Coxsackievirus A6 strain CVA6-KM-J33 and use thereof

Abstract

Provided is a Coxsackievirus A6 (CVA6) strain CVA6-KM-J33 and use thereof, and belongs to the technical field of biomedicine. The present invention provides a CVA6 strain CVA6-KM-J33, which belongs to a CVA6 virus. In the present invention, the strain CVA6-KM-J33 is susceptible to KMB17 cells and can achieve a relatively high titer. The strain has strong virulence, high pathogenicity and lethality to suckling mice, and desirable immunogenicity, and is a highly effective virus strain for CVA6 vaccine development. This strain can be used for immunogenicity evaluation or protective evaluation of CVA6 vaccine to improve the accuracy and reproducibility of vaccine immunogenicity evaluation. This strain can also be used to prepare animal models of Coxsackievirus (CV) infection, and exhibits desirable application prospects.

Claims

1. A method for propagating and passaging the CVA6 strain CVA6-KM-J33 comprising infecting a human embryonic lung diploid cell with a Coxsackievirus A6 (CVA6) strain CVA6-KM-J33 and culturing the human embryonic lung diploid cell at 37 C. under 5% CO2; wherein the human embryonic lung diploid cell is a KMB17 human embryonic lung diploid cell; and wherein the CVA6 strain CVA6-KM-J33 has a deposit number of CCTCC NO. V202384 in the China Center for Type Culture Collection and a VP1 structural protein of the CVA6 strain CVA6-KM-J33 has the amino acid sequence set forth in SEQ ID NO: 10.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 shows an electrophoresis pattern of the RT-PCR amplification product in Example 1 of the present disclosure;

(2) FIG. 2 shows a phylogenetic tree based on VP1 region nucleotides of the CVA6-KM-J33 in Example 1 of the present disclosure;

(3) FIG. 3 shows the test results of a cross-neutralizing ability in Example 1 of the present disclosure;

(4) FIG. 4 shows a growth curve of the virus strain in Example 4 of the present disclosure in human diploid cells KMB17;

(5) FIG. 5A-FIG. 5B show the clinical manifestations, survival rate (FIG. 5A), and evaluation of clinical symptom scores (FIG. 5B) of suckling mice inoculated with the strain CVA6-KM-J33 at different infection doses in Example 5 of the present disclosure;

(6) FIG. 6A-FIG. 6C show the changes in viral load in different tissues after inoculation of the CVA6-KM-J33 in 1-day-old suckling mice in Example 5 of the present disclosure; where FIG. 6A is the change of viral load in each tissue with the number of days of infection after intracerebral injection of 10.sup.5 CCID.sub.50/mouse infected with CV-A6 virus in 1-day-old suckling mice; FIG. 6B is the change of viral load in each tissue with the number of days of infection after intracerebral injection of 10.sup.6 CCID.sub.50/mouse infected with CV-A6 virus in 1-day-old suckling mice; FIG. 6C is the change of viral load in each tissue with the number of days of infection after intracerebral injection of 10.sup.7 CCID.sub.50/mouse infected with CV-A6 virus in 1-day-old suckling mice; the base of log is 10;

(7) FIG. 7A-FIG. 7D show the H&E staining results of brain and lung tissues of newborn suckling mice infected with the CVA6-KM-J33 in Example 5 of the present disclosure; where FIG. 7A is normal lung tissues; FIG. 7B is lung-endothelial cell necrosis and shedding; FIG. 7C is normal brain tissues; FIG. 7D is brain-local (cerebellum) focal hemorrhage, with fewer brain neuron cells, mild edema, and pyknosis of individual cell nuclei;

(8) FIG. 8A-FIG. 8B show the immunogenicity evaluation of the experimental inactivated vaccine in Example 6 of the present disclosure, where FIG. 8A is the neutralizing antibody seroconversion rate of serum before and after booster immunization at different doses; FIG. 8B is the comparison of neutralizing antibody titers in mice immunized by three routes; 35 days: the 7th day after the booster immunization.

DETAILED DESCRIPTION OF THE EMBODIMENTS

(9) The present disclosure provides a CVA6 strain CVA6-KM-J33 with a deposit number of CCTCC NO. V202384 in the CCTCC.

(10) In the present disclosure, the strain CVA6-KM-J33 is isolated from Vero cells, amplified for 3 generations and then inoculated on KMB17 cells for adaptive passage. This strain is susceptible to KMB17 cells and can achieve a relatively high titer. This strain has strong virulence, high pathogenicity and lethality to suckling mice, and desirable immunogenicity, and is a highly effective virus strain.

(11) In the present disclosure, a VP1 structural protein of the CVA6 strain CVA6-KM-J33 has the amino acid sequence shown in SEQ ID NO: 10, indicating that this strain belongs to a CVA6 virus.

(12) The present disclosure further provides a propagation and passage method of the CVA6 strain CVA6-KM-J33, including conducting propagation and passage using a human diploid cell as a stromal cell.

(13) In the present disclosure, the human diploid cell preferably includes a human embryonic lung diploid cell KMB17. The human embryonic lung diploid cell KMB17 is a human-derived cell line independently developed and established by the Institute of Medical Biology, Chinese Academy of Medical Sciences. Preferably, the human embryonic lung diploid cell KMB17 is infected with the CVA6 strain CVA6-KM-J33 and then cultured at 37 C. under 5% CO.sub.2. Under the culture conditions, cytopathic effect is observed in not less than 75% of the cells within 72 h to 96 h.

(14) The present disclosure further provides a biological agent prepared using a genomic RNA of the CVA6 strain CVA6-KM-J33.

(15) In the present disclosure, the biological agent preferably includes any one of the following items: 1) a nucleic acid molecule encoding the genomic RNA of the CVA6 strain; 2) an expression cassette carrying the nucleic acid molecule in 1); 3) a recombinant vector carrying the nucleic acid molecule in 1) or a recombinant vector carrying the expression cassette in 2); 4) a recombinant microorganism carrying the nucleic acid molecule in 1), a recombinant microorganism carrying the expression cassette in 2), or a recombinant microorganism carrying the recombinant vector in 3); 5) a cell line carrying the nucleic acid molecule in 1) or a cell line carrying the expression cassette in 2); and 6) an animal model constructed using the strain.

(16) In the present disclosure, the animal model is preferably based on mice, such as Balb/c mice to establish the animal model. The genomic RNA has the nucleotide sequence preferably set forth in SEQ ID NO: 11.

(17) The present disclosure further provides an antiserum against a CVA6 strain, where a preparation process of the antiserum includes injecting the CVA6 strain CVA6-KM-J33 into an animal and collecting a serum of the animal to obtain the antiserum.

(18) In the present disclosure, there is no special limitation on the type of the animal, and animals for conventional antiserum preparation in this field can be used.

(19) The present disclosure further provides a vaccine or a drug for preventing and/or treating a CVA6 strain-caused disease, where an active ingredient of the vaccine or the drug includes the biological agent or the antiserum.

(20) In the present disclosure, the CVA6 strain can produce immune effects through multiple immune routes, such as intradermal, intramuscular, and intradermal routes. After immunizing mice, the antibody titer can reach up to 1:1024, showing desirable immunogenicity, and can be used to prepare virus-free vaccines.

(21) The present disclosure further provides the use of an inactivated strain of the CVA6 strain CVA6-KM-J33 as a drug delivery medium.

(22) In the present disclosure, the CVA6 strain CVA6-KM-J33 has desirable infectivity and can be used as a drug delivery medium for drug delivery after inactivation.

(23) To further illustrate the present disclosure, the CVA6 strain CVA6-KM-J33 and the use thereof provided by the present disclosure are described in detail below in combination with examples, but these examples should not be construed as limiting the claimed scope of the present disclosure.

Example 1 Isolation and Identification of CVA6 Strain CVA6-KM-J33

(24) 1. Processing of clinical samples: anal swab samples were collected from children diagnosed with HFMD by the Yunnan Provincial Center for Disease Control and Prevention into 15 mL sterile centrifuge tubes, and 1 mL of 0.01 M PBS was added. The anal swab clinical specimen was fully oscillated with an oscillator, centrifuged at 4,000 rpm for 20 min, a supernatant was collected and an equal volume of chloroform was added, mixed repeatedly, centrifuged at 2,800 rpm for 15 min, and a supernatant was collected.

(25) 2. Virus isolation and culture: viruses were cultured and isolated on Vero cells, cultured statically at 37 C., 5% CO.sub.2, and observed continuously for 7 d. If cytopathic effect was observed in not less than 80% of the cells under the microscope, the virus fluid was collected. Passaging 3 times in this way could eliminate cell lesions caused by chloroform or other factors.

(26) 3. Virus harvesting and adaptive subculture in KMB17 cells: within 24 h to 48 h after KMB17 cell subculture, when the cell area approached 90%, the growth medium was discarded and the cells were washed once with PBS. After discarding the PBS, a serum-free maintenance solution was added to the cells, shaken gently, and then the maintenance solution was removed. An appropriate amount of the virus liquid was inoculated into the culture bottle, adsorbed at 37 C. for 1 h, an appropriate amount of the maintenance solution was added, and cultured at 37 C. When distinct cytopathic effect was observed in not less than 80% of the cells under a microscope, the culture bottle was frozen in a 30 C. refrigerator.

(27) 4. Virus identification: After 3 times of adaptive subculture, the virus liquid was obtained, and the harvested virus liquid was initially identified, including molecular biology identification (nucleic acid sequence determination and subtype analysis), research on cross-neutralization capabilities, and genome sequencing, so as to initially screen virus strains.

(28) 4.1. Molecular biology identification: RT-PCR was conducted to identify CVA6, CVA6-positive strains were subjected to VP1 nucleic acid sequence determination, and CVA6 genotyping was conducted based on the obtained VP1 nucleotide sequence.

(29) 1) The uploaded CV-A6 gene sequences in GenBank were selected as reference sequences (the reference sequences had gene accession numbers of MN845834.1 and MN845849.1, respectively), and the primers for the VP1 segment shown in Table 1 were designed using a Primer-BLAST primer design function in the National Center for Biotechnology Information (NCBI).

(30) TABLE-US-00001 TABLE 1 Primer sequences for RT-PCR amplification Primer name Primer sequence (5-3) Product size CVA6-1-F SEQ ID NO: 1: TATAGCTCTTGGAGCAGCACA 914 bp CVA6-1-R SEQ ID NO: 2: TTACCACTCTAAAGTTACCCACATA CA16-VP1-F SEQ ID NO: 3: GCAAACGGCTAACATACA 932 bp CA16-VP1-R SEQ ID NO: 4: TGTCCAAACTTTCCCAAC EV71-VP1-F SEQ ID NO: 5: AAGGATGCTAGTGATATCCT 1009 bp EV71-VP1-R SEQ ID NO: 6: CATTGTGAGTGGCAAGAT

(31) 2) Viral nucleic acid was extracted using the AxyPrep body fluid viral DNA/RNA mini kit, and the VP1 fragment was amplified using the PrimeScript One Step RT-PCR Kit produced by Takara Bio (Dalian) Co., Ltd. The reaction conditions included: 50 C. for 30 min; 94 C. for 2 min; 35 cycles of 94 C. for 30 s, 50 C. for 30 s, and 72 C. for 1 min; and 72 C. for 10 min.

(32) 3) The target fragment was identified by 1% agarose gel electrophoresis and sent to Shanghai Sangon Biotech Co., Ltd. for sequencing. Germline evolution analysis was performed using MEGA5.0 software.

(33) A target band with a size of 914 bp was observed in the positive sample using CVA6 VP1-specific primers, but no bands appeared in the amplification using EV71 and CA16 primers again, as shown in FIG. 1 (where Lane 1 was the amplification product of CVA6-1 primer, and Lanes 2 and 3 were the amplification products of EV71-VP1 and CA16-VP1 primers). Viruses identified as CVA6-positive were genotyped for CVA6 based on the VP1 nucleic acid sequence. The results showed a B3 type. The phylogenetic tree of the CVA6 based on the VP1 region nucleotide sequence is shown in FIG. 2.

(34) 4.3. Establishment of candidate strains for neutralizing antibody detection: validation of CVA6-KM-J33 was conducted. The results showed that this strain only had a specific neutralizing ability against the immune serum of CVA6, but had no cross-reactivity against the immune serum of other enteroviruses such as EVA71, CVA10, and CVA16, as shown in FIG. 3. The results proved that this strain was suitable for detecting the neutralizing antibody titer of immune serum of the CVA6 strain.

Example 2 Preparation of CVA6 Standard Serum

(35) 1. Crude Purification for Virus Liquid of CVA6 Reference Strain

(36) Vero cells were inoculated in a culture bottle. When the cell area was inoculated close to 90%, an appropriate amount of CVA6 reference strain GS2015-399 (from the Institute of Viral Disease Prevention and Control, Chinese Center for Disease Control and Prevention) was inoculated and placed in a 37 C. 5% CO.sub.2 incubator for adsorption for 1 h, added with an appropriate amount of serum-free maintenance solution, and cultured statically until cytopathic effect was observed in not less than 80%, and the virus liquid was harvested. The 15-399 virus harvest solution was centrifuged at 100,000g for 4 h at 4 C., resuspended in 0.01 M PBS, extracted once with volume of chloroform, centrifuged at 2,800 rpm for 20 min at room temperature, and a supernatant was collected to obtain crudely purified virus liquid.

(37) 2. Preparation of Standard Serum

(38) During primary immunization, the 15-399 crude virus solution and a Freund's complete adjuvant were thoroughly mixed at a volume of 1:1, and injected subcutaneously at multiple points to immunize Japanese big-eared rabbits, 1 mL/rabbit. 28 d after the primary immunization, the crude virus liquid and an equal volume of Freund's incomplete adjuvant were fully mixed to allow booster immunization 4 times, while the control group was injected with an equal dose of PBS, and the growth of rabbit was continuously observed and recorded. Blood was collected from the car vein on the 28th day after the primary immunization and the 14th day after the booster immunization, and the neutralizing antibodies in the isolated serum had a titer of 1:2048 to 1:8192.

(39) 3. Negative Serum

(40) The serum isolated from Japanese big-eared rabbits that had not been immunized with virus fluid and collected from the car vein was used as the negative serum used in the identification experiment.

Example 3 Preliminary Purification and Amplification of CVA6 Strain

(41) 1. A virus dilution of the initially screened virus strain in Example 1 was inoculated into a 6-well cell culture plate for purification.

(42) 1.1 Cell preparation: KMB17 cells were inoculated in a 6-well plate in advance and cultured. When the monolayer became dense, the original medium was discarded, the cell surface was washed, and residual bovine serum and dead cells were removed by washing.

(43) 1.2 Virus preparation: the virus liquid was diluted at appropriate times.

(44) 1.3 Virus adsorption: the virus was inoculated into a 6-well plate, 0.4 mL/well, while a cell control was set up, the two groups were placed in a 5% CO.sub.2 incubator at 37 C. to allow adsorption for 1 h to 2 h, where the cell plate was gently shaken several times every 15 min to 20 min to allow the virus to contact the entire cell surface during the adsorption.

(45) 1.4 Covering and culture: the virus liquid was discarded after the adsorption was completed, and the virus maintenance solution was added into the virus control and cell control wells at 3 ml/well. A mixture of agarose and virus maintenance solution was added into the remaining wells along the wall at 3 mL/well, allowed to stand at room temperature for not less than 30 min to cool and solidify into a covering layer. The culture plate with agarose was placed upside down in a 5% CO.sub.2 incubator and cultured at 371 C., and the plaque status (morphology, size, and number) and cytopathic effect in the virus control were observed every day.

(46) 1.5 Plaque picking: when obvious plaques were seen under the microscope, a marker pen was used to mark the bottom of the 6-well plate at the corresponding position of the plaque; in a class II biosafety cabinet in the clean room, a 200 L pipette was used to draw 20 L of the mixed liquid at the marked position with the pipette tip under the liquid surface, and a total of 10 plaques of suitable size was selected.

(47) 1.6 Plaque culture: a 200 L pipette tip with a filter element was used to select 10 single plaques into a 1.5 mL EP tube containing 100 L of virus maintenance solution, pipetted and mixed repeatedly, inoculated into a 96-well cell culture plate where the cells have grown to a monolayer, cultured at 371 C. in a 5% CO.sub.2 incubator, and CPE was observed every day. When the CPE of the cells reached 75%, a supernatant was collected and stored in a 20 C. refrigerator, and 3 virus clones that could cause the fastest pathogenesis of KMB17 cells were selected. At this time, the virus passage was P2. In this way, plaque purification was done 3 times continuously.

(48) 2. Identification and analysis: the virus clones selected for the third time were amplified, and infectivity titer testing was conducted on the virus clones selected each time and the virus amplification fluid from the third spot pick.

(49) 2.1 Although each clone strain selected was from the same strain of virus, there were differences in infectivity titers between clone strains, and the difference range was within 1 lgCCID.sub.50/mL. In addition, the infectivity titers between clones increased with the rounds of plaque purification, and the infectivity titers of clones after the third plaque purification could reach a maximum of 6.25 lgCCID.sub.50/mL.

(50) 2.2 The nucleic acid electrophoresis bands of the 9 spot-picked samples were single and bright, with a size of about 914 bp, which was consistent with expectations (FIG. 1), and no base mutation was found after the nucleic acid sequence comparison of VP1 gene of 9 spot picking samples. Therefore, it was believed that the 9 samples after plaque purification were still CVA6, and the base sequence and amino acid level of the VP1 region maintained certain stability.

Example 4 Detection of Infectivity Titer and Analysis of Growth Characteristics for CVA6 Strain CVA6-KM-J33 on KMB17 Cells

(51) The growth curve of strain CVA6-KM-J33 was observed on KMB17 cells, the virus liquid was harvested at 11 time points (0 h, 12 h, 24 h, 36 h, 48 h, 72 h, 96 h, 5 d, 6 d, 7 d, 8 d), and the infectious titer was measured detection. Virus titration: the infectivity titer of CVA6 was detected using the microcytopathy method and the virus growth characteristics were observed, and the results were calculated using Karber's formula: 1) KMB17 cells were prepared into a cell suspension and then counted, adjusted to a cell concentration of 1.0*10.sup.5 cells/mL, inoculated into a 96-well plate (100 L/well), and cultured in a 37 C. 5% CO.sub.2 incubator for 24 h; 2) the CVA6 virus liquid was serially diluted 10 times with maintenance solution, from 10.sup.1 to 10.sup.8; 3) the 10-fold serially diluted virus solution to be tested was added into a 96-well plate having cells spread, with 8 parallel wells for each dilution, 100 L/well, and 100 L maintenance solution was added into the cell control group; 4) the cells were cultured in a 37 C. 5% CO.sub.2 incubator; 5) the growth characteristics of KMB17 cells were analyzed, the occurrence of CPE in each dilution of cells was observed daily and the number of lesion wells was recorded until no more cell lesions formed;

(52) 6) the virus infectivity titer (lgCCID.sub.50/mL) was calculated according to the Karber's method, and the average was taken after 3 replicated tests.

(53) Experimental results: as shown in FIG. 4, an abscissa of the growth curve was the culture time, and an ordinate was the infectivity titer corresponding to the sampling time point. The one-step growth curve on KMB17 cells showed that the titer of strain CVA6-KM-J33 could reach the duplication peak at 72 h, and its infection titer reached 6.5 CCID.sub.50/mL on the fourth day.

Example 5 In Vivo Pathogenicity Detection of CVA6 Strain CVA6-KM-J33

(54) 1-day-old SPF grade Balb/c suckling mice, 6 mice/group, were injected with different doses of CVA6-KM-J33 virus liquid via the intracerebral route while suckling mice in the control group were injected with equal doses of PBS. After 18 days of continuous observation, the growth, onset, and death of the suckling mice were recorded to evaluate the severity of the disease caused by the strain CVA6-KM-J33 at different doses. 3 infected suckling mice were sacrificed on days 3, 5, and 9 after infection, and their organs and tissues were collected for viral load detection. Histopathological examination (H&E staining) was conducted on the brain, lung, and heart tissues of suckling mice.

(55) 1. In this example, 1-day-old suckling mice were injected into the brain via the intracerebral route. The dosage groups were 10.sup.4 CCID.sub.50/mouse, 10.sup.5 CCID.sub.50/mouse, and 10.sup.6 CCID.sub.50/mouse, while the control group suckling mice were given equal doses of PBS, with 6 mice in each group. Suckling mice began to become ill 3 days to 6 days after injection, and the latest onset time was the 6th day after injection. Compared with the control group, mice in different dose groups experienced varying degrees of morbidity and death. The symptoms of disease are shown in Table 2.

(56) TABLE-US-00002 TABLE 2 Clinical standard score sheet Clinical score Clinical manifestations 0 Health 1 Tiredness or lack of energy 2 Weight loss or weakness in the hind limbs 3 Paralysis of single hind limb 4 Paralysis of double hind limbs 5 Impending death or death

(57) Clinical scores and mortality results are shown in FIG. 5. The CVA6-KM-J33 clone strain amplification solution was used to challenge Balb/c suckling mice at different doses (10.sup.4 CCID.sub.50/mouse, 10.sup.5 CCID.sub.50/mouse, and 10.sup.6 CCID.sub.50/mouse) via intracerebral injection. The suckling mice in the high-dose group became ill on the 3rd day, where the symptoms of the sick suckling mice were fatigue, hind limb weakness, paralysis of one hind limb, paralysis of both hind limbs, paralysis of the front and rear limbs, and eventually dying or death. All suckling mice died on the 6th day after the challenge. However, the onset time of the suckling mice in the medium and low dose groups was slower, the symptoms of the sick suckling mice did not worsen and the mortality rate was low. Especially in the low-dose group, the symptoms gradually improved 10 days after the challenge and the weight began to increase.

(58) 2. Detection of Viral Load in Organs of Suckling Mice Infected with Strain CVA6-KM-J33

(59) In order to study the load and distribution of strain CVA6-KM-J33 in different organs of suckling mice in different stages at different doses, the viral load was measured 3, 5, and 9 days after intracerebral challenge.

(60) 2.1 Preparation of titer standard: CVA6 (CVA6-KM-J33) of known titer (7.0 lgCCID.sub.50/mL) was selected.

(61) 2.2 Extraction of total tissue RNA: 3 infected suckling mice in different dose groups of the intracerebral route were sacrificed on days 3, 5, and 9 after infection, their heart, liver, spleen, lung, kidney, brain, spinal cord, trigeminal nerve, and skeletal muscle where ground thoroughly, 0.01 g of tissue grinds were placed in 1.5 mL sterile centrifuge tubes, added with 0.01 M PBS to 1 mL, centrifuged at 9,000 rpm 4 C. for 10 min, and the supernatant after centrifugation was collected to extract viral nucleic acid by Trizol method to detect the viral load in each tissue.

(62) 2.3 qPCR system and reaction conditions: Following the instructions of the One-Step RT qPCR Kit (TAKARA/RR064), 4 L of template was selected to allow one-step RT qPCR on a fluorescence quantitative PCR instrument (Biorad, CFX-96), where a total reaction system was 25 L. The viral load (CCID.sub.50/10 mg) in the sample was absolutely quantified based on the standard curve. The qPCR probe and primer sequences, reaction procedures, and systems are shown below.

(63) Primer Sequence

(64) CVA6-qP-F (SEQ ID NO: 7): TACCACCGGGARAAACGTCCACG CVA6-qP-R (SEQ ID NO: 8): CGGTCAGYTGCAGTGTTAGT Probe (SEQ ID NO: 9): 5-FAM-ACGTGAGAGCTTGGGTACMTAGACCCCTTC-BHQ-3

(65) The reaction system included: 12.5 L of 2 OnestepRT-PCRbuffer III, 0.5 L of ExTaqHS, 0.5 L of PrimeScriptRTEnzymeMixII, 5.5 L of RNase Free ddH.sub.2O, 0.5 L each of Primer F/R, 1 L of Probe, and 4 L of template.

(66) Reaction parameters: 425 min; 9,510 s; 955 s, 6,030 s, 39 cycles.

(67) The experimental results are shown in FIG. 6: the viral load in each organ in the high-dose (10.sup.6 CCID.sub.50/mouse) group showed a significant upward trend on days 3 to 9 after infection; on the 3rd day, the viral loads in the heart, liver, spleen, and kidney were all lower than 5.0 lgCCID.sub.50/10 mg; on the 9th day after the challenge, the viral load in the heart, spleen, lungs, brain, hind limb muscles, and forelimb muscles of the suckling mice was (6.0-8.5) lgCCID.sub.50/10 mg. The viral load in each organ in the medium-dose (10.sup.5 CCID.sub.50/mouse) group showed an increasing trend on days 3 to 9 after infection; the viral load in each organ increased on day 3; on the 9th day after infection, the viral load in the heart and skeletal muscles (front and rear limb muscles) of suckling mice could reach (4.0-6.5) lgCCID.sub.50/10 mg, and the viral load in the brain and skeletal muscles (front and rear limb muscles) was higher than that in other organs. In the low-dose (10.sup.4 CCID.sub.50/mouse) group, there was a gentle upward trend on the 3rd and 5th days after infection, but the changing trend was not obvious on the 9th day.

(68) 3. Histopathological Examination of Suckling Mice after Immunization with CVA6 Strain CVA6-KM-J33

(69) Histopathological examination of CVA6-KM-J33-immunized suckling mice: the pathology of the brain and lung tissues of suckling mice was observed, and organs were fixated in 10% neutral formalin for 48 h and then embedded in paraffin to make paraffin sections for H&E staining.

(70) CVA6-KM-J33 intracerebral route: 1-day-old SPF grade Balb/c suckling mice infected at a dose of 10.sup.6 CCID.sub.50/mouse were sacrificed, and brain and muscle (forelimbs and hindlimbs) tissues of the diseased suckling mice and the healthy suckling mice of the control group were collected on the 9th day after infection for histopathology. The H&E staining results are shown in FIG. 7. It was found that in the late stage of infection, damages, and inflammatory reactions occurred in multiple organs throughout the body, such as perivascular infiltration of inflammatory cells, tissue congestion, and inflammatory cell accumulation. The changes in these cases showed a gradual worsening trend as time progressed. Brain: the pathological examination showed obvious pathological changes in the brain, local focal hemorrhage, local meningeal and subarachnoid congestion and hemorrhage, fewer neurons in the brain, mild edema, and pyknosis of individual cell nuclei. No obvious pathological changes were found in negative control brain tissue sections. Lung: the H&E staining had found that infection of suckling mice with CVA6-KM-J33 could cause viral pneumonia in suckling mice, manifested by congestion, mild degeneration, and thickening of blood vessel walls; while there were cell proliferation, mild expansion of tracheal alveoli, and endothelial cell necrosis and shedding; and a small number of red blood cells, exfoliated tissue cells, and inflammatory cells were seen in the alveolar spaces and some bronchioles. No obvious pathological changes were found in negative control lung tissue sections.

Example 6 Immunogenicity Evaluation of Strain CVA6-KM-J33

(71) In order to explore the immune dose of CVA6-KM-J33 and the impact of different immune routes on the immune effect of CVA6-KM-J33, 3 immune routes of muscle, abdominal cavity, and intradermal were set up, and vaccination doses were: 9 different combinations of 10.sup.4 CCID.sub.50/mouse, 10.sup.5 CCID.sub.50/mouse, and 10.sup.6 CCID.sub.50/mouse were used to immunize 6-week-old Balb/c mice.

(72) The serum antibody titer test results showed that the neutralizing antibody seroconversion rates of mice in the 9 experimental groups on the 7th day after primary immunization were all lower than 50% (1:8 was regarded as a threshold for vaccine efficacy evaluation). As the days after infection increased, the serum neutralizing antibody seroconversion rates of mice in the medium-dose group and the high-dose group increased; on the 28th day after the primary immunization, the positive conversion rates of the intramuscular low-dose group, intraperitoneal low-dose group, intradermal low-dose group, and intramuscular medium-dose group were less than 100%, while the positive conversion rates of the other experimental groups all reached 100%. A booster immunization was carried out on the 28th day. On the 7th day after the booster immunization, except for the intramuscular low-dose group, intraperitoneal low-dose group, and intradermal low-dose group, the antibody-positive conversion rate of each experimental group increased to 100% (FIG. 8).

(73) Statistical analysis of the data showed that there was no statistically significant difference in the data of the muscle, intraperitoneal, and intradermal route immune groups in different dose groups (t=0.216, p=0.892), such that the data of the 9 experimental groups could be combined and analyzed. From the perspective of immunization time points, except for the low-dose group, the antibody levels of mice on the 7th day after booster immunization were significantly higher than those on the 28th day after the primary immunization (FIG. 8); from the perspective of different immune routes, intradermal, intramuscular, and intradermal routes all produce immune effects, but the intramuscular and intraperitoneal routes had better immune effects. The highest antibody titer after immunizing mice was 1:1024, and the highest antibody titer in mice immunized via intradermal route was 1:256. (FIG. 8). The above results suggested that CVA6-KM-J33 in the medium-dose group with 10.sup.6 CCID.sub.50/animal and the high-dose group with 10.sup.7 CCID.sub.50/animal had desirable immunogenicity, indicating that the CVA6-KM-J33 could produce higher titer antibodies in the mouse serum after immunizing Balb/c mice through the intraperitoneal and intramuscular routes.

(74) Although the above example has described the present disclosure in detail, it is only a part of, not all of, the examples of the present disclosure. Other examples may also be obtained by persons based on the example without creative efforts, and all of these examples shall fall within the protection scope of the present disclosure.