METHOD AND PRODUCTS FOR PRODUCING SINGLE STRANDED DNA POLYNUCLEOTIDES

Abstract

The present invention provides a method for producing single stranded DNA polynucleotides. In particular, the invention provides a method that utilises a DNA minicircle obtained from a parental minicircle plasmid as a template in an enzyme-mediated rolling circle amplification (RCA) reaction to generate a product that can be cleaved to provide the plurality of single stranded DNA polynucleotides.

Claims

1. A method for producing a plurality of single stranded DNA polynucleotides comprising: a) providing a DNA minicircle obtained from a parental minicircle plasmid, wherein the DNA minicircle comprises the polynucleotide sequence to be produced bordered by cleavage domains; b) performing a rolling circle amplification (RCA) reaction with the DNA minicircle of (a) as a template to produce an RCA product comprising a plurality of copies of the polynucleotide sequence to be produced, bordered by cleavage domains; and c) cleaving the RCA product at the cleavage domains to release the plurality of single stranded DNA polynucleotides.

2. The method of claim 1, wherein step (a) comprises providing a host cell comprising the parental minicircle plasmid, wherein the host cell is capable of expressing a site-specific recombinase enzyme that acts on recombinase attachment sites in the parental minicircle plasmid.

3. The method of claim 2, wherein the site-specific recombinase enzyme is encoded by the host cell genome, optionally under the control of an inducible promoter.

4. The method of claim 2, wherein the site-specific recombinase enzyme is encoded by a plasmid in the host cell (e.g. the parental minicircle plasmid), optionally under the control of an inducible promoter.

5. The method of any one of claims 2 to 4 further comprising a step of inducing expression of the site-specific recombinase in the host cell to promote formation of the DNA minicircle in the cell.

6. The method claim 5 further comprising a step of isolating the DNA minicircle from the host cell.

7. The method of claim 1, wherein step (a) comprises contacting the parental minicircle plasmid in vitro with a site-specific recombinase enzyme that acts on recombinase attachment sites in the parental minicircle plasmid.

8. The method of any one of claims 1 to 7, wherein step (b) comprises cleaving a single strand of the DNA minicircle to provide the RCA template.

9. The method of any one of claims 1 to 8, wherein step (b) comprises hybridising a primer to the DNA minicircle.

10. The method of claim 9, wherein the primer hybridises to a sequence in the DNA minicircle that is formed by recombination of the parental minicircle plasmid.

11. The method of any one of claims 1 to 10, wherein the cleavage domains are directly adjacent to the polynucleotide sequence.

12. The method of any one of claims 1 to 11, wherein the cleavage domains contain a sequence that is recognised by a cleavage enzyme.

13. The method of any one of claims 1 to 12, wherein the cleavage domains comprise or consist of a sequence capable of forming a hairpin structure.

14. The method of claim 13, wherein the double-stranded portion of the hairpin structure comprises a sequence that is recognised by a cleavage enzyme.

15. The method of any one of claims 12 to 14, wherein the cleavage enzyme is a type II restriction endonuclease or a homing endonuclease.

16. The method of any one of claims 1 to 15, wherein the cleavage domains that border the polynucleotide sequence are cleaved by the same enzyme.

17. The method of any one of claims 1 to 16, wherein the DNA minicircle comprises a plurality of polynucleotide sequences, wherein each polynucleotide sequence is bordered by cleavage domains.

18. The method of claim 17, wherein the polynucleotide sequences are different.

19. The method of any one of claims 1 to 18, wherein the RCA reaction is performed in the presence of one or more functionalised nucleotides (dNTPs).

20. The method of any one of claims 1 to 19 further comprising a step of isolating or purifying the plurality of single stranded polynucleotides.

21. Use of a DNA minicircle obtained from a parental minicircle plasmid in the production of a plurality of single stranded DNA polynucleotides, wherein the DNA minicircle comprises the polynucleotide sequence to be produced, bordered by cleavage domains.

22. The use of claim 21, wherein the DNA minicircle is obtained by inducing the expression of a site-specific recombinase enzyme, that acts on recombinase attachment sites in the parental minicircle plasmid, in a host cell comprising the parental minicircle plasmid.

23. The use of claim 21, wherein the DNA minicircle is obtained by contacting the parental minicircle plasmid in vitro with a site-specific recombinase enzyme that acts on recombinase attachment sites in the parental minicircle plasmid.

24. The use of any one of claims 21 to 23, wherein the cleavage domains are as defined in any one of claims 11 to 16 and/or the DNA minicircle is as defined in claim 17.

25. A parental minicircle plasmid comprising: (a) a first domain comprising: (i) a polynucleotide sequence bordered by cleavage domains, which is bordered by recombinase attachment sites; or (ii) an insertion site for a polynucleotide sequence bordered by cleavage domains, which is bordered by recombinase attachment sites; and (b) a second domain comprising: (i) two or more nickase cleavage domains, wherein each strand of the plasmid DNA comprises at least one nickase cleavage domain; and/or (ii) a nucleotide sequence encoding a recombinase enzyme that recognises the recombinase attachment sites in the first domain.

26. The parental minicircle plasmid of claim 24 comprising: (a) a first domain comprising: (i) a polynucleotide sequence bordered by cleavage domains, which is bordered by recombinase attachment sites; or (ii) an insertion site for a polynucleotide sequence bordered by cleavage domains, which is bordered by recombinase attachment sites; and (b) a second domain comprising two or more nickase cleavage domains, wherein each strand of the plasmid DNA comprises at least one nickase cleavage domain.

27. The parental minicircle plasmid of claim 25 or 26, wherein the first domain comprises a nickase cleavage domain, optionally wherein the nickase cleavage domain in the first domain of the parental minicircle plasmid is the same as the nickase cleavage domains in the second domain of the parental minicircle plasmid.

28. The parental minicircle plasmid of claim 25 or 27, wherein the nucleotide sequence encoding a recombinase enzyme is under the control of an inducible promoter.

29. The parental minicircle plasmid of claim 28, wherein the inducible promoter is an arabinose inducible promoter.

30. The parental minicircle plasmid of any one of claims 25 to 29, wherein the parental minicircle plasmid comprises a nucleotide sequence as set forth in SEQ ID NO: 1, 27 or 28 or a nucleotide sequence with at least 80% sequence identity to a sequence as set forth in SEQ ID NO: 1, 27 or 28.

31. A kit for use in the method of any one of claims 1 to 20 comprising: (i) a DNA minicircle obtained from a parental minicircle plasmid, wherein the DNA minicircle comprises a polynucleotide sequence bordered by cleavage domains; or (ii) a parental minicircle plasmid as defined in any one of claims 25 to 30; and (iii) one or more additional components for use in the method of any one of claims 1 to 20, optionally wherein the one or more additional components are: (a) one or more cleavage enzymes that cleave the cleavage domains of (i); and/or (b) functionalised dNTPs.

32. The kit of claim 31, wherein the cleavage domains are as defined in any one of claims 11 to 16 and/or the DNA minicircle is as defined in claim 17.

Description

[0245] The invention will now be described in more detail in the following non-limiting Examples with reference to the following drawings:

[0246] FIG. 1 shows a schematic representation of the parental minicircle plasmid pM1. The multiple cloning site (MCS) comprises a plurality of restriction enzyme cleavage sites to allow the polynucleotide sequence bordered by cleavage domains (poly), i.e. the pseudogene, to be inserted into the plasmid. The pseudogene is located between the two recombination sites attP and attB. Sce-I represents a I-Scel recognition site (cleavage domain). KanR represents a kanamycin resistance gene. ColE1 represents an origin of replication.

[0247] FIG. 2 shows the results of Sanger sequencing of the DNA minicircle obtained from the pM1 plasmid at the precise recombination site following the recombination reaction. The recombination reaction occurs between the attP site and the attB site, and generates the junction sequence 5′-GGGTAACCTTT/GGGCTCCCC-3 (SEQ ID NO: 2).

[0248] FIG. 3 shows a negative image of a photograph of an agarose gel visualised using UV light following ethidium bromide staining. The agarose gel shows the results of the ligation of linear pseudogenes using T4 ligase (lane 0 is without ligase; lane+is with ligase). The original linear pseudogene is indicated, as are the products of the reaction (either a linear concatemer, resulting from inter-molecular ligation; or a circular DNA molecule, resulting from intra-molecular ligation).

[0249] FIG. 4 shows a negative image of a photograph of an agarose gel visualised using UV light following ethidium bromide staining. The agarose gel shows the parental plasmid pM1 containing three different pseudogenes (CRC1, CRC2, and Oligo mix), and the corresponding minicircle (MC) recombination products. Each recombination product comprises a mixture of minicircles including a minicircle monomer (pseudogene plus junction sequence) and multiple minicircle polymers (multiple pseudogenes plus junction sequences in a circular form).

[0250] FIG. 5 shows a negative image of a photograph of a denaturing polyacrylamide gel electrophoresis (PAGE) gel visualised using Cy2 light following SybrGold staining. The polyacrylamide gel shows the enzymatic production of a mixture of polynucleotides using the method of the present invention. A pseudogene comprising 8 polynucleotide sequences ranging from 81 to 91 nucleotides in length, bordered by cleavage domains was cloned into the parental minicircle plasmid pM1. DNA minicircles comprising the pseudogene sequence were obtained from the harvested bacterial culture following the recombination reaction and used as the template for an RCA reaction. The enzymatic digestion of the product of this RCA reaction released the hairpin sequences (the remnants of the cleavage domains), the desired polynucleotides and a 150-nucleotide long recombination scar sequence. The scar sequence comprised the recombination product of the merged attB/attP sequences (i.e. the junction sequence), in the centre, surrounded on both sides by remnants of the multiple cloning site for the restriction enzymes XbaI, EcoRV, BamHI, HindII, PstI, StuI, and DraII.

[0251] FIG. 6 shows a negative image of a photograph of an agarose gel visualised using UV light following ethidium bromide staining. The agarose gel shows the enzymatic production of two “long” polynucleotides using the method of the present invention. The single stranded DNA polynucleotides obtained had lengths of 1316 nucleotides (A) and 1969 nucleotides (B). Accordingly, they migrated in a 2% agarose gel in a manner consistent with a 700 bp and a 1000 bp double stranded polynucleotide, according to the ladder.

[0252] FIG. 7 shows photographs of agarose gels visualised using UV light following ethidium bromide staining (top), and fluorescent imaging using wavelengths corresponding to the emission wavelengths of the fluorophores (bottom). The agarose gels show functionalised single stranded oligonucleotide products of the invention (containing 378 nucleotides) comprising fluorophores ATTO-488 (A) or Cy3 (B).

[0253] FIG. 8 shows the negative image of a photograph of an agarose gel visualised using UV light following ethidium bromide staining. The agarose gel shows functionalised single stranded oligonucleotide products of the invention (containing 420 nucleotides) comprising 5-ethnyl-dUTP (5-EdUTP) produced using various relative amounts of 5-EdUTP/dTTP nucleotides, i.e. 25%, 50%, 75% and 100% and phi29 DNA polymerase (A) or Bst DNA polymerase (B).

[0254] FIG. 9 shows a photograph of an agarose gel visualised using UV light following ethidium bromide staining (left), and fluorescent imaging using wavelengths corresponding to the emission wavelengths of the Cy3 fluorophores (right). The agarose gels show single stranded oligonucleotide products of the invention (containing 420 nucleotides) comprising 5-ethnyl-dUTP (5-EdUTP) or conventional dTTP that were subsequently reacted with Cy3 fluorophore-azide molecule (N3-Cy3). The shaded boxes denote the presence of the indicated species.

[0255] FIG. 10 shows negative images of photographs of agarose gels visualised using UV light following ethidium bromide staining. The agarose gels show functionalised single stranded oligonucleotide products of the invention (containing 420 nucleotides) comprising: (A) 2′-Fluoro-2′-deoxyuridine-5′-triphosphate (2′F-dUTP); (B) 2′-Deoxythymidine-5′-O-(1-Thiotriphosphate) (α-thiol-dTTP); and (C) 2-dNTP Alpha S nucleotides (Alpha S-dATP, Alpha S-dTTP, Alpha S-dCTP, Alpha S-dTTP, and an Alpha S-dNTP mixture), produced using various relative amounts of the functionalised. The right panels in A and B show the lane corresponding to 100% functionalised nucleotides overexposed to show a band corresponding to the RCA product. The right panel in C show the lanes corresponding to Alpha S-dNTP mixture overexposed to show bands corresponding to the RCA product.

[0256] FIG. 11 shows negative images of photographs of agarose gels visualised using UV light following ethidium bromide staining. The agarose gels show oligonucleotides produced by the invention subjected to various concentrations of DNase I, wherein: (A) shows the reaction products of an oligonucleotide containing only conventional nucleotides (natural ODN); (B) shows the reaction products of an oligonucleotide containing 2′-Fluoro-2′-deoxyuridine-5′-triphosphate functionalised nucleotides (2′F-dUTP); and (C) shows the reaction products of an oligonucleotide containing 2′-Deoxythymidine-5′-O-(1-Thiotriphosphate) (S-ODN).

[0257] FIG. 12 shows a negative image of a photograph of a denaturing PAGE gel visualised using UV light following SybrGold staining. The PAGE gel shows functionalised single stranded oligonucleotide products of the invention comprising 5-Vinyl-2′-deoxyuridine-5′-triphosphate (5-Vinyl-dUTP) produced using various relative amounts of 5-Vinyl-dUTP nucleotides, i.e. 25%, 50%, 75% and 100%.

[0258] FIG. 13 shows a negative image of a photograph of a denaturing PAGE gel visualised using UV light following SybrGold staining. The PAGE gel shows functionalised single stranded oligonucleotide products of the invention comprising 4-Thiothymidine-5′-Triphosphate (4-Thio-dTTP) produced using various relative amounts of 5-Vinyl-dUTP nucleotides, i.e. 25%, 50%, 75% and 100%.

[0259] FIG. 14 shows annotated versions of the pseudogene sequences that were used in the production of oligonucleotides having sequences corresponding to SEQ ID NOs: 9-21. The sequences recognised by the cleavage and nicking enzymes, the hairpin sequences, and final oligonucleotide sequences are identified.

[0260] FIG. 15 shows the structure of a 2′-Azido-dATP (A) and negative images of photographs of denaturing PAGE gels visualised using UV light following SybrGold staining (B and C). The PAGE gels show functionalised single stranded oligonucleotide products of the invention comprising 2′-Azido-dATP produced using various relative amounts of 2′-Azido-dATP nucleotides, i.e. 25%, 50%, 75% and 100% and phi29 DNA polymerase (B) or Bst DNA polymerase (C).

[0261] FIG. 16 shows the structure of a Biotin-16-Aminoallyl-2′-dUTP (A) and a negative image of a photograph of a denaturing PAGE gel visualised using UV light following SybrGold staining (B). The PAGE gel shows functionalised single stranded oligonucleotide products of the invention comprising Biotin-16-Aminoallyl-2′-dUTP produced using various relative amounts of Biotin-16-AA-dUTP nucleotides, i.e. 25%, 50%, 75% and 100% and phi29 DNA polymerase.

[0262] FIG. 17 shows the structures of a 5′-Bromo-2′-deoxyuridine-5′Triphosphate nucleotide (A) and a 5′-Propynyl-2′-deoxycytidine-5′-Triphosphate nucleotide (B); negative images of photographs of denaturing PAGE gels visualised using UV light following SybrGold staining (C, D, E and F). The PAGE gels show functionalised single stranded oligonucleotide products of the invention comprising 5′-Br-dUTP (C and E) or 5′-Propynyl-dCTP (D and F) produced using various relative amounts of the respective functionalised nucleotides, i.e. 25%, 50%, 75% and 100% and phi29 DNA polymerase or Bst DNA polymerase.

[0263] FIG. 18 shows the structure of a 2′-O-Methyladenosine-5′-Triphosphate nucleotide (A) and a negative image of a photograph of a denaturing PAGE gel visualised using UV light following SybrGold staining (B). The PAGE gel shows functionalised single stranded oligonucleotide products of the invention comprising 2′-OMe-ATP produced using various relative amounts of 2′-OMe-ATP nucleotides, i.e. 25%, 50%, 75% and 100% and phi29 DNA polymerase.

[0264] FIG. 19 shows the structure of an LNA-adenosine-5′-triphosphate nucleotide (A) and negative images of photographs of denaturing PAGE gels visualised using UV light following SybrGold staining (B and C). The PAGE gels show functionalised single stranded oligonucleotide products of the invention comprising LNA-ATP produced using various relative amounts of LNA-ATP nucleotides, i.e. 25%, 50%, 75% and 100% and phi29 DNA polymerase (B) or Bst DNA polymerase (C).

[0265] FIG. 20 shows a photograph of a 2% agarose gel wherein: lanes 1a and 2a show the plasmids pM3 (SEQ ID NO: 28) and pM2 (SEQ ID NO: 27), respectively, comprising the CRC1 pseudogene described in the Examples; lanes 1 b and 2b show the recovered recombination products from the pM3 and pM2 plasmids, respectively (minicircle DNA is marked with an “*”); and lanes 1c and 2c show the single stranded polynucleotides generated from the pM3 and pM2 minicircles, respectively.

EXAMPLES

Example 1—Efficiency of Circularization of Long Pseudogenes Using T4 Ligase

[0266] The MOSIC approach (Ducani et al., Nature Methods 2013) was used to study the circularization efficiency of two long pseudogenes with T4 ligase. The longest pseudogene, here called CRC2 (SEQ ID NO: 8), was designed for the production of a single stranded DNA polynucleotide 1969 bases in length (the total length of the pseudogene after excision was 2041 base pairs). The shorter pseudogene, called ActEVEN (SEQ ID NO: 6), was designed to produce a pool of 11 single stranded oligonucleotides of between 76 and 81 bases in length (the total length of the pseudogene after excision was 1159 base pairs).

[0267] The linear pseudogenes (final concentration 5 ng/μl) were mixed with T4 ligase (0.25 U/μl) in 1× rapid ligation buffer at 22° C. for 30 min, followed by an inactivation step at 65° C. for 10 min. As a control, the same reaction mixtures were prepared without T4 ligase. All the reaction mixtures were loaded on a 1.5% agarose gel casted with ethidium bromide (1 μg/ml), run at 150V for 90 minutes and images were acquired by UV trans-illumination (UVITEC). The agarose gel (FIG. 3) showed that the circularization of long linear pseudogenes by T4 ligase is inefficient, and that the ligation reaction favoured the production of concatemers over single circular DNA molecules. It was noted that for the shorter pseudogene, ActEVEN (SEQ ID NO: 6), a faint band corresponding to the single circular DNA molecules was visible, but for the longer DNA pseudogene, CRC2, only concatemers were visible.

Example 2—Generation of Minicircles from Pseudogenes Cloned into pM1 Plasmids

[0268] Three pseudogenes were designed and synthesized as previously described (Ducani et al., Nature Methods 2013). Each pseudogene was designed for the production of single stranded DNA polynucleotides of different lengths: CRC1 (SEQ ID NO: 7) for a single polynucleotide 1316 bases long; CRC2 (SEQ ID NO: 8) for a single polynucleotide 1969 bases in length; and Oligo-mix for a pool of eight oligonucleotides of length between 81 to 91 bases in length.

[0269] All of the pseudogenes were cloned into pM1 (SEQ ID NO: 1), using XbaI and BamHI restriction sites located in between the attachment sites attB and attP of the parental plasmid. The parental plasmids containing the pseudogene were sequence verified, and used to transform E. coli bacteria (ZYCY10P3S2T). Transformed bacteria cultures were grown overnight to propagate the plasmids, then the recombination process was triggered upon induction with arabinose (to a final concentration of 0.01%), and an additional 6 hour incubation was necessary to complete the process. The minicircles (MC) were collected by standard plasmid preps and loaded on a 1.5% agarose gel containing ethidium bromide (1 μg/ml; Sigma Aldrich) for analysis control (FIG. 4). All of the recombination reactions produced mixtures of circular products, which included circular monomer minicircles (MC monomer) and multimeric minicircles (MC polymers), all of which are suitable substrates (DNA minicircles) for use in the method described herein.

Example 3—Generation of an Oligonucleotide Pool from a Single Minicircle Template

[0270] The product of the recombination reaction involving the Oligo mix minicircle of Example 2 was enzymatically nicked using Nb.BsrDI and Nt.BspQI to provide a 3′OH to trigger the RCA reaction. The RCA reaction was performed overnight using phi29 DNA polymerase. The amplification product was later digested with BtsCI (0.5U/μl) to release the desired oligonucleotide sequences, and the digestion products were run on a 10% denaturing polyacrylamide gel, stained in SybrGold 1× (FIG. 5). The same result was achieved when the production started from a gel extracted minicircle monomer.

Example 4—Generation of Long Single Stranded DNA Polynucleotides Using Minicircle Templates

[0271] The products of the recombination reactions involving the CRC1 and CRC2 minicircles of Example 2 were used as templates for the production of single stranded DNA polynucleotides. Both recombination products were enzymatically nicked (Nb.BsrDI and Nt.BspQI) to provide a 3′OH to trigger the RCA reactions. The RCA reactions were performed overnight using phi29 DNA polymerase. The amplification products were later digested with BtsCI (0.5U/μl) to release the desired DNA polynucleotide sequences, and the digestion products were run on a 2% agarose gel containing ethidium bromide (1 μg/ml; Sigma Aldrich) for analysis control (FIG. 6).

Example 5—Enzymatic Production of Single Stranded Oligonucleotides Comprising Fluorescent Nucleotides

[0272] Single stranded fluorescent oligonucleotides 378 nucleotides in length (SEQ ID NO: 9) were produced enzymatically using phi29 DNA polymerase. This was done via incorporation of two different functionalised dATP nucleobases, one comprising the fluorophore Cy3 (7-Propargylamino-7-deaza-ATP-Cy3) and one comprising the fluorophore ATTO-488 (7-Propargylamino-7-deaza-ATP-ATTO-488).

[0273] A double stranded circular DNA template containing SEQ ID NO: 9 and hairpin cleavage domains was prepared as described in Ducani et al., 2013, Nature Methods, 647-652. The template (1 ng/μL) was nicked with Nb.BsrDI and Nt.BspQI (0.25 U/μL) and a rolling circle amplification reaction (0.1-0.25 ng/μL template DNA, phi29 DNA polymerase 0.25 U/μL, 0.1 pg T4 gene 32) was performed several times with different ratios of natural dATPs and functionalised dATPs in each reaction (i.e. different relative amounts of the functionalised dATP, 2%, 3% or 5%). The resulting RCA products were diluted five times in deionized water and 1× digestion buffer (50 mM Potassium Acetate, 20 mM Tris-acetate, 10 mM Magnesium Acetate, 100 μg/ml BSA, pH 7.9 at 25° C.) and were then digested with BtsCI restriction enzyme (0.5U/μL) overnight at 50° C. and the digestion products were run on agarose gels. Imaging was done using the emission wavelengths corresponding to the two fluorophores, and after ethidium bromide staining, by UV visualization.

[0274] The resulting images are shown in FIGS. 7A and B for ATTO-488 and Cy3, respectively. It can be seen that increasing the percentage of dATP-ATTO-488 nucleotides resulted in oligonucleotides with higher fluorescence. However, the total amount of RCA product dropped by approximately 60% when 5% of the dATP nucleotides were dATP-ATTO-488.

[0275] Surprisingly and in contrast to the use of dATP-ATTO-488, the percentage of dATP-Cy3 nucleotides present did not seem to affect the efficiency of phi29 DNA polymerase; single stranded DNA products were visible with 5% of dATP-Cy3 in the RCA mixture (FIG. 7B). Moreover, incorporation of the modified nucleotides did not prevent or reduce the efficiency of the BtsCI restriction enzyme, and consequently the release of the designed hairpins comprising the cleavage domains.

TABLE-US-00001 SEQ ID NO: 9: CCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTA AAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCA AGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGT GCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCT GGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATA AGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAA TATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATAC ATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGC ACATTTCCCCGAAAAGTG

Example 6—Enzymatic Production of Single Stranded Oligonucleotides Comprising Nucleotides with Internalized Alkyne Groups, i.e. Alkyne Groups in the Nucleobase

[0276] Single stranded oligonucleotides 420 nucleotides in length (SEQ ID NO: 10) comprising nucleotides with alkyne groups were produced enzymatically using phi29 DNA polymerase.

[0277] A double stranded circular DNA template containing SEQ ID NO: 10 and hairpin cleavage domains was prepared as described in Ducani et al., 2013, Nature Methods, 647-652. Nicking of the template RCA reactions were performed using the conditions described in Example 1, but using increasing relative amounts of 5′-Ethynyl-dUTP (5′-EdUTP), i.e. replacing dTTP with 5′-EdUTP such that the relative amount of 5′-EdUTP was 0% (control reaction), 25%, 50%, 75% or 100%. After amplification, the RCA products were digested by the BtsCI restriction enzyme and loaded on to an agarose gel as described in Example 5.

[0278] The results in FIG. 8A surprisingly show that even when up 100% of the dTTP nucleotides were replaced with the alkyne functionalised dUTP, the RCA yields dropped only by 15-20%. Thus, FIG. 8A also demonstrates that the RCA product was successfully and efficiently cleaved by BtsCI. The incorporation of the alkyne functionalised dUTP nucleotide was confirmed by the fact that a lower mobility of the functionalised oligonucleotide was observed.

[0279] An additional experiment was performed replacing phi29 DNA polymerase with Bst DNA polymerase. Gel electrophoresis showed no changes in amplification yield up to 50% of functionalised dUTP, with the final product shifted compared the one with 25% of modified dUTP, confirming the incorporation of the modified nucleotide which has higher molecular weight than its corresponding natural nucleotide (dTTP) (FIG. 8B).

TABLE-US-00002 SEQ ID NO: 10: ATTGAAGCATGCGGCGTGCATAATTCTCTTACTGTCATGCCATGC GTAAGATACCACCACACCCGCATTCGCCATTCAGGCGGCCGCCAC CGCGGTGGAGCTCCAGCTGCTGTTTCCTGTGTAGAGTTGGTAGCT CTTGATCCGGTCATATTTGTTCCCTTTAGATCCGCCTCCATCTAC AGGGCGCGTCCCCGCGCTTAATGCGCGGCCTAACTACGGCTACAC TAGAAGGACTTACCTTCGGAAAAGAAATTGTTATCCGCTCACAAA AGCCAGAGTATTTAAGCTCCCTCGTGCGCTCTCCTGTTCCGGGTT ATTGTCTCATCGGCGACCGAGTTGCTCTTGCTTATCAGACCCTGC CGCTTACAAGTGGTCGCCAGTCTATTAACAGCACTCAATACGGGA TAATTTTTCAATATT

Example 7—Click Chemistry Reaction to Conjugate Azide-Fluorophore to Single Stranded Nucleotide Comprising Internalised Alkyne Groups

[0280] The successful incorporation of the functionalised 5-Ethynyl-dUTP nucleotides into the oligonucleotide produced in Example 6 was further demonstrated by performing a click chemistry reaction.

[0281] The functionalised oligonucleotide from the reaction with 75% of the alkyne functionalised dUTP nucleotide was incubated with a Cy3-azide (50 μM). The click chemistry solution also included copper sulfate (50 μM) as a catalyst, sodium ascorbate (50 mM) and THPTA (250 μM). As negative control, an oligonucleotide produced by the same method from the same template but with conventional dNTPs was also incubated with the Cy3-azide. In addition, the functionalised oligonucleotide comprising internalised alkyne groups was also incubated in the absence of the Cy3-azide. The reaction mixtures from the three reactions were run on an agarose gel and imaged (FIG. 9). Fluorescent single stranded oligonucleotides of the expected length were observed only for the reaction comprising the functionalised oligonucleotide and the fluorophore-azide. In addition, no visible DNA degradation due to the presence of the copper sulfate was observed.

Example 8—Enzymatic Production of Single Stranded Oligonucleotides Comprising Endonuclease Resistant Nucleotides

[0282] 2′-Fluoro-2′-deoxyuridine-5′-triphosphate (2′F-dUTP) or 2′-Deoxythymidine-5′-O-(1-Thiotriphosphate) (phosphorothioate dTTP) have both been previously used to modify DNA and RNA oligonucleotides for biomedicine and therapeutics applications, due to their capacity of conferring nuclease stability. These modified nucleotides were incorporated into single stranded DNA oligonucleotides by RCA using the experimental schemes described above. The conventional dTTP nucleotides were replaced by the functionalised nucleotides in increasing percentages from 0 to 100%. The tandem repeat RCA products were then digested by the BtsCI restriction enzyme into discrete 420 base single stranded functionalised oligonucleotides (SEQ ID NO: 10).

[0283] In the experiment performed with the 2′F-dUTP functionalised nucleotides, similar RCA yields were visible from 0% up to 75% of the functionalised nucleotide, with a drastic drop in yield observed with 100% of the functionalised nucleotide (FIG. 10A).

[0284] In the phosphorothioate dTTP experiment, the RCA yield decreased gradually as the amount of the functionalised nucleotide was increased, up to approximately a 65% drop with 75% of the functionalised nucleotide, relative to the yield with only conventional nucleotides (FIG. 10B).

[0285] However, overexposure of the agarose gels showed how functionalised single stranded oligonucleotides were produced even with 100% of functionalised nucleobases—see the panels on the right of FIGS. 10A and B.

[0286] Other phosphorothioate dNTPs (indicated as Alpha S dNTPs) were tested in additional experiments, either added one by one or in combination (FIG. 10C). Even in the last case, in which 75% of all the conventional nucleotides were replaced with their corresponding Alpha S functionalised nucleotides, RCA products were synthesized and enzymatically cleaved to yield oligonucleotides visible on the agarose gel.

[0287] The endonuclease resistance of the functionalised oligonucleotides relative to control oligonucleotides produced with only conventional nucleotides was investigated. A control 420-nt long oligonucleotide produced with only conventional nucleotides, the 2′-F-dUTP functionalised oligonucleotides and phosphorothioate dTTP functionalised oligonucleotides (both produced using a relative amount of 75% of the functionalised nucleotide), were incubated with increasing concentrations of DNAse I (FIGS. 11A-C). The control oligonucleotide was completely digested with 18 mU/ml of DNAse I, but both the enzymatically produced 2′-F-dUTP and phosphorothioate dTTP functionalised DNA oligonucleotides were still visible on agarose gels after incubation with the same concentration of endonuclease.

Example 9—Enzymatic Production of Single Stranded Oligonucleotides Comprising Nucleotides with Vinyl Groups

[0288] Single stranded DNA oligonucleotides with lengths from 76-81 bases (SEQ ID NOs: 11-21), functionalised with the thymidine analogue 5-Vinyl-2′-deoxyuridine-5′-triphosphate (5-Vinyl-dUTP) were produced enzymatically via an RCA reaction according to the experimental schemes described above. All of the oligonucleotides were encoded on a single pseudogene (SEQ ID NO: 24). The incorporation of such a functionalised nucleotide in single stranded oligonucleotides enables copper-free click chemistry reactions to be used to conjugate tetrazine-like molecules to the oligonucleotide. This alkene-tetrazine reaction can be completely orthogonal to the alkyne-azide click chemistry reaction previously performed.

[0289] Increasing the amount of the functionalised nucleotide in the RCA reaction mixture, relative to the conventional nucleotide dTTP, led to the successful incorporation of the 5-Vinyl-dUTP into the single stranded RCA product and the successful digestion of the hairpin structures. However, the activity levels of both the phi29 DNA polymerase and the type II endonuclease used to cleave the RCA product were lower than in the absence of the functionalised nucleotide, which consequently led to higher molecular weight bands with undigested hairpin structures when the functionalised nucleotides fully replaced the conventional dTTP nucleotides (FIG. 12).

TABLE-US-00003 SEQ ID NO Sequence 11 GAACCGTCCCAAGCGTTGCGC CACATCTGCTGGAAGGTGGAC AGTGAGAGGACACCTACGAAT CGCAACGGGTATCCT 12 GAACCGTCCCAAGCGTTGCGC CTGGGTACATGGTGGTACCAC CAGACAGGACACCTACGAATC GCAACGGGTATCCT 13 GAACCGTCCCAAGCGTTGCGG AGAGCATAGCCCTCGTAGATG GGCAAGGACACCTACGAATCG CAACGGGTATCCT 14 GAACCGTCCCAAGCGTTGCGG TCCCAGTTGGTAACAATGCCA TGTTCAATGAGGACACCTACG AATCGCAACGGGTATCCT 15 GAACCGTCCCAAGCGTTGCGC GGACTCATCGTACTCCTGCTT GCTGAGGACACCTACGAATCG CAACGGGTATCCT 16 GAACCGTCCCAAGCGTTGCGT TCTCTTTGATGTCACGCACGA TTTCCCAGGACACCTACGAAT CGCAACGGGTATCCT 17 GAACCGTCCCAAGCGTTGCGC TCGGTCAGGATCTTCATGAGG TAGTCTGTAGGACACCTACGA ATCGCAACGGGTATCCT 18 GAACCGTCCCAAGCGTTGCGT TTCACGGTTGGCCTTAGGGTT CAGGGGAGGACACCTACGAAT CGCAACGGGTATCCT 19 GAACCGTCCCAAGCGTTGCGG TACTTCAGGGTCAGGATACCT CTCTTGAGGACACCTACGAAT CGCAACGGGTATCCT 20 GAACCGTCCCAAGCGTTGCGC TGCTCGAAGTCTAGAGCAACA TAGCACAAGGACACCTACGAA TCGCAACGGGTATCCT 21 GAACCGTCCCAAGCGTTGCGC CTCGTCACCCACATAGGAGTC CTTCAGGACACCTACGAATCG CAACGGGTATCCT

Example 10—Enzymatic Production of Single Stranded Oligonucleotides Comprising Thiolated Nucleotides

[0290] Single stranded DNA oligonucleotides functionalised with a thiolated dTTP (4-Thiothymidine-5′-Triphosphate) were produced enzymatically via an RCA reaction using the reaction scheme and the templates described above (SEQ ID NOs: 11-21). All of the oligonucleotides were encoded on a single pseudogene (SEQ ID NO: 24)

[0291] The incorporation of the thiolated nucleotide into the single stranded oligonucleotide by phi29 DNA polymerase incorporation was very successful in amounts of the functionalised nucleotide up to 75% replacement of the corresponding conventional nucleotide (dTTP) (FIG. 13), i.e. a relative amount of 75% of the functionalised nucleotide.

[0292] The RCA products were digested by type II restriction enzymes as described above, however, a complete digestion of the functionalised RCA products required an enzyme concentration 10 times higher than the concentration used on RCA products comprising only conventional nucleotides. When the conventional dTTP nucleotide was completely replaced with the functionalised thiolated nucleotide, no single stranded oligonucleotides were observed following treatment with the type II restriction enzymes, though there only very faint accumulation of undigested RCA products was observed in the well, suggesting that the activity of the polymerase was also affected.

Example 11—Enzymatic Production of Single Stranded Oligonucleotides Comprising Azide Nucleotides

[0293] Single stranded oligonucleotides 420 nucleotides in length (SEQ ID NO: 10) comprising increasing percentages of functionalised 2′-Azido-dATP nucleotides (FIG. 15A), which replace the corresponding conventional dATP nucleotides, were produced enzymatically using phi29 DNA polymerase (FIG. 15B) and Bst DNA polymerase (FIG. 15C).

[0294] The high density azido groups in the newly synthesized DNA strands enables the post-synthesis functionalisation with alkyne molecules, either by a Cu(I)-catalyzed Huisgen cycloaddition (“click” chemistry), or by a strain-promoted [3+2] cycloaddition of azides and cycloalkynes, e.g. cyclooctyne or cyclononyne.

[0295] Two different polymerases with strand displacement activity were used in the amplification step: phi29 DNA polymerase or Bst DNA polymerase. Both polymerases were able to incorporate the functionalised nucleotide into the amplification products, which were then digested and run on an agarose gel.

[0296] DNA products produced with phi29 DNA polymerases were visible in the gel up to 75% of the modified nucleotides (FIG. 15B) while Bst DNA polymerases products were visible up to 100% (FIG. 15C), although Bst amplification buffer salts led to smear effect (even in the lane corresponding to 0% of 2′-Azido dATP). The functionalised nucleotides were incorporated successfully and did not significantly affect the formation of hairpin structures, which enable the cleavage of the amplification product.

Example 12—Enzymatic Production of Single Stranded Oligonucleotides Comprising Biotinylated Nucleotides

[0297] Single stranded oligonucleotides 420 nucleotides in length (SEQ ID NO: 10) comprising increasing percentages (25%-100%) of functionalised Biotin-16-Aminoallyl-2′-dUTP (FIG. 16A), which replace the corresponding conventional nucleotide dTTP, were produced enzymatically using phi29 DNA polymerase (FIG. 16B).

[0298] The incorporation of the biotinylated nucleotides only slightly affected the DNA amplification reaction and, surprisingly, despite the potential for steric hindrance due to the large size of the functionalised nucleotide, did not interfere with the formation of the hairpin structures, which enable the cleavage of the RCA products. The incorporation of multiple internal biotins into a functionalised polynucleotide enables the conjugation with streptavidin functionalised molecules.

Example 13—Enzymatic Production of Single Stranded Oligonucleotides Comprising 5-Modified Pyrimidines: 5-Bromo-2′-deoxyuridine-5′-Triphosphate and 5-Propynyl-2′-deoxycytidine-5′-Triphosphate

[0299] Single stranded oligonucleotides 420 nucleotides in length (SEQ ID NO: 10) comprising increasing percentages (25%-100%) of unnatural 5-modified pyrimidines: 5-Bromo-2′-deoxyuridine-5′-Triphosphate (FIG. 17A) and 5-Propynyl-2′-deoxycytidine-5′-Triphosphate (FIG. 17B), which replace the corresponding conventional nucleotides dTTP and dCTP, respectively, were produced enzymatically using phi29 DNA polymerase (FIGS. 17C and 17D) and Bst DNA polymerase (FIGS. 17E and 17F). Surprisingly, both functionalised nucleotides were successfully incorporated into the newly synthesized DNA sequence without affecting the formation of the hairpin structures in the RCA product, thus allowing the cleavage reaction to occur.

Example 14—Enzymatic Production of Single Stranded Oligonucleotides Comprising 2′-O-Methyl-ATP

[0300] Single stranded oligonucleotides 420 nucleotides in length (SEQ ID NO: 10) comprising increasing percentages (25%-100%) of 2′-O-Methyl-ATP (FIG. 18A), which replace the corresponding conventional nucleotide dATP, were produced enzymatically using phi29 DNA polymerase (FIG. 18B). Even with 100% of the functionalised nucleotide present, the amplification product was still visible. This result was contrary to previous studies which showed that no known natural polymerases are capable of efficiently accepting these modified substrates (Romesberg, JACS 2004, 10.1021/ja038525p).

[0301] In addition, no higher molecular weight undigested DNA bands were visible in the gel, showing that the presence of the functionalised nucleotides did not affect the formation of the hairpin structure and its digestion by the restriction enzyme. This was a surprising result in view of the nuclease resistance which is conferred to DNA molecules by O-methyl groups.

Example 15—Enzymatic Production of Single Stranded Oligonucleotides Comprising LNA-adenosine-5′-triphosphate

[0302] Single stranded oligonucleotides 420 nucleotides in length (SEQ ID NO: 10) comprising increasing percentages (25%-100%) of LNA-adenosine-5′-triphosphate (FIG. 19A), which replace the corresponding conventional nucleotide dATP, were produced enzymatically using phi29 DNA polymerase (FIG. 19B) and Bst DNA polymerase (FIG. 19C).

[0303] Although LNA monomers structurally mimic RNA, even with 100% of the functionalised nucleotide the efficiency of the polymerases, both phi29 DNA polymerase and Bst DNA polymerases, was not significantly affected. Moreover, the functionalised nucleotide did not interfere with the formation of the hairpin structures which enable digestion of the amplification products.

Example 16—Generation of Single Stranded DNA from Minicircles Produced Using ParA Resolvase and FLP Recombinase

[0304] A pseudogene was designed for the production of a single stranded DNA polynucleotide, CRC1 (SEQ ID NO: 7) as described above.

[0305] The pseudogene was cloned into pM2 (SEQ ID NO: 27) and pM3 (SEQ ID NO: 28), using restriction sites located in between the recombinase attachment sites FLPr and FLPl (pM2) and msr_l and msr_r (pM3) of the respective parental plasmid. pM2 and pM3 encode FLP recombinase and ParA resolvase, respectively, under the control of an arabinose inducible promoter. The parental plasmids containing the pseudogene were sequence verified, and used to transform E. coli bacteria (DH10B). Transformed bacteria cultures were grown overnight to propagate the plasmids, then the recombination process was triggered upon induction with arabinose (to a final concentration of 0.02%), and an additional 4 hour incubation was necessary to complete the process. The minicircles (MC) were collected by standard plasmid preps and loaded on a 2% agarose gel containing ethidium bromide (1 μg/ml; Sigma Aldrich) for analysis control (FIG. 20, 1b and 2b for pM3 and pM2, respectively). The isolated minicircles were used for the enzymatic production of ssDNA as described above. FIG. 20 (1c and 2c) shows that the minicircles function as templates for RCA and subsequent cleavage of the RCA product results in ssDNA of the correct size.