APPLICATION OF NITAZOXANIDE AND ACTIVE FORM THEREOF, TIZOXANIDE, IN TREATMENT OF SARS-COV-2 INFECTION

Abstract

Nitazoxanide represented by formula I and an active form thereof, tizoxanide compound, represented by formula II, a geometric isomer thereof and pharmaceutically acceptable salt thereof and/or solvate thereof and/or hydrate thereof, and a pharmaceutical composition containing this compound, used for preventing and/or treating coronavirus (such as SARS-CoV-2) infection.

##STR00001##

Claims

1.-8. (canceled)

9. A method for preventing and/or treating a disease in a mammal in need thereof, wherein the method comprises administering to the mammal in need thereof a therapeutically and/or prophylactically effective amount of i) a pharmaceutical composition comprising a compound represented by Formula I and/or Formula II, a geometric isomer, a pharmaceutically acceptable salt and/or a solvate and/or a hydrate thereof, or ii) a compound represented by Formula I and/or Formula II, a geometric isomer, a pharmaceutically acceptable salt and/or a solvate and/or a hydrates thereof, ##STR00005## wherein, the disease is a disease or an infection caused by a SARS-CoV 2.

10. (canceled)

11. The method according to claim 9, wherein the disease or the infection caused by a SARS-CoV 2 is a respiratory disease, sepsis or septic shock.

12. A method for inhibiting the replication or reproduction of a SARS-CoV-2 in a mammal in need thereof, wherein the method comprises administering to the mammal in need thereof i) a pharmaceutical composition comprising a compound represented by Formula I and/or Formula II, a geometric isomer, a pharmaceutically acceptable salt and/or a solvate and/or a hydrate thereof, or ii) a compound represented by Formula I and/or Formula II, a geometric isomer, a pharmaceutically acceptable salt and/or a solvate and/or a hydrates thereof, ##STR00006##

13.-18. (canceled)

19. The method according to claim 9, wherein the disease caused by a SARS-CoV-2 is COVID-19.

20. The method according to claim 9, wherein the mammal is bovine, equine, caprid, suidae, canine, feline, rodent, or primate.

21. The method according to claim 9, wherein the disease or the infection caused by a SARS-CoV-2 is severe acute respiratory infection (SARI).

22. The method according to claim 9, wherein the disease or the infection caused by a SARS-CoV-2 is simple infection, fever, cough, sore throat, pneumonia, acute respiratory infection, severe acute respiratory infection, hypoxic respiratory failure or acute respiratory distress syndrome.

23. The method according to claim 9, wherein the mammal is a human, a cat, a dog, or a pig.

24. The method according to claim 9, wherein the pharmaceutical composition further comprises a pharmaceutically acceptable carrier or excipient.

25. The method according to claim 24, wherein the pharmaceutical composition is a solid preparation, an injection, an external preparation, a spray, a liquid preparation, or a compound preparation.

26. The method according to claim 12, wherein the mammal is bovine, equine, caprid, suidae, canine, feline, rodent, or primate.

27. The method according to claim 12, wherein the mammal is a human, a cat, a dog, or a pig.

28. The method according to claim 12, wherein the pharmaceutical composition further comprises a pharmaceutically acceptable carrier or excipient.

29. The method according to claim 28, wherein the pharmaceutical composition is a solid preparation, an injection, an external preparation, a spray, a liquid preparation, or a compound preparation.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0046] FIG. 1 shows that nitazoxanide can effectively reduce the viral nucleic acid load in Vero E6 cells infected by SARS-CoV-2. In FIG. 1, (a) shows that nitazoxanide can reduce the viral RNA load in the cells 48 hours after the cells were infected by SARS-CoV-2. The ordinate is the copy number of viral RNA in the sample, and the abscissa is the drug concentration; (b) shows that the test cells were treated by nitazoxanide at the test concentration for 48 hours, and no cytotoxicity was observed. The ordinate is the percentage of cell viability relative to the vehicle control group (only cells, no drug was added), and the abscissa is the drug concentration.

SPECIFIC MODELS FOR CARRYING OUT THE INVENTION

[0047] The following examples are illustrative preferred embodiments of the present application and do not constitute any limitation to the present application.

Example 1: Experiment on Nitazoxanide Reducing Viral Nucleic Acid Load in SARS-CoV-2 Infected Cells

[0048] (1) Drug Treatment of Virus-Infected Cells

[0049] Vero E6 cells (purchased from ATCC, Catalog No. 1586) was inoculated on a 24-well plate, cultured for 24 hours; then virus infection was carried out. Specifically, SARS-CoV-2 (2019-nCoV) virus (nCoV-2019BetaCoV/Wuhan/WIV04/2019 strain, provided by Wuhan Institute of Virology, Chinese Academy of Sciences) was diluted with 2% cell maintenance solution (formulation: FBS (purchased from Gibco company, Catalog No. 16000044) was added to MEM (purchased from Gibco, Catalog No. 10370021) at a volume ratio of 2%, thereby obtaining the 2% cell maintenance solution) to a corresponding concentration, and then added to a 24-well plate so that each well contained a viral load of 100TCID.sub.50. Nitazoxanide (purchased from Selleck Chemicals, Catalog No. S1627) were diluted with 2% cell maintenance solution to corresponding concentrations and added separately to the corresponding wells, so that the final concentrations of the drugs were 100 μM, 33 μM, 11 μM, 3.7 μM, 1.23 μM, 0.41 μM, 0.14 μM, respectively, then the plate was placed in a 37° C., 5% CO.sub.2 incubator and cultured for 48 hours. To the vehicle control group, the 2% cell maintenance solution without any test drugs was added.

[0050] (2) RNA Extraction

[0051] RNA extraction kit was purchased from Qiagen Company, Catalog No. 74106. The consumables (spin columns, RNase-free 2m1 collection tubes, etc.) and reagents (RLT, RW1, RPE, RNase-free water, etc.) involved in the following RNA extraction steps were part of the kit. The following extraction steps were recommended steps in the kit instruction.

[0052] 1) 100 μL of the supernatant was taken from the tested plate and added to a nuclease-free EP tube, then 350 μL of Buffer RLT was added to each well and mixed by beating with a transfer liquid gun until complete lysis was achieved, then centrifugation was carried out to obtain a supernatant;

[0053] 2) an equal volume of 70% ethanol was added to the supernatant obtained in 1) and mixed well;

[0054] 3) the mixture solution obtained in 2) was transferred to a RNase-free spin column, and centrifuged at 12000 rpm for 15 seconds, and the waste liquid was discarded;

[0055] 4) 700 μL of Buffer RW1 was added to the spin column, and centrifuged at 12000 rpm for 15 seconds to clean the spin column, and the waste liquid was discarded;

[0056] 5) 500 μL of Buffer RPE was added to the spin column, and centrifuged at 12000 rpm for 15 seconds to clean the spin column, and the waste liquid was discarded;

[0057] 6) 500 μL of Buffer RPE was added to the spin column, and centrifuged at 12000 rpm for 2 min to clean the spin column, the waste was discarded;

[0058] 7) a new RNase-free 2m1 collection tube was used for replacement, centrifugation was carried out at 12000 rpm for 1 min, the spin column was dried, and then the spin column was transferred to a 1.5 m1 collection tube in step 8);

[0059] 8) a new 1.5 m1 collection tube was used for replacement, in which the spin column dried in step 7) was placed, and 30 μl of RNase-free water was added to the spin column, and centrifugation was carried out at 12000 rpm for 2 minutes, the obtained eluate contained the corresponding RNA, then the RNase inhibitor (purchased from NEB company, Catalog No. M0314L) was added, and Nano Drop (purchased from Thermo scientific, Nano Drop One) was used to detect each RNA concentration.

[0060] (3) RNA Reverse Transcription

[0061] In the experiment, the reverse transcription kit (PrimeScript™ RT reagent Kit with gDNA Eraser, Catalog No. RR047Q) produced by TaKaRa was used for RNA reverse transcription. The steps were as follows.

[0062] {circle around (1)} Removal of gDNA: RNA samples of each experimental group were collected, 1 μg of each sample was taken for reverse transcription. First, 2 μl of 5× gDNA Eraser Buffer was added to the RNA sample of each experimental group, the reaction system was supplemented with RNase-free water to reach 10 μl, mixed well, and subjected to water bath at 42° C. for 2 min to remove the gDNA that might be present in the sample;

[0063] {circle around (2)} Reverse transcription: Appropriate amounts of enzyme, primer Mix and reaction buffer were added to the sample obtained in {circle around (1)}, RNase-free water was added to supplement to reach a volume of 20 μl, the reaction was performed in a water bath at 37° C. for 15 minutes, and then in water bath at 85° C. for 5 seconds, to obtain cDNA by transcription.

[0064] (4) Real-Time PCR

[0065] Fluorescence quantitative PCR was used to detect the number of copies per milliliter of the original virus solution.

[0066] The reaction system was mixed by using TB Green Premix (Takara, Cat #RR820A), and the amplification reaction and reading were carried out with StepOne Plus Real-time PCR instrument (brand: ABI). The copy number contained in per milliliter of the original virus solution was calculated. The steps were as follows:

[0067] {circle around (1)} Establishment of standard product: the plasmid pMT-RBD (the plasmid was provided by Wuhan Institute of Virology, Chinese Academy of Sciences) was diluted to 5×10.sup.8 copies/μL, 5×10.sup.7 copies/μL, 5×10.sup.6 copies/μL, 5×10.sup.5 copies/μL, 5×10.sup.4 copies/μL, 5×10.sup.3 copies/μL, 5×10.sup.2 copies/μL, respectively. 2 μL of standard product or cDNA template was taken for qPCR reaction.

[0068] {circle around (2)} The primer sequences used in the experiment were as follows (all indicated in the 5′-3′ direction):

TABLE-US-00001 RBD-qF: CAATGGTTTAACAGGCACAGG RBD-qR: CTCAAGTGTCTGTGGATCACG

[0069] {circle around (3)} The reaction procedure was as follows:

[0070] Pre-denaturation: 95° C. for 5 minutes;

[0071] Cycle parameters: 95° C. for 15 seconds, 54° C. for 15 seconds, 72° C. for 30 seconds, a total of 40 cycles.

[0072] (5) Cytotoxicity Test of Drugs

[0073] The cytotoxicity test of drugs was carried out by using CCK-8 kit (Beyotime). Specific steps were as follows:

[0074] {circle around (1)} 1×10.sup.4 Vero-E6 cells (ATCC) were inoculated in a 96-well plate and cultured at 37° C. for 8 hours.

[0075] {circle around (2)} The drug was diluted with DMSO to an appropriate concentration of mother solution, and then diluted with MEM (purchased from Gibco company, Catalog No. 10370021) medium containing 2% FBS (purchased from Gibco company, Catalog No. 16000044) to the same concentration as that for the drug treatment. The original medium in the 96-well plate was discarded, 100 μL of the drug-containing MEM medium was taken and added to the cells, and three replicate wells were set for each concentration. A vehicle control (adding DMSO and medium to cells in wells, without adding drug) and a blank control (adding DMSO and medium to the wells, without cells) were set up. After the drug was added, the cells were cultured at 37° C. for 48 hours.

[0076] {circle around (3)} 20 μL of CCK-8 solution (Beyotime) was added to the well to be tested, mixed gently without generating bubbles, and cultured subsequently at 37° C. for 2 hours. OD.sub.450 was read on a microplate reader (purchased from Molecular Devices, model: SpectraMax M5), and the cell viability was calculated:


Cell viability (%)=(A.sub.(drug treatment group)−A.sub.(blank control))/(A.sub.(vehicle control)−A.sub.(blank control))×100%

[0077] Wherein, A was the reading of the microplate reader.

[0078] (6) Experimental Results

[0079] The results of the virus proliferation inhibition experiment showed that the test compound at concentrations of 100 μM, 33 μM, 11.1 μM and 3.7 μM could effectively inhibit the replication of SARS-CoV-2 virus genome in the infected supernatant (Table 1).

TABLE-US-00002 TABLE 1 In vitro antiviral test results of the test compound (nitazoxanide) Concentration (μM) 100 33.33 11.11 3.70 1.23 0.41 0.14 Vehicle Copy number 1220444.5 ± 1424671.5 ± 5389366.5 ± 21027512.5 ± 76022948.5 ± 363337006 ± 820470664.5 ± 74119457 ± of virus 130618.89 80107.42 1871677.00 1791348.26 10886647.82 85827045.67 130183808.09 8463359.65 genome

[0080] The cytotoxicity test results showed that the treatment of the test compound nitazoxanide did not change the cell viability at all test concentrations, that was, the test compound had no toxic effect on the cells at all concentrations (Table 2 and FIG. 1).

TABLE-US-00003 TABLE 2 Cytotoxicity test results of the test compound (nitazoxanide) Concentration (μM) 100 33.33 11.11 3.70 1.23 0.41 0.14 Vehicle Cell viability 93.29 ± 93.58 ± 96.03 ± 96.47 ± 98.54 ± 101.40 ± 98.78 ± 103.47 ± (% of vehicle 1.55 0.75 1.34 3.10 1.28 2.34 2.38 2.65 control)