After recovering the esters in the remaining solution, the materials are in a readily usable form and one can either distill the ester mixture to separate the different ester species and any remaining alcohol. Once the esters are recovered, one can use the monoesters as precursors for conversion into chelating agents, and the diesters as solvents.

(35) An advantage of recovering the carboxylic acids from fermentation in the form of their corresponding esters is that downstream processing of the esters is less energy intensive than the hydrogenation of the free acids. Another advantage of the present esterification process is that, one will find the present process simpler and easier, as compared to other approaches, to refine carboxylic acids for C.sub.4 chemical platforms from fermentation. It simplifies efforts to separate esters from the other insoluble materials, as well as minimizes the amount of salt that one needs to separate. In an integrated process enables one to directly esterify a combination of free acid and salts that is produced in a low-pH fermentation, in which the fermentation is operated at a pH of less than the pKa of the carboxylic acids. The process can be less energy intensive that current recovery approaches.

(36) We will now expound in more detail the concepts of the general process depicted in FIG. 2. FIG. 3 shows a schematic diagram of a downstream processing that incorporates an iteration of the present esterification process. In particular, FIG. 3 depicts an example of using succinic acid or any other kind of carboxylic acid derived from a fermentation broth is extracted and reacted with an alcohol in the presence of excess CO.sub.2 to generate esters. According to this iteration of the process, glucose, corn steep liquor, or other sugars, and Mg(OH).sub.2/NaOH are introduced into a fermentation reactor 1 and fermented 2 to produce succinic acid and its sodium or magnesium salt. A fermentation broth liquid containing a mixture of carboxylic acids, salts, and other by-products 4 is filtered 6 to remove cell mass 8 and other insoluble matter. The fermentation is performed at a low pH value, in which one starts at a higher pH (e.g., pH 7 or 8) and during the course of the fermentation, the pH value drops to about 2-3. One will produce a mixture of salts and free acid present, for example, in a ratio range of about 9:1 w/w to 7:3 w/w of salt to acid. The fermentation broth is retrieved from a fermentation reactor at a pH value of less than the pKa of the carboxylic acids, (e.g., pH 5). Typically, the fermentation broth is at a pH value in a range between about 1.5 and about 4.5.

(37) The broth extract is then dried 8 to a powder. When drying the mixed acid filtrate should remove as much water as possible. The drying step can be accomplished, for instance, by means of spray drying, drum drying, or cryodesiccation. As with esterification in general, relatively low water content is desired, otherwise the reversible reaction will tend to hydrolyze back to the dicarboxylic acid. In the present process, a maximum residual moisture content of about 5% by weight should be maintained. One would expect an increase in ester yield of up to about 98 or 99% with samples that contain less than 3% wt. of water.

(38) The dried powder (average moisture content between about 1 wt. % and 5 wt. %, desirably 3 wt. %) is then reacted 12 with an alcohol 14 which serves as an alkylating agent, in excess CO.sub.2 at a temperature between about 180 C. to about 250 C. for a duration of about 4 hours or more to esterify the carboxylic acids. In this example, succinic acid is reacted in methanol and CO.sub.2 to generate dimethyl succinate. Along with the free carboxylic acid, any remaining free amino acids which were in the fermentation broth are also esterified.

(39) One can also produce various precursor chemicals by subjecting the ester mixture to hydrogenation. One can produce a variety of compounds, including for example: 1,4-butane-diol (BDO), tetrahydrofuran (THF), -butyrolactone (GBL), or N-Methyl-2-pyrrolidone (NMP), which in turn can be further modified to other useful compounds, by means of hydrogenation processes such as described in U.S. Pat. No. 4,584,419A (relating to process for the production of 1,4-butane-diol involving the hydrogenation of a di(C.sub.1 to C.sub.3 alkyl) ester of a C.sub.4 dicarboxylic acid); UK Patent Application No. GB2207914A (relating to a process for production of a mixture of butane 1,4-diol. -butyrolactone, and tetrahydrofuran from maleate and fumerate); International Patent Application Nos. WO8800937A (relating to a process for the co-production of butane-1,4-diol and -butyrolactone by means of hydrogenation of dialkyl maleate) or WO 82/03854 (relating to a process for hydrogenolysis of a carboxylic acid ester), the content of each of the preceding patent disclosures is incorporated herein in its entirety by reference.

(40) As the example illustrates in FIG. 3, when reacted with methanol in accord with the reaction temperatures and pressure parameters defined above, succinic acid esterified to produce dimethyl succinate (as predominant product), NaHCO.sub.3, MgCO.sub.3/Mg(HCO.sub.3).sub.2 and excess methanol 16. The dimethyl succinate and methanol 18 are separated from NaHCO.sub.3 and MgCO.sub.3 20. The carbonates, unlike CaSO.sub.4, can be recycled 22 back into the reactor 1, either for a continuous process or in a fresh batch process. The dimethyl succinate and methanol are further separated 24 from each other with the methanol 7 being recycled 26. Subsequently, the dimethyl succinate 28 can be hydrogenated 30 into a variety of different chemical products 32, including for instance: 1,4-butane-ldiol (BDO), tetrahydrofuran (THF), -butyrolactone (GBL), or N-methyl-2-pyrrolidone (NMP).

(41) Another advantage of the present process is that it can simplify the transport and processing of crops for fermentation products. For instance, with a dried fermentation broth powder one is freed from issues associated with working with wet or liquid stock. A dried fermentation broth powder can be more economically shipped to a location different from where the fermentation broth is made or sourced. This will enable the reaction for ester synthesis to be performed at a remote location different from where the fermentation broth is sourced, and expand the geography of where the final processing facilities can be situated.

(42) Hence, we also envision that the esterification process described herein can be integrated into a method for processing an agricultural product or biomass. The method involves obtaining carbohydrates from the agricultural product or biomass, fermenting the carbohydrates to produce a fermentation broth, drying the fermentation broth to produce a fermentation broth powder, and transporting the fermentation broth powder to a second processing site. This second site can be located closer to a source of demand for a product derivable from the broth powder, which can be esterified and/or otherwise processed at the second site to produce a product therefrom.

C

(43) In another aspect, the present process for recovering and converting organic acids from a fermentation broth may be incorporated as part of a broader process for making esters and polymeric derivative compounds, such as those that exhibit improved barrier properties over conventional plastic materials.

(44) In an embodiment, the process is used to recover and convert a carboxylic acid or a furanic molecule. The process involves: a) converting an aldose sugar to a sugar acid either by a chemical or biological means; b) bio-transforming said sugar acid to a keto-acid intermediate in a solution; c) adjusting pH value of the solution containing the keto-acid intermediates to a pH of less than 5 so as to generate free acids; and d) reacting the free acids with an alcohol and CO.sub.2 to generate an ester of the carboxylic acid, keto-acid intermediate, or furanic molecule. The process may further include drying the solution containing the keto-acid intermediate or furanic molecule.

(45) The present process is illustrated generally in Scheme 1 and 2, which show respectively the conversion of a generic hexose and pentose sugar to their respective aldaric acids, aldonic acids, and uronic acids. These three kinds of sugar acids are subject subsequently to bio-transformation into a keto-acid intermediate that in some species can cyclize to form a mono or disubstituted furanic molecule (i.e., a furanic precursor or body) (e.g., furan dicarboxylic acid (FDCA), formyl furan carboxylic acid (FFCA) hydroxymethyl furan carboxylic acid (HMFA) from hexoses, furoic acid (FA) from pentoses). As used herein, the terms bio-transformation, bio-transforming, or bio-transformrefers to a process by which a starting material is chemically modified or converted into a desired product by means of using a catalyst derived from a biological source (e.g., free or supported enzymes, or whole cells). As used herein, the term keto-acid intermediate refers to an organic molecule that has a methylene (methane-diyl) carbon atom adjacent to a ketone functional group. The term furanic molecule as used herein refers to is an organic molecule having a 5-carbon heterocycle.

(46) The aldose sugar can be converted to a sugar acid according to an oxidative operation using either a chemical means, such as either nitric acid or a noble metallic catalyst, or a biological means (i.e., a biological organism or bio-transformation). The sugar acid is bio-transformed to a keto-acid intermediate using one or more enzymes selected from an enolase superfamily. For example, the enzyme (dehydratase) can be at least: a glucarate dehydratase, gluconate dehydratase, altronate dehydratase, or a mixture thereof.

(47) In particular embodiments, one may use biological organisms that can be identified for their enzymatic functionality. For instance, one can identify glucarate dehydratase homologs using BLAST (Basic Local Alignment Search Tool). Enzymes that can catalyze the dehydration of glucarate can be identified from ascomycetes (e.g., fusarium, Aspergillus, verricillium), proteo-bacteria (e.g., E. coli salmonella, Burkholderia, Rhizobium, Agrobacterium, Actinobacteria), or high G+C rich organisms (e.g., Streptomyces. Rhodococcus, Arthrobacter, Acidobacteria). In another example, gluconate dehydratase homologs can be identified using BLAST. Particular enzymes that can catalyze the dehydration of gluconate can be selected from archea (e.g., Thermoproteus tenax, Sulfolobus solfataricus), halophiles (e.g., Halarchaeum acidiphilum), or bacteria (e.g., Streptomyces, Norcardia, Pseudomonas, Salmonella, Klebsiella, Burkholderia). This should not be considered an exhaustive listing. Other organisms that can provide similar dehydratase function should also be considered within the scope of the present system.

(48) The pH value of a solution containing keto-acid intermediates and/or furanic bodies is adjusted to a pH of less than 5. According to an embodiment, one can convert the aldonic, aldaric, and uronic acids to furanic esters (e.g., hydroxymethyl furoic methyl ester, 2,5-furandicarboxylic dimethyl ester (FDME), or 5-formyl furan carboxylic methyl ester) or other species, which can be used as precursors for polymers or other uses.

(49) In accord with the present invention, hexoses include: allose, altrose, glucose, mannose, gulose, idose, galactose, and talose. Pentoses include: ribose, arabinose, xylose, and lyxose. Hence, the particular a) aldaric acids, b) aldonic acids, or c) uronic acids of the hexose or pentose sugars can include respectively: a) hexose-derived: allaric acid, altraric acid, glucaric acid, galactaric acid, mannaric acid, gularic acid, idaric acid, and talaric acid; pentose-derived: xylaric acid, lyxaric acid, arabinaric acid, and ribaric acid; b) hexose-derived: allonic acid, altronic acid, gluconic acid, galactonic acid, mannonic acid, gulonic acid, idonic acid, and talonic acid; pentose-derived: xylonic acid, lyxonic acid, arabonic acid, and ribonic acid; and c) hexose-derived: alluronic acid, altruronic acid, glucuronic acid, galacturonic acid, mannuronic acid, guluronic acid, iduronic acid, and taluronic acid; pentose-derived: xyluronic acid, lyxuronic acid, araburonic acid, and riburonic acid.

(50) ##STR00001##

(51) ##STR00002##

(52) An example of the process is depicted in Scheme 3, which shows the conversion of D-glucose to D-gluconic acid, D-glucaric acid, and D-glucuronic acid. According to a first reaction pathway of the process, gluconic acid biotransforms to a keto-acid intermediate (2-keto-3-deoxy gluconic acid) that can cyclize to form a furanic molecule HMFA, which is esterified finally to form hydroxymethyl furoic acid methyl ether. The keto-acid. In a second pathway of the process, glucaric acid biotransforms to 5-keto-4-deoxy glucaric acid and/or FDCA, before being esterified to form 2,5-furandicarboxylic acid dimethyl esters in high yields. Furan dicarboxylic acid dimethyl ester (FDME) is used as precursor for the polymers with better barrier properties. In a third pathway of the process, glucuronic acid converts to 2-dehydro-3-deoxy gluconate and/or FFCA, before being esterified to form 5-formyl furan carboxylic acid methyl ester.

(53) ##STR00003## ##STR00004##
Certain particular exemplar mechanisms by which to achieve process operations for oxidation and other conversions are listed in the accompanying key. Several other process mechanisms and conversional protocols can be used to advance the several transformation steps according the present process. These protocols include, for example, research at the Massachusetts Institute of Technology (WO 2009145838) that has shown the conversion of glucose to glucaric acid using a engineered Escherichia coli expressing myo-inositol-1-phosphate synthase and myo-inositol oxygenase. The yield of glucaric acid from this construct is 2.5 g/L These yields though promising make it impractical for industrial production of glucaric acid. Another is a method for oxidizing glucose to glucaric acid acid using Psedogluconobacter as catalyst as described in US Patent Application Publication No. 2015/0152448. GB 957985 details a process for converting glucaric acid to FDCA using concentrated sulfuric acid. Stepwise heating of glucaric acid in sulfuric acid from 85 C. to 135 C. leads to formation of FDCA. However, use of concentrated sulfuric acid makes the process unattractive for large scale commercial production. The contents of patents and other literature references cited are incorporated herein by reference.

Section IIExamples

A. Carboxylic Acid Recovery & Esterification

(54) Examples prepared according to the present esterification method are integrated into a process for isolating free carboxylic acid from a fermentation broth. The method involves generally the following steps: a) filtering a crude fermentation broth to remove cell mass and other biological debris from a fermentation broth; b) desiccating the fermentation broth; c) reacting the dried fermentation broth with an excess of methanol (CH.sub.3OH) or ethanol (C.sub.2H.sub.5OH) and carbon dioxide (CO.sub.2) at a temperature about 150 C. up to the near critical or critical temperature and under near critical or critical pressure of the alcohol and/or CO.sub.2 reagents, to produce a mixture of monoesters and diesters and carbonate (NaHCO.sub.3/MgCO.sub.3); d) filtering the reaction product to remove by-products; and e) purifying by distilling the esters.

(55) The fermentation broth filtrate was dried to remove all or nearly all of the water to produce a powder of mixed organics. Using a spray dryer or drum dryer, one aerosolizes the raw solution containing mixed carboxylic acids to desiccate into a powder. The desiccated powder is suspended in an alcohol solvent. The powder reacts with the alcohol according to the conditions described herein to esterify into either monoesters or diesters.

(56) Each of the following examples was performed according to the following general protocol, except for variations in reaction temperature, pressure, time, and/or acid species as indicated, mutatis mutandis. Ten grams of freeze-dried succinic acid fermentation broth (off-white powder) and 300 g of methanol were charged to a 1 L stainless steel vessel, jacketed, and fixed to a Parr reactor. While stirring mechanically at 1100 rpm, the internal headspace of the reactor vessel was purged with N.sub.2 and then pressurized initially to 400 psi with CO.sub.2 and heated to 180 C. for 5 hours. The internal pressure was observed to be 1650 psi at 180 C. After the reaction time, the reactor body was cooled in a water bath until reaching room temperature and pressure released. The heterogeneous mixture was then filtered and solids were dried overnight under vacuum. Samples of the solid material and the solution were analysis quantitatively using gas-chromatography/mass spectrometry (GC/MS). The yield of dimethyl succinate was determined to be 31.9% with more than 95% of the available magnesium succinate consumed in the reaction. The remaining balance of product included the corresponding monoesters as the greater part, and was in a range of about 60% to about 65%.

(57) As the reactions depicted in the accompanying figures and tables show, modification and selection of certain temperature and pressure parameters causes reactions to yield preferentially more of the diester compounds. In certain examples of the present process, the esterification reactions yielded more than 50%, typically more than 70% or 80% di-akyl succinate or malate. As stated before, the unreacted materials and the undesired products are recycled into the fermentation reactor. Subsequent separation of the mono-esters and di-esters was achieved by crystallization.

(58) FIG. 4 shows a series of esterification reactions which summarize CO.sub.2-assisted esterification of free succinic acid in various alcohols. FIG. 4A shows succinic acid reacted with methanol in 400 psi CO.sub.2 gas, at 150 C. for 5 hours, which achieved a yield of about 37% dimethyl succinate. When the operational temperature was increased to 180 C. in the reaction of FIG. 4B and all other parameters kept the same as in FIG. 4A, the amount of dimethyl succinate yield increases more than two-fold to about 81.2%.

(59) FIG. 4C represents free succinic acid reaction at 180 C. under present operational conditions in ethanol, which generates diethyl succinate in good yield of about 60.8%. In FIG. 4D, free succinic acid was reacted at 180 C. under operational conditions in n-butanol, which generates dibutyl succinate at about 52.2% yield. These examples demonstrate the versatility of the present esterification reaction in view of different kinds of alcohols.

(60) FIG. 5 shows examples of CO.sub.2-assisted esterification of other kinds of carboxylic polyacids. In FIGS. 5A and 5B, succinic acid was substituted respectively with citric acid, a tricarboxylic acid, and malic acid. The yield of trimethylcitrate was reasonable at about 20.1%, demonstrating that the CO.sub.2-assisted protocol can be applied to tricarboxylic acids. The yield of the dimethyl analogue of malic acid was good at about 84.3%. Hence, the new method of esterification is feasible for general use with other acids.

(61) Table 4 summarizes results of several reactions that were performed according to the esterification method of the present disclosure as depicted in FIGS. 6, 7, and 8. Each set of examples is arranged in terms of a variation of an operational condition under which the reaction was performed: A) temperature, B) pressure, and C) reaction time. In each of the examples, succinic acid from a fermentation broth is used as the substrate. The filtered clarified broth containing free acid and salts are dried and later reacted with methanol and CO.sub.2 in solution. (As the reactions are heated, the actual operational temperatures and pressures within the reactor vessel will exceed the initial temperatures and pressures provided herein.)

(62) In the three examples of Set A, we carried out the reaction for 5 hours at an initial CO.sub.2 pressure of 400 psi, under different temperatures: Ex. A-1 at 180 C., Ex. A-2 at 210 C., and Ex. A-3 at 230 C. The percent conversion of acid to its corresponding diester increased with higher operational temperature. FIG. 6 shows the effect of varying temperature in a series of esterification reactions of succinic acid and its salt. In FIG. 6A, the esterification of succinic acid is performed at a temperature of about 180 C., over a period of 5 hours. The reaction produced about 13.9% yield of dimethyl succinate. FIG. 6B shows the same reaction as in FIG. 6A, when the reaction time held constant, but with the temperature raised to about 210 C., which yields about 42.9%. FIG. 6C shows a reaction at 230 C. and yields about 72.4%. This suggests that as the temperature increases, the reaction kinetics drives toward a more complete reaction of the acid and alkylating agent, and a greater yield of the dialkyl-ester. Reactions performed at or near critical temperature and/or pressure conditions can produce about 95%, likely 97% or 98%, conversion.

(63) In Set B and FIG. 7, we performed the esterification reaction for 5 hours at an initial temperature of 180 C., and varied the initial CO.sub.2 gas pressures: Ex. B-1 at 400 psi, Ex. B-2 at 500 psi, and Ex. B-3 at 600 psi. The percent conversion of acid to its corresponding diester was moderate, and the amount yield did not show significant difference statistically. The initial CO.sub.2 gas pressure in the reactor did not exert much effect in conversion of the acid to its diester, but the operational pressures in the reactor during the reaction suggest an effect on yields.

(64) In Set C and FIG. 8, we performed the esterification reaction at a constant pressure and temperature but varied the duration of the reaction. Ex. C-1 at 5 hours, Ex. C-2 at 2 hours, and Ex. C-3 at 0.5 hours. The examples shown in FIG. 8 suggest that a greater amount of diester was converted from the acid with increased reaction time.

(65) FIG. 9 shows a first set of CO.sub.2-assisted esterification reactions using a concentration of succinate salts of about 4% w/w, which are presented as Examples 1-3 in Table 5. In Examples 1 and 2, succinic acid and its magnesium (Mg.sup.2+) salt was reacted in methanol and ethanol at 210 C. and 180 C., respectively, for a reaction time of 5 hours. The reactions produced about 33% dimethyl succinate and about 1 diethyl succinate, respectively. Methanol exhibits a greater capacity to dissolve the succinate salt than ethanol. Magnesium succinate exhibits a reasonable level of solubility in methanol, while it exhibits limited solubility in ethanol, even at high temperatures. Hence, the yield of diethylsuccinate was negligible. Example 3 shows a reaction using calcium (Ca.sup.2+) succinate, at 180 C., over 5 hours. The reaction yields only about 1.33% of the corresponding dimethylsuccinate. Relatively low conversion rates in Examples 2 and 3, also highlights the solubility difference between corresponding alkali earth salts. The calcium succinate salt is insoluble in methanol, even at high temperatures. The methanol to salt molar ratio used in the CO.sub.2 experiments was approximately 110:1 for methanol to magnesium succinate. Likewise, the ratio was about 100:1 for methanol to the other carboxylic acids.

(66) TABLE-US-00004 TABLE 4 Variations in Reaction Conditions Reaction Time Temperature Initial CO.sub.2 % Conversion Example Substrate Alcohol (h) ( C.) pressure (psi) to Diester A 1 Succinic acid Methanol 5 180 400 13.9 fermentation broth, Mg.sup.2+ salt 2 Succinic acid Methanol 5 210 400 49.2 Temperature fermentation broth, Variation Mg.sup.2+ salt 3 Succinic acid Methanol 5 230 400 72.4 fermentation broth, Mg.sup.2+ salt B 1 Succinic acid Methanol 5 180 400 13.9 fermentation broth, Mg.sup.2+ salt 2 Succinic acid Methanol 5 180 500 11.4 Pressure fermentation broth, Variation Mg.sup.2+ salt 3 Succinic acid Methanol 5 180 600 9.6 fermentation broth, Mg.sup.2+ salt C 1 Succinic acid Methanol 5 180 400 13.9 fermentation broth, Mg.sup.2+ salt 2 Succinic acid Methanol 2 180 400 5.4 Reaction Time fermentation broth, Variation Mg.sup.2+ salt 3 Succinic acid Methanol 0.5 180 400 ND fermentation broth, Mg.sup.2+ salt

(67) TABLE-US-00005 TABLE 5 Reaction Time Temperature Initial CO.sub.2 % Conversion Example Substrate Alcohol (h) ( C.) pressure (psi) to Diester Note 1 Succinic acid, Mg.sup.2+ Methanol 5 210 400 33.4 Control salt 2 Succinic acid, Mg.sup.2+ Ethanol 5 180 400 1.0 Limited solubility salt 3 Succinic acid, Ca.sup.2+ Methanol 5 180 400 1.3 Limited solubility salt 4 Succinic acid Methanol 5 150 400 37.0 5 Succinic acid Methanol 5 180 400 81.2 6 Succinic acid Ethanol 5 180 400 60.8 7 Succinic acid 1-Butanol 5 180 400 52.2 8 Citric acid Methanol 5 180 400 20.1 9 Malic acid Methanol 5 180 400 86.3

(68) Table 5 lists results from other examples of esterification reactions according to the present method. Examples 1, 2 and 3 demonstrate the importance of substrate solubility of succinic acid as compared to the salts of succinate. Examples 4-7 is a second set of reactions in which free succinic acid was reacted in methanol, ethanol, and 1-butanol in similar fashion. Examples 8 and 9 show that reactions with other carboxylic acids, such as citric acid and malic acid can achieve relatively good yields of about 20% and 86%, respectively.

(69) Free succinic acid reacts readily with the alcohols, since it is completely soluble in methanol, ethanol, butanol, and other alcohols up to and including octanol (C.sub.8 alcohol). In Examples 6 and 7, succinic acid reacted in ethanol and 1-butanol, yields 60.8% and 52.2% conversion, respectively.

(70) The solubility of carboxylic salts in a particular solvent can have an influence on the esterification process. The greater solubility of free-acid permits a greater reactivity than the carboxylate salt, which lacks an acid functionality. Accordingly, the yields of the corresponding esters tend to be significantly greater than the control samples when comparing the two sets of reactions. The reactions of Examples 4-7 yielded significantly greater amounts of corresponding diesters than that of Examples 1-3. The carboxylic acid itself may be sufficient to catalyze the esterification reaction under the present operational temperature and pressure conditions. One can adjust the substrate solubility for successful esterification according to the present method.

B. Biotransformation of Sugar Acids & Esterification

(71) One can identify various kinds of biological organisms that will transform a sugar or sugar acid to a keto-acid or furanic molecule. Some of these organisms, as mentioned above, derive from dehydratase homologs identified using BLAST (Basic Local Alignment Search Tool). For instance, enzymes that can catalyze the dehydration of glucarate can be selected from ascomycetes (e.g., fusarium, Aspergillus, verticillium), proteo-bacteria (e.g., E. coli salmonella, Burkholderia, Rhizobium, Agrobacterium, Actinobacteria), or high G+C rich organisms (e.g., Streptomyces. Rhodococcus, Arthrobacter, Acidobacteria). In other examples, enzymes that can catalyze the dehydration of gluconate can be selected from archea (e.g., Thermoproteus tenax, Sulfolobus solfataricus), halophiles (e.g., Halarchaeum acidiphilum), bacteria (e.g., Streptomyces, Norcardia, Pseudomonas, Salmonella, Klebsiella, Burkholderia).

(72) The following example presents an illustrative embodiment of the present process for bio-transformation of sugar acids and their esterification according to the present invention.

(73) 1. Construction of Host Strain

(74) The following example uses an E. coli strainBL21(DE3)thrC-. This strain is auxotrophic for threonine biosynthesis. BL21(DE3)thrC- was generated by the successive integration of an antibiotic cassette deleting thrC and excision of the antibiotic cassette by the following steps. The thrC gene is already disrupted in an E. coli K-12 derivative in the Keio collection (Baba, T. T Ara, M Hasegawa, Y Takai, Y Okumura, M Baba, K A Datsenko, M Tomita, B L Wanner, and H Mori. Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol Syst Biol. 2006; 2:2006.0008). In this mutant, a kanamycin cassette has replaced the native thrC gene and is flanked by DNA sequences recognized by the FLP recombinase, an enzyme capable of excising the cassette. A P1 phage lysate generated on this thrC::km.sup.R strain was used to transduce kanamycin resistance into BL21 (DE3). The transductants were transformed with a temperature sensitive ampicillin resistant plasmid pCP20 (see, Cherepanov, P P and W Wackernagel. Gene disruption in Escherichia coli; Tc.sup.R and Km.sup.R cassettes with the option of Flp-catalyzed excision of the antibiotic-resistance determinant. Gene 158:9-1) to transiently introduce the FLP recombinase and isolates that were sensitive to kanamycin and ampicillin were confirmed as being auxotrophic for threonine biosynthesis.

(75) To remove all ampicillin resistance-encoding DNA, p-3-13_pET-22b (+) was digested with DraI and DraIII restriction enzymes (New England Biolabs). The thrC gene of E. coli K-12 was amplified with primers SEQ ID No. 4 and No. 5 that appended extended homology to pET22b at the DraI and DraII cut sites. The PCR and digested p-3-13_pET-22(b)+ plasmid were assembled by means of a Gibson Assembly Master Mix (New England Biolabs). The resulting plasmid, p-3-13_pET-22(b)+thrC, was transformed into BL21(DE3)thrC- and the colonies that appeared on M9 minimal media constitute the strain designated herein ASR180.

(76) The gluc-D gene (also called ygcX) was amplified with primers sequence ID 1 and 2 (Promega Taq). The template was a synthetic nucleotide sequence ordered from IDT. The purpose of ordering the gene was to introduce a silent mutation in codon 195 that removed an NdeI restriction site. The sequence of the ordered nucleotide is Sequence ID 3; the gene proper is in lower case. The plasmid expressing epimerase in ASR180 was digested with NdeI and XhoI, as was the PCR product of gluc-D. The DNA molecules were ligated (NEB T4 ligase) and transformed into a BL21 (DE3) derivative that is deleted for thrC. The plasmid was selected for on minimal (M9) agar, and transformants were screened for gluc-D inserts by PCR and assayed for enzymatic activity.

(77) E. coli or bacillus having certain gene sequences, as shown in Seq. 1 and 2, primers to amplify for Sequence ID 3.

(78) TABLE-US-00006 SequenceID1: AGGAGATATACATatgagactcaatttacgacgcc SequenceID2: GGTGGTGGTGCTCGAGttaacgcaccatgcacgggcgc SequenceID3: AGGAGATATACATatgagttctcaatttacgacgcctgttgttactgaaa tgcaggttatcccggtggcgggtcatgacagtatgctgatgaatctgagt ggtgcacacgcaccgttctttacgcgtaatattgtgattatcaaagataa ttctggtcacactggcgtaggggaaattcccggcggcgagaaaatccgta aaacgctggaagatgcgattccgctggtggtaggtaaaacgctgggtgaa tacaaaaacgttctgacgctggtgcgtaatacttttgccgatcgtgatgc tggtgggcgcggtttgcagacatttgacctacgtaccactattcatgtag ttaccgggatagaagcggcaatgctggatctgctggggcagcatctgggg gtaaacgtggcatcgctgctgggcgatggtcaacagcgtagcgaagtcga aatgctcggttatctgttcttcgtcggtaatcgcaaagccacgccgctgc cgtatcaaagccagccggatgactcatgcgactggtatcgcctgcgtcat gaagaagcgatgacgccggatgcggtggtgcgcctggcggaagcggcTta tgaaaaatatggcttcaacgatttcaaactgaagggcggtgtactggccg gggaagaagaggccgagtctattgtggcactggcgcaacgcttcccgcag gcgcgtattacgctcgatcctaacggtgcctggtcgctgaacgaagcgat taaaatcggtaaatacctgaaaggttcgctggcttatgcagaagatccgt gtggtgcggagcaaggtttctccgggcgtgaagtgatggcagagttccgt cgcgcgacaggtctaccgactgcaaccaatatgatcgccaccgactggcg gcaaatgggccatacgctctccctgcaatccgttgatatcccgctggcgg atccgcatttctggacaatgcaaggttcggtacgtgtggcgcaaatgtgc catgaatttggcctgacctggggttcacactctaacaaccacttcgatat ttccctggcgatgtttacccatgttgccgccgctgcaccgggtaaaatta ctgctattgatacgcactggatttggcaggaaggcaatcagcgcctgacc aaagaaccgtttgagatcaaaggcgggctggtacaggtgccagaaaaacc ggggctgggtgtagaaatcgatatggatcaagtgatgaaagcccatgagc tgtatcagaaacacgggcttggcgcgcgtgacgatgcgatgggaatgcag tatctgattcctggctggacgttcgataacaagcgcccgtgcatggtgcg ttaaCTCGAGCACCACCACC
The sequence of the primer used to amplify the thrC gene with homology to pET22b at the DraIII restriction site for cloning purposes to create BL21(DE3)thrC-

(79) TABLE-US-00007 SEQIDNo.4: gaatccCACGTAGTGcggctggatacggcgggcgcacg
The sequence of the primer used to amplify the thrC gene with homology to pET22b at the DraI restriction site for cloning purposes to create BL21(DE3)thrC-

(80) TABLE-US-00008 SEQIDNo.5: gctaaTTTAAAttactgatgattcatcatcaatttacg

(81) 2. Culturing of Gluc-D Constructs.

(82) Gluc-D was cultured in shake flask. A batch process was designed using E. coli strain ASR180. M9 media was used in the flask: 5.0 g/L Dextrose; 12.8 g/L Na.sub.2HPO.sub.4.7H2O; 5.0 g/L KH.sub.2PO.sub.4; 1.0 g/L NH.sub.4Cl; 0.5 g/L NaCl; 0.3 g/L MgSO.sub.4; 0.03 g/L CaCl.sub.2; 2.6 g/L (NH.sub.4).sub.2SO.sub.4; 50 mg/L FeCl.sub.3.6H.sub.2O; and 1.8 mg/L ZnSO.sub.4.7H.sub.2O. Thiamine was aseptically added at a concentration of 0.05 g/L, 1.5 to 1.8 ml inoculum from a frozen vial was used to inoculate one 50 ml shake flask. Flasks were incubated overnight at 37 C. and 250 RPM.

(83) Overnight cultures were used to inoculate 41 L M9 medium with dextrose. The cultures were grown at 37 C. to an OD of 0.6 and protein expression was induced with IPTG. The cultures were incubated at 30 C. overnight. The cells were harvested by centrifugation and resuspended in 50 mM TrisCl with 2 mM MgSO.sub.4. The cell were lysed with Bug Buster and centrifuged to separate cell debris. The supernatant was taken for enzyme assays.

(84) 3. Enzyme Assays.

(85) Glucaric acid dehydratase assay was an epimerase assay performed at 30 C. for 4 hr. in 50 mM TrisCl buffer (pH 7.5) containing 2 mM MgSO.sub.4. 50 mM Glucaric acid and 40 g of crude lysate. The reaction was stopped by adjusting to pH 2. One unit of glucarate dehydatase activity was defined as the amount of the enzyme required to produce 1 mol of 5-keto-4-deoxyglucarate per min at pH 7.5 and 30 C. FIG. 10 shows the dehydration of glucaric acid using two clone strains (Clone 15 and 9). The two clones expressed the same enzyme and performed at similar activity levels. The amount of glucose is consumed at similar rates over a period of about 3 hours.

(86) 4. Examples of Conversion of Glucaric Acid to 5-Keto-4-Deoxy-Glucarate.

(87) Crude E. coli cell free lysate with GluD overexpressed was used to immobilize resins like Dow Duolite A568, Purolire ECR8315, 8415, and similar amino functionalized resin. A 20% glucaric acid solution was adjusted to pH 6.5 with 10 mM tris buffer and passed over a column containing immobilized GluD at 45 C. and a LHSV of 0.5 hr.sup.1. Under these conditions, the reactor effluent was most 5-keto-4-deoxy-glucarate.

(88) 5. Conversion of 5-KDG to FDME.

(89) The reactor effluent solution was then taken and adjusted to a pH of less than 5, and spray died to form a fine power. Ten grams of 5-KDG (2R,3S)-2,3-dihydroxy-5-oxohexanedioate) and 300 g of methanol were charged to a IL stainless steel vessel, jacketed, and fixed to a Parr reactor. While stirring mechanically at 1100 rpm, the internal headspace of the reactor vessel was purged with nitrogen (N.sub.2) and then pressurized initially to 400 psi with CO.sub.2 and heated to 180 C. for 5 hours. The internal pressure was observed to be 1650 psi at 180 C. After the reaction time, the reactor body was cooled in a water bath until reaching room temperature and pressure released. The heterogeneous mixture was then filtered and solids were dried overnight under vacuum. Samples of the solid material and the solution were analysis quantitatively using gas-chromatography/mass spectrometry (GC/MS). One observes the presence of dimethyl KDG and FDME in the product and all the 5-KDG was consumed in the reaction.

(90) The present invention has been described in general and in detail by way of examples. Persons of skill in the art understand that the invention is not limited necessarily to the embodiments specifically disclosed, but that modifications and variations may be made without departing from the scope of the invention as defined by the following claims or their equivalents, including other equivalent components presently known, or to be developed, which may be used within the scope of the present invention. Therefore, unless changes otherwise depart from the scope of the invention, the changes should be construed as being included herein.