Chimeric antigen receptor to which anti-cotinine antibody is linked, and use thereof
11478555 · 2022-10-25
Assignee
Inventors
- Kyungho Choi (Goyang-si, KR)
- Hyung-Bae Park (Seoul, KR)
- Ji Eun Lee (Goyang-si, KR)
- Yumi Oh (Goyang-si, KR)
- Ki-hyun Kim (Seoul, KR)
- Soohyun Kim (Seoul, KR)
- Hyori Kim (Seoul, KR)
- Junho Chung (Seongnam-si, KR)
Cpc classification
A61K39/395
HUMAN NECESSITIES
A61K31/7034
HUMAN NECESSITIES
A61K35/17
HUMAN NECESSITIES
A61K31/7034
HUMAN NECESSITIES
C07K2317/73
CHEMISTRY; METALLURGY
C07K2319/10
CHEMISTRY; METALLURGY
A61K2300/00
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
C12N15/86
CHEMISTRY; METALLURGY
A61K31/5513
HUMAN NECESSITIES
A61P35/00
HUMAN NECESSITIES
C07K16/2809
CHEMISTRY; METALLURGY
A61K31/704
HUMAN NECESSITIES
A61K31/5513
HUMAN NECESSITIES
A61K31/704
HUMAN NECESSITIES
C12N2740/13043
CHEMISTRY; METALLURGY
International classification
A61K35/17
HUMAN NECESSITIES
C07K16/28
CHEMISTRY; METALLURGY
A61K47/68
HUMAN NECESSITIES
Abstract
The present invention relates to chimeric antibody receptors with anti-cotinine antibodies linked, and use thereof. A T cell presenting the chimeric antibody receptor on the surface secretes interferon gamma specifically for a target molecule of a cotinine-conjugated binding molecule that is added together therewith and induces cell death of the cell expressing the target molecule by the T cell. On the contrary, by administering a cytotoxic agent conjugated with cotinine, cell death of the chimeric antigen receptor T cell is induced. Therefore, if necessary, a cytotoxic agent conjugated with cotinine can be administered to remove the chimeric antigen receptor T cells that have been already administered, thereby suppressing immune side effects due to hyperactivity of T cells. Thus, the chimeric antigen receptor to which the anti-cotinine antibody is linked can be effectively and safely used for the treatment of cancer.
Claims
1. An isolated chimeric antigen receptor comprising, in the order from the N-terminus to the C-terminus of the chimeric antigen receptor, the following (a)-(d): (a) an anti-cotinine single chain Fv (scFv) antibody, wherein the anti-cotinine scFv antibody comprises the amino acid sequence of SEQ ID NO: 1; (b) a CD8 (cluster of differentiation 8) hinge domain comprising the sequence of SEQ ID NO: 3; (c) a transmembrane domain of CD28 comprising the sequence of SEQ ID NO: 5 or 7; and (d) a signal transduction domain selected from the group consisting of the following (i)-(iii): (i) a CD28 cytoplasmic region comprising the sequence of SEQ ID NO: 9 or 11, (ii) a CD3 zeta cytoplasmic region comprising the sequence of SEQ ID NO: 13, and (iii) a CD28 cytoplasmic region comprising the sequence of SEQ ID NO: 9 or 11 and a CD3 zeta cytoplasmic region comprising the sequence of SEQ ID NO: 13.
2. The isolated chimeric antigen receptor of claim 1, wherein the signal transduction domain is the (iii) CD28 cytoplasmic region comprising the sequence of SEQ ID NO: 9 or 11 and CD3 zeta cytoplasmic region comprising the sequence of SEQ ID NO: 13.
3. The isolated chimeric antigen receptor of claim 1, wherein the chimeric antigen receptor comprises the amino acid sequence of SEQ ID NO: 15 or SEQ ID NO: 17.
4. An isolated nucleic acid molecule encoding the chimeric antigen receptor of claim 1.
5. An isolated expression vector comprising the nucleic acid molecule of claim 4.
6. The isolated expression vector of claim 5, wherein the expression vector is a virus vector.
7. The isolated expression vector of claim 6, wherein the virus vector is an adenovirus vector, a retrovirus vector, a lentivirus vector, or an adeno-associated virus vector.
8. An isolated virus comprising the nucleic acid molecule of claim 4.
9. An isolated cell transduced with the virus of claim 8.
10. The isolated cell of claim 9, wherein the cell is a T cell, a natural killer cell, or a macrophage.
Description
BRIEF DESCRIPTION OF DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
BEST MODE FOR CARRYING OUT THE INVENTION
(12) Hereinafter, the present invention will be described in detail.
(13) The present invention provides a chimeric antigen receptor linked with an anti-cotinine antibody, the chimeric antigen receptor comprising an anti-cotinine antibody or a fragment thereof, a hinge domain, a transmembrane domain, and a signal transduction domain.
(14) The chimeric antigen receptor linked with the anti-cotinine antibody may be in a form in which an anti-cotinine antibody or a fragment thereof, a hinge domain, a transmembrane domain, and a signal transduction domain are linked in this order in the direction from the N-terminus to the C-terminus.
(15) The anti-cotinine antibody is an antibody that binds to cotinine, and the antibody may be any one of a monoclonal antibody, a polyclonal antibody, or a recombinant antibody. In addition, the antibody may be an antibody in a full-length form or a fragment thereof. Here, the fragment of an antibody may comprise a part of an anti-cotinine antibody capable of binding to cotinine. The fragment of an antibody may be Fab, Fab′, F(ab′)2, Fv, or scFv.
(16) The anti-cotinine antibody or a fragment thereof may include a heavy chain variable region which includes CDR1, CDR2, or CDR3, where CDR1, CDR2, and CDR3 are complementarity determining regions (CDR) represented by the amino acid sequences of SEQ ID NOs: 23 to 25, respectively, or a light chain variable region including CDR1, CDR2 or CDR3, where CDR1, CDR2, and CDR3 are represented by the amino acid sequences of SEQ ID NOs: 26 to 28, respectively. Specifically, the above-mentioned anti-cotinine antibody or a fragment thereof may include a heavy chain variable region including CDR1, CDR2, and CDR3 represented by the amino acid sequences of SEQ ID NOs: 23 to 25, respectively, and a light chain variable region including CDR1, CDR2, and CDR3 represented by the amino acid sequences of SEQ ID NOs: 26 to 28, respectively. In an embodiment of the present invention, the anti-cotinine antibody may be a scFv fragment having an amino acid sequence of SEQ ID NO: 1. In addition, the anti-cotinine antibody may be at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% identical to the amino acid sequence of SEQ ID NO: 1.
(17) The anti-cotinine antibody or a fragment thereof according to the present invention can be prepared by modifying the method described in U.S. Pat. No. 8,008,448.
(18) The hinge domain is a domain for connecting an anti-cotinine antibody or a fragment thereof and a transmembrane domain, and may include a cysteine residue. The cysteine residue may be involved in the binding of a hinge domain to an antibody. For example, the hinge domain may be a CD8 hinge domain, an IgG1 hinge domain, an IgG4 hinge domain, a CD28 extracellular domain, a killer immunoglobulin-like receptor (KIR) extracellular domain, or a combination thereof (Mol. Ther, 2015(23):757; J. Immunother, 2006(29):284; Cancer Immunol. Res., 3(7):815-26; Blood, 2013(122):2965). The CD8 hinge domain may have an amino acid sequence of SEQ ID NO: 3. In addition, the CD8 hinge domain may be at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% identical to the amino acid sequence of SEQ ID NO: 3.
(19) The transmembrane domain may connect the hinge domain of the chimeric antigen receptor and the signal transduction domain. The transmembrane domain may penetrate cell membranes of cells such that the anti-cotinine antibody of the chimeric antigen receptor or a fragment thereof is located on the surface of the cells and the signal transduction domain is located intracellularly. The transmembrane domain may be a transmembrane region of the CD3 zeta, CD4, CD8, CD28, or KIR protein (Immunol. Rev., 2014(257):107; J. Immunol., 2010(184): 6938; Blood, 2013(122): 2965, J. Immunother, 2006(29):284; Cancer Immunol. Res., 3(7):815-26). In an embodiment of the present invention, the transmembrane domain may include a transmembrane region and a cytoplasmic region of CD28, and the domain may have an amino acid sequence of SEQ ID NO: 5 or SEQ ID NO: 7. In addition, the transmembrane domain may be at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% identical to the amino acid sequence of SEQ ID NO: 5 or SEQ ID NO: 7.
(20) The signal transduction domain receives a signal provided by an anti-cotinine antibody or a fragment thereof and plays a role in transmitting the signal into the cell to which the chimeric antigen receptor is bound. The signal transduction domain may be CD3 zeta, CD278 (inducible T-cell costimulator, ICOS), CD28, CD134 (OX40), CD137 (4-1BB), killer immunoglobulin-like receptor (KIR), or DNAX activation protein 12 (DAP12) (J. Immunol., 2004(172):104; Mol. Ther, 2013(21):2268; Proc. Natl. Acad Sci. USA, 2009(106):3360; Cancer Immunol. Res., 3(7):815-26). Specifically, the signal transduction domain may be a cytoplasmic region of CD28 and CD3 zeta, or a cytoplasmic region of CD137 (4-1BB) and CD3 zeta.
(21) In an embodiment of the present invention, the signal transduction domain may be a cytoplasmic region of CD28 and CD3 zeta. The cytoplasmic region of CD28 may have an amino acid sequence of SEQ ID NO: 9 or SEQ ID NO: 11, and the cytoplasmic region of CD3 zeta may have an amino acid sequence of SEQ ID NO: 13. In addition, the signal transduction domain may be at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% identical to the amino acid sequence of SEQ ID NO: 9, SEQ ID NO: 11 or SEQ ID NO: 13.
(22) Furthermore, the chimeric antigen receptor of the present invention may include a modified form of the antibody and the domain as described above. Here, the modification may be carried out by substituting, deleting, or adding one or more amino acids of the amino acid sequence of a wild-type antibody and domain without modifying the function of the antibody and the domain. Conventionally, the substitution may be alanine or may be carried out by conservative amino acid substitution which does not affect the charge, polarity, or hydrophobicity of the whole protein. In an embodiment of the present invention, the chimeric antigen receptor may have an amino acid sequence of SEQ ID NO: 15 or SEQ ID NO: 17. In the sequence of SEQ ID NO: 15, amino acid residues at positions 22-266 correspond to scFv (SEQ ID NO: 1), amino acid residues at positions 286-348 correspond to CD8 hinge (SEQ ID NO: 3), amino acid residues at positions 349-376 correspond to human CD28 transmembrane domain (SEQ ID NO: 5), and amino acid residues at positions 377-417 and 420-531 each correspond to human CD28 cyt (SEQ ID NO: 9) and human CD3 zeta cyt (SEQ ID NO: 13), respectively. In the sequence of SEQ ID NO: 17, amino acid residues at positions 22-266 correspond to scFv (SEQ ID NO: 1), amino acid residues at positions 286-348 correspond to CD8 hinge (SEQ ID NO: 3), amino acid residues at positions 349-378 correspond to mouse CD28 transmembrane domain (SEQ ID NO: 7), and amino acid residues at positions 379-419 and 422-533 each correspond to mouse CD28 cyt (SEQ ID NO: 11) and CD3 zeta cyt (SEQ ID NO: 13), respectively. Human CD8 hinge and mouse CD8 hinge share the same sequence of SEQ ID NO: 3, and human CD3 zeta cyt and mouse CD3 zeta cyt share the same sequence of SEQ ID NO: 13. In addition, the chimeric antigen receptor may be at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% identical to the amino acid sequence of SEQ ID NO: 15 or SEQ ID NO: 17.
(23) In addition, the present invention provides a nucleic acid molecule encoding the chimeric antigen receptor.
(24) The nucleic acid molecule according to the present invention may encode the anti-cotinine antibody or a fragment thereof (SEQ ID NO: 2), the hinge domain (SEQ ID NO: 4), the transmembrane domain (SEQ ID NO: 6 or 8), and the signal transduction domain (SEQ ID NO: 10, 12, or 14) described above. Here, the nucleic acid molecule encoding the chimeric antigen receptor according to the present invention may be a nucleotide sequence of SEQ ID NO: 16 or SEQ ID NO: 18. Here, the nucleotide sequence may include another substituted nucleotide sequence capable of expressing the antibody or domain of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, or SEQ ID NO: 13. In addition, the nucleic acid molecule may include a nucleic acid molecule encoding the antibody or the domain in the modified form as described above.
(25) In addition, the present invention provides an expression vector including the nucleic acid molecule.
(26) The expression vector may be an adenovirus vector, a retrovirus vector, a lentiviral vector, or an adeno-associated virus vector. In an embodiment of the present invention, the expression vector may be a retrovirus vector. The expression vector may be prepared by those skilled in the art such that the chimeric antigen receptor according to the present invention is expressed and secreted.
(27) The expression vector may further include a signal sequence or a leader sequence. In an embodiment of the present invention, the leader sequence may be an immunoglobulin kappa leader sequence. The immunoglobulin kappa leader sequence may have an amino acid sequence of SEQ ID NO: 19, and may be at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% identical to the amino acid sequence of SEQ ID NO: 19.
(28) The present invention also provides a virus comprising the nucleic acid molecule.
(29) The virus may include, in the genome thereof, a nucleic acid molecule encoding the chimeric antigen receptor according to the present invention. Therefore, a cell transduced with the virus may express the chimeric antigen receptor according to the present invention, in which an anti-cotinine antibody or a fragment thereof is located on the surface thereof. The virus may be an adenovirus, a retrovirus, a lentivirus, or an adeno-associated virus. In an embodiment of the present invention, the virus may be a retrovirus.
(30) The virus may be obtained by transfecting cells with the expression vector as described above together with an expression vector comprising a nucleic acid molecule encoding a viral envelope protein. Here, transfection can be carried out by a conventional method. For transfection, the envelope protein that can be used may be VSV-G, an ecotropic envelope, Mokola, Rabies, MLV-Ampho, MLV-10A1, LCMV-WE, LCMV-Arm53b envelope, feline endogenous gamma retrovirus RD114 envelope and a variant thereof, gibbon ape leukemia virus (GALV) envelope and a variant thereof, MLU 4070A envelope, or gp120/gp41 (Mol. Ther Methods Clin. Dev., 2016(3):16017; J. Virol. Methods, 2004:122-131; Molecular Therapy-Methods & Clinical Development 2016(3):16017).
(31) In addition, the present invention provides a cell transduced with the virus as described above.
(32) The cell may be transduced with a virus comprising a nucleic acid capable of expressing the chimeric antigen receptor according to the present invention. The transduced cell may have an anti-cotinine antibody or a fragment thereof located on the surface of the cell, and when cotinine binds to the antibody or the fragment thereof via antigen-antibody binding, cellular activity may be induced through intracellular signal transduction. Here, the cell may be a T cell, a natural killer cell, or a macrophage. In an embodiment of the present invention, the cell may be a T cell.
(33) In addition, the present invention provides a chimeric antigen receptor cell further comprising a binding molecule to which cotinine is conjugated.
(34) In the cotinine-conjugated binding molecule, when the binding molecule is an antibody, the complex may be formed via a bond between the carboxyl group of cotinine and the amine group of the antibody.
(35) The cotinine, being a hapten, may bind to an antibody that specifically recognizes cotinine without changing the properties of the cotinine-conjugated binding molecule. Specifically, the binding molecule may be a peptide, a nucleic acid, a protein, or a chemical substance. The nucleic acid may be an aptamer, and the protein may be an antibody or a hormone. In an embodiment of the present invention, the aptamer may be an anti-VEGF aptamer. In addition, in an embodiment of the present invention, the antibody may be an anti-HER2 antibody, an anti-CD20 antibody, or an anti-HLA antibody.
(36) The chimeric antigen receptor cell may harbor the anti-cotinine antibody or the fragment thereof linked to the cell. When the cotinine conjugates bind to an anti-cotinine antibody or a fragment thereof, they may induce cellular activities. Here, the binding of the cell and cotinine-conjugated binding molecule may be an antigen-antibody binding between the anti-cotinine antibody of the chimeric antigen receptor or a fragment thereof and cotinine. In addition, the cellular activity may be cell death-inducing activity by cytotoxic T cells.
(37) The chimeric antigen receptor cell may be prepared through a step of adding a cotinine-conjugated binding molecule to the cell in which a chimeric antigen receptor linked with an anti-cotinine antibody or a fragment thereof expresses, and a step of selecting a chimeric antigen receptor cell complexed with the binding molecule.
(38) In addition, the present invention provides a pharmaceutical composition for preventing or treating a condition or a disease in which specific cells are proliferated, comprising the chimeric antigen receptor cell as an active ingredient.
(39) The chimeric antigen receptor cell used as the active ingredient of the pharmaceutical composition is as described above.
(40) The condition or disease may be cancer, and the cancer may be solid cancer or hematologic malignancy. Here, the solid cancer may be lung cancer, colon cancer, prostate cancer, thyroid cancer, breast cancer, brain cancer, head and neck cancer, esophageal cancer, skin cancer, melanoma, retinoblastoma, thymic cancer, gastric cancer, colorectal cancer, liver cancer, ovarian cancer, uterine cancer, bladder cancer, rectal cancer, gall bladder cancer, bile duct cancer, or pancreatic cancer. In addition, the hematologic malignancy may be lymphoma, leukemia, or multiple myeloma.
(41) The pharmaceutical composition may comprise 10 to 95 wt % of the chimeric antigen receptor cells according to the present invention as an active ingredient based on the total weight of the pharmaceutical composition. In addition to the above-mentioned active ingredient, the pharmaceutical composition of the present invention may further include one or more types of active ingredients exhibiting the same or similar functions.
(42) In addition to the active ingredients described above, the pharmaceutical composition according to the present invention may further comprise one or more types of pharmaceutically acceptable carriers for administration.
(43) In addition, the present invention provides a method for preventing or treating a condition or a disease in which specific cells are proliferated, the method including administering the chimeric antigen receptor cell to a subject.
(44) The chimeric antigen receptor cell is as described above. In addition, the condition or disease may be cancer, and specific cancers are as described above.
(45) The dosage amount of the chimeric antigen receptor cell according to the present invention may be adjusted according to various factors such as the type of a disease, the severity of a disease, the type and content of active ingredients and other ingredients included in the pharmaceutical composition, the type of dosage form and the age, body weight, general health, sex, and diet of a patient, administration time, administration route, treatment time, and concurrently used drugs. However, for desired effects, the effective amount of the chimeric antigen receptor cells included in the pharmaceutical composition according to the present invention may be 1×10.sup.5 to 1×10.sup.11 cells/kg. Here, the administration may be performed once a day and may also be divided over several times a day.
(46) In addition, the chimeric antigen receptor cell of the present invention may be administered to a subject by various methods known in the art. The subject may be a mammal, and specifically a human. The administration route may be appropriately selected by those skilled in the art in consideration of the administration method, volume and viscosity of a body fluid, and the like.
(47) In addition, the present invention provides a method for producing a chimeric antigen receptor cell in a subject, the method comprising administering the cell to the subject; and administering a cotinine-conjugated binding molecule to the subject.
(48) The cell is transduced with a virus comprising a nucleic acid capable of expressing the chimeric antigen receptor according to the present invention, and is as described above. In addition, the cotinine-conjugated binding molecule is as described above.
(49) The subject may be a mammal, and specifically a human, and administration may be appropriately carried out by those skilled in the art as described above.
(50) In addition, the present invention provides a method for inducing cell death of a chimeric antigen receptor cell, the method comprising administering the cell and a cotinine-conjugated binding molecule to a subject; and further administering a cotinine-conjugated cytotoxic agent to the subject.
(51) The chimeric antigen receptor cell is as described above. In the case of an anticancer treatment using chimeric antigen receptor cells, immunotoxicity due to overactivity of the cells may occur as a side effect. Therefore, in order to resolve such a side effect, cell death of chimeric antigen receptor cells can be induced by additionally administering a cotinine-conjugated cytotoxic agent in addition to a cotinine-conjugated binding molecule.
(52) The cytotoxic agent mentioned above may be used as long as it is a substance capable of inducing cell death. Specifically, the cytotoxic agent may be duocarmycin, SN-38, calicheamicin, monomethyl auristatin E (MMAE), monomethyl auristatin F (MMAF), doxorubicin, pyrrolobenzodiazepine, DM4, or DM1. In an embodiment of the present invention, the cytotoxic agent may be duocarmycin or DM1 (ASCO meeting abstracts 2014(32):2558; Clin. Cancer Res., 2011(17):3157-69; Leuk. Lymphoma, 2015(56):2863-69; J. Clin. Oncol., 2014(32):3619-25; Proc. Am. Soc. Clin. Oncol., 2015(33):2503; J. Drug Deliv., 2013(2013):898146; Sci. Transl. Med., 2015(7):302ra136; Mol, Cancer Ther., 2014(13):1537-48; J. Clin. Oncol., 2008(26):2147-54).
(53) Administration of the cotinine-conjugated cytotoxic agent may be adjusted by various factors as described above. The effective amount of the chimeric antigen receptor cells included in the pharmaceutical composition according to the present invention may be appropriately determined by those skilled in the art. Here, the administration may be performed once a day and may also be divided over several times a day.
(54) Furthermore, the present invention provides a pharmaceutical kit for preventing or treating a condition or a disease in which specific cells are proliferated, the pharmaceutical kit comprising a first component containing the chimeric antigen receptor cell as an active ingredient in a pharmaceutically and therapeutically effective amount; and a second component containing a cotinine-conjugated cytotoxic agent as an active ingredient in a pharmaceutically and therapeutically effective amount.
(55) In the pharmaceutical kit of the present invention, the first component and the second component may be administered sequentially for the prevention or treatment of a condition or a disease. In the case of sequentially administering the first component and the second component, the second component may be administered when an immunotoxic side effect appears or when the chimeric antigen receptor cells are immortalized after the administration of the first component.
(56) The condition or disease may be cancer, and specific cancers are as described above.
MODE FOR THE INVENTION
(57) Hereinafter, the present invention is described in detail using the examples below. The examples below are merely intended exemplify the present invention, and the scope of the present invention is not limited thereto.
Example 1. Preparation of Retrovirus Comprising Nucleic Acid Encoding Chimeric Antigen Receptor Linked with Anti-Cotinine Antibody Fragment
(58) 1-1. Preparation of Construct
(59) First, a plasmid comprising nucleic acids each encoding an scFv fragment of an anti-cotinine antibody, a hinge domain, a transmembrane domain, and a signal transduction domain was prepared by the following method.
(60) Specifically, a scFv fragment of an anti-cotinine antibody was amplified by PCR in a conventional manner from a template plasmid using a primer including a mouse Ig kappa leader sequence. The template was a plasmid generated by ligation of an anti-cotinine scFv fragment cleaved with the SfiI restriction enzyme to a pCEP4 vector (Invitrogen, US) (Clin. Chim. Acta., 2010, 411-1238). Meanwhile, the skeletal part of the chimeric antigen receptor including c-myc tag (SEQ ID NO. 21), human CD8 hinge region, transmembrane region and cytoplasmic region of mouse CD28, and a cytoplasmic region of human CD3 zeta, was amplified by PCR from the template, pLxSN-scFv-anti-CEA-CD28-zeta plasmid (Dr. Philip Darcy, PeterMac Cancer Center, Australia). Specific sequences of the primers used for the PCR are shown in Table 1 below.
(61) TABLE-US-00001 TABLE 1 Name Sequence (5'′.fwdarw.3′) SEQ ID Number Anti-cotinine gatatcaagcttgccaccatggattttcaggtgcagattttcagcttcctgctaatcagtgcctca SEQ ID NO: 29 scFv forward gtcataatgtctagagagctcgatctgacccag direction Anti-cotinine tgaagagatggtgaccag SEQ ID NO: 30 scFv reverse direction CAR skeleton gcggccgcagaacaaaaa SEQ ID NO: 31 forward direction CAR skeleton actagtgtcgacttagcgagggggcagggc SEQ ID NO: 32 forward direction CEA CAR gatatcaagcttccatgggccaccatggattttcaggtgcag SEQ ID NO: 33 forward direction CEA CAR gaattcatcgatgtcgacgcggccgcttagcgagggggcagggc SEQ ID NO: 34 reverse direction
(62) The two obtained PCR products were ligated to prepare cDNA of the anti-cotinine chimeric antigen receptor. The prepared cDNA and the pMSCV-puro vector (K1062-1, Clontech, US) were cleaved with HindIII/SalI and HindIII/ClaI, respectively and ligated together. As a result, the cDNA encoding the scFv fragment of the anti-cotinine antibody and the skeletal domains of chimeric antigen receptor was cloned into the position downstream of the PGK promoter of a pMSCV-puro retroviral vector, where the puromycin-resistant gene had been originally located. The prepared construct was confirmed through nucleotide sequencing analysis, and named pMP-Cot-28Z (
(63) 1-2. Preparation of Retrovirus
(64) The retroviral construct prepared in Example 1-1 was transfected into PHOENIX™ GP (ATCC, US) cell line, along with pMD2.G plasmid (#12259, Addgene, US) which contains cDNA encoding the vesicular stomatitis Indiana virus G protein (VSV-G) as a virus envelope protein. Transfection was carried out according to the manufacturer's protocol using LIPOFECTAMINE™ 2000 (Cat. #11668-019, Invitrogen, US). After 48 hours, the culture supernatant containing the VSV-G pseudotyped retrovirus was harvested and incubated with a PHOENIX™ Eco (ATCC, US) cell line for infection with the retrovirus. Three to five days after infection, Phoenix Eco cells positively stained with fluorescence-labeled anti-myc antibody were selected using a flow cytometer (BD Bioscience, US) to establish a retrovirus-producing cell line. The retrovirus culture supernatant produced from this cell line was concentrated 10-fold using a centrifugal filter device (Amicon Ultra-15, 100 kDa cut-off, Millipore, US).
Example 2. Preparation of Cytotoxic T Cells with a Chimeric Antigen Receptor Linked with Anti-Cotinine Antibody Fragment Presented on Surface Thereof
(65) Using the virus prepared in Example 1-2, cytotoxic T cells were prepared with a chimeric antigen receptor linked with anti-cotinine antibody fragment presented on the surface thereof.
(66) First, splenocytes were isolated from B6 mice and dispensed in a cell culture container coated with 10 μg/mL of the anti-CD3 antibody (145-2C11, BD Bioscience, US) so that there were 2.5×10.sup.6 cells per well. The cells were supplemented with a total of 1 mL of the RPMI-1640 medium including 2 μg/mL of the anti-CD28 antibody (37.51, BD Bioscience, US), and cultured under conditions of 5% CO.sup.2 and 37° C. After 24 hours, 1 mL of the concentrated retrovirus including 2 μL of polybrene (Sigma-Aldrich, US) at 6 mg/mL was added to the cells and transduced by centrifugation for 90 minutes at 2,500 rpm using a centrifuge (Centrifuge 5810R, Eppendorf, US). Polybrene was used to increase the transduction rate of the retrovirus. Afterwards, 1 mL of the culture supernatant was removed, 1 mL of the concentrated retrovirus and 1 μL of polybrene were added thereto, and the retrovirus was transduced by centrifugation under the same conditions as above. Afterwards, 1 mL of the culture solution was removed, and 1 mL of the RPMI-1640 medium including 20 U/mL of interleukin-2 (Gibco, US) was added.
(67) After 48 hours, the medium of the virus-transduced T cells was replaced with a medium containing 20 U/mL of interleukin-2 and cultured for 72 hours under conditions of 5% CO.sup.2 and 37° C. Afterwards, the transduction rate of the chimeric antigen receptor linked with the anti-cotinine antibody fragment was determined by measuring the percentage of cell population positively stained with fluorescence-labeled anti-c-myc antibody using a flow cytometer, which was about 50 to 70% (
Example 3. Preparation of Complex of Cotinine and Binding Molecule
(68) 3-1. Preparation of Complex of Cotinine and Antibody
(69) As a binding molecule, cotinine-conjugates were prepared using rituximab (Genentech, Biogen, US), which is an anti-CD20 antibody, trastuzumab (Genentech, US), which is an anti-HER2 antibody, CT302 (Celltrion, Korea), which is an anti-influenza virus hemagglutinin antibody, and W6/32 (eBioscience, US), which is an anti-HLA antibody. Cotinine conjugation was performed by an EDC (1-ethyl-3-[3-dimethylaminopropyl]carbodiimide) coupling method.
(70) First, the antibodies above were dissolved in PBS to a concentration of 25 μM. Meanwhile, trans-4-cotinine carboxylic acid (Sigma-Aldrich) was dissolved in 1 mL of the MES buffer [0.1 M MES (2-[morpholino]ethanesulfonic acid) and 0.5 M sodium chloride, pH 6.0] to a concentration of 5 mM. EDC at a concentration of 50 mM and N-hydroxysulfosuccinimide (Sulfo-NHS, Thermo Scientific, US) at a concentration of 125 mM were added to the solution, and were then mixed by stirring at room temperature for 15 minutes to prepare an active solution in which cotinine-NHS ester was formed. A sodium hydroxide solution was added to adjust the pH of the above-mentioned active solution to 7 or more for optimal reaction between the cotinine-NHS ester and the amine group of the protein, and 1 mL of this active solution was mixed with the same volume of the antibody to be conjugated with cotinine at a concentration of 25 μM. The mixture was reacted by stirring at room temperature for 3 hours to obtain a cotinine-antibody conjugates produced via an EDC coupling reaction. The cotinine-antibody conjugates thus obtained was dialyzed with PBS using the SLIDE-A-LYZER™ Dialysis Cassette (Thermo Fisher Scientific, US), or was subject to replacing the buffer solution with PBS using the AMICON® Ultra Centrifugal Filter (EMD Millipore, US).
(71) 3-2. Preparation of Complex of Cotinine and Aptamer
(72) A cotinine-pegaptanib conjugate was prepared from pegaptanib, an aptamer that recognizes the vascular endothelial growth factor (VEGF), which was generated by the solid-phase oligopeptide synthesis method.
(73) In detail, a pegaptanib RNA aptamer (5′-pCfpGmpGmpArpArpUfpCfpAmpGmpUfpGmpAmpAmpUfpGmpCfpUfpUfpAmpUfp AmpCfpAmpUfpCfpCfpGm-p-dT-3-3′, SEQ ID NO: 35) was synthesized from the 3′-terminus to the 5 ‘-terminus using an oligopeptide synthesizer, and an amino C6 linker was attached to the 5’-terminus. Chemical conjugation with cotinine was performed using the active ester cross-linking method for the amino C6 linker, and then purified (>95% purity) by reverse phase high pressure liquid chromatography using an Xbridge Prep C18 column (5 μm, 10×150 mm, Waters Corp., US). The mass thereof was determined using a mass spectrometer (ST Pharm, Korea) (Clin. Chim. Acta., 2010(411):1238; Exp. Mol. Med., 2012(44):554).
(74) The synthesized pegaptanib cotinine-conjugate suspended in distilled water containing diethyl pyrocarbonate was denatured at 95° C. for 5 minutes, cooled at room temperature for 30 minutes, and then stored at −20° C.
Comparative Example 1. Preparation of Chimeric Antigen Receptor T Cells Linked with Anti-Carcinoembryonic Antigen scFv Fragment
(75) A chimeric antigen receptor gene linked with the anti-carcinoembryonic antigen (anti-CEA) scFv fragment was obtained by PCR method by using the primers listed in Table 1 above using the pLxSN-scFv-anti-CEA-zeta plasmid (Dr. Philip Darcy, PeterMac Cancer Center, Australia) as a template. The obtained gene and the pMSCV-puro vector (K1062-1, Clontech, US) were cleaved with HindIII and ClaI respectively and ligated together. The prepared construct was named pMP-C28Z. Using the construct, a retrovirus was prepared under the conditions and methods of Examples 1 and 2, and T cells transduced with the retrovirus were prepared.
Comparative Example 3. Preparation of T Cells Expressing Green Fluorescent Protein
(76) In order to prepare T cells expressing the green fluorescent protein, the gene of the green fluorescent protein (GFP) included in the pMIG-w plasmid (Dr. Yosef Refaeli, National Jewish Medical and Research Center, US) was obtained by digestion of the plasmid with NcoI and SalI. The digested GFP gene fragment was inserted into the NcoI/SalI site of the pMP-C28Z plasmid prepared in Comparative Example 2 after removing the anti-carcinoembryonic chimeric antigen receptor gene that was included in this plasmid. The prepared construct was named pMP-GFP. Afterwards, the construct was used to produce a retrovirus under the conditions and methods of Examples 1 and 2, and T cells transduced with the retrovirus were produced.
Test Example 1. Confirmation of Activation of Chimeric Antigen Receptor T Cells Linked with Anti-Cotinine Antibody Fragment Using Cotinine-Pegaptanib Conjugate
(77) Using the cotinine-pegaptanib conjugate prepared in Example 3-2 above, whether the conjugate recognizes the vascular endothelial growth factor (VEGF) and thereby induces activation of chimeric antigen receptor cells was examined.
(78) First, 5 μg/mL of VEGF protein was added to a 96-well plate, and then, the plate was placed overnight at 4° C. for coating the plate with VEGF. The coated plate was washed twice with the RPMI-1640 medium (Welgene, Korea) supplemented with 20% fetal bovine serum and 1% penicillin-streptomycin (Gibco, US), and the 100-nM cotinine-pegaptanib conjugate was added and incubated at 37° C. for 1 hour. After the reaction, the plate was washed 3 times with the RPMI-1640 medium, and then the chimeric antigen receptor T cells prepared in Example 2 were added so that there were 1×10.sup.5 cells per well, and the cells were cultured at 37° C. under 5% CO.sub.2 for 24 hours. Then, the amount of interferon gamma secreted in the medium was measured according to the manufacturer's protocol using an ELISA kit (Cat #. 555138, BD Bioscience, US), and the results are shown in
(79) As shown in
Test Example 2. Confirmation of Activation of Chimeric Antigen Receptor T Cells Linked with Anti-Cotinine Antibody Fragment Using Cotinine-Anti-HER2 Antibody Conjugate
(80) Using the cotinine-anti-HER2 antibody conjugate prepared in Example 3-1, it was determined whether the conjugate induces activation of chimeric antigen receptor cells by recognizing HER2 present on cell surfaces.
(81) First, the AU565 cell line, which is an HER2 positive cell, and the MDA-MB-231 cell line, which is an HER2 negative cell, were dispensed in wells of 96-well round bottom plate so that there were 3×10.sup.4 cells per well, and were cultured overnight under conditions of 5% CO.sub.2 and 37° C. After removal of the culture supernatant, 100 μL of the cotinine-anti-HER2 antibody conjugate added to a concentration 10 μg/mL in the DMEM medium (Gibco, US) supplemented with 10% fetal bovine serum and 1% penicillin-streptomycin was added, and was cultured under the same conditions for 1 hour. Thereafter, the medium was removed, the cells were washed twice with a serum-free medium, and then the chimeric antigen receptor T cells prepared in Example 2 were added so that there were 3×10.sup.5 cells per well, and cultured for 24 hours under conditions of 5% CO.sup.2 and 37° C. Then, the amount of interferon gamma secreted in the medium was measured according to the manufacturer's protocol using an ELISA kit, and the results are shown in
(82) As shown in
Test Example 3. Confirmation of Antigen-Specific Activation of Chimeric Antigen Receptor T Cells Linked with Anti-Cotinine Antibody Fragment
(83) In order to determine whether secretion of interferon gamma induced by chimeric antigen receptor T cells linked with the anti-cotinine antibody fragment complexed with the cotinine-anti-HER2 antibody conjugate is specific to the antibody linked with cotinine, the following experiment was carried out.
(84) The experiment was carried out under the same conditions and methods as in Test Example 2, except that only AU565 cells which were HER2 positive cells were used. T cells not expressing anything on the surface, T cells prepared in Comparative Example 1, or T cells prepared in Example 2 were each added in combination with a group (T cell only) in which only T cells were added to a plate in which tumor cells were not cultured, a group (CT302) in which the CT302 antibody and T cells were added to a plate in which tumor cells were cultured, a group (CT302-Cot) in which cotinine conjugated with the CT302 antibody and T cells were added to a plate in which tumor cells were cultured, a group (anti-HER2) in which the free anti-HER2 antibody and T cells were added to a plate in which cells were cultured, and a group (anti-HER2-Cot) in which cotinine conjugated with the anti-HER2 antibody and T cells were added to a plate in which tumor cells were cultured. As a result, the amount of secreted interferon gamma was measured by the ELISA method and shown in
(85) As shown in
Test Example 4. Confirmation of Expression of Chimeric Antigen Receptor Presented on Surface of T Cells
(86) The expression of the chimeric antigen receptor was determined by measuring the positivity of c-myc tag staining in T cells that do not express any chimeric antigen receptor on the surface and the chimeric antigen receptor T cells linked with the anti-cotinine antibody fragment or with the anti-CEA antibody fragment, prepared in Example 2 and Comparative Example 1 respectively.
(87) First, T cells that do not express any chimeric antigen receptor on the surface and the chimeric antigen receptor T cells prepared in Example 2 or Comparative Example 1 were dispensed so that there were 4×10.sup.5 cells per well. The dispensed cells were washed twice with a PBS buffer solution supplemented with 1% bovine serum albumin (BSA) and 0.02% NaN.sub.3, and the anti-c-myc antibody (BD Bioscience, US) was added after diluting at a ratio of 1:400 in the buffer solution. The mixtures were reacted for 20 minutes under refrigeration and washed 3 times with the PBS buffer solution. After adding 50 μL of a PBS supplemented with streptavidin-PE (BD Bioscience, US) at a ratio of 1:1000, anti-CD8-perCP-Cy5.5 (BD Bioscience, US) at a ratio of 1:500, and anti-CD4-APC (BD Bioscience, US) at a ratio of 1:1000, the mixtures were reacted for 25 minutes under refrigeration. After being washed three times with the PBS buffer, the cells were resuspended in a total of 300 μL of PBS. c-myc positive cells were analyzed using a flow cytometer (FACS Caliber, BD Bioscience, US), and the results are shown in
(88) As shown in
Test Example 5. Confirmation of Activation of Chimeric Antigen Receptor T Cells Linked with Anti-Cotinine Antibody Fragment Using Cotinine-Anti-CD20 Antibody Conjugate
(89) Using the cotinine-anti-CD20 antibody conjugate prepared in Example 3-1, it was determined whether the conjugate induces activation of chimeric antigen receptor cells by recognizing CD20 on the cell surface. Specifically, an experiment was carried out under the same conditions and methods as in Test Example 2, except that instead of the AU565 cell line and the MDA-MB-231 cell line, a Jurkat E6.1 cell line, which is a CD20 negative cell, and a Raji cell line, which is a CD20 positive cell, were cultured in the RPMI-1640 medium supplemented with 10% fetal bovine serum and 1% penicillin-streptomycin, and the amount of secreted interferon gamma was determined in a culture solution obtained after 48 hours of culturing. As a result, the amounts of secreted interferon gamma are shown in
(90) As shown in
Test Example 6. Confirmation of Activation of Chimeric Antigen Receptor T Cells Linked with Anti-Cotinine Antibody Fragment Using Cotinine-Anti-HLA Antibody Conjugate
(91) Using the cotinine-anti-HLA antibody conjugate prepared in Example 3-1, it was determined whether the conjugate induces activation of chimeric antigen receptor cells by recognizing HLA on the cell surface. Specifically, the experiment was carried out under the same conditions and methods as in Test Example 2, except that instead of the AU565 cell line and the MDA-MB-231 cell line, an NIH3T3 cell line, which is an HLA negative cell, and an HLA7 or HLA20 cell line, which is an HLA positive cell, were cultured in the IMDM medium supplemented with 20% fetal bovine serum and 1% penicillin-streptomycin, and the amount of secreted interferon gamma was determined in a culture solution obtained after 48 hours of culturing.
(92) Meanwhile, the HLA7 and HLA20 cell lines were prepared by the following method. Specifically, a mixed solution of 10 mL of peripheral blood and the same amount of PBS was dispensed to 15 mL of Ficoll-Paque PLUS (GE Healthcare Life Science, US) and centrifuged at 400×g for 30 minutes, with the brake set to “0”. After centrifugation, the plasma in the uppermost layer was removed, and 5 mL of a peripheral blood mononuclear cell layer was taken. 30 mL of the RPMI-1640 medium was added thereto, and centrifugation was performed for 10 minutes under the same conditions. The supernatant was removed, and the same amount of the RPMI-1640 medium was added to perform another wash. The precipitated cells were resuspended in 2 mL of the RPMI-1640 medium including 20% fetal bovine serum, and the number of cells was counted. 1×10.sup.7 cells were dispensed into a T25 flask, and a total of 6 mL of a culture medium was added and cultured under conditions of 5% CO.sub.2 and 37° C. 2 mL of Epstein-Barr virus (VR-1492, ATCC, US) was added thereto and cultured under the same conditions. After two hours of culturing, 1 μg/mL of cyclosporin A (Gibco, US) was added and cultured under the same conditions for 4 days. On the 4.sup.th day of culturing, 2 mL of a culture medium was added, and on the 7.sup.th day, was subcultured. When B cells transduced with Epstein-Barr virus formed colonies for 10 to 20 days by continuing the subculture, two colonies were taken to continue subculturing. The two immortalized B cell lines thus prepared were named HLA7 and HLA20, respectively.
(93) As a result, the amounts of secreted interferon gamma are shown in
(94) As shown in
Test Example 7. Confirmation of Target Cell-Specific Apoptotic Effect by Chimeric Antigen Receptor T Cells Linked with Cotinine-Anti-HER2 Antibody Conjugate and Anti-Cotinine Antibody Fragment
(95) Using the chimeric antigen receptor T cells linked with the anti-cotinine antibody fragment and the cotinine-anti-HER2 antibody conjugate prepared in Example 3-1, it was determined whether the chimeric antigen receptor T cells induces cell death of the HER-positive tumor cells by recognizing HER2 on the cell surface.
(96) First, the AU565 cell line, which is an HER2 positive cell, and MDA-MB-231 cell line, which is an HER2 negative cell, were dispensed such that 2×10.sup.6 cells were in a 100 mm cell culture container. The dispensed cells were cultured under the same medium and the conditions as in Test Example 2. The cultured cells were counted, and the cells were prepared so that there were 2×10.sup.7 cells per 1 mL for the AU565 cell line and 2×10.sup.7 cells per 1 mL for the MDA-MB-231 cell line, and carboxyfluorescein succinimidyl ester (CFSE, Invitrogen, US) was added thereto to a concentration of 1 μM and 100 nM, respectively. After reacting at room temperature for 8 minutes so that each cell line was stained to different fluorescence intensities, the results thereof were determined using a flow cytometer (BD Bioscience, US) and shown in
(97) As shown in
(98) The stained cells were washed twice with PBS, and the washed cell lines were mixed in 1:1 ratio of 1.5×10.sup.6 cells each and dispensed into a 96-well plate. When the dispensed cells were adhered, the cotinine-anti-HER2 antibody conjugate at 1 μg/mL was added thereto and allowed to react at room temperature for 1 hour. After the reaction, the cell lines were washed with a culture medium, counted, and placed in a 5-mL tube so that there were 5×10.sup.4 cells. Herein, the chimeric antigen receptor T cells linked with the anti-cotinine antibody fragment were added and cultured for 4 hours or 22 hours under conditions of 5% CO.sub.2 and 37° C. Here, the ratio of the chimeric antigen receptor T cells (working cell line, E), and the AU565 and MDA-MB-231 cell lines (target cell line, T) was set to be 0:1, 5:1, or 10:1. After culturing, in order to distinguish dead cells, 0.25 μg of 7-AAD (BD Bioscience, US) was added per 1×10.sup.6 cells and reacted at room temperature for 10 minutes, and then was analyzed by a flow cytometer. Here, 7-AAD negative cells and CFSE positive cells were fractionated and analyzed. As a result of the analysis, the rate of cell death of the target cell was calculated according to Equation 1 below, and the result is shown in
(99)
(100) As shown in
Test Example 8. Confirmation of Cell Death-Inducing Effect of Chimeric Antigen Receptor T Cells by Cotinine-Cytotoxic Agent Conjugate
(101) A cotinine-cytotoxic agent conjugate was prepared by Concortis Biotherapeutics, and it was determined whether the conjugate induces cell death of the chimeric antigen receptor T cells prepared in Example 2 by the following method.
(102) Specifically, the chimeric antigen receptor T cells were dispensed in a 96-well plate so that there were 5×10.sup.5 cells and cultured in a culture medium. A 0, 0.1, 1, 10, 100, or 1000 nM cotinine-cytotoxic agent conjugate was added thereto and cultured for 48 hours under conditions of 5% CO.sub.2 and 37° C. For the added cotinine-cytotoxic agent conjugate, a cotinine-duocarmycin single conjugate, a cotinine-DM1 complex conjugate (2×cotinine-4×DM 1), or cotinine-duocarmycin complex conjugate (2×cotinine-4×duocarmycin) was used (
(103)
(104) As shown in
(105) From the above results, it was found that using the small amount of cotinine-cytotoxic agent conjugate, cell death of the chimeric antigen receptor T cells linked with the anti-cotinine antibody fragment can be induced.