Methods for detecting target analytes using synthetic biological circuits that modify glucose levels in a cell-free system
12215370 ยท 2025-02-04
Assignee
Inventors
Cpc classification
C12Y302/01023
CHEMISTRY; METALLURGY
C12P19/14
CHEMISTRY; METALLURGY
International classification
C12P19/14
CHEMISTRY; METALLURGY
Abstract
Described are methods for generating a reporter molecule in response to a target analyte in a cell-free system. A synthetic biological circuit is used to modify the level of the reporter molecule in response to the presence of the target analyte. The reporter molecule may be glucose or another molecule readily detected using a device such as glucose monitor or other portable sensor. Also provided are kits comprising a cell-free system with a synthetic biological circuit that generates or consumes a reporter molecule in response to a target analyte.
Claims
1. A method for modifying glucose in response to a target nucleic acid molecule in a sample, the method comprising: (i) contacting the sample with a synthetic biological circuit within a cell-free system reaction volume, the reaction volume present in a container, wherein the synthetic biological circuit comprises a DNA molecule comprising a promoter operably linked to a DNA molecule encoding an enzyme whose expression modifies the level of glucose in the reaction volume and the target nucleic acid molecule activates the synthetic biological circuit in the reaction volume to regulate translation of a mRNA molecule encoding the enzyme to modify the level of glucose in the reaction volume, and (ii) detecting glucose in the cell-free system reaction volume using a glucose meter thereby detecting the target nucleic acid molecule in the sample, wherein the synthetic biological circuit further comprises a riboregulator that controls translation of the mRNA molecule encoding the enzyme, wherein the riboregulator recognizes the target nucleic acid molecule and the target nucleic acid molecule is a trigger for the riboregulator such that binding of the target nucleic acid molecule to the riboregulator changes the conformation of the riboregulator thereby permitting translation of the mRNA encoding the enzyme in the synthetic biological circuit, and wherein the cell-free system comprises a substrate that is acted on by the enzyme to generate glucose and i) the substrate is trehalose and the enzyme is trehalase; ii) the substrate is maltose and the enzyme is maltase; iii) the substrate is cellobiose and the enzyme is cellobiase; iv) the substrate is starch and the enzyme is amylase; v) the substrate is lactose and the enzyme is lactase (beta-galactosidase); vi) the substrate is sucrose and the enzyme is invertase or sucrase; vii) the substrate is glucose and the enzyme is glucose dehydrogenase; or viii) the substrate is glucose-6-phosphate or glucose-1-phosphate and the enzyme is glucose 6-phosphatase.
2. The method of claim 1, wherein the riboregulator is a toehold switch.
3. The method of claim 1, wherein the cell-free system is freeze-dried and rehydrated by contact with the sample and/or a reaction buffer.
4. The method of claim 1, comprising detecting a level of glucose in the cell-free system reaction volume thereby quantifying a level of the target analyte in the sample.
5. The method of claim 1, comprising detecting glucose in the cell-free system reaction volume using a glucose test strip.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1) Embodiments of the invention will now be described in relation to the drawings in which:
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
DETAILED DESCRIPTION OF THE INVENTION
(19) The present description provides synthetic biological circuits for the detection of target analytes in a cell-free system. As shown in the Examples, the use of synthetic biological circuits as described allows for the detection of target analytes using readily available sensors and reagents such as glucose monitors and test strips. Different synthetic biological circuits can readily be generated to allow for the detection of different target analytes using the embodiments described herein. For example, target RNA or DNA sequences can be detected using a riboregulator such as a toehold switch to control expression of a reporter enzyme in response to a target nucleic acid sequence. Expression of the reporter enzyme modifies the level of a substrate which is then detected within the cell-free reaction volume. In a preferred embodiment, the reporter enzyme modifies the level of glucose in the cell-free reaction volume enabling the detection of the target analyte using a glucose monitor and/or glucose test strip.
(20) Different reporter enzymes may be used in the same reaction to allow for the simultaneous detection of multiple target analytes. By selecting reporter enzymes that have different rates of modifying the level of a reporter molecule (such as glucose) and preloading different amounts of substrates for each enzyme, the presence or absence of multiple target analytes will result in distinctive levels of the reporter molecule.
(21) As used herein, cell-free system refers to a set of reagents capable of providing for or supporting a biosynthetic reaction (e.g., transcription reaction, translation reaction, or both) in vitro in the absence of cells. For example, to provide for a transcription reaction, a cell-free system comprises promoter-containing DNA, RNA polymerase, ribonucleotides, and a buffer system. Cell-free systems can be prepared using enzymes, coenzymes, and other subcellular components either isolated or purified from eukaryotic or prokaryotic cells, including recombinant cells, or prepared as extracts or fractions of such cells. A cell-free system can be derived from a variety of sources, including, but not limited to, eukaryotic and prokaryotic cells, such as bacteria including, but not limited to, E. coli, thermophilic or cryophilic bacteria and the like, wheat germ, rabbit reticulocytes, mouse L cells, Ehrlich's ascitic cancer cells, HeLa cells, CHO cells and budding yeast and the like. In one embodiment, the cellular extracts are purified and/or treated to remove endogenous glucose and/or glucose converting enzymes to obtain a cell-free system. Examples of cell-free systems also include the PURExpress system available from New England Biolabs Inc.
(22) As used herein, the term biosynthetic reaction refers to any reaction that results in the synthesis of one or more biological compounds (e.g., DNA, RNA, proteins, monosaccharides, polysaccharides, etc.). For example, a transcription reaction is a biosynthetic reaction because RNA is produced. Other examples of biosynthetic reactions include, but are not limited to, translation reactions, coupled transcription and translation reactions, DNA synthesis, isothermal amplification reactions and polymerase chain reactions.
(23) The term synthetic biological circuit used herein refers to any engineered biological circuit where the biological components are designed to perform logical functions. In general, an input is needed to activate a synthetic biological circuit, which subsequently produces an output as a function of the input. In some embodiments, a synthetic biological circuit comprises at least one nucleic acid material or construct. In other embodiments, a synthetic biological circuit is substantially free of nucleic acids. A synthetic gene network is one kind of synthetic biological circuit. Other examples of synthetic biological circuits include, but are not limited to, an engineered signaling pathway, such as a pathway that amplifies input via kinase activity. In one embodiment, the synthetic biological circuit modifies the level of a reporter molecule in a cell-free reaction volume in response to a target analyte. In one embodiment, the synthetic biological circuit regulates the expression and/or activity of an enzyme that generates or consumes a reporter molecule in a cell cell-free reaction volume.
(24) Synthetic gene network or synthetic gene circuit or gene circuit are used interchangeably herein to refer to an engineered composition that comprises at least one nucleic acid material or construct and can perform a function including, but not limited to, sensing, a logic function, and/or a regulatory function. The nucleic acid material or construct can be naturally occurring or synthetic. The nucleic acid material or construct can comprise DNA, RNA, or an artificial nucleic acid analog thereof. In some embodiments of a synthetic gene network comprising at least two nucleic acid materials or constructs, the nucleic acid materials or constructs can interact with each other directly or indirectly. An indirect interaction means that other molecules are required for or intermediate in the interaction. Some examples of synthetic gene networks comprise a nucleic acid operably linked to a promoter. In one embodiment, the gene circuit or gene network comprises a riboregulator such as a toehold switch.
(25) In one aspect there is provided a method for generating a reporter molecule in response to a target analyte in a sample. Preferably, the reporter molecule is a molecule such as glucose that can be detected using a readily available sensor such as a glucose monitor. In one embodiment, the method comprises contacting the sample with a synthetic biological circuit in a cell-free system, wherein the target analyte activates the synthetic biological circuit to modify a level of the reporter molecule within a cell-free system reaction volume.
(26) In one embodiment, the target analyte activates the synthetic biological circuit to increase the level of the reporter molecule within the cell-free system reaction volume. In another embodiment, the target analyte activates the synthetic biological circuit to decrease the level of the reporter molecule within the cell-free system reaction volume. For example, the target analyte may activate the synthetic biological circuit to produce an enzyme that increases the level of glucose by breaking down polymeric sugars.
(27) The methods described herein can be used to detect a variety of different target analytes. In one embodiment, the target analyte is an inorganic molecule such as a metal. In another embodiment, the target analyte is an organic molecule, optionally a biomolecule. Synthetic biological circuits that are activated by various inorganic or organic targets are known in the art and can readily be adapted for use in the methods and kits described herein. For example such circuits are described in Roelof Van der Meer and Belkin (Nat Rev Microbiol., 2010, Jull 8(7)511-522), Zhou et al. Chem. Rev., 2017, 117 (12), pp 8272-8325, and Wedekind et al. (The Journal of Biological Chemistry 292, 9441-9450 Jun. 9, 2017), all of which are hereby incorporated by reference.
(28) In one embodiment, the target analyte is a biomolecule such as a nucleic acid (DNA or RNA), protein, lipid, metabolite or sugar molecule. The nucleic acid may be a nucleic acid or variant that is associated with a specific organism and/or phenotype. In one embodiment, the target analyte is a nucleic acid molecule associated with a microbial pathogen, optionally a virus or bacteria. The methods and kits described herein may therefore be used for the detection of specific microbes, optionally for diagnostic purposes. For example, in one embodiment, the target analyte is a nucleic acid molecule associated with microbial drug resistance. In one embodiment, the methods and kits described herein may be used for the detection of enteric fevers such as typhoid or paratyphoid. For example, as shown in Example 4 and
(29) In one embodiment, the sample is from a subject and the target analyte is a biomarker associated with a known phenotype. For example, the biomarker may be associated with a disease or the responsiveness to certain therapies or chemotherapeutic drugs. The methods and products described herein may be used to generate biomarker data for a patient at the point of care, optionally using an inexpensive portable device such as glucose meter.
(30) Alternatively or in addition, the synthetic biological circuits described herein may be used to generate a reporter molecule in response to a metal (e.g. Ni, Co, Fe, Hg), explosive material, herbicide (e.g. atrazine), pollutant and/or toxin. The reporter molecule may then be detected using an inexpensive portable device such as a glucose meter.
(31) The sample may be subjected to various treatments prior to or during contact with the synthetic biological circuit. In one embodiment, the treatment increases the concentration of the target analyte in the sample. Alternatively, or in addition, the sample may be treated to remove one or more contaminants or to dilute the sample to facilitate detection of the target analyte. In one embodiment, the target analyte is a nucleic acid molecule and the method comprises amplifying the nucleic acid molecule in the sample. For example, in one embodiment, the method comprises isothermal amplification of a target DNA molecule or the target RNA molecule, prior to or during contact with the synthetic biological circuit.
(32) In one embodiment, the methods and kits described herein comprise steps and/or reagents for processing a sample prior to detecting one or more target analytes using the synthetic biological circuit. In one embodiment, nucleic acid molecules are extracted from the sample. Various methods of nucleic acid extraction may be used in combination with the embodiments described herein. As shown in the Examples, an adherent substrate such as cellulose-based paper can be used to capture nucleic acids from a sample, such as a sample of lysed cells. Optionally, the nucleic acid molecules are then retained on the substrate during a washing step, while contaminants present in the sample are removed.
(33) Various techniques known in the art may be used to amplify a nucleic acid molecule within the sample. These include, but are not limited to, polymerase chain reaction (PCR), strand displacement amplification (SDA), loop-mediated amplification (LAMP), Invader assay, rolling circle amplification (RCA), signal mediated amplification of RNA technology (SMART), helicase-dependent amplification (HDA), Nicking Enzyme Amplification Reaction (NEAR), recombinase polymerase amplification (RPA), nicking endonuclease signal amplification (NESA) and nicking endonuclease assisted nanoparticle activation (NENNA), exonuclease-aided target recycling, Junction or Y-probes, split DNAZyme and deoxyribozyme amplification strategies, template-directed chemical reactions that lead to amplified signals, non-covalent DNA catalytic reactions, hybridization chain reactions (HCR) and detection via the self-assembly of DNA probes to give supramolecular structures.
(34) In one aspect of the disclosure, a synthetic biological circuit is constructed to modify the level of a reporter molecule such as glucose in response to the presence of a target analyte. In one embodiment, the synthetic biological circuit regulates the expression, level or activity of an enzyme that modifies the level of the reporter molecule in the cell-free system. Optionally, the synthetic biological circuit may operate by regulating the transcription or translation of the enzyme or by post-translational regulation of the enzyme such as by using small molecule controlled inteins.
(35) In one embodiment, the synthetic biological circuit is a gene circuit. In one embodiment, the gene circuit comprises a DNA molecule comprising a promoter operably linked to a nucleic acid encoding one or more enzymes whose expression modifies the level of a reporter molecule such as glucose in the cell-free system. In one embodiment, the gene circuit regulates the transcription of a DNA molecule encoding one or more enzymes or translation of one or more mRNA molecules encoding one or more enzymes. Optionally, two or more synthetic biological circuits regulate the expression of two or more enzymes that modify the level of glucose. In one embodiment, the two or more enzymes modify the level of glucose at different rates, for example by acting on different substrates.
(36) In one embodiment, the gene circuit comprises one or more transcriptional activators or transcriptional repressors. In one embodiment, the gene circuit comprises a riboregulator that controls translation of an mRNA molecule encoding an enzyme. In one embodiment, the riboregulator is a toehold switch. For example, in one embodiment, the target analyte is a trigger for the toehold switch such that binding of the target analyte to the toehold switch permits translation of the mRNA encoding the enzyme in the gene circuit. A skilled person would readily be able to design toehold switches for various target DNA or RNA molecules.
(37) In one embodiment, the cell-free system comprises one or more substrates that respond to the activity of the biological circuit to modify the level of the reporter molecule. For example, in one embodiment, the cell-free system comprises glucose or a substrate that is acted on by an enzyme under control of the synthetic biological circuit to generate glucose.
(38) In one embodiment, the substrate comprises an oligosaccharide or polysaccharide comprising one or more glucose monomers. Exemplary combinations of enzymes and substrates suitable for use in the synthetic biological circuits described herein are shown in
(39) The methods and products described herein may be used to analyze any sample for which information regarding the presence or absence of a target analyte is desired. In one embodiment, the sample is a biological fluid, optionally blood, urine, cerebrospinal fluid or saliva. In one embodiment the sample is a patient sample such as a tissue sample. In another embodiment, the sample is an environmental sample, optionally a water sample. In one embodiment, the sample is a food sample.
(40) In some embodiments, the sample is treated prior to contacting the sample with the synthetic biological circuit in the cell-free system. In one embodiment, treating the sample comprises diluting the sample with a buffer/diluent and/or nuclease free water. In one embodiment, the sample is treated to normalize or lower the concentration of glucose in the sample. The sample may also be treated to remove or reduce the level of contaminants that interfere with the cell-free system and/or the detection of the reporter molecule. In one embodiment, the sample is treated to increase the relative concentration of the target analyte. Alternatively, or in addition, the sample may be subjected to a thermal treatment, such as by heating, cooling and/or freezing the sample. In one embodiment the sample is heated to lyse cells contained in the sample and/or denature endogenous proteins such as naturally occurring enzymes that could interfere with the operation of the cell-free system and/or synthetic biological circuit.
(41) In one embodiment, the sample may be treated to normalize and/or lower the level of a reporter molecule such as glucose in the sample prior to contacting the sample with the synthetic biological circuit. In one embodiment, treating the sample helps control the influence of the sample source, which could potentially include reporter molecules (such as glucose or natural blood sugars) or enzymes that could distort the detection of a target analyte.
(42) In one embodiment, the sample is diluted with a diluent or buffer to reduce the level of the reporter molecule in the sample. In one embodiment, the diluent or buffer comprises a surfactant. In one embodiment, the surfactant is Tween-20. In one embodiment, diluting the sample may bring even high diabetic levels of glucose to below a threshold for the methods described herein. For example, normal glucose levels are 7.8-16.7 mM but occasionally can temporarily exceed 28 mM in extreme hyperglycemia. Diluting the sample by e.g. 10-fold would bring glucose levels to between 0.8 mM and 2.8 mM, which in some embodiments would not be expected to impair the use of the methods described herein.
(43) In some embodiments, the sample may be subjected to additional treatment steps to reduce, remove, sequester and/or normalize the level of glucose. For example, glucose-binding lectins may be used to sequester glucose and/or blood sugars from the sample. In one embodiment, glucose may be removed from the sample by adding an enzyme (e.g. glucose dehydrogenase) that would convert glucose to an inert substance. This process would be limited by the amount of cofactor (e.g. NAD) supplied and tailored to neutralize incoming glucose.
(44) In one embodiment, the method comprises treating the sample with a pre-determined amount of GDH and/or NAD to remove a pre-determined amount of glucose from the sample, such as an average amount of glucose found in a particular sample type.
(45) In one embodiment, the cell-free system comprises a synthetic biological circuit as described herein, enzymes for transcription and translation, ribosomes, dNTPs, tRNAs, and amino acids. Optionally, the cell-free system further comprises one or more of an RNAse inhibitor, a buffer, one or more cofactors, a cryoprotectant and a surfactant, optionally Tween-20. In one embodiment, the cell-free system also comprises a substrate for an enzyme whose expression and/or activity is regulated by the synthetic biological circuit. For example, in one embodiment the cell-free system comprises a pre-determined amount of glucose or a substrate shown in
(46) The components of the cell-free system may be freeze dried and rehydrated prior to, or as part of a method as described herein. For example, in one embodiment the cell-free system is freeze-dried and rehydrated by contact with the sample, a buffer, and/or diluent.
(47) In one embodiment, the methods described herein include detecting a reporter molecule such as glucose whose level is modified by the synthetic biological circuit. In one embodiment, detection of the presence or absence of the reporter molecule is indicative of the presence or absence of the target analyte in the sample. In one embodiment, the method comprises detecting a level of glucose in the cell-free reaction volume.
(48) In one embodiment, the level of glucose in the cell-free reaction volume is indicative of the level of the target analyte in the sample. In one embodiment, the level of glucose in the cell-free reaction volume is indicative of the presence or absence of a plurality of target molecules detected in a multiplex reaction. In one embodiment, the level of glucose in the cell-free reaction volume is determined at a plurality of time points.
(49) While glucose meters are capable of detecting a wide range of glucose levels, meters have conventionally only been used to generate a single readout (glucose in mg/dL). The methods and kits described herein take advantage of the wide dynamic range of glucose meters to create bandwidth for multiplexed outputs. This can be done by selecting enzymes with different kinetics and controlling substrate concentration. By designing non-overlapping glucose yields for each synthetic biological circuit, multiplexed diagnostics are possible with a single readout number. In one embodiment, each sensor in the multiplexed system produces a unique reporter enzyme that converts an oligomeric glucose substrate into monomeric glucose that can be detected by the glucose meter. By selecting enzymes with different kinetics, and tuning the concentration of substrate, template DNA and other molecular/biochemical parameters, the resulting glucose production can be controlled. In one embodiment, sensor outputs are designed to be non-overlapping so that the additive glucose production can be easily used to determine which sensors were activated.
(50) In one embodiment, the sample is contacted or incubated with the synthetic biological circuit in the cell-free system for a pre-determined amount of time prior to detecting glucose in the cell-free reaction volume. In one embodiment, the sample is contacted or incubated with the synthetic biological circuit in the cell-free system for a period of at least 5, 10, 15, 20, 25, 30, 35, 40 or 45 minutes. In one embodiment, the sample is contacted or incubated with the synthetic biological circuit in the cell-free system for a period of 30-180 minutes, optionally between 30 and 90 minutes or between 60 and 90 minutes.
(51) In one embodiment, the method comprises adding a buffer to the cell-free system reaction volume prior to detecting glucose. In one embodiment, the buffer is a composition comprising 0.1 M NaCl, 0.1 M sodium phosphate, 0.05% Tween-20 and has a pH of about 7.3. IN one embodiment, the buffer comprises or consists of Tween-20, optionally about 0.0125% Tween-20 or between 0.01% and 0.02% Tween-20.
(52) In one embodiment, the methods described herein include detecting a level of glucose using a glucose meter, optionally using a glucose test strip. In one embodiment, the method comprises contacting the cell-free reaction volume, or a portion thereof, with a glucose test strip.
(53) As shown in Example 3, the use of a more than one synthetic biological circuit as described herein can be used to detect a plurality of target analytes in a single reaction volume. In one embodiment, the method comprises contacting the sample with a plurality of synthetic biological circuits in a cell-free system, wherein a different target analyte activates each synthetic biological circuit to modify a level of a reporter molecule in the cell-free reaction volume. In one embodiment, each of the plurality of synthetic biological circuits generates glucose using a different substrate and enzyme. In one embodiment, differences in the rate and/or level of the reporter molecule generated by the plurality of synthetic biological circuits in the cell-free system allows for the multiplex detection of a plurality of different target analytes in a single reaction.
(54) As shown in
(55) Optionally, the methods described herein include comparing the level of glucose detected in the cell-free system reaction volume to one or more control levels. In one embodiment, the control level is indicative of a pre-determined level of the target analyte in a control sample tested under similar conditions. In one embodiment, the method comprises comparing the level of glucose detected in the cell-free system reaction volume to one or more control levels, wherein each control level is indicative of the presence or absence of one or more the target analytes in the sample.
(56) In one embodiment, the methods described herein comprise presenting data indicative of the presence or absence of one or more target analytes in the sample to a user. For example, the data may be indicative of the level of the one or more target analytes in the sample. In one embodiment, the data may be indicative of a phenotype or other condition associated with the presence of a target analyte in the sample.
(57) In another aspect of the description, there is provided a kit comprising a cell-free system comprising a synthetic biological circuit that generates or consumes a reporter molecule in response to a target analyte in a sample. In one embodiment, the reporter molecule is glucose. In another embodiment, the reporter molecule is a ketone. In one embodiment, the kit comprises reagents, such as, but not limited to, those in the cell-free system or reagents for increasing the concentration of a target analyte. In one embodiment, the kit comprises reagents for performing a method as described herein.
(58) In one embodiment, the kit comprises a container for receiving the sample and contacting the sample with the cell-free system. In one embodiment, the container comprises a lid and a receptacle. Optionally, the container is adapted to receive a glucose test strip such that a cell-free reaction volume within the container is in contact with the glucose test strip. In one embodiment, the container comprises a chamber containing the cell-free system. For example, in one embodiment the chamber is located in the lid. Optionally, the cell-free system may be freeze dried and positioned within the container. In one embodiment, the cell-free system is associated with a substrate, such as a paper or another inert material.
(59) In one embodiment, the kit comprises a plurality of containers useful in a workflow as described herein. For example, in one embodiment the kit comprises a first container suitable for receiving a sample and extracting nucleic acids onto an adherent substrate. In one embodiment, the kit comprises a second container suitable for washing the adherent substrate to remove impurities. In one embodiment, the kit comprises a third container suitable for eluting nucleic acid molecules captured on the substrate, and optionally for amplifying the nucleic acid molecules in the sample prior to contacting the sample with the synthetic biological circuit. In one embodiment, the adherent substrate is affixed to a lid or cap that is configured to fit one or more of the three containers. This facilitates the transfer of the sample containing the target analyte between the different containers for processing and/or amplifying the sample prior to contact with the synthetic biological circuit.
(60) In one embodiment, the kit comprises reagents for extracting and/or washing a target analyte from a sample. In one embodiment, the kit comprises an extraction buffer suitable for lysing cells to extract nucleic acids. In one embodiment, the kit comprises a wash buffer suitable for removing impurities from a sample of nucleic acid molecules.
(61) In one embodiment, the target analyte is a nucleic acid molecule and the kit comprises reagents for increasing the concentration of the nucleic acid molecule. In one embodiment, the kit comprises reagents for the isothermal amplification of the nucleic acid molecule. Optionally, the reagents for increasing the concentration of the target analyte are combined with the cell-free system within the container or are provided separately within or outside of the container.
(62) In one embodiment, the synthetic biological circuit is a gene circuit. For example, in one embodiment the gene circuit comprises a DNA molecule comprising a promoter operably linked to a nucleic acid encoding one or more enzymes whose expression generates or consumes the reporter molecule in the cell-free system. In one embodiment, the gene circuit comprises a riboregulator that controls translation of an mRNA encoding an enzyme whose expression generates or consumes the reporter molecule in the cell-free system. In one embodiment, the riboregulator is a toehold switch. In one embodiment, the reporter molecule is glucose.
(63) In one embodiment, the cell-free system in the kit comprises glucose or a substrate that is acted on by the enzyme to generate glucose. For example, in one embodiment the cell-free system comprises a pre-determined amount of glucose or a substrate shown in
(64) In one embodiment, the kit comprises reagents for treating the sample prior to contacting the sample with the cell-free system. In one embodiment, the kit comprises reagents for treating the sample to remove and/or sequester endogenous glucose and/or blood sugars from the sample. For example, in one embodiment the kit comprises glucose dehydrogenase (GDH) and NAD, optionally a pre-determined amount of GDH and/or NAD. In one embodiment, the kit comprises lectins to sequester glucose and/or blood sugars in the sample. In one embodiment, the reagents for treating the sample to remove and/or sequester endogenous glucose and/or blood sugars are provided in the kit separated from the cell-free system.
(65) In one embodiment, the kit comprises a diluent or buffer. In one embodiment, the diluent or buffer may be used to dilute the sample and/or rehydrate a cell-free system. In one embodiment, the diluent or buffer comprises nuclease free water and/or a surfactant, optionally Tween-20. In one embodiment, the diluent or buffer is provided within the container separated from the cell-free system. In use, the sample and the diluent or buffer may be contacted with the cell-free system to activate the synthetic biological circuit in response to a target molecule.
(66) In one embodiment, the cell-free system comprises a synthetic biological circuit as described herein, enzymes for transcription and translation, ribosomes, dNTPs, tRNAs, and amino acids. Optionally, the cell-free system further comprises an RNAse inhibitor, a buffer, one or more cofactors, a cryoprotectant and/or a surfactant, optionally Tween-20. In one embodiment, the cell-free system comprises a substrate for an enzyme whose expression and/or activity is regulated by the synthetic biological circuit such as a substrate shown in
(67) In one embodiment, the kit comprises a plurality of different synthetic biological circuits that are activated by different target analytes. For example, different kits may be provided, either alone or in combination, for the detection of different target analytes or combinations of target analytes.
(68) In one embodiment, the kit comprises a device and/or reagents suitable for detecting the reporter molecule within the cell-free reaction volume. For example, in one embodiment the kit comprises a glucose meter and optionally one or more glucose test strips.
Example 1
Use of Synthetic Biological Circuits for Producing Glucose in Response to a Target Analyte in a Cell-Free System
(69) A series of experiments were performed to demonstrate the use of synthetic biological circuits to generate glucose in response to a target analyte in a cell-free reaction. For all experiments, glucose was detecting using a commercially available blood glucose meter and associated test strips (Bayer Contour Blood Glucose Monitoring System).
(70) Endogenous levels of glucose within a sample could potentially interfere with the use of glucose as a reporter molecule, especially for the analysis of biological samples. As shown in
(71) Next, experiments were performed using the PURExpress cell-free system commercially available from New England Biolabs (NEB) that includes reconstituted purified components necessary for transcription/translation from E. coli. A recombinant construct Toehold Switch G was generated with a T7 promoter (in italics) and toehold switch G(underlined) operably connected to DNA encoding trehalase enzyme (SEQ ID NO: 1):
(72) TABLE-US-00001 (SEQIDNO:1) TAATACGACTCACTATAGGGATCTATTACTACTTACCATTGTCTTGCTCTATACAGAAACAGAGGAGAT ATAGAATGAGACAATGGAACCTGGCGGCAGCGCAAAAGATGCGTAAAGATTATAAAGATGATGATGATA AAGGACATCATCATCATCATCACAGCAGCGGCGAGAACCTGTACTTCCAATCCTCTGGAGGTGGGGGTT CTGGAACAGCGGTACGGATAGATTATGCAAGCGGGTTAACTGATCGCGAAAACTCTATGTTCAAAGAAA TCCAGTTGTCAGGCGTTTTTGCCGATTCAAAAACCTTTGTGGATAGCCATCCCAAATTGCCCCTGGCGG AAATCGCCGAGCTTTACCATGTCCGGCAACAGCAGGCGGGTTTTGACCTCGCCGCTTTTGTTCACCGGT ATTTTGAGCTGCCGCCGAGCATTGCCTCCGGTTTTGTCAGCGATACCTCGCGCCCGGTGGAAAAGCATA TCGACATTCTCTGGGATGTGCTCACCCGCCAACCGGACAGGCAGGAGGCGGGAACCCTGCTGCCCTTAC CTTACCCCTATGTCGTTCCCGGCGGCCGCTTCCGCGAAATTTACTACTGGGACAGCTATTTCACCATGC TCGGTTTGCAGGCATCGAAGCGCTGGGATCTGATGGAGGGTATGGTGAATAATTTTTCACACCTGATCG ACACCATCGGCTTTATTCCCAACGGCAATCGCACCTATTACGAGGGCCGCTCCCAGCCGCCTTTTTACG CCCTGATGGTGGAGTTGCTGGCCAATAAACAGGGTGAGTCGGTGCTGCTCGCGCATTTGCCGCATTTGC GCAGGGAATATGAATTCTGGATGGAGGGCGCCGCTAAACTTTCGCCCGCTGCACCCGCGCATCGCCGTG TGGTGCTGCTGCCGGATGGCAGCATACTCAATCGCTACTGGGATGATATAGCCGCGCCGCGCCCGGAAT CCTTCCGCGAAGACTACGAACTGGCGGAAGCCATCGGCGGCAACAAGCGCGAGCTGTACCGCCATATTC GCGCGGCGGCAGAATCCGGCTGGGACTTCAGCAGCCGCTGGTTCAAAGATGGCAATGGCATGGCCAGCA TCCACACCACCGATATTATCCCGGTGGATTTGAATGCGCTGGTCTTTAACCTGGAGCGGATGCTGGCCC ATATTTATGGCTTGCAGGGCGACCAGGATCAGGCCACGCATTACTACCAATTGGCGGAGCAGCGCAAAC AGGCGTTGCTGCGCTACTGTTGGAATGCGCAGCAGGGATTTTTCCACGATTACGATTATGTCGCCGCAC AACAGACGCCGGTCATGTCGCTGGCGGCGGTTTACCCGCTTTATTTCAGTATGGTCGACCAGCGCACGG GCGACCGGGTCGCCGAACAGATAGAGGCGCATTTTATCCAGGCGGGCGGTGTGACCACGACCCTGGCGA CCACAGGCCAGCAGTGGGACGCGCCCAATGGCTGGGCGCCGCTGCAATGGCTGACCATCCAGGGCCTGC GCAATTATCACCACAATTCAGCGGCGGAGCAGATCAAACAGCGCTGGATTGCACTCAACCAGCGCGTTT ACCGCAACACCGGAAAGTTGGTGGAAAAATACAACGTCTATGACCTGGATGTGGCCGGCGGCGGTGGCG AATATGAATTACAGGATGGCTTCGGTTGGACCAACGGTGTCTTGTTGCACTTACTCAACGAAAGTACAC CCTAA
(73) Toehold switch G is activated by RNA trigger sequence G below (SEQ ID NO: 2):
(74) TABLE-US-00002 (SEQIDNO:2) GGGUGAUGGGACAUUCCGAUGUCCCAUCAAUAAGAGCAAGACAAUGGUAA GUAGUAAUAGAUAAG
(75) As shown in
Example 2
Use of a Toehold Switch to Regulate Lactase Expression in a Cell-Free System
(76) A series of cell-free reactions were assembled following a reaction template using a toehold switch to control lactase expression as shown in Table 1.
(77) TABLE-US-00003 TABLE 1 Assembly of master mix and individual reactions for cell-free systems with lactase (also known as beta-galactosidase or LacZ) under the control of a toehold switch. Volumes in microliters. Master Mix Assembly Reagent Lactose Tween-20 NEB A (0.4) NEB B (0.3) (0.005) (mM) (1%) Stock Conc. 2.50 3.33 200.00 1460.00 1.00 Final Conc. 40% of total 30% of total Treatment volume volume 20 mM 0.0125 Neg control - cell-free alone NEB 3.20 2.40 0.04 0.11 0.10 Positive control - glucose spike Glucose 3.20 2.40 0.04 0.11 0.10 Toehold switch alone LacZSwE 3.20 2.40 0.04 0.11 0.10 Toehold switch + Trigger RNA LacZSwE + Trig 3.20 2.40 0.04 0.11 0.10 Master Mix 14.1 10.6 0.18 0.48 0.44 Assembly of Individual Reactions. Glucose LacZ LacZ (mM) Switch Trigger Master 200.00 97.00 257.00 Total Treatment mix 10 mM 10 ng/uL 15 ng/uL ddH2O Volume Neg control - cell-free alone 5.85 0.00 0.00 0.00 2.15 8.00 Positive control - glucose spike 5.85 0.40 0.00 0.00 1.75 8.00 Toehold switch alone 5.85 0.00 0.82 0.00 1.33 8.00 Toehold switch + Trigger RNA 5.85 0.00 0.82 0.62 0.70 8.00 Totals 23.40 0.40 1.65 0.62 5.93 32.00 Toehold switch with beta-galactosides (LacZ) reporter enzyme * Enzyme substrate lactose * Reaction volumes in uL
(78) A recombinant construct Toehold Switch E was generated with a T7 promoter (in italics) and toehold switch E (underlined) operably connected to DNA encoding a lactase reporter enzyme (SEQ ID NO: 3):
(79) TABLE-US-00004 (SEQIDNO:3) TAATACGACTCACTATAGGGAGTTTGATTACATTGTCGTTTAGTTTAGTGATACATAAACAGAGGAGAT ATCACATGACTAAACGAAACCTGGCGGCAGCGCAAAAGATGCGTAAAATGACCATGATTACGGATTCAC TGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCAC ATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCA GCCTGAATGGCGAATGGCGCTTTGCCTGGTTTCCGGCACCAGAAGCGGTGCCGGAAAGCTGGCTGGAGT GCGATCTTCCTGAGGCCGATACTGTCGTCGTCCCCTCAAACTGGCAGATGCACGGTTACGATGCGCCCA TCTACACCAACGTGACCTATCCCATTACGGTCAATCCGCCGTTTGTTCCCACGGAGAATCCGACGGGTT GTTACTCGCTCACATTTAATGTTGATGAAAGCTGGCTACAGGAAGGCCAGACGCGAATTATTTTTGATG GCGTTAACTCGGCGTTTCATCTGTGGTGCAACGGGCGCTGGGTCGGTTACGGCCAGGACAGTCGTTTGC CGTCTGAATTTGACCTGAGCGCATTTTTACGCGCCGGAGAAAACCGCCTCGCGGTGATGGTGCTGCGCT GGAGTGACGGCAGTTATCTGGAAGATCAGGATATGTGGCGGATGAGCGGCATTTTCCGTGACGTCTCGT TGCTGCATAAACCGACTACACAAATCAGCGATTTCCATGTTGCCACTCGCTTTAATGATGATTTCAGCC GCGCTGTACTGGAGGCTGAAGTTCAGATGTGCGGCGAGTTGCGTGACTACCTACGGGTAACAGTTTCTT TATGGCAGGGTGAAACGCAGGTCGCCAGCGGCACCGCGCCTTTCGGCGGTGAAATTATCGATGAGCGTG GTGGTTATGCCGATCGCGTCACACTACGTCTGAACGTCGAAAACCCGAAACTGTGGAGCGCCGAAATCC CGAATCTCTATCGTGCGGTGGTTGAACTGCACACCGCCGACGGCACGCTGATTGAAGCAGAAGCCTGCG ATGTCGGTTTCCGCGAGGTGCGGATTGAAAATGGTCTGCTGCTGCTGAACGGCAAGCCGTTGCTGATTC GAGGCGTTAACCGTCACGAGCATCATCCTCTGCATGGTCAGGTCATGGATGAGCAGACGATGGTGCAGG ATATCCTGCTGATGAAGCAGAACAACTTTAACGCCGTGCGCTGTTCGCATTATCCGAACCATCCGCTGT GGTACACGCTGTGCGACCGCTACGGCCTGTATGTGGTGGATGAAGCCAATATTGAAACCCACGGCATGG TGCCAATGAATCGTCTGACCGATGATCCGCGCTGGCTACCGGCGATGAGCGAACGCGTAACGCGAATGG TGCAGCGCGATCGTAATCACCCGAGTGTGATCATCTGGTCGCTGGGGAATGAATCAGGCCACGGCGCTA ATCACGACGCGCTGTATCGCTGGATCAAATCTGTCGATCCTTCCCGCCCGGTGCAGTATGAAGGCGGCG GAGCCGACACCACGGCCACCGATATTATTTGCCCGATGTACGCGCGCGTGGATGAAGACCAGCCCTTCC CGGCTGTGCCGAAATGGTCCATCAAAAAATGGCTTTCGCTACCTGGAGAGACGCGCCCGCTGATCCTTT GCGAATACGCCCACGCGATGGGTAACAGTCTTGGCGGTTTCGCTAAATACTGGCAGGCGTTTCGTCAGT ATCCCCGTTTACAGGGCGGCTTCGTCTGGGACTGGGTGGATCAGTCGCTGATTAAATATGATGAAAACG GCAACCCGTGGTCGGCTTACGGCGGTGATTTTGGCGATACGCCGAACGATCGCCAGTTCTGTATGAACG GTCTGGTCTTTGCCGACCGCACGCCGCATCCAGCGCTGACGGAAGCAAAACACCAGCAGCAGTTTTTCC AGTTCCGTTTATCCGGGCAAACCATCGAAGTGACCAGCGAATACCTGTTCCGTCATAGCGATAACGAGC TCCTGCACTGGATGGTGGCGCTGGATGGTAAGCCGCTGGCAAGCGGTGAAGTGCCTCTGGATGTCGCTC CACAAGGTAAACAGTTGATTGAACTGCCTGAACTACCGCAGCCGGAGAGCGCCGGGCAACTCTGGCTCA CAGTACGCGTAGTGCAACCGAACGCGACCGCATGGTCAGAAGCCGGGCACATCAGCGCCTGGCAGCAGT GGCGTCTGGCGGAAAACCTCAGTGTGACGCTCCCCGCCGCGTCCCACGCCATCCCGCATCTGACCACCA GCGAAATGGATTTTTGCATCGAGCTGGGTAATAAGCGTTGGCAATTTAACCGCCAGTCAGGCTTTCTTT CACAGATGTGGATTGGCGATAAAAAACAACTGCTGACGCCGCTGCGCGATCAGTTCACCCGTGCACCGC TGGATAACGACATTGGCGTAAGTGAAGCGACCCGCATTGACCCTAACGCCTGGGTCGAACGCTGGAAGG CGGCGGGCCATTACCAGGCCGAAGCAGCGTTGTTGCAGTGCACGGCAGATACACTTGCTGATGCGGTGC TGATTACGACCGCTCACGCGTGGCAGCATCAGGGGAAAACCTTATTTATCAGCCGGAAAACCTACCGGA TTGATGGTAGTGGTCAAATGGCGATTACCGTTGATGTTGAAGTGGCGAGCGATACACCGCATCCGGCGC GGATTGGCCTGAACTGCCAGCTGGCGCAGGTAGCAGAGCGGGTAAACTGGCTCGGATTAGGGCCGCAAG AAAACTATCCCGACCGCCTTACTGCCGCCTGTTTTGACCGCTGGGATCTGCCATTGTCAGACATGTATA CCCCGTACGTCTTCCCGAGCGAAAACGGTCTGCGCTGCGGGACGCGCGAATTGAATTATGGCCCACACC AGTGGCGCGGCGACTTCCAGTTCAACATCAGCCGCTACAGTCAACAGCAACTGATGGAAACCAGCCATC GCCATCTGCTGCACGCGGAAGAAGGCACATGGCTGAATATCGACGGTTTCCATATGGGGATTGGTGGCG ACGACTCCTGGAGCCCGTCAGTATCGGCGGAATTCCAGCTGAGCGCCGGTCGCTACCATTACCAGTTGG TCTGGTGTCAAAAATAA
(80) Toehold switch E is activated by RNA trigger sequence E below (SEQ ID NO: 4):
(81) TABLE-US-00005 (SEQIDNO:4) GGGACAGAUCCACUGAGGCGUGGAUCUGUGAACACUAAACUAAACGACAA UGUAAUCAAACUAAC
(82) As shown in
Example 3
Multiplexed Detection of Target Analytes in a Single Reaction Volume
(83) A common reaction mixture containing two different toehold switches was assembled and aliquoted into replicates. The first set of triplicate reactions were then incubated without trigger and were used to normalize data against background signal. As shown in
(84) More than one target analyte can therefore be distinguished using a single reaction with two different gene circuits. This demonstrates a simulated diagnostic application where more than one pathogen/analyte is distinguished using a single reaction with glucose outputs that are dependent on which RNA input is present.
(85)
(86)
Example 4
Use of Synthetic Biological Circuits for the Detection of Typhoid and Paratyphoid Targets
(87) Toehold switches were designed to detect RNA sequences from typhoid, paratyphoid A, and paratyphoid B respectively. All toehold switches were configured to activate production of a trehalase enzyme for glucose generation.
Example 5
Glucose Meter Mediated Diagnostic Workflow
(88)
(89) Step 1: Sample Collection
(90) The sample may be a patient blood sample or other biological sample.
(91) Step 2: RNA Extraction
(92) Various RNA extraction methods can be used such as a) paper-based extraction or b) magnetic bead extraction.
(93) For paper-based extraction, a paper or membrane is attached to the inside of the cap of a tube using glue or wax. Lysis buffer is added to the sample to a final concentration of 1. The tube is inverted, and the cap incubated with the extract for 1 min, after which the cap is transferred to another tube with wash buffer, and inverted continuously for 1 min. Finally, the cap is transferred to another tube that contains the isothermal reaction mixture. The tube is inverted and incubated with the mixture for another minute to elute the RNA.
(94) For magnetic bead extraction, similar to the paper-based extraction method, lysis buffer is added to the sample to a final concentration of 1. A solution containing magnetic beads will be then added to the sample, and mixed until uniform. The magnetic beads, and the nucleic acid bound to them, will be collected to the side of the tube using a magnet, and the lysis waste removed. The subsequent wash step will proceed similarly; with the wash buffer being added to the tube, the tube being shaken to homogenize the mixture, and with the magnetic beads once again being collected to the side of the tube using a magnet. As a final step, the RNA will be eluted from the beads into either water or directly into an isothermal amplification reaction mixture.
(95) Step 3) Isothermal Amplification Reaction
(96) If the target that is intended to be detected is found at low concentrations in the initial sample, it may be necessary to amplify the target RNA to a level that is compatible with the sensor. This will be done using an isothermal or near-isothermal amplification method, such as NASBA. The reaction incubation may be performed in a smartphone-controlled incubator.
(97) Step 4) Cell-Free Reaction
(98) The amplified RNA may then be added directly to cell-free reactions, which will contain sensors designed to express significant levels of trehalase only upon recognition of the target RNA. The trehalase will then catalyse the breakdown of the trehalose (supplied in the reaction) into glucose monomers. The reaction incubation may be performed in a smartphone-controlled incubator.
(99) Step 5) Glucose Meter
(100) Cell free reactions may then be tested on glucose strips, with the expectation that positive samples would yield a significant increase in glucose levels that could be read by a glucose meter.
(101) Step 6) Analyze Results
(102) A smartphone app may be used to interpret the glucose meter data (and optionally forward data to family doctor or to public health surveillance programs, +/ anonymously). This is optionally the same app that controls the incubator used in Steps 3) and 4)
Example 7
Nucleic Acid Extraction Using Recycling Cap Paper Extraction (ReCap) or Magnetic Beads
(103) Experiments were performed to investigate capturing nucleic acids from samples using paper or membrane. Zou et al. (2017) (hereby incorporated by reference) previously described the use of cellulose paper for nucleic acid purification.
(104) The paper is adhered to the cap of a tube, and the nucleic acids are captured in the initial lysis stage. The cap with the captured nucleic acids is then transferred to a wash tube which removes any potential inhibitors of downstream reactions, which includes any residual glucose from the blood sample. The final stage involves eluting the nucleic acids into an amplification reaction.
(105) Experiments were also performed to investigate capturing nucleic acids from samples using magnetic extraction.
(106) Materials and Reagents
(107) Buffers were used at a final concentration of 1 during the lysis step. 4 buffers allow for more sample to be added at the lysis step.
(108) TABLE-US-00006 TABLE 2 Buffers for ReCap and for Magnetic Bead extraction: A) and B) list different compositions of extraction buffer #3 used for lysis. C) lists the composition of the wash buffer. Note that these buffers are used for both ReCap extraction and the magnetic bead-based extraction. For RNA extraction the buffers were modified to contain 0.5% v/v of Murine RNase Inhibitor (NEB). Reagent Final Initial Final Conc Conc To Add Volume A) - 1x Extraction Buffer #3 Tween-20 1% v/v 100% v/v 0.5 mL 50 mL EDTA 5 mM NA 0.07306 g 50 mL NaCl 100 mM NA 1.1688 g 50 mL Guanidine 1.5 M 8 M 9.375 mL 50 mL Hydrochloride Tris pH8 50 mM 1 M 2.5 mL 50 mL H2O to adj 37.625 ml volume 50 mL B) - 4x Extraction Buffer #3 Tween-20 4% v/v 100% v/v 2 mL 50 mL EDTA 20 mM NA 0.29224 g 50 mL NaCl 400 mM NA 1.1688 g 50 mL Guanidine 6 M 8 M 37.5 mL 50 mL Hydrochloride Tris pH8 200 mM 1 M 10 mL 50 mL H2O to adj 0.5 ml volume 50 mL C) - Wash Buffer Tris pH8 0.01 M 1 M 0.5 mL 50 mL Tween-20 0.10% v/v 100% v/v 0.05 mL 50 mL NFH2O 49.45 mL 50 mL total 50 mL
ReCap Fabrication
(109) Instead of utilizing paper as either loose paper disks or dipsticks, tubes were utilized that have the paper adhered to the inside of the cap of the tube. This method was tested using both Whatman filter paper and Polyethersulfone (PES) membrane, utilizing both hot glue and paraffin wax to adhere the paper/membrane. Theoretically, this method can be adopted for any type and volume of tube with a cap (50 mL, 15 mL, 2 mL, 1.5 mL, strip PCR tubes, etc.)
(110) The following protocol steps were used: 1. Set up Lysis, Wash and Elution tubes. If the buffers contain RNase I Inhibitor, keep the tubes on ice. a. Set up the lysis tube in a ReCap tube, add extraction buffer at the appropriate concentration so that the final concentration of the extraction buffer will be 1 after the addition of your sample. b. In the Wash tube, add 200 L of Wash buffer c. In the Elution tube, set up an amplification reaction mix (for examplea PCR reaction or a NASBA amplification reaction). This tube should be kept on ice. 2. Lysis: a. In a ReCap tube combine sample to be extracted with extraction buffer to a final concentration of 1. b. Mix by Inverting the tube for 1 minute. c. Collect any liquid that may remain adhered to the lid by gently tapping the tube on a counter. 3. Wash a. Transfer the ReCap lid to the Wash tube b. Mix by inverting the tube for 1 minute c. Collect any liquid that may remain adhered to the lid by gently tapping the tube on a counter. 4. Elution a. Transfer the ReCap lid to the elution tube b. Mix by inverting the tube for 1 minute. c. Collect any liquid that may remain adhered to the lid by gently tapping the tube on a counter. d. Remove ReCap lid for a conventional lid. This is important as any reaction that requires significant heat may melt the adhesive used in ReCap. 5. Amplification a. PCR: Run reactions in a standard PCR protocol. For example, ReCap was assayed using NEB Q5 Polymerase Protocol as listed in Table 3. b. Isothermal Reaction: ReCap was assayed using a NASBA reaction as listed in Table 4.
(111) TABLE-US-00007 TABLE 3 PCR amplification protocol. Standard Q5 PCR Reaction 5X Q5 Reaction Buffer 10 L GC enhancer 10 L 10 mM dNTPs 1 L 10 uM fwd primer 2.5 L 10 uM rev primer 2.5 L template 1 L Q5 polymerase 0.5 L NF H20 22.5 L final volume 50 L Conditions temp time Denaturation 98 2 min 30 Cycles 98 15 sec 55 30 sec/kb 72 1 min Final Extension 72 10 min Hold 4 hold
(112) TABLE-US-00008 TABLE 4 Isothermal NASBA protocol 25 L NASBA Reaction Final Composition Vol to add Reaction buffer 0.335 % 8.38 L Nucleotide Mix 0.165 % 4.13 L RNase Inhibitor 0.005 % 0.13 L Primer 1 (500 nM) 0.05 M 0.13 L Primer 2 (500 nM) 0.05 M 0.13 L NF H20 0.035 % 0.88 L Enzyme Mix 0.25 % 6.25 L RNA amplicon* 0.2 % 5.00 L total volume 25 L
(113) NASBA reactions were run at 62 C. for 2 mins, at which point the enzyme mix was added and the reaction was run at 41 C. for 1 hr.
(114) ReCap Extraction and Amplification
(115) 10{circumflex over ()}0 to 10{circumflex over ()}10 copies of mRFP1 plasmid DNA template were spiked into extraction buffer, bound to paper, washed, and eluted into 50 L PCR reactions. In the PCR+ control 10{circumflex over ()}0 to 10{circumflex over ()}10 copies of DNA template were added directly to the Q5 polymerase PCR reaction. 5 L of the PCR products were run on a 1% agarose gel. As shown in
(116) SYBR Green I dye was added to the same reactions as shown in
(117) Magnetic Bead Extraction and Amplification
(118) As an alternative to ReCap extraction, experiments were performed using magnetic bead-based extraction methods with magnetic beads from the Genesig Easy DNA/RNA Extraction kit (Tube 3), along with the buffers (listed in Table 2) from the ReCap paper extraction method. The following protocol steps were used: 1. Lysis a. Add sample and extraction buffer to a final concentration of 1. Add an equal volume of Tube 3 (solution with Magnetic beads) as supplied in the kit. b. Shake the tube and wait for 15 minutes c. Magnetize and remove all liquid 2. Wash a. Add 200 L of Wash buffer. b. Shake the tube and wait 30 seconds c. Magnetize and remove all liquid. 3. Elute a. Elute in the appropriate volume of water or amplification mix.
(119) Similar to the experiments performed for ReCap, 10{circumflex over ()}0-10{circumflex over ()}10 copies of mRFP1 plasmid were added to 50 L of extraction buffer, bound to magnetic beads, washed, and eluted into Q5 polymerase PCR buffer. The reaction products were run on a 1% agarose gel. As shown in
(120) Isothermal Amplification and Cell-Free Reaction
(121) The amplification methods used for amplifying nucleic acids prior to detection using a synthetic circuit are preferably isothermal or near-isothermal (i.e. NASBA). Experiments were performed using Zika sensors (see Pardee et al. 2016, hereby incorporated by reference) in order to investigate the use of ReCap paper extraction with NASBA.
(122) 10{circumflex over ()}10 copies of Zika virus Trigger 3 RNA were spiked into 50 L of extraction buffer, bound to paper, washed, and eluted into a 25 L NASBA reaction. NASBA reactions were then added in a 1:7 ratio to 1.8 L cell-free reactions containing Zika toehold sensors that produce the LacZ enzyme only upon recognition of the Zika RNA trigger. The LacZ enzyme produced then cleaves a substrate (CPRG) to produce chlorophenol red, which can be detected at 570 nM.
(123) As shown in
Example 8
Environmental Sensing of Mercury Using Synthetic Biological Circuits
(124) Glucose meter mediated sensing using synthetic biological circuits may also be used for the detection of environmental analytes, such as metals. Specifically, the sensors and methods may be used for environmental monitoring and remediation, as well as for detecting/prospecting for valuable metals such as precious or rare earth elements.
(125) Current methods of sensing environmental mercury rely on expensive equipment such as atomic absorption (AA) spectroscopy, High Pressure Liquid Chromatography (HPLC) and Mass Spectroscopy MS in order to determine levels of mercury contamination present in water, tissue and soil samples.
(126) For the purposes of detecting mercury, samples may include water, tissue, and soil samples. The extraction method depends on the type of sample. For example, for soil-based extraction a combination of centrifugation and filtration methods are common (see for example Reis et al. 2014). For extraction of mercury from tissue samples, samples may be lyophilized and microwaved (see for example Hinojosa Reyes et al. 2009)
(127) For extraction of mercury from water, samples are most commonly subjected to a method of coagulation/filtration.
(128) As shown in
(129) Mercury sensors are designed using the Tn21 Promoter, which is bound and sequestered by a MerR repressor in the absence of mercury. Once mercury is present, the repressor unbinds and exposes the Tn21 promoter, allowing for transcription of downstream genes by the E. coli RNA polymerase (RNAP). Sensor design is tested using deGFP fluorescent reporter before coupling the Tn21-MerR gene regulatory system with a Trehalase enzyme for use with a glucose meter. The Trehalase enzyme catalyses the breakdown of trehalose into glucose monomers in the presence of mercury. The produced glucose levels are measured on glucose test strips with a glucose meter. Optionally, a smartphone app assists with interpreting the results from the glucose meter and with data analysis.
(130) All publications, biological sequences or sequence identifiers, patents and patent applications are herein incorporated by reference in their entirety to the same extent as if each individual publication, biological sequence, patent or patent application was specifically and individually indicated to be incorporated by reference in its entirety.
REFERENCES
(131) Hinojosa Reyes et al. Robust microwave-assisted extraction protocol for determination of total mercury and methylmercury in fish tissues. Analytica Chimica Acta Volume 631, Issue 2, 12 Jan. 2009, Pages 121-128.
(132) Lan et al. Transforming the blood glucose meter into a general healthcare meter for in vitro diagnostics in mobile health. Biotechnol Adv. 2016, 34(3), 331-341.
(133) Pardee et al. Paper-based Synthetic Gene Networks. Cell, 2014, 159: 940-954.
(134) Pardee et al. Rapid, Low-Cost Detection of Zika Virus Using Programmable Biomolecular Components. Cell. 2016 May 19; 165(5):1255-66.
(135) Reis et al. Extraction of mercury water-soluble fraction from soils: An optimization study. Geoderma Volume 213, January 2014, Pages 255-260.
(136) Roelof Van der Meer and Belkin. Where microbiology meets microengineering: design and applications of reporter bacteria. Nat Rev Microbiol., 2010, Jull 8(7)511-522).
(137) Wang et al. Multiplex detection of nucleic acids using a low cost microfluidic chip and a personal glucose meter at the point-of-care. Chem. Commun., 2014, 50, 3824-3826.
(138) Wedekind et al. Metalloriboswitches: RNA-based inorganic ion sensors that regulate genes. The Journal of Biological Chemistry 292, 9441-9450 Jun. 9, 2017.
(139) Yu Xiang and Yi Lu. Using personal glucose meters and functional DNA sensors to quantify a variety of analytical targets Nat Chem. 2011 Jul. 24; 3(9): 697-703.
(140) Zhou et al. Metal Sensing by DNA. Chem. Rev., 2017, 117 (12), pp 8272-8325.
(141) Zou et al. Nucleic acid purification from plants, animals and microbes in under 30 seconds. PLoS Biol 15(11): e2003916. Nov. 21, 2017.