TOLERANCE IN PLANTS OF SOLANUM LYCOPERSICUM TO THE TOBAMOVIRUS TOMATO BROWN RUGOSE FRUIT VIRUS (TBRFV)

20230079261 · 2023-03-16

Assignee

Inventors

Cpc classification

International classification

Abstract

The invention relates to a Solanum lycopersicum plant comprising in its genome QTLs confering to the plant an improved phenotype corresponding to foliar and/or fruit tolerance and/or resistance to Tomato Brown Rugose Fruit virus, with respect to a corresponding plant devoid of said QTLs, and wherein said QTLs are chosen from those present in the genome of a plant of the seeds HAZTBRFVRES1 NCIMB accession number 42758. The QTL are preferably characterized by defined alleles of different SNPs on chromosome 6, 9 and 11. The invention is also directed to parts of these plants with improved phenotype, as well as progeny, to the use of these plants for introgressing the improved phenotype in another genetic background, as well as to different methods for obtaining tomato plants or seeds with increased foliar and/or fruit tolerance or resistance to Tomato Brown Rugose Fruit virus.

Claims

1-31. (canceled)

32. A Solanum lycopersicum plant comprising homozygously in its genome a quantitative trait locus, QTL3, on chromosome 11, that confers to the plant an improved phenotype corresponding to foliar tolerance to Tomato Brown Rugose Fruit virus, wherein said QTL is present in the genome of a plant of the seeds HAZTBRFVRES1 NCIMB accession number 42758.

33. A S. lycopersicum plant according to claim 32, wherein said QTL3 is to be found on chromosome 11, within the chromosomal region delimited by TO-0122252 (SEQ ID NO:7) and TO-0162427 (SEQ ID NO:18).

34. A S. lycopersicum plant according to claim 32, wherein said QTL is to be found at one or more of the following loci: a) locus encompassing TO-0122252 (SEQ ID NO:7) on chromosome 11, b) locus encompassing TO-0144317 (SEQ ID NO:8) on chromosome 11, c) locus encompassing TO-0142270 (SEQ ID NO:9) on chromosome 11, d) locus encompassing TO-0142294 (SEQ ID NO:10) on chromosome 11, e) locus encompassing TO-0142303 (SEQ ID NO:11) on chromosome 11, f) locus encompassing TO-0142306 (SEQ ID NO:12) on chromosome 11, g) locus encompassing TO-0182276 (SEQ ID NO:13) on chromosome 11, h) locus encompassing TO-0181040 (SEQ ID NO:14) on chromosome 11, i) locus encompassing TO-0123057 (SEQ ID NO:15) on chromosome 11 j) locus encompassing TO-0125528 (SEQ ID NO:16) on chromosome 11, k) locus encompassing TO-0162432 (SEQ ID NO:17) on chromosome 11, and l) locus encompassing TO-0162427 (SEQ ID NO:18) on chromosome 11 and wherein said QTL is present in the genome of a plant of the seeds HAZTBRFVRES1 NCIMB accession number 42758.

35. The S. lycopersicum plant according to claim 32, characterized by the presence in the genome of said S. lycopersicum plant of at least one of the following alleles: a) allele T of TO-0122252 and/or b) allele C of TO-0144317 and/or c) allele T of TO-0142270 and/or d) allele G of TO-0142294 and/or e) allele A of TO-0142303 and/or f) allele A of TO-0142306 and/or g) allele G of TO-0182276 and/or h) allele G of TO-0181040 and/or i) allele G of TO-0123057 and/or j) allele A of TO-0125528 and/or k) allele C of TO-0162432 and/or l) allele T of TO-0162427.

36. The plant according to claim 32, wherein said plant is a progeny of seeds of HAZTBRFVRES1 (NCIMB accession number 42758).

37. The S. lycopersicum plant according to claim 32, wherein said plant further comprises in its genome a quantitative trait locus, QTL2, on chromosome 9, that confers to the plant fruit tolerance to Tomato Brown Rugose Fruit virus, wherein said QTL2 is present in the genome of a plant of the seeds HAZTBRFVRES1 NCIMB accession number 42758.

38. A S. lycopersicum plant according to claim 37, wherein said QTL2 is to be found on chromosome 9, within the chromosomal region delimited by TO-0180955 (SEQ ID NO:3) and TO-0196109 (SEQ ID NO:6).

39. A cell of a S. lycopersicum plant according to claim 32, comprising in its genome said QTL3 on chromosome 11, conferring the improved phenotype corresponding to foliar tolerance to TBRF virus.

40. Plant part of a S. lycopersicum plant according to claim 32, wherein said plant part comprises cells according to cells in their genome said QTL3 on chromosome 11, conferring the improved phenotype corresponding to foliar tolerance to TBRF virus.

41. Seed of a S. lycopersicum plant, which develops into a plant according to claim 32.

42. A method for detecting and/or selecting S. lycopersicum plants according to claim 31 having foliar tolerance to Tomato Brown Rugose Fruit virus, said method comprising detection of at least one of the following markers allele T of TO-0122252, allele C of TO-0144317, allele T of TO-0142270, allele G of TO-0142294, allele A of TO-0142303, allele A of TO-0142306, allele G of TO-0182276, allele G of TO-0181040, allele G of TO-0123057, allele A of TO-0125528, allele C of TO-0162432 and allele T of TO-0162427 in a genetic material sample of the plant to be selected.

43. A method for breeding S. lycopersicum plants having tolerance to TBRFV, comprising the steps of crossing a plant grown from the deposited seeds NCIMB 42758 or progeny thereof bearing QTL3 conferring TBRFV tolerance, with an initial S. lycopersicum plant devoid of said QTL.

44. The method of claim 43, comprising the steps of: a)crossing a plant grown from the deposited seeds NCIMB 42758, or progeny thereof, bearing QTL3 conferring TBRFV tolerance, and an initial S. lycopersicum plant devoid of said QTL, b) selecting a plant in the progeny thus obtained, bearing QTL3; c)optionally self-pollinating one or several times the plant obtained at step b) and selecting in the progeny thus obtained a plant having tolerance to TBRFV.

45. The method of claim 43, comprising the steps of: a1) crossing a plant grown from the deposited seeds NCIMB 42758 or progeny thereof, bearing QTL3 conferring TBRFV tolerance, and an initial S. lycopersicum plant, devoid of said QTL, thus generating the F1 population, a2) selfing the F1 population to create F2 population, b) selecting individuals in the progeny thus obtained having tolerance to TBRFV.

46. The method of claim 44, wherein SNPs markers are used in steps b) and/or c) for selecting plants bearing QTL3 conferring TBRFV tolerance.

47. The method according to claim 44, wherein the selection is carried out by detection of at least one of the following alleles: allele T of TO-0122252, allele C of TO-0144317, allele T of TO-0142270, allele G of TO-0142294, allele A of TO-0142303, allele A of TO-0142306, allele G of TO-0182276, allele G of TO-0181040, allele G of TO-0123057, allele A of TO-0125528, allele C of TO-0162432 and allele T of TO-0162427.

48. A S. lycopersicum plant obtained by the method according to claim 43, wherein said plant comprises QTL3 conferring TBRFV tolerance.

49. A method for genotyping a S. lycopersicum plant or tomato germplasm, for the presence of at least one genetic marker associated with tolerance to TBRFV infection, comprising the step of detecting in the genome of the tested plant or germplasm of more than 5 nucleic acids, each one comprising at least one of allele T of TO-0122252, allele C of TO-0144317, allele T of TO-0142270, allele G of TO-0142294, allele A of TO-0142303, allele A of TO-0142306, allele G of TO-0182276, allele G of TO-0181040, allele G of TO-0123057, allele A of TO-0125528, allele C of TO-0162432 and/or allele T of TO-0162427.

Description

LEGEND OF FIGURES

[0194] FIG. 1: p-value plot of QTL associated to fruit TBRFV resistance based on F2 population of HAZ1×HAZ2.

[0195] This figure is the Manhattan plot showing mapping results of the bi parental mapping population regarding (HAZ1×HAZ2, see example 4) the fruit tolerance and/or resistance to Tomato Brown Rugose Fruit virus. Vertical axis (y-axis) shows the −log10 (p-value) and horizontal axis (x-axis) represents all SNPs by their positions (in physical distances bp) by chromosomes along the physical map.

[0196] FIG. 2: p-value plot of QTL associated to foliar TBRFV resistance based on F2 population of HAZ1×HAZ2.

[0197] This figure is the Manhattan plot showing mapping results of the bi parental mapping population (HAZ1×HAZ2, see example 4) regarding the leaf tolerance and/or resistance to Tomato Brown Rugose Fruit virus. Vertical axis (y-axis) shows the −log10 (p-value) and horizontal axis (x-axis) represents all SNPs by their positions (in physical distances bp) by chromosomes along the physical map.

[0198] FIG. 3: p-value plot of QTL associated to foliar TBRFV resistance based on F2 population of HAZ3×HAZ4

[0199] This figure is the Manhattan plot showing mapping results of the bi parental mapping population (HAZ3×HAZ4, see example 6) regarding the leaf tolerance and/or resistance to Tomato Brown Rugose Fruit virus. Vertical axis (y-axis) shows the −log10 (p-value) and horizontal axis (x-axis) represents all SNPs by their positions (in physical distances bp) by chromosomes along the physical map.

EXAMPLES

Example 1: Collection and Identification of the Tomato Brown Rugose Fruit Virus:

[0200] The present inventors have made a collection of different isolates from different Israeli production areas (North, Center and South Israel) infected by the Tomato Brown Rugose Fruit virus: 7 different isolates were collected and analyzed according to the protocols described in Salem et al. Sequences comparisons to the Jordanian Tomato Brown Rugose fruit virus showed that all Israeli isolates were identical to the Jordanian one, confirming the same virus was present in both countries.

Example 2: Identification of Resistance

[0201] The inventors have screened their tomato breeding genetic material in a naturally infected greenhouse in the Southern part of Israel, in the Bsor region, which is the major tomato crop production area in Israel. About 443 different tomatoes were screened. Each tomato was planted in two repeats, 10 μlant per repeat in different locations in the greenhouse.

[0202] Each row in the greenhouse contained 120 μlants. At each row, a susceptible line control of 10 μlants was planted. In order to spread the controls in the different places in the greenhouse, the controls were positioned in diagonal along the different rows in the greenhouse.

[0203] In this screening, a few tomatoes showed no foliar TBRFV symptoms and very little fruit symptoms. Out of these, two symptomless tomatoes and two susceptible tomatoes were chosen for the next stage.

[0204] The results of these experiments are shown in table no. 1. The 2 susceptible tomatoes that have been chosen are representative of the 441 susceptible tomatoes in the sense that they are considered susceptible to the Tomato Brown Rugose fruit virus.

[0205] Hazera no. 1 (or HAZ1) is an indeterminate tomato of the loose type with regular, round and dark red fruits of about 170 gr The plant has a dark green foliage and is resistant to Verticillium dahlia, Meloidogyne incognita, Tomato yellow leaf curl virus and Stemphylium solani.

[0206] Hazera no. 2 (or HAZ2) is an indeterminate tomato of the beef type with regular and intermediate flat, dark intense red fruits of about 280 gr The plant is resistant to Verticillium dahlia, Fusarium oxysporum f. sp. lycopersici 1,2, Tomato mosaic virus, Fulvia fulva, Meloidogyne incognita, Tomato spotted wilt virus.

[0207] Hazera no. 3 (or HAZ3) is an indeterminate tomato of the beef type with intermediate flat red fruits of about 270 gr The plant is resistant to Tomato spotted wilt virus, Verticillium dahlia Fusarium oxysporum f.sp. lycopersici 1,2 and Stemphylium solani.

[0208] Hazera no. 4 (or HAZ4) is an indeterminate tomato of the minibeef type with round red fruits of about 180 gr The plant is resistant to Tobacco mosaic virus, Tomato yellow leaf curl virus, Cladosporium fulvum (CF9) Verticillium dahlia and Fusarium oxysporum f.sp. lycopersici 1,2.

TABLE-US-00001 TABLE 1 plants tested for resistance to TBRFV: Nb Nb of plants of plants with without significant TBRFV TBRFV Total foliar foliar number of and fruit and fruit Tomato plants symptoms symptoms Conclusion Hazera no. 1 20 20 0 Tolerant/Resistant Hazera no. 2 20 0 20 Susceptible Hazera no. 3 20 20 0 Tolerant/Resistant Hazera no. 4 20 0 20 Susceptible

Example 3: Confirmation of Resistance

[0209] In order to better understand the genetics underlying the tolerance/resistance phenotype as well as to validate the leads identified during the first screening, the present inventors have made a second screening under similar conditions as the ones of the first screening: each row in the greenhouses under natural infection contained 120 μlants and at each row, a susceptible control (10 μlants) was planted. In order to spread the controls in the different places in the greenhouse, the controls were positioned in diagonal along the different rows in the greenhouse.

[0210] In addition to the resistant tomatoes identified during the first screening, their F1 obtained from the cross of a resistant plant with a susceptible line were also included in the trial, as well as their F2s:

[0211] Table 2 shows the result of the second screening regarding the foliar evaluation: plants were considered as susceptible as soon as they had some mosaic and distortions in the apex of the shoots. Tolerant/Resistant plants have no symptoms in the apex of the shoots.

TABLE-US-00002 TABLE 2 Foliar evaluation of second screening Number Number of plants of plants with without significant Total TBRFV TBRFV number of foliar foliar Tomato plants symptoms symptoms Conclusion Hazera no. 1 20 20 0 Tolerant/ Resistant Hazera no. 2 20 0 20 Susceptible F1 Hazera no. 20 0 20 Susceptible 1 × Hazera no. 2 F2 Hazera no. 247 60 187 Segregating 1 × Hazera no. 2 Hazera no. 3 20 20 0 Tolerant/ Resistant Hazera no. 4 20 0 20 Susceptible F1 Hazera no. 20 0 20 Susceptible 3 × Hazera no. 4 F2 Hazera no. 248 63 185 Segregating 3 × Hazera no. 4

[0212] The phenotyping data of the F1 and F2 μlants tend to demonstrate that the foliar tolerance and or resistance to the Tomato Brown Rugose fruit virus is controlled in a recessive manner by one single gene or QTL.

[0213] Table 3 shows the result of the second screening regarding the fruit evaluation: plants are scored on a 1 to 4 scale whereby plants with 1 to 3 scores will be considered as susceptible, having for the plants graded 1 severe symptom of typical fruit lesions and some fruit deformation, for the plants graded 2 moderate lesions in some of the fruits only and 3 light symptoms. Only plants having 3.5 and 4, i.e. without symptoms on the fruits would be considered as resistant.

TABLE-US-00003 TABLE 3 Fruit evaluation of second screening Total Number of plants number of With a fruit rating of symptoms Line plants 1 1.5 2 2.5 3 3.5 Conclusion Hazera 20 0 0 0 0 0 20 Tolerant no. 1 Hazera 20 20 0 0 0 0 0 Susceptible no. 2 F2 238 101 28 21 12 21 55 Segregating Haz1 × Haz2

[0214] The phenotyping data of the F2 μlants tend to demonstrate that the fruit tolerance and/or resistance to the Tomato Brown Rugose fruit virus is controled in a recessive manner by a few, one or two QTLs.

Example 4: Association Analysis for Gene Mapping

[0215] The tomato plants Hazera no. 1 and Hazera no. 2 were used to build an F2 bi-parental mapping population. The tomato plant Hazera no. 1 showing a resistant phenotype (fruit and foliar) to Tomato Brown Rugose Fruit virus was crossed with the susceptible plant in order to create an F1 which was used later to generate an F2 segregating population. Additional bi-parental population used for validation (foliar QTL) based on Hazera no. 3 and Hazera no. 4 was developed in the same manner (see example 6).

[0216] DNA Extraction: DNA was extracted from leaves ground using NucleoMag® Plant kit (Macherey-Nagel) according to the manufacturer's procedures. DNA purification was based on Magnetic-bead technology for the isolation of genomic DNA from plant tissue. DNA concentrations were quantified with a NanoDrop spectrophotometer.

[0217] The genotyping of the F2 population (based on Hazera no. 1 and Hazera no. 2) was done using a custom made Affymetrix Axium chip array containing approximatively 9500 SNPs for tomatoes (multiplex genotyping technology).

[0218] Tomatoes SNP markers were selected and discovered from different sources including public domain, LVS projects and collaborations. All SNPs were validated in pre-screen (previous experience on other technologies) and were selected according the following: [0219] Polymorphic/Allele frequency [0220] Representing world wide variation [0221] SNP clusters removal [0222] SNPs placed evenly according to physical map distance [0223] Lower representation in heterochromatin (pericentromeric) regions-high LD

[0224] Genotyping with the Affymetrix Axiom chip array was made using the standard protocol recommended by the manufacturer. The procedure includes the following steps: DNA amplification, fragmentation, precipitation, resuspension and hybridization preparation, hybridization to chip, wash, ligation, stain and scan. Two last steps are performed by Affymetrix's GeneTitan instrument. The analysis is performed by an automatic algorithm of clustering developed by Affymetrix.

[0225] A mixed linear model association was used independently for both fruit and foliar symptoms. The mapping results revealed one candidate QTL associated with the foliar tolerance and/or resistance to Tomato Brown rugose Fruit virus located on chromosome 11 and two candidate QTLs associated with fruit tolerance and/or resistance to Tomato Brown rugose Fruit virus located on chromosomes 6 and chromosome 9.

[0226] Markers significantly linked with the various QTLs for foliar and/or fruit tolerance/resistance to Tomato Brown rugose Fruit virus and their position on the tomato genome are summarized in Table 4. The sequence of the SNPs, including the flanking sequences are reported in table 5 and accompanying sequence listing part of the application.

[0227] Results showed that one QTL (QTL1 of the present invention) responsible for the fruit tolerance and or resistance to Tomato Brown rugose Fruit virus was located on chromosome 6, between position 33 932 438 and position 33 933 905, and that the second QTL (QTL2 of the present invention) responsible for the fruit tolerance and/or resistance to Tomato Brown rugose Fruit virus was located on chromosome 9, between position 4 800 680 and position 59 014 540, such physical positions on the genome being based on the version 2.40 of the tomato genome (Bombarely 2011). The region of chromosome 9 is a region of low recombination rate.

[0228] The region of chromosome 6 is a region prone to introgression and several genes of interest have already been mapped in this region, inter alia introgression of genes involved in salt tolerance from S. lycopersicoides, S. pennellii and S. pimpinellifolium (Li et al, Euphytica (2011) 178: 403), introgression of genes involved in powdery mildew resistance from S. habrochaites and S. neorickii (Seifi et al, Eur J Plant Pathol (2014) 138: 641) and introgression of genes involved in Pepino Mosaic Virus (WO2013/064641).

[0229] Results showed that the QTL responsible for the foliar tolerance and/or resistance to Tomato Brown rugose Fruit virus was located on chromosome 11, between position 9 548 029 and position 10 015 478, such physical position on the genome being based on the version 2.40 of the tomato genome (Bombarely 2011).

[0230] A further analysis was conducted with additional markers in order to better characterize the QTL on chromosome 11 responsible for the foliage resistance. The results are presented in table 6 and the sequences of the SNPs are reported in tables 5 and 7.

[0231] These additional results allow to define, on the basis of the p-value and R.sup.2 values, and on the variation of these values along chromosome 11, that the QTL responsible for the foliar tolerance to Tomato Brown rugose Fruit virus was broadly located on chromosome 11, between the SNPs TO-0122252 and TO-0162427, i.e. between position 8 090 264 and position 10 018 811, such physical positions on the genome being based on the version 2.40 of the tomato genome. The SNPs TO-0122252 and TO-0162427 flanking the broader definition of the QTL locus are mentioned by an asterisk (*) in table 6. A narrower definition of the location of the QTL on chromosome 11 is the region defined by the SNPs TO-0142270 and TO-0162432. These flanking markers of the narrower definition of the locus are mentioned by (**) in table 6. The SNPs having the more significant association with the QTL conferring foliar resistance/tolerance are mentioned by “+” in table 6, namely TO-0181040, TO-0123057 and T060125528.

TABLE-US-00004 TABLE 4 list of SNPs, their position and the alleles found in susceptible plants (1.sup.st nucleotide mentioned: S allele) vs. the alleles of the markers linked to the tolerance/resistance (2.sup.nd nucleotide mentioned: T allele). Position S/T SNP R.sup.2 Pvalue Chromosome SL2.40 allele TO-0005197 0.33402601 5.61E−08 6 33932438 C/T TO-0145581 0.33402601 5.61E−08 6 33933905 T/C TO-0180955 0.33863743 1.68E−11 9 4800680 A/G TO-0196724 0.351965936 4.96E−12 9 5203457 T/C TO-0145125 0.347544015 6.03E−12 9 40025769 A/G TO-0196109 0.33402601 2.09E−11 9 59014540 T/G TO-0182276 11 9548029 A/G TO-0181040 0.848753 2.35E−50 11 9797143 A/G TO-0123057 0.8477487 5.33945E−51   11 9825111 T/G TO-0125528 0.8477487 5.33945E−51   11 9837711 G/A TO-0162432 0.7216998 8.88E−34 11 10015478 T/C

TABLE-US-00005 TABLE 5 sequence of the SNPs SEQ Sequence of the SNPs: the allele associated with the Tomato Brown rugose ID Fruit virus tolerance or resistance is mentioned second in the bracket TO-0005197  1 GTCGGACCAAGAAACCATATTTGGTAACGGGTTCGAGTTGCTGCCTGAAC CTTTTAGCCC[C/T]TTGCAATATTTGTGAAGTGATATTCCTTTGTGTTATTAA TAATTTTTCGTTTTGAGTTTT TO-0145581  2 TTCAGAGAGCAACACTCCTGCAAGACCAACTCGGAGTAATTCAGTAACT CGACCTTCCAT[T/C]TCTAGCTCTCAGTATAGTACTTACTCAAATAAATCA GGCTCTATTCTAAACACAAGCTCT TO-0180955  3 TTCCGAAATGAGGACGATCCATCAGCTTCTTCAGCTGAGAGCCCCTGG TC[A/G]ACATACCAGAATTCTGTTTTTCTAAAACTGTCCAAAATCTCCTGT AAAGA TO-0196724  4 GATTTGAATGCCTTGCCACAGCCAGAGGATGACGA[T/C]GAGATTTTT GGACAACAATTAGAAGATGAACCACA TO-0145125  5 AGAGAATGATATCACTGCCTTAGTTTCTCAATTAAAAGTTGTGCAAAA ACAAAACACACA[A/G]CTAGATGAAGAAAACAGAGCATTCGCCTCAA AGCTTCAGACAAAAGAAGTTGAGAACAAC TO-0196109  6 TACAATACCTTCTGGCATCCCTTTCCGCAAAACGA[T/G]AGATCTTTAG TATCAAAACCGAGAGCACTGTCACC TO-0182276 13 CTCCTATTGAACATCCTGAAAACTTGTGTCTACATCATGAGAAGATGCA GGCCAATTC[A/G]CTCAGTACATGGAATGCACGAGCATGTTAGGGGA ATTCTAACGCAAAGCATAAGCTTGATACTTGAATAAAAGATGAAACAT ACTTACTTCTTCTCAAACT TO-0181040 14 CTCTTGGTGACAAACCACTGGCTCAATTTCTTCGCGAAGCTAAAG CTATC[A/G]CTGATGAGCTTGTCACGGCAGGCACACGTGTCTCCTGATG AATTCAATGC TO-0123057 15 CATTACTGTTGAGATATCTCATCGGCAACCCCTGGAGCTTGCCCAC CCGC[T/G]TGTCCTCCAGGATCTGATTTCAGAAAGGATGAATAGTAACTGT GTTTCAG TO-0125528 16 CAAGAACCCAACGACTTCTTCTTCTTTGCTTATTGAAAAACTTGGT TTTGAAATGAAAGG[G/A]ATCGAGAAATTGGATACTCAGTGGTTCTCTAC TACTAAACCTTCTCCTGATTTTAAGAAA TO-0162432 17 TGATCGACAATTCTTGTTGTTGTTGAAACTCTGCAAGTGAGAGAGGGATG [T/C]ATATAGAGAAAGGATATTGGTAAAGGACAATTCTAGAAGGGTCTA GGGAA

TABLE-US-00006 TABLE 6 additional flanking markers - association analysis mapping foliage resistance based on F2 population of HAZ1. The alleles found in susceptible plants (S allele) and the alleles of the markers linked to the tolerance/resistance (2.sup.nd nucleotide mentioned: T allele) are reported. Position on chromo- some 11 Flanking S/T SNP R.sup.2 Pvalue SL2.40 markers allele TO-0122252 0.7758002 1.16E−40 8090264 * A/T TO-0144325 0.8101493 9.62E−45 8140310 TO-0144322 0.8001583 1.10E−42 8163278 TO-0144317 0.8051598 2.07E−44 8334467 TO-0101684 0.8051598 2.07E−44 8345699 TO-0197358 0.8051598 2.07E−44 8357644 TO-0144313 0.8051598 2.07E−44 8410749 TO-0144309 0.8249175 1.65E−46 8412924 TO-0144308 0.8051598 2.07E−44 8414574 TO-0144303 0.8051598 2.07E−44 8419932 TO-0121816 0.797688 2.30E−42 8626324 TO-0142268 0.7613548 5.39E−39 8631287 TO-0142270 0.8064465 1.37E−44 8633469 ** C/T TO-0142294 0.8474345 6.06E−51 8764030 TO-0142299 0.8474345 6.06E−51 8891489 TO-0142301 0.8474345 6.06E−51 8900707 TO-0142302 0.8474345 6.06E−51 8902922 TO-0142303 0.8474345 6.06E−51 8903092 TO-0142305 0.8474345 6.06E−51 8963512 TO-0142306 0.8474345 6.06E−51 9318832 TO-0142307 0.8474345 6.06E−51 9318930 TO-0162436 0.7855676 7.54E−41 9789608 TO-0181040 0.848753 2.35E−50 9797143 + A/G TO-0123057 0.8477487 5.34E−51 9825111 + T/G TO-0125528 0.8477487 5.34E−51 9837711 + G/A TO-0162432 0.7216998 8.88E−34 10015478 ** T/C TO-0162427 0.7459438 2.53E−37 10018811 * C/T

TABLE-US-00007 TABLE 7 sequences of the additional SNPs SEQ Sequence of the SNPs; the allele associated with the TBRFV ID tolerance or resistance is mentioned second in the bracket TO-0122252  7 ATGGCAATAGTGAACTGCAGATACAACTGAAATTGCAGAACAC CCTTAAA[A/T]ATAGAATCAATAGAAAGTTGCAACAATATTTGAA TGATGAAGCAACAAAG TO-0142270  9 AACACCAGGTAGAGAGCACAGCGAAACAATGGCCTCAGGAAG ATCTACTT[C/T]GCGAAGTGCAGCAAGCCACTCCATACCTCCAC CAGGCTTTGATTTCAGTG TO-0162427 18 GCACCAGTTATAGTAATGTCCTGCTTCTTTCCTGTACCCTTATC AGTAGC[C/T]GTGACAGAAAGAATACCGTTGGTGTCAATGTCGA ACTTCACTTCAATCTG

Example 5: Further Marker Validation

[0232] One most associated marker to foliar tolerance to TBRF virus was defined at the edge of the QTL3 region to be the candidate marker close to the resistance gene. This SNP was designed to SNP monoplex KASPar technology: KASPar assay used for validation was preformed based on KASP method from KBioscience (LGC Group, Teddington, Middlesex, UK).

[0233] Primers for the KASP SNP assays were designed using LGC's primer picker software. Due to a SNP, two allele-specific forward primers and one common reverse primer per SNP assay were designed. KASP genotyping assays are based on competitive allele-specific PCR and enable bi-allelic scoring of SNPs at specific loci. To summarize, the SNP-specific KASP assay mix and the universal KASP Master mix were added to DNA samples, a thermal cycling reaction was then performed, followed by an end-point fluorescent read. Biallelic discrimination was achieved through the competitive binding of two allele-specific forward primers, each with a unique tail sequence that corresponded with two universal FRET (fluorescence resonant energy transfer) cassettes, one of which was labelled with FAM™ dye and the other of which was labelled with VIC™ dye (LGC, www.lgcgroup.com).

[0234] A volume of 3 μl of DNA was pipetted into black 384 well hard shell PCR plates and dried down at room temperature. When the genotyping was performed, the DNA was suspended by adding a 3 μl PCR mix, according to the manufacturer's protocol (KBioscience). Genotyping PCR results were analyzed using the software KlusterCaller (KBioscience). The marker used in this study is the TO-0182276 (SEQ ID NO:13).

[0235] HAZ3×HAZ4 F2 population (table 2) was used for this marker validation. The F2 μlants were genotyped using this marker and also phenotyped for foliar symptoms as described in example 3. The association was 100% based on a data of 251 μlants.

[0236] The summary data of phenotyping foliar symptoms and candidate marker genotyping is presented in table 8: R marker means homozygous to resistance/tolerance allele, S marker means homozygous to susceptible allele, H marker means heterozygous comprising of the two alleles:

TABLE-US-00008 TABLE 8 Number of plants with Number of foliar plants with TBRFV foliar tolerance or TBRFV Number of resistance susceptibility plants symptoms symptoms R marker 67 67 0 S marker 62 0 62 H marker 122 0 122

Example 6: Association Analysis for Gene Mapping

[0237] The tomato plants Hazera no. 3 and Hazera no. 4 were used to build an F2 bi-parental mapping population. The tomato plant Hazera no. 3 showing a foliar resistance phenotype to Tomato Brown Rugose Fruit virus was crossed with the susceptible plant Hazera no. 4 in order to create an F1 which was used later to generate an F2 segregating population.

[0238] Crosses, phenotyping and associations were performed as described in example 4, with HAZ1 and HAZ2.

[0239] The QTL for foliar resistance and the most significant associated markers were identified on chromosome 11, as detailed in table 9 and illustrated on FIG. 3.

[0240] As in example 4, the broader definition of the locus comprising the QTL is defined by flanking markers with an asterisk in table 9, namely SNPs TO-012252 and TO0162427. These SNPs are the same as those flanking the broader definition of the QTL position as deduced from the results obtained with the other tolerance source, namely NAZI. This point strongly corroborates the conclusion that the QTL for foliar tolerance is the same for HAZ1 and HAZ3.

[0241] HAZ1 corresponds to the seeds HAZTBRFVRES1 deposited at the NICMB under the accession number 42758.

[0242] A narrower definition of the locus of the QTL, as deduced from the results on HAZ3 population is defined by the flanking makers TO-0144317 and TO-0125528 on chromosome 11 (markers ** in table 9). The markers with the most significant association to TBRFV foliar tolerance/resistance are the markers mentioned with (+), namely TO-0142303, TO-0142306 and TO60142294.

TABLE-US-00009 TABLE 9 list of additional SNPs, their position and the alleles found in susceptible plants (1.sup.st nucleotide mentioned: S allele) vs. the alleles of the markers linked to the tolerance/resistance (2.sup.nd nucleotide mentioned: T allele) Position on chromo- some 11 Flanking S/T SNP R.sup.2 Pvalue SL2.40 markers allele TO-0122252 0.81927235 1.55E−60 8090264 * A/T TO-0144317 0.854230073 6.90E−69 8334467 ** T/C TO-0142303 0.884698061 3.46E−77 8903092 + C/A TO-0142305 0.884698061 3.46E−77 8963512 TO-0142306 0.884698061 3.46E−77 9318832 + G/A TO-0142307 0.884698061 3.46E−77 9318930 TO-0142294 0.884698061 3.46E−77 8764030 + A/G TO-0142299 0.884698061 3.46E−77 8891489 TO-0142301 0.884698061 3.46E−77 8900707 TO-0142302 0.884698061 3.46E−77 8902922 TO-0144308 0.854199247 7.02E−69 8414574 TO-0144303 0.854199247 7.02E−69 8419932 TO-0142268 0.854144413 7.24E−69 8631287 TO-0142270 0.854144413 7.24E−69 8633469 TO-0121816 0.854144413 7.24E−69 8626324 TO-0144313 0.853890923 2.18E−68 8410749 TO-0181040 0.851931696 2.47E−68 9797143 TO-0123057 0.851931696 2.47E−68 9825111 TO-0125528 0.851931696 2.47E−68 9837711 ** G/A TO-0144309 0.853578274 6.78E−68 8412924 TO-0162436 0.851618235 7.62E−68 9789608 TO-0197358 0.848638959 9.80E−67 8357644 TO-0101684 0.831991299 7.32E−64 8345699 TO-0144325 0.821665121 9.46E−62 8140310 TO-0144322 0.822371998 1.62E−61 8163278 TO-0162427 0.789778057 6.28E−56 10018811 * C/T

TABLE-US-00010 TABLE 10 sequence of the additional SNPs SEQ Sequence of the SNPs; the allele associated with the TBRFV SNP ID tolerance or resistance is mentioned second in the bracket TO-0144317  8 AGCCATTGTGATTGTGTCTGTTGTACATTACCAAAATTCTCTAGA GAAAG[T/C]GATACACATGCCAGCCCTATCGATATAAAGCAACGC AAGGTGGATTCTGC TO-0142303 11 GAGGAGCTATCAACTTCATAGTCAGATTCAGAAAATGATTCAGAT GAGGA[C/A]GTGGCTGATTCTTCTTGTTTTCTTTTCTTCCTTCTGC TCGAACTCTCTCC TO-0142306 12 CAGAAATAATAGAAAATCAGAAAGAAAAATCAGCTTTCTAAATGG AAAAG[G/A]CGATGGCACTATGTTTGAAGTTTTAAGCAACTTTTCT GAAGTCCCAAAAG TO-0142294 10 TCAACTGCAACTTTAACAGCTGATTCAACTTCTTCTTCTTTCGAA ACATC[A/G]CATTGAATGTAACGACCTCCAATAGATTCAGCTAAA CTTGTACCTACTTC

[0243] Taken together, these results confirm the presence of a QTL conferring foliar tolerance, broadly located within the chromosomal region delimited by TO-012252 and TO0162427 and more precisely by TO-0144317 and TO-0125528.

[0244] In view of the results of example 4, these results thus demonstrate that the location of this QTL can advantageously been defined as between TO-0142270 and TO-0125528.

Example 7: Genetic Modification of Tomato Seeds by Ethyl Methane Sulfonate (EMS)

[0245] Seeds of a tomato varieties are to be treated with EMS by submergence of approximately 2000 seeds per variety into an aerated solution of either 0.5% (w/v) or 0.7% EMS for 24 hours at room temperature.

[0246] Approximately 1500 treated seeds per variety per EMS dose are germinated and the resulting plants are grown, preferably in a greenhouse, for example, from May to September, to produce seeds. Following maturation, M2 seeds are harvested and bulked in one pool per variety per treatment. The resulting pools of M2 seeds are used as starting material to identify the individual M2 seeds and the plants with a fruit and/or a foliar tolerance to Tomato Brown Rugose Fruit virus.