Identification of rare products of crossing organisms
12215309 ยท 2025-02-04
Assignee
Inventors
- Arthur Roelof Gorter DE VRIES (Delft, NL)
- Charlotte Catharina KOSTER (Delft, NL)
- Jean-Marc Georges Daran (Delft, NL)
- Jan-Maarten GEERTMAN (Amsterdam, NL)
- Niels Gerard Adriaan KUIJPERS (Amsterdam, NL)
Cpc classification
G01N1/30
PHYSICS
International classification
Abstract
The invention relates to methods for identifying a hybrid organism, based on staining of parent cells with a dye, preferably a fluorescent dye. A preferred dye is a succinimidyl ester-coupled dye. The invention further relates to the resulting hybrid organism, preferably an interspecies hybrid organism, that is labelled with a dye.
Claims
1. A method for identifying a hybrid yeast organism, comprising (a) providing cells from a first and second yeast parent organism, whereby the first and second yeast parent organisms are mating-compatible, whereby the first yeast parent organism differs from the second yeast parent organism, whereby said first yeast parent organism, but not said second yeast parent organism, carries an auxotrophic marker, (b) labelling cells from the second yeast parent organism with a fluorescent dye; (c) hybridizing cells from the first yeast parent organism with labelled cells from the second yeast parent organism at a temperature between 5 C. and 15 C.; and (d) identifying a hybrid yeast organism as an auxotrophic, labelled cell.
2. The method of claim 1, wherein the cells from the first yeast parent organism and/or the second yeast parent organism are gametes or spores that are labelled after germination.
3. The method of claim 1, wherein the cells from the first yeast parent organism or from the second yeast parent organism are diploid.
4. The method of claim 1, wherein the first and second yeast parent organisms are microorganisms.
5. The method of claim 1, wherein the first and second yeast parent organisms are Saccharomyces sensu stricto yeasts.
6. The method of claim 1, wherein the first and second yeast parent organisms are different yeast species and the resulting hybrid is an interspecies hybrid.
7. The method of claim 1, wherein identification of the yeast hybrid organism is performed by fluorescence activated cell sorting (FACS).
8. The method of claim 1, further comprising determining a ploidy of an auxotrophic, labelled cell and identifying a hybrid yeast organism as an auxotrophic, labelled cell having the summed ploidy of the first and second yeast parent organisms.
9. A method for identifying a hybrid yeast organism, comprising (a) providing cells from a first and second yeast parent organism, whereby the first and second yeast parent organisms are mating-compatible, whereby the first yeast parent organism differs from the second yeast parent organism, whereby said first yeast parent organism, but not said second yeast parent organism, carries an auxotrophic marker, (b) labelling cells from the second yeast parent organism with a fluorescent dye; (c) hybridizing cells from the first yeast parent organism with labelled cells from the second yeast parent organism at a temperature that is at least 5 C. below an optimal growth temperature of the first yeast parent organism and/or the second yeast parent organism; and (d) identifying a hybrid yeast organism as an auxotrophic, labelled cell.
10. The method of claim 9, wherein the first and second yeast parent organisms are different yeast species and the resulting hybrid is an interspecies hybrid.
Description
FIGURE LEGENDS
(1)
(2)
(3)
(4)
(5)
(6)
DETAILED DESCRIPTION OF THE INVENTION
(7) Definitions
(8) The term hybrid or hybrid organism, as is used herein, refers to an organism that is the result of combining genomes of two organisms of different varieties, species or genera. A hybrid preferably is the result of sexual crossing, meaning that the hybrid organism is the result of fusion of two cells of different sex, such as two cells of different mating types, preferably two gametes.
(9) The term interspecies hybrid, as is used herein, refers to an organism that is the result of combining genomes of two organisms of different species or genera.
(10) The terms first parent organism and second parent organism, as are used herein, refer to two organisms of different varieties, species or genera. Said two organisms are hybridization-compatible.
(11) The term hybridization-compatible, as is used herein, refers to two organisms that can be crossed, preferably sexually crossed. When the two organisms are yeast organism, the term mating compatable may be used, which equals the term hybridization-compatible.
(12) The terms dye A and dye B refer to different fluorescent dyes that can be used to stain cells.
(13) The term optimal growth temperature, as is used herein, refers to the temperature at which the cells from a first parent organism and from a second parent organism growth optimally, meaning that cells complete a full cell cycle fastest. Most plants, algae and yeast have an optimal growth temperature between 10 and 50 C., preferably between 15 and 40 C., such as between 18 C. and 25 C., more specifically between 20 C. and 22 C.
(14) The term auxotrophic marker, as is used herein, refers to marker genes that encode key enzymes in metabolic pathways towards essential metabolites, especially monomers, used in biosynthesis. An example is the URA3 gene, which encodes orotidine-5-phosphate decarboxylase, an essential enzyme in pyrimidine biosynthesis in Saccharomyces cerevisiae. Similarly, HIS3, LEU2, TRP1, and MET15 marker genes encode essential enzymes for de novo synthesis of the amino acids histidine, leucine, tryptophan, and methionine, respectively. The presence of an auxotrophic marker allows growth of cells in the absence of the corresponding essential metabolite.
(15) The term gamete, as is used herein, refers to a haploid cell that may fuse with another haploid cell during fertilization. Said haploid cell results from a reductive cell division process termed meiosis. Most organisms have two morphologically distinct types of gametes. Some organisms, including yeast, have morphologically identical types of gametes that, however, differ in allele expression in one or more loci termed mating-type regions. Most plants, algae and yeast organisms can cycle between a diploid and a haploid stage.
(16) The term diploid, as is used herein, refers to a cell or an organism comprising of two sets of chromosomes. One set of chromosomes is obtained from one parent, while a second set of chromosomes normally is obtained from a second parent. The term diploid is used to separate cells and organisms having two sets of chromosomes, from cells and organisms having one set of chromosomes, termed haploid, and from cells and organisms having multiple sets of chromosomes, termed polyploid. Polyploid cells and organisms include triploid, tetraploid, pentaploid, hexaploid and octaploid cells and organisms.
(17) The term aneuploid, as is used herein, refers to a cell or an organism in which not all chromosomes are present in the same number of copies. Hence, the chromosome complement can not be indicated as a defined number of complete chromosome sets, such as n, 2n, 3n, or 4n, as is known to a person skilled in the art. The term aneuploidy refers to the presence of an abnormal number of chromosomes in a cell or organism, in contrast to an euploid cell. An aneuploid cell may miss or have an extra part of a chromosome, or may miss one or more chromosome or have one or more chromosomes extra.
(18) The term germination, as is used herein, refers to the process by which a seed or a gamete recovers the ability to grow vegetatatively, resulting in multicellular structures or in cell replication by mitotic growth. The most common example of germination is the sprouting of a seedling from a seed. In addition, the growth of a sporeling from a spore, such as the spores of hyphae from fungal spores, is also termed germination. In addition, the process in which a fungal spore sheds its spore wall and recovers normal metabolic activity, such as occurs in yeasts is also termed germination. Germination often depends on conditions such a temperature, humidity, oxygen supply and sometimes light or darkness.
(19) The term microorganism, as is used herein, refers to a unicellular or multicellular eukaryotic organism such as a fungus including a yeast and a protist such as algae. Most microorganisms are unicellular.
(20) The term yeast, as is used herein, refers to eukaryotic, unicellular microorganisms that are classified as members of the kingdom fungus. A most preferred yeast is a Saccharomyces sensu stricto complex. The Saccharomyces sensu stricto complex currently encompasses nine different species: Saccharomyces cerevisiae, S. paradoxus, S. cariocanus, S. uvarum, S. mikatae, S. kudriauzevii, S. arboricola, S. eubayanus and the recently discovered S. jurei [Hittinger, 2013. Trends Genet 29: 309-317; Naseeb et al., 2017. Int J Syst Evol Microbiol 67: 2046-2052].
(21) Cells
(22) Cells of an organism may be grown in a suitable medium comprising, for example, peptone/yeast extracts, or in synthetic medium. If required, a suitable compound enabling growth in presence of a specific genetic marker, for example G418 (2R,3S,4R,5R,6S)-5-Amino-6-[(1R,2S,3S,4R,6S)-4,6-diamino-3-[(2R,3R,4R, 5R)-3,5-dihydroxy-5-methyl-4-methylaminooxan-2-yl]oxy-2-hydroxycyclohexyl]oxy-2-(1-hydroxyethyl)oxane-3,4-diol), may be added to grow specifically cells that are resistant to such compound.
(23) Homothallic diploid cells, especially homothallic diploid yeast cells, are preferably sporulated and germinated to obtain haploid gametes, before staining and mating. As an alternative, diploid cells may be stained and mated directly as diploids.
(24) For sporulation, cells may be isolated, for example by filtration and/or centrifugation, washed, for example with phosphate buffered saline or with sterile water and resuspended in sporulation medium, for example in 1% (w/v) potassium acetate, 0.02% (w/v) raffinose, adjusted to pH=7 by addition of KOH, and supplemented with adenine, arginine, histidine, isoleucine, leucine, lysine, methionine, threonine, tryptophan, tyrosine, valine and/or uracil, dependent on the specific organism. Cells are preferably incubated in plates or tubes that allow sufficient aeration, as sporulation has high respiratory requirements.
(25) Sporulation is preferably performed for at least 48 hours, preferably between 48 and 96 hours, preferably about 72 h, at 15-25 C., preferably about 20 C. Cells are preferably shaken at about 200 RPM during sporulation.
(26) Following sporulation, spores may be isolated as is known to a person skilled in the art. Suitable protocols for sporulation and isolation of spores are known, including Beckman and Payne, 1983. Phytopathol 73: 286-289; El-Gholl, et al., 1982. Can J Botany 60: 862-868; Wang et al., 2016. Nature Scientific Reports 6: 24923; Alani et al., 1990. Cell 61: 419-436.
(27) For germination, spores are preferably incubated in a suitable medium, preferably a rich medium such as YPD, for a period of at least 1 hours, for example 2-10 hours, preferably about 5 hours. It is preferred that the spores are stirred during incubation. Incubation preferably is at an optimal growth temperature, for example between 20 and 35 C., preferably at about 30 C.
(28) Staining of Cells
(29) Cells of a first and a second organism are stained with a cell-staining fluorescent dye. Said cell-staining dye preferably is non-toxic and suitable for permanently labelling cells with the fluorescent dye in vivo and/or in vitro. Said cell staining or cell labelling preferably does not affect cell morphology and/or cell physiology.
(30) Said cell labelling may be performed by direct or indirect labelling. Indirect labelling includes use of, for example, secondary antibodies that are labelled with the fluorescent dye and the use of tagged compounds, for example tagged proteins, against which an antibody comprising a fluorescently labelled dye is used.
(31) Labelling preferably is direct. Labelling is preferably preformed by labelling primary amines (RNH2) of proteins, amine-modified oligonucleotides, and other amine-containing molecules.
(32) For this, a dye preferably comprises a succinimidyl group, preferably a succinimidyl ester, to couple the dye to intracellular lysine residues and other amine sources. Further preferred dyes include thiol-reactive dyes, in which a fluorescent label is coupled to, for example, iodoacetamide, maleimide, benzylic halide or a bromomethylketone. In addition, microinjectable dyes comprising a polar dye such as lucifer yellow CH, Cascade Blue hydrazide, Alexa Fluor hydrazides and biocytin that may be introduced into a cell by whole-cell patch clamping, iontophoresis, osmotic lysis of pinocytic vesicles; and/or fluorescent dextran conjugates or fluorescent microspheres that may be loaded into cells by invasive techniques such as microinjection, whole-cell patch clamping, scrape loading, microprojectile bombardment, electroporation or osmotic shock, can be used to stain cells in methods of the invention.
(33) Said fluorescent label preferably is selected from Abz (Anthranilyl, 2-Aminobenzoyl), N-Me-Abz (N-Methyl-anthranilyl, N-Methyl-2-Aminobenzoyl), FITC (Fluorescein isothiocyanate), 5-FAM (5-carboxyfluorescein), 6-FAM (6-carboxyfluorescein), TAMRA (carboxytetramethyl rhodamine), Mca (7-Methoxycoumarinyl-4-acetyl), AMCA or Amc (Aminomethylcoumarin Acetate), Dansyl (5-(Dimethylamino) naphthalene-1-sulfonyl), EDANS (5-[(2-Aminoethyl)amino]naphthalene-1-sulfonic acid), Atto (e.g. Atto465, Atto488, Atto495, Atto550, Atto647), cyanine (Cy) dyes, including Cy3 (1-(5-carboxypentyl)-3,3-dimethyl-2-((1E,3E)-3-(1,3,3-trimethylindolin-2-ylidene)prop-1-en-1-yl)-3H-indol-1-ium chloride), Cy5 (1-(5-carboxypentyl)-3,3-dimethyl-2-((1E,3E,5E)-5-(1,3,3-trimethylindolin-2-ylidene)penta-1,3-dienyl)-3H-indolium chloride), including trisulfonated Cy5, and Cy7 (1-(5-carboxypentyl)-2-[7-(1-ethyl-5-sulfo-1,3-dihydro-2H-indol-2-ylidene)hepta-1,3,5-trien-1-yl]-3H-indolium-5-sulfonate), Alexa Fluor (e.g. Alexa Fluor 647, Alexa488, Alexa532, Alexa546, Alexa594, Alexa633, Alexa647), Bodipy (e.g. Bodipy FL), Dylight (e.g. DyLight 488, DyLight 550), Lucifer Yellow (ethylene diamine or 6-amino-2-(2-amino-ethyl)-1,3-dioxo-2,3-dihydro-1H-benzo[de]isoquinoline-5,8-disulfonic acid) and derivatives thereof.
(34) Cells of a first organism may be labeled with a first dye, herein after termed dye A, while cells of a second organism may be labeled with a second dye, herein after termed dye B. Dye A and dye B are fluorescent dyes, whereby dye A differs from dye B. In addition, cells labelled with dye A preferably can be distinguished from cells labelled with dye B; for example by employing dyes with different excitation and/or emission spectra. Suitable dyes that can be used in methods of the invention can be excited by a monochromatic light source, preferably a laser, more preferably by an ultraviolet laser (about 355 nm). a violet laser (about 405 nm), a blue laser (about 488 nm) or a red laser (about 640 nm). For example, dye A may be a dye that is excited with a red laser at about 630 nm, and which emits at about 661 nm, while dye B is a dye that is excited with a blue laser at about 492 nm and which emits at about 517 nm.
(35) It will be clear to a person skilled in the art that preferred dye combinations include dyes that can be distinctly measured, preferably by two emission filters without spectral overlap, preferably without the need for fluorescence compensation, more preferably dyes that can be excited by two different by two different lasers to minimize spectral overlap, such as with a violet laser (about 405 nm), a blue laser (about 488 nm) or a red laser (about 640 nm). Preferred combinations, which allows cells that are stained with dye A to identify and isolate from cells stained with dye B are fluorescent dyes that can be excited with a violet laser and a blue laser; with a violet laser and a red laser, or with a blue laser and a red laser.
(36) Dye A and dye B preferably are dyes that also allow the identification and isolation of cells that harbor both dye A and dye B, from cells that harbor only dye A and only dye B. For this, preferred dyes include a dye that is excited with a red laser at about 630 nm, and which emits at about 661 nm, and a dye that is excited with a blue laser at about 492 nm and which emits at about 517 nm.
(37) Staining of cells can be performed by methods known in the art. For example, cells of an organism may be incubated with a dye, preferably a succinimidyl ester-coupled dye, for a period of time, preferably between 0.1 hour and 1 day, preferably between 10 minutes and overnight. It is preferred that cells are concentrated, for example by filtration or centrifugation, followed by incubation in a balanced electrolyte solution,
(38) Staining preferably is performed at a reduced temperature to prevent cell proliferation. Therefore, staining preferably is performed at a temperature below 20 C., preferably between 5 C. and 15 C., more preferably between 10 C. and 13 C., most preferably about 12 C. By reducing the temperature, cell division takes longer.
(39) Staining, and further mating and processing of stained cells, preferably is performed under reduced light conditions, preferably in the dark.
(40) Hybridization of Cells
(41) The production of a hybrid organism through fusion of cells is called hybridization. If the cells are somatic cells that are hybridized under in vitro conditions, the term somatic hybridization is applicable.
(42) In vitro somatic cell hybridization was first discovered by the group of George Barski (Barski et al., 1960. C R Hebd Seances Acad Sci 251: 1825-7). Spontaneous hybridization is rare. Hybridization of stained parent organisms may be induced either chemically, for example with polyethylene glycol, or with inactivated virus, for example Sendai Virus. Protocols for generating hybrids, including interspecies hybrids, are known. Examples of such protocols are present in, for example, Grosser et al., 1996. Theor Appl Genet 92: 577-582; Kisaka et al., 1998. Plant Cell Rep 17: 362-367; Matsumoto et al., 2002. Euphytica 125: 317-324.
(43) If the parent organism are yeasts, hybridization or mating may be performed by incubating stained parent cells in rich medium, for example 1% (w/w) yeast extract, 2% (w/w) peptone and 2% (w/w) glucose.
(44) For hybridization, stained cells may be brought in close contact with each other, for example by filtration or centrifugation, followed by incubating the cells in an appropriate medium.
(45) Hybridization preferably is performed at a temperature that is below the optimal growth temperature of the parent organism, in order to prevent excessive cell proliferation. By reducing the temperature, cell division takes longer, while hybridization is less affected. Hence, a higher proportion of the resulting cells are hybrid cells, when compared to hybridization at a higher temperature. A hybridization temperature that is at least 5 C. below the optimal growth temperature of the parent organisms was found to limit loss of staining by the dyes and to result in identification of rare interspecies hybrids resulting from hybridization between the first parent organism and the second parent organism.
(46) A temperature that is at least 5 C. below the optimal growth temperature of the first and/or the second parent organism is preferably below 18 C., preferably between 5 C. and 15 C., more preferably between 10 C. and 13 C., most preferably about 12 C. A person skilled in the art is unquestionably able to determine an optimal growth temperature of a plant, an alga and/or a yeast with an unusual optimal growth temperature, for example by growing cells of the plant, alga and/or yeast at different temperatures.
(47) Hybridization of cells is preferably performed in the dark to prevent bleaching of the fluorescent dyes, as will be clear to a person skilled in the art.
(48) Hybridization preferably performed by statically incubating the cells of the first and second parent organisms in the dark at a temperature of at least 5 C. below the optimal growth temperature for a period of at least 2 hours, preferably for a period of between 2 and 48 hours, such as 12 hours, 16 hours, 24 hours and 36 hours. A preferred period is overnight, which routinely is about 16 hours.
(49) Isolation of Cells
(50) Following hybridization of cells of the first and second parent organisms, hybrid cells such as interspecies hybrid cells, are identified and separated from the first and second parent organisms. Because cells from the first parent organism are stained with fluorescent dye A and cells from the second parent organism are stained with dye B; hybrid cells such as interspecies hybrid cells can be isolated on the basis of a staining with both dye A and with dye B. For example, if cells of the first parent are stained with carboxyfluorescein, and cells of the second parent are stained with Far Red, hybrid cells with be visible as emitting at about 661 nm when excited with a red laser at about 630 nm, and emitting at about 517 nm when excited with a blue laser at about 492 nm.
(51) Such dual stained hybrid cells can be isolated from singular stained cells by any method known in the art. For example, a microscope equipped with a micromanipulator may be used to identify and isolate dual labelled hybrid cells.
(52) A preferred method to sort dual labelled cells comprises a flow cytometry technique such as fluorescent activated cell sorting (FACS). A FACS has the additional advantage that the morphology of the cells can simultaneously be analysed by forward scatter and side scatter. Based in the staining pattern and the forward/side scatter, sorting gates can be set to determine the types of cells to be sorted. Gated single cells can be isolated in individual receptacles, for example in well of a multiwell plate such as a 96-well microtiter plate.
(53) Following isolation of single hybrid cells, they may be grown in the individual receptacles. In case the gated cells comprise false positive hybrid cells comprising closely associated cells of the first and second parent that were scored as double stained singular cells, the isolated dual labelled cells may be subjected to a second round of identifying a hybrid organism as a dual labelled cell and isolating the dual labelled cell from singular labelled cells. The dyes that are used for this second round may be identical or different from the dyes that are used in the first round, as long as a hybrid organism can be isolated as a dual labelled cell from singular labelled cells.
(54) Prior to the second round of identifying a hybrid organism, associated cells may be detached by incubating the cells, for example, with a detergent and/or sonicating or vortexing the cells, as is known to a person skilled in the art. In addition, cells may be incubated in the presence of a chelating agent, for example ethylenediaminetetraacetic acid, a surfactant and/or an enzyme such as zymolyase and/or lyticase.
(55) As an alternative, or in addition, the ploidy of the cells may be determined, for example by flow or laser-scanning cytometry. Such method relies on labeling cells with a fluorochrome that is expected to stain DNA stoichiometrically and thus accurately report DNA content. For analytical purposes, a portion of the cells may be permeabilized by a detergent and/or a fixative such as methanol or ethanol and labeled with a DNA-specific fluorochrome. For example, a sample of the cells may be fixed, for example using ethanol, and stained with a nucleic acid stain such as SYTOX Green Nucleic Acid Stain (Invitrogen S7020). Preferably, a fluorochrome which can penetrate into live cells due to innate permeability of the cellular membrane is used, such as Vybrant Dyecycle dyes (ThermoFisher Scientific). Fluorescence of the samples may be determined on a flow cytometer, using a laser and emission filter suitable for detection of the DNA-binding fluorescent stain. Suitable conditions may be excitation with a 488 nm laser and detecting emission through a 533 bandpass filter with a bandwidth of 30 nm. Cells may be sorted that have the expected ploidy which is the summed ploidy of the first and second parent organisms. For example, when a first parent organism is haploid (1N), and a second parent organism is diploid (2N), a hybrid organism can be scored as 3N.
(56) For the purpose of clarity and a concise description, features are described herein as part of the same or separate embodiments, however, it will be appreciated that the scope of the invention may include embodiments having combinations of all or some of the features described.
EXAMPLES
Example 1
(57) Materials and Methods
(58) Strains, Media and Cultivation
(59) The S. cerevisiae and S. eubayanus strains used in this study are listed in Table 1. Strains were routinely grown in complex medium (YP), containing 10 g L1 yeast extract and 20 g L1 peptone supplemented with 20 g L1 glucose for YPD and with 20 g L1 trehalose for YPT. Synthetic medium (SM) containing 20 g L1 glucose, 3 g L.sup.1 KH2PO4, 5.0 g L.sup.1 (NH4)2SO4, 0.5 g L.sup.1 MgSO4.Math.7 H2O, 1 mL L.sup.1 of a trace element solution and 1 mL L.sup.1 of a vitamin solution, was prepared as described previously [Verduyn et al., 1992. Yeast 8: 501-517], and the pH was set to 6.0 using 2 M KOH. Selection for the KanMX marker was performed in SM+G418, which corresponds to SM medium supplemented with 0.2 g L.sup.1 of G418 (Invitrogen, Carlsbad, Calif., USA) in which (NH4)2SO4 was replaced by 1 g L.sup.1 monosodium glutamate as ammonium sulfate impedes G418 [Cheng et al., 2000. Nucleic Acids Res 28: e108-e108]. For solid media, 20 g L1 agar was added to media. Sporulation was performed in sporulation medium, containing 2% potassium acetate with the pH set to 7.0 using acetic acid [Bahalul et al., 2010. Yeast 27: 999-1003]. Saccharomyces strains were propagated in YPD in either 500 mL round-bottom shake flasks with a working volume of 100 mL or in 50 mL Greiner Polypropylene Filter Top Tubes with a working volume of 30 mL. S. cerevisiae and S. eubayanus cultures were grown at 30 C. and 20 C., respectively, at 200 RPM in an Innova44 incubator shaker (Eppendorf, Nijmegen, the Netherlands). Frozen stocks were prepared by addition of glycerol (30% v/v) to exponentially growing shake-flask cultures and stored aseptically in 1 mL aliquots at 80 C.
(60) Staining of Saccharomyces Cultures
(61) For staining, CellTrace Violet, CellTrace CFSE and CellTrace Far Red fluorescent dyes (Thermo Fisher Scientific, Waltham, Mass., USA) were prepared according to the manufacturers' recommendations. Cultures were stained with 2 L CellTrace dye per mL culture and incubated overnight in the dark at 12 C. and 200 RPM. Dyed cultures were washed twice with YP medium to remove any leftover dye by binding to the yeast extract and peptone.
(62) Intraspecific Mating
(63) For intraspecific mating experiments, two heterothallic haploid S. cerevisiae strains were propagated until mid-logarithmic phase. The cultures were washed and diluted in sterile Isoton II (Beckman Coulter, Woerden, NL) to a final cell density of approximately 106 cells mL-1 and stained with CellTrace Violet and CellTrace CFSE as described. The two stained cultures were mated by pipetting them together into one Greiner tube. The cells were pelleted and resuspended in YPT. The mating culture was transferred to an Eppendorf tube and centrifuged briefly (2000 g, 1 min) to increase proximity of the cells for more efficient mating. Subsequently, the mating culture was statically incubated at 12 C. in the dark until FACS analysis.
(64) Interspecies Mating and Rare Mating
(65) Homothallic diploid strains were sporulated and germinated prior to staining and mating to obtain haploid gametes which could readily mate with the homothallic haploid gametes or heterothallic haploid cells of the other species. For rare mating, diploid strains were either treated as above or stained and mated directly as diploids. For sporulation, 10 mL of stationary phase culture was spun down, washed with sterile demineralized water and resuspended in 9 mL of sporulation medium in a 50 mL Polypropylene Filter Top Tubes to ensure sufficient aeration, as sporulation has high respiratory requirements [Sherman, 1963. Genetics 48: 375]. Sporulation cultures were incubated for at least 72 h at 20 C. and 200 RPM. The presence of asci was determined using microscopy. By default, spores were isolated as described by Herman and Rine [Herman and Rine, 1997. EMBO J 16: 6171-6181] with minor modifications. In short, spores were pelleted (1000 g, 5 min), resuspended in in softening buffer (10 mM dithiothreitol, 100 mM Tris-SO4, pH set to 9.4 with H2SO4) and incubated at 30 C. for 10 minutes. Cells were washed using demineralized water, resuspended in spheroplasting buffer (2.1 M sorbitol, 10 mM KH2PO4, pH set to 7.2 with 1M NaOH) with 0.8 gL1 Zymolyase 20-T (AMS Biotechnology Ltd., Abingdon, UK) and incubated overnight at 30 C. After incubation, the culture was pelleted (1000 g, 10 min), washed using demineralized water and resuspended in 0.5% Triton X-100. The spores were sonicated for approximately 15 s at 50 Hz with an amplitude of 6 micron while kept on ice. During initial optimization of the protocol, a short protocol where only the Zymolyase-step was used was also tested. The isolation of spores was confirmed using a microscope and isolated ascospores were either stored at 4 C. or immediately used. For germination, spores were by default washed once with YPD and subsequently resuspended in 20 mL YPD to a concentration of approximately 10.sup.6 cells mL1. The germination culture was incubated in a 100 mL round bottom flask at 30 C. and 200 RPM for 5 h. A protocol using 2% glucose instead of YPD as well as germination on YPD for different times was tested during initial optimization of the interspecies hybridization. By default, the haploid S. eubayanus and S. cerevisiae strains were washed and diluted in sterile Isoton II (Beckman Coulter) to a final cell density of approximately 10.sup.6 cells mL1 and stained with CellTrace Violet and CellTrace CFSE as described. For rare mating, a final cell density of approximately 2010.sup.6 cells mL1 was used and cells were stained with CellTrace Far Red and CellTrace CFSE as described. Two stained cultures were mated by pipetting them together into one Greiner tube. The cells were pelleted and resuspended in YPD. The mating culture was transferred to an Eppendorf tube and centrifuged briefly (2000 g, 1 min) to increase proximity of the cells for more efficient mating. The mating culture was statically incubated at 12 C. in the dark until FACS analysis.
(66) FACS Analysis and Sorting
(67) Cultures for FACS analysis and sorting were diluted in sterile Isoton II and vortexed briefly to disrupt cell aggregates. For rare mating, 50 mM EDTA was added to disrupt any nonsexual flocculation. The cultures were analysed on a BD FACSAria II SORP Cell Sorter (BD Biosciences, Franklin Lakes, N.J., USA) equipped with 355 nm, 445 nm, 488 nm, 561 nm and 640 nm lasers and a 70 m nozzle, and operated with filtered FACSFlow (BD Biosciences). Correct cytometer performance was evaluated prior to each experiment by running a CST cycle with corresponding CS&T Beads (BD Biosciences). Drop delay for sorting was determined by running an Auto Drop Delay cycle with Accudrop Beads (BD Biosciences). CellTrace Violet fluorescence was excited by the 355 nm laser and emission was detected through a 450 nm bandpass filter with a bandwidth of 50 nm, CellTrace CFSE was excited by the 488 nm laser and emission was detected through a 545 nm bandpass filter with a bandwidth of 30 nm and CellTrace Far Red was excited by the 640 nm laser and emission was detected through a 780 nm bandpass filter with a bandwidth of 60 nm. Fluorescence of mating cultures was analysed on either a CFSE versus Violet or a CFSE versus Far Red plot.
(68) Morphology of the cells was analysed by plotting forward scatter (FSC) against side scatter (SSC). For each measurement, at least 100000 events were analysed. Sorting regions (gates) were set on these plots to determine the types of cells to be sorted. Gated single cells were sorted in 96-well microtiter plates containing YPD using a single cell sorting mask corresponding to a yield mask of 0, a purity mask of 32 and a phase mask of 16. When required, colonies were replica-plated upon growth to 96-well plates with selective medium (SM or SM+G418), using an ethanol-flame sterilized 96-pin replicator. FACS data was analysed using FlowJo software (version 3.05230, FlowJo, LLC, Ashland, Oreg., USA).
(69) Viability Determination
(70) In order to determine the rate of viability or mating efficiency in cultures with low viability or mating efficiency, Poisson statistics were used. According to Poisson statistics, the chance of a viable colony appearing from a set number of sorted cells in each well can be determined mathematically (Equation 1), where P is an estimate of the chance of a colony appearing and is the fraction of living cells per well [Dube et al., 2008. PloS One 3: e287650].
=ln(1P)Equation 1
(71) The total percentage of hybrid cells is then defined as A multiplied by the amount of wells (W), which yields the corrected amount of true positives. This is divided by the amount of cells sorted to determine the yield of hybrids on the total population (Equation 2).
% hybrids=(*W)/(Total cells sorted)Equation 2
(72) For experiments with high viabilities, only 1 cell was sorted in each well so no Poisson correction for the probability of multiple events in one well was applied (Equation 1). Here, the percentage of viability was calculated by counting the amount of colonies and dividing those by the amount of sorted cells.
(73) Imaging
(74) Cells were imaged using a Zeiss Axio Imager Z1 (Carl Zeiss AG, Oberkochen, Germany). For fluorescent imaging, cells were excited with a xenon lamp using different filter sets for different fluorophores. Filter sets were chosen in such a way that bleed-through from one fluorophore into the other channel was minimized. Fluorescence from CellTrace CFSE was imaged through a GFP filter set (Carl Zeiss AG) containing a 470 nm bandpass excitation filter with a bandwidth of 20 nm and a 540 nm emission filter with a bandwidth of 25 nm. CellTrace Far Red was imaged through a Cy5 filter set (Carl Zeiss AG) containing a 640 nm bandpass excitation filter with a bandwidth of 30 nm and a 690 nm emission filter with a bandwidth of 50 nm. Images were processed using AxioVision SE64 (Rel. 4.9.1. Carl Zeiss AG, Oberkochen, Germany) and FIJI [Schindelin et al., 2012. Nature Methods 9: 676-682].
(75) Ploidy Determination by Flow Cytometry
(76) For ploidy determination, samples were fixed using ethanol as previously described [Hebly et al., 2015. FEMS Yeast Res 15: fov005]. Staining of cells with SYTOX Green Nucleic Acid Stain (Invitrogen 57020) was performed as described [Haase and Reed, 2002. Cell Cycle 1: 117-121] with some minor modifications. The cells were washed in 50 mM Tris-Cl (pH 7.5) and resuspended in 100 L RNase solution (1 mg/mL RNase A in 50 mM Tris-Cl). By default, 100 L of cells was added to 1 mL of SYTOX Green solution. When processing large amounts of samples, a high-throughput protocol in 96-well microtiter plates was used with a PIPETMAN M multichannel electronic pipette (Gilson, Middleton, Wis., USA). In this modified protocol, 100 L sample was fixated by adding 150 L 70% ethanol and in the final step 20 L sample was added to 180 L SYTOX Green solution. An unstained control was included for every sample. Fluorescence of the samples was measured on a BD Accuri C6 CSampler Flow Cytometer (BD Biosciences). The fluorophore was excited with the 488 nm laser of the flow cytometer and emission was detected through a 533 bandpass filter with a bandwidth of 30 nm. Ploidy data was analysed using FlowJo software (version 3.05230, FlowJo).
(77) Identification of Interspecies Hybrids by PCR
(78) The presence of genetic material from S. cerevisiae and from S. eubayanus was confirmed by PCR. A master mix was prepared, containing water, primers and 2 DreamTaq PCR Mastermix (Life Technologies, Carlsbad, Calif., USA). Primers specific for S. cerevisiae (8570 & 8571, see Table 3) and S. eubayanus (8572 & 8573, Table 3) [Muir et al., 2011. FEMS Yeast Res 11: 552-563; Pengelly and Wheals, 2013. FEMS Yeast Res 13: 156-16153] were added to a final concentration of 0.25 mM of each primer. DNA was isolated by boiling 2 L of a liquid culture in 2 L of NaOH for 15 min at 99 C. 18 L of PCR master mix was added to the template DNA. Cycling parameters for PCR with DreamTaq were: initial denaturation at 95 C. for 2 min, then 35 PCR cycles of 95 C. for 30 s, 55 C. for 30 s and 72 C. for 1 min, ending with a final extension at 72 C. for 10 min. Mating type was determined using the same protocol, but using primers specific for mating type (Table 3). PCR reactions were prepared using a Tecan Freedom EVO liquid handler (Tecan, Mnnedorf, Switzerland) or with a PIPETMAN M multichannel electronic pipette (Gilson). PCR products were separated on a 2% (w/v) agarose gel stained with SERVA DNA Stain G (Serva electrophoresis GmbH, Heidelberg, Germany) in 0.5TBE buffer (45 mM Tris-borate, 1 mM EDTA, pH 8) for approximately 30 min on 100 V. The gel was imaged using an InGenius LHR Gel Imaging System (Syngene, Bangalore, India).
(79) Results
(80) Isolating intraspecific hybrids from a mating culture using FACS As intraspecific mating occurs more efficiently than interspecies mating, a functional protocol for staining, mating and sorting was developed by mating two heterothallic S. cerevisiae haploid strains. Two strains with complimentary auxotrophies were mated, resulting in prototrophic mated diploids which could grow on synthetic minimal medium (SM), allowing for easy and accurate measurement of the fraction of mated cells in a sample. Strains CEN.PK113-5A (MATa, His-, Lys-, Trp-) and IMK439 (MAT, Ura-) were stained with CFSE and Violet dyes, respectively, and subsequently crossed. The concentration of dye per cell is diluted during each division, resulting in a decrease of intensity of the fluorescent signal per cell over time. To minimize this loss of fluorescence, the mating culture was incubated in YPT at 12 C., as S. cerevisiae grows slowly under these conditions. Fluorescence emitted by the cells was measured on a FACS at different time points: before staining, after staining but before mating and after 18 h, 24 h and 42 h of mating (
(81) Isolation of interspecies hybrids from a mating culture using FACS To investigate whether the developed staining and sorting protocol could also be applied to isolate interspecies hybrids from mating cultures, the diploid wildtype S. eubayanus strain CBS12357 was crossed with the haploid S. cerevisiae strain IMK439 (MAT, ura3::KanMX). Hybrid cells of these strains would be easily identifiable due to uracil prototrophy and resistance to G418.
(82) As S. eubayanus CBS12357 is a homothallic diploid, sporulation and isolation of the spores prior to staining and mating was necessary. As spores from homothallic diploids are able to homodiploidize, efficient separation of the spores in asci is required to minimize self-mating, which would compete with interspecies mating. Therefore, two protocols for digestion of the ascus cell wall were tested: (i) using zymolyase and (ii) using the surfactant Triton X-100 in addition to the zymolyase digestion [Herman and Rine, 1997. EMBO J 16: 6171-6181], the latter resulting in improved separation of the spores (Data not shown). Furthermore, FACS analysis indicated approximately half of the S. eubayanus cells was not fluorescent after staining was completed (Data not shown). During germination, the cell wall of a spore is lost. Given the impermeability of the spore cell wall, it is likely to contain much of the fluorescent dye after staining of the spore. Its loss during germination could explain the observed loss of fluorescence. Therefore, an optimal germination method to be used prior to staining was developed by testing germination in 2% glucose and YPD with different incubation durations. After 5 h of germination in YPD the first significant growth was observed, indicating enough time for germination had passed while intraspecific mating was still minimal (Data not shown). Lastly, the ability of S. eubayanus to grow or mate with trehalose as a sole carbon source is unknown. Therefore, mating of germinated cells of S. eubayanus CBS12357 stained with CFSE and haploid cells of S. cerevisiae strain IMK439 stained with Violet dye in YPD medium was compared to mating these strains in YPT medium. The amount of hybrids was assessed over time by sorting the dual-stained population using FACS (
(83) Generation of Marker-Free Interspecies Hybrids
(84) In the previous experiments, the presence of hybrids in the dual-stained population sorted by FACS was verified by growth on selective medium. However, parental strains with complementary selectable phenotypes are not always available or applicable. Therefore, screening methods which do not dependent on the presence of selectable phenotypes in the parental strains are preferable. Hybrids without a selectable phenotype can be identified by amplification of species-specific genes of the parental strains by PCR [Muir et al., 2011. FEMS Yeast Res 11: 552-563; Pengelly and Wheals, 2013. FEMS Yeast Res 13: 156-161] and assessment of the ploidy of cells. However, such screening methods have limited throughput and are only effective on samples with a high frequency of hybrids, such that the amount of cells that has to be screened in order to identify one or more hybrids remains reasonable. When mating IMK439 and spores of CBS12357, 20% of the obtained cells had a phenotype corresponding to the hybrid phenotype, so about 5 cells would have to be screened in order to find a hybrid. To test the possibility of screening for putative hybrids based on a multiplex PCR using primer pairs specific for S. eubayanus and S. cerevisiae, marker-free S. eubayanus and S. cerevisiae were crossed. A previously developed PCR-method was used yielding a fragment of 150 bp in the presence of genomic DNA of S. cerevisiae with primers 8570 and 8571, and a fragment of 228 bp in the presence of genomic DNA of S. eubayanus with primers 8572 and 8573 (Table 3). Because this PCR cannot distinguish a hybrid from a mixed population of two species, a second single-cell sorting step was implemented after propagation of the initially sorted dual-stained cells to ensure single colony isolates were tested. Additionally, the ploidy of the sorted cells was determined with DNA staining and flow cytometry, since uniform ploidy indicated there were no mixed populations as were observed without second sorting (
(85) To test the proposed method of generating and screening for marker-free interspecies hybrids, two crosses were made. The previous experiment of generating interspecies hybrids with sporulated CBS12357 was repeated, but replacing the genetically modified IMK439 with the marker-free laboratory strain CEN.PK113-7D (MATa) as S. cerevisiae parental strain. In parallel, a cross between two industrially-relevant strains was done to investigate whether the presented method could also be applied to generate new potentially industrially relevant hybrids. Industrial strains often have more complex, aneuploid genomes and sporulate poorly, resulting in lower hybridization rates than observed for interspecies hybrids using laboratory strains [Steensels et al., 2014. FEMS Microbiol Reviews 38: 947-995]. S. eubayanus strain AS2.4940 (kindly donated by J. Bing [Bing et al., 2014. Current Biol 24: R380-R381), was crossed with Ale28, an industrial ale-type strain of S. cerevisiae. Both strains were diploids, so they were sporulated and germinated using the previously discussed optimized protocol to obtain haploid gametes (
(86) Generation of Interspecies Hybrids by Rare Mating
(87) Many of the hybrids used in industrial processes are polyploid or aneuploid, and this ploidy may contribute to the industrially relevant phenotypes these strains exhibit. Such strains can be constructed by mating strains with higher ploidy. However, only strains of opposite mating type can mate with each other and since diploid strains have mating type a/a, mating can only occur when a spontaneous mating-type switch occurs, yielding a homozygous a/a or / mating type. The frequency of this type of mating was reported to be between 10.sup.6 and 10.sup.8 [Gunge and Nakatomi, 1972. Genetics 70: 41-58], hence it is called rare mating. As it has been shown that the technique discussed in this study successfully enriches a culture for mated cells, it was investigated whether the enrichment is significant enough to isolate these extremely rare mating events by making different crosses between haploid and diploid S. eubayanus and S. cerevisiae strains.
(88) In order to allow for easy measurement of rare mating frequencies, strain IMK439 was used as the haploid S. cerevisiae parental strain (MAT ura3::KanMX). To obtain strains with a diploid S. cerevisiae chromosome complement using the same selectable phenotype, the diploid strain IMX1471 was constructed by intraspecific mating as described previously between IMK439 (S. cerevisiae, MATa) stained with CFSE and IMK440 (S. cerevisiae, MATa) stained with a new dye, Far Red. Dual-stained cells were sorted and after overnight incubation, single cells from each well were sorted again. A PCR was performed to determine the mating type of the sorted cells using primers 11 (SEQ ID NO: 5), 12 (SEQ ID NO: 6), and 13 (SEQ ID NO: 7) (Table 3), and ploidy, the ability to sporulate and the presence of the uracil auxotrophy and the KanMX marker were tested (
(89) In the previous experiments, the separation of the CFSE-stained population and the Violet-stained population was suboptimal; the Violet fluorescence intensity was relatively low and overlapped slightly with the fluorescence emitted by CFSE. As rare mating events have a low frequency, a clear separation of the single-stained and dual-stained population is essential. When constructing strain IMX1471 by mating CFSE- and Far Red-stained parental strains, it was found that the Far Red dye had a stronger fluorescent signal than the Violet dye, leading to clearer separation of the different populations (
REFERENCE TO A SEQUENCE LISTING, A TABLE, OR A COMPUTER PROGRAM LISTING APPENDIX SUBMITTED AS AN ASCII TEXT FILE
(90) The material in the ASCII text file, named VOB-63511-Sequences_ST25.txt, created Nov. 3, 2020, file size of 4,096 bytes, is hereby incorporated by reference.
(91) TABLE-US-00001 TABLE 1 Saccharomyces strains used Name Species Parental strain(s) Relevant genotype Origin CEN.PK113-5A S. cerevisiae MATa URA3 his3-1 leu2-3,112 trp1-289 [Entian and Ktter, 2007. Methods Microbiol 36: 629-666] IMK439 S. cerevisiae CEN.PK113-7D MAT HIS3 LEU2 TRP1 ura3::KanMX [Gonzlez-Ramos et al., 2013. Biotechnol Biofuels 6: 48] IMK440 S. cerevisiae CEN.PK113-7D MATa HIS3 LEU2 TRP1 ura3::KanMX [Gonzlez-Ramos et al., 2013. Biotechnol Biofuels 6: 48] CEN.PK122 S. cerevisiae MATa/MAT URA3/URA3 [Entian and Ktter, 2007. Methods Microbiol 36: 629-666] CBS12357 S. eubayanus MATa/MAT [Libkind et al., 2011. PNAS 108: 14539-14544] CEN.PK113-7D S. cerevisiae MATa [Entian and Ktter, 2007. Methods Microbiol 36: 629-666] IMS0408 S. eubayanus CBS12357 MATa/MAT SeubURA3/ [Hebly et al., 2015. FEMS Yeast Res S. cerevisiae IMK439 Scura3:KanMX 15: fov005] AS2.4940 S. eubayanus MATa/MAT Kindly provided by J. Bing, Chinese Academy of Science [Bing, et al., 2014. Current Biol 24: R380-R381] Ale28 S. cerevisiae MATa/MAT Kindly donated by HEINEKEN Supply Chain, Zoeterwoude, The Netherlands IMX1471 S. cerevisiae IMK439 IMK440 MATa/MAT ura3::KanMX/ This study ura3::KanMX IMH001 S. eubayanus CBS12357 MATa/MAT This study S. cerevisiae CEN.PK113-7D IMH002 S. eubayanus CBS12357 MATa/MAT This study S. cerevisiae CEN.PK113-7D IMH003 S. eubayanus AS2.4940 Ale28 MATa/MAT This study S. cerevisiae IMH004 S. eubayanus AS2.4940 Ale28 MATa/MAT This study S. cerevisiae IMH005 S. eubayanus AS2.4940 Ale28 MATa/MAT This study S. cerevisiae IMH006 S. eubayanus AS2.4940 Ale28 MATa/MAT This study S. cerevisiae IMH007 S. eubayanus AS2.4940 Ale28 MATa/MAT This study S. cerevisiae
(92) TABLE-US-00002 TABLE 2 Hybridization rates and enrichment factors of interspecies (rare) mating between different ploidies of S. eubayanus strain CBS12357 and S. cerevisiae strains IMK439 (1n) and IMX1471 (2n). CBS12357 (spores) CBS12357 (spores) IMK439 IMX1471 CBS12357 IMK439 CBS12357 IMX1471 Hybridization (1n 1n) (1n 2n) (2n 1n) (2n 2n) time Plating.sup.A Sorting.sup.B Plating Sorting Plating Sorting Plating Sorting 24 h 4.4 10.sup.5 3.1 10.sup.2 .sup.C 4.3 10.sup.4 48 h 3.2 10.sup.5 6.2 10.sup.2 8 10.sup.7 4.6 10.sup.6 2.9 10.sup.3 72 h 2.5 10.sup.5 3.9 10.sup.2 4.1 10.sup.3 96 h 6.9 10.sup.5 3.3 10.sup.2 8 10.sup.7 4.3 10.sup.4 7.2 10.sup.6 4.3 10.sup.3 1 10.sup.7 120 h 3.4 10.sup.4 2.5 10.sup.2 9 10.sup.7 1.9 10.sup.6 1.3 10.sup.3 144 h 3.2 10.sup.4 3.6 10.sup.2 3 10.sup.7 1.6 10.sup.6 4.3 10.sup.4 168 h 3.0 10.sup.4 2.9 10.sup.2 1.5 10.sup.6 4.7 10.sup.6 3.6 10.sup.3 .sup.ADetermined by plating mating culture on SM + G418 .sup.BDetermined by sorting mating culture on YPD and replica-plating to SM + G418 .sup.CA hyphen means that no viable hybrids were obtained
(93) TABLE-US-00003 TABLE 3 Primers used Primer Product # Name Sequence 5 to 3 size (bp) Description Origin 8570 Scer F2 GCGCTTTACATTCAGATCCCGAG 150 S. cerevisiae Muir et al., 2011. FEMS (SEQ ID NO: 1) specific primers Yeast Res 11: 552-563. 8571 Scer R2 TAAGTTGGTTGTCAGCAAGATTG (SEQ ID NO: 2) 8572 Seub F3 GTCCCTGTACCAATTTAATATTGCGC 228 S. eubayanus Pengelly and Wheals, 2013. (SEQ ID NO: 3) specific primers FEMS Yeast Res 8573 Seub R2 TTTCACATCTCTTAGTCTTTTCCAGACG 13: 156-161. (SEQ ID NO: 4) 11 Matuniv AGTCACATCAAGATCGTTTATGG MAT: 404 S. cerevisiae MAT Huxley, et al., 1990. (SEQ ID NO: 5) MATa: 504 cassette ( and a) Trends Gen 6: 236. 12 Mat- GCACGGAATATGGGACTACTTCG alpha (SEQ ID NO: 6) 13 MATa ACTCCACTTCAAGTAAGAGTTTG (SEQ ID NO: 7)