Dnazyme-nanoparticle conjugates and methods of use thereof
20170298346 ยท 2017-10-19
Assignee
Inventors
Cpc classification
C12N2770/24122
CHEMISTRY; METALLURGY
G01N2333/185
PHYSICS
C12N15/11
CHEMISTRY; METALLURGY
G01N33/5308
PHYSICS
Y02A50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
G01N2333/181
PHYSICS
International classification
Abstract
The present invention relates to DNAzymes (also known as deoxyribozymes, DNA enzymes, catalytic DNA, or DZ), which are conjugated to nanoparticles (NP) to facilitate the detection of nucleic acids. One aspect of the invention relates to compounds comprising DNAzymes conjugated to nanoparticles (DZ-NP), such as metallic or gold nanoparticles, and methods for their synthesis. Another aspect of the invention relates to methods of using the conjugated compounds to detect nucleic acids, such as genomic material or transcripts of infectious agents, such as viruses, exemplified by applications demonstrating visual detection of Flavivirus RNA molecules, such as dengue virus, or Alphavirus RNA molecules, such as chikungunya virus, in short time periods, using compositions comprising stable components.
Claims
1. A compound comprising a DNAzyme (DZ) conjugated to a nanoparticle (NP) by a linker (L), designated DZ-NP, wherein said DNAzyme comprises: a deoxyribonucleic acid (DNA) sequence comprising a 5 Binding Arm (5 BA), a Catalytic Core (CC), and a 3 Binding Arm (3 BA); wherein said 5 and 3 Binding Arms are complementary to two target sequences on a target region of a ribonucleic acid (target RNA) comprising at least one purine-pyrimidine dinucleotide motif; wherein said DNAzyme is an RNA-Cleaving DNAzyme selected from the group consisting of a 10-23 DNAzyme and a 8-17 DNAzyme; wherein said nanoparticle is in a shape selected from a sphere, rod, a polygonal rod, rectangular block, cube, tetrapod, and pyramid; wherein said nanoparticle comprises one or more substances selected from the group consisting of (a) a metallic substance, selected from the group consisting of gold, silver, iron, titanium, platinum, cerium, silicon, palladium, transition metals, and oxides thereof, and (b) a non-metallic substance selected from the group consisting of carbon, dextrose, solid lipid nanoparticles, dextran, and chitosan; wherein a nanoparticle comprising a metallic substance, is designated a metallic nanoparticle (mNP); a nanoparticle comprising a non-metallic substance is designated a non-metallic nanoparticle, nmNP); a nanoparticle comprising a metallic and a non-metallic substance, is designated a composite nanoparticle (cNP), and a nanoparticle that comprises two or more metallic substances, or oxides thereof, is designated a multi-metallic nanoparticle (mmNP).
2. The compound of claim 1, wherein the DDZ is linked to said nanoparticle by a linker through two or more covalent bonds, designated a covalent linker (cL).
3. The compound of claim 2, wherein said covalent linker comprises SH(CH.sub.2).sub.6.
4. The compound of claim 3, wherein said covalent linker comprises one or more compounds selected from the group consisting of Streptavidin fluorescent conjugates, acridine and Azobenzene fluorescent conjugates, Biotin, Biotin Diol Linker, Biotin TEG, Biotin BB, Desthiobiotin TEG, DOTA (1,4,7,10-Tetraazacyclododecane-1,4,7,10-tetraacetic acid), Dual Biotin, Photocleavable (PC) Biotin, Psoralen C2, Psoralen C6, Fluorescein, FITC, TRITC, fluorescent proteins, GFP, YFP, RFP, 2 modified NTPs, 2 fluoro dC (fC), 2 amino and 2 OMe analogs, polyethylene glycol (PEG) transport molecules, acetyl-PEG-amine, and Carboxy-PEG-Amine.
5. The compound of claim 1, wherein the DZ is linked to said nanoparticle by a linker through one or more high-affinity noncovalent bonds, designated a high affinity noncovalent linker (hancL).
6. The compound of claim 5, wherein said high affinity noncovalent linker comprises biotin.
7. The compound of claim 1, wherein said target RNA is a viral RNA.
8. The compound of claim 7, wherein said target region of a ribonucleic acid (target RNA) is selected from the group consisting of: (a) a target region which is within a viral sequence encoding a polypeptide; (b) a target region which is within a noncoding viral sequence; and (c) a target region comprising a viral 5-3 Cyclization Sequence (CS).
9. The compound of claim 7, wherein said viral RNA is from a mosquito-borne Flavivirus selected from the group consisting of Avian tembusu-related virus, Calbertado virus, Chaoyang virus, Aroa virus, dengue virus, Japanese encephalitis virus, Kokobera virus, Ntaya virus, Spondweni virus, Zika virus, and Yellow fever virus group.
10. The compound of claim 8, wherein said Flavivirus is a dengue virus.
11. The compound of claim 10, wherein the target region of a Dengue-specific DNAzyme (DDZ) comprising a viral 5-3 Cyclization Sequence (CS) is selected from the group consisting of (a) a target region designated DDZ-M comprising the sequence TABLE-US-00020 (SEQIDNO:15) UGCUGAAACGCGAGAGAAA and (b) a target region designated DDZin-M comprising the sequence TABLE-US-00021 (SEQIDNO:20) UGCUGAAACGCGAGAGAAA.
12. The compound of claim 10, wherein the target region of a Dengue-virus specific DNAzyme is selected from the group consisting of DDZ-1, DDZ-2, DDZ-3, and DDZ-4, which is a conserved region, specific to each virus serotype, selected from the group consisting of: TABLE-US-00022 DDZ-1 (SEQIDNO:16) UCAAGAAGAAUGGAGCGAU; DDZ-2 (SEQIDNO:17) AGGCGAGAAAUACGCCUUU; DDZ-3 (SEQIDNO:18) ACAGCAGGAGUCUUGGCUA; and DDZ-4 (SEQIDNO:19) UCUGGAAAAAUGAACCAAC; respectively.
13. The compound of claim 10, wherein said catalytic core (CC) is TABLE-US-00023 (SEQIDNO:13) GGCTAGCTACAACGA.
14. The compound of claim 10, wherein said 5 Arm and said 3 Arm are a pair of sequences selected from the group consisting of: TABLE-US-00024 (SEQIDNO:1) TTTCTCTCG and (SEQIDNO:7) GTTTCAGCA; (SEQIDNO:2) ATCGCTCCA and (SEQIDNO:8) TCTTCTTGA; (SEQIDNO:3) AAAGGCGTA and (SEQIDNO:9) TTCTCGCCT; (SEQIDNO:4) TAGCCAAGA and (SEQIDNO:10) TCCTGCTGT; and (SEQIDNO:5) GTTGGTTCA and (SEQIDNO:11) TTTTCCAGA.
15. The compound of claim 10, wherein said linker and said DNAzyme designated DDZ-1, DDZ-2, DDZ-3, DDZ-4, DDZ-in-M, are selected from the group consisting of: TABLE-US-00025 thiol-DDZ-1 (SEQIDNO:22) 5-SH-(CH.sub.2).sub.6-d(ATCGCTCCAGGCTAGCTACAACGATCTTCTTGA)- 3 (SH-DDZ-1); thiol-DDZ-2 (SEQIDNO:23) 5-SH-(CH.sub.2).sub.6-d(AAAGGCGTAGGCTAGCTACAACGATTCTCGCCT)- 3 (SH-DDZ-2); thiol-DDZ-3 (SEQIDNO:24) 5-SH-(CH.sub.2).sub.6-d(TAGCCAAGAGGCTAGCTACAACGATCCTGCTGT)- 3 (SH-DDZ-3); thiolDDZ-4 (SEQIDNO:25) 5-SH-(CH.sub.2).sub.6-d(GTTGGTTCAGGCTAGCTACAACGAGTTTCAGCA)- 3 (SH-DDZ-4); and thiol-DDZin-M (SEQIDNO:26) 5-SH-(CH.sub.2).sub.6-d(TTTCTCTCGAGCAACATCGATCGGGTTTCAGCA)- 3 (SH-DDZin-M), respectively.
16. The compound of claim 7, wherein said viral RNA is from an Alphavirus selected from a complex of viruses in the group consisting of Barmah Forest virus, Eastern equine encephalitis, Middleburg virus, Ndumu virus, Semliki Forest virus, Sindbis virus, Venezuelan equine encephalitis, Western equine encephalitis, unclassified Alphaviruses, and recombinant viruses within each complex.
17. The compound of claim 16, wherein said Alphavirus is chikungunya virus in the Semliki Forest Virus complex.
18. The compound of claim 17, wherein the target region of a chikungunya-specific DNAzyme (CDZ) is a conserved region, specific to each virus serotype, which is TABLE-US-00026 SEQIDNO(28) AAUGCUAGAGCGUUCUCGCAU.
19. The compound of claim 17, wherein said catalytic core (CC) is TABLE-US-00027 (SEQIDNO:13) GGCTAGCTACAACGA.
20. The compound of claim 17, wherein said 5 Arm and said 3 Arm are a pair of sequences selected from the group consisting of: TABLE-US-00028 (SEQIDNO:26) ATGCGAGAA; and (SEQIDNO:27) GCTCTAGCA.
21. The compound of claim 17, wherein said linker and said DNAzyme designated CDZ are selected from the group consisting of: TABLE-US-00029 thiol-CDZ(SH-CDZ) (SEQIDNO:28) 5-SH-(CH2)6-d(TTTCTCTCGGGCTAGCTACAACGAGTTTCAGC A)-3.
22. The compound of claim 1, wherein said nanoparticle is a metallic nanoparticle.
23. The compound of claim 22, wherein said metallic nanoparticle comprises gold, designated as a gold nanoparticle (AuNP).
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0021] The foregoing aspects and many of the attendant advantages of this invention will become more readily appreciated as the same become better understood by reference to the following detailed description, when taken in conjunction with the accompanying drawings, wherein:
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038] The following is a list of terms and their definitions used throughout the specification and the claims:
[0039] The terms cell and cells, which are meant to be inclusive, refer to one or more cells which can be in an isolated or cultured state, as in a cell line comprising a homogeneous or heterogeneous population of cells, or in a tissue sample, or as part of an organism, such as a transgenic organism.
[0040] The term isolated when used with respect to a polynucleotide (e.g., single- or double-stranded RNA or DNA), an enzyme, or more generally a protein, means a polynucleotide, an enzyme, or a protein that is substantially free from the cellular components that are associated with the polynucleotide, enzyme, or protein as it is found in nature. In this context, substantially free from cellular components means that the polynucleotide, enzyme, or protein is purified to a level of greater than 80% (such as greater than 90%, greater than 95%, or greater than 99%).
[0041] General abbreviations and their corresponding meanings include: aa or AA=amino acid; mg=milligram(s); ml or mL=milliliter(s); mm=millimeter(s); mM=millimolar; nmol=nanomole(s); pmol=picomole(s); ppm=parts per million; RT=room temperature; U=units; ug, g=micro gram(s); ul, l=micro liter(s); uM, M=micromolar.
[0042] Specific abbreviations and their corresponding meanings include: NP=nanoparticle; AuNP=gold nanoparticle; DDZ=dengue virus targeting DNAzyme; L=linker; DDZ-M=universal dengue virus targeting DNAzyme; DDZ-1=DNAzyme targeting dengue virus serotype 1; DDZ-2=DNAzyme targeting dengue virus serotype 2; DDZ-3=DNAzyme targeting dengue virus serotype 3; DDZ-4=DNAzyme targeting dengue virus serotype 4. CDZ=CHIKV targeting DNAzyme.
DETAILED DESCRIPTION OF THE INVENTION
[0043] The present invention relates to compounds comprising DNAzyme (DZ) conjugated to a nanoparticle (NP) by a linker (L), designated DZ-NP, methods of detecting nucleic acids having specific target sites using the DZ-NP conjugates, and stable compositions comprising the DZ-NP conjugates. The conjugates encompass virus-specific DNAzymes, such as dengue virus-specific DNAzymes (DDZ), and chikungunya virus-specific DNAzymes (CDZ). Other types of virus-specific DNAzymes are also encompassed by the invention.
[0044] One aspect of the invention relates to a compound comprising a DNAzyme (DZ) conjugated to a nanoparticle (NP) by a linker (L), designated DZ-NP, wherein said DNAzyme comprises: a deoxyribonucleic acid (DNA) sequence comprising a 5 Binding Arm (5 BA), a Catalytic Core (CC), and a 3 Binding Arm (3 BA); wherein said 5 and 3 Binding Arms are complementary to two target sequences on a target region of a ribonucleic acid (target RNA) comprising at least one purine-pyrimidine dinucleotide motif.
[0045] Related aspects are directed to a DZ-NP wherein said DNAzyme is an RNA-Cleaving DNAzyme selected from the group consisting of a 10-23 DNAzyme and a 8-17 DNAzyme. Other aspects are directed to a DZ-NP wherein said DNAzyme is selected from UO.sub.2.sup.2+-dependent and Mg.sup.2+-independent DNAzymes.
[0046] The nanoparticles used in the invention may be different shapes, typically a sphere, but also including shapes selected from a rod, a polygonal rod, rectangular block, cube, tetrapod, and pyramid.
[0047] Related aspects are directed to a DZ-NP wherein nanoparticle is a quantum dot. Quantum dots are tiny particles, or nanoparticles, of a semiconductor material, traditionally chalcogenides, such as selenides or sulfides, of metals like cadmium or zinc (e.g., CdSe or ZnS), ranging in size from 2 nm to 10 nm in diameter. Quantum dots have unique optical and electrical properties that are often different in character from those observed in the corresponding bulk material. One prominent difference is the emission of photons under excitation, which are visible to the human eye as light. The wavelength of photon emissions depend on the size, and not on the material, from which the quantum dot is made. Gold quantum dots can also be produced by a variety of methods [Goho (2004)].
[0048] The nanoparticles may be comprised of different substances, which may be homogeneous, or pure, such as a metal (designated a metallic nanoparticle, mNP), or a non-metallic substance (designated a non-metallic nanoparticle, nmNP), or they may be made of composite materials (designated a composite nanoparticle, cNP) comprised of two or more substances, such as a metallic and a non-metallic substance. Non-metallic nanoparticles may comprise one or more substances selected from the group consisting of carbon, dextrose, solid lipid nanoparticles, dextran, chitosan. A composite nanoparticle comprises a composite material comprising a metallic and a non-metallic substance. The nanoparticles may also comprise one or more substances selected from the group consisting of: gold, silver, iron, titanium, platinum, cerium, silicon, palladium, transition metals, and oxides thereof. Nanoparticles that comprise two or more metallic substances, or oxides thereof, are designated multi-metallic nanoparticles (mmNP). Nanoparticles that comprise metal are designated metallic nanoparticles (mNP). One aspect of the invention is directed to gold nanoparticles (AuNP), which are typically spherical, ranging in size from about 1 nm to about 400 nm in diameter. The range of sizes in a population of particles may vary, with a narrow or broad distribution of sizes in a sample, based on the source of the particles, and the process used to manufacture or purify particles of different shapes and sizes.
[0049] Related aspects are directed to DZ-NP conjugates wherein the DZ is linked to said nanoparticle by a linker through two or more covalent bonds, designated a covalent linker (cL). In one aspect, the covalent linker comprises SH(CH.sub.2).sub.6.sup.. In other aspects, said covalent linker comprises Streptavidin fluorescent conjugates, acridine and Azobenzene fluorescent conjugates, Biotin, Biotin Diol Linker, Biotin TEG, Biotin BB, Desthiobiotin TEG, DOTA (1,4,7,10-Tetraazacyclododecane-1,4,7,10-tetraacetic acid), Dual Biotin, Photocleavable (PC) Biotin, Psoralen C2, Psoralen C6, Fluorescein, FITC, TRITC, fluorescent proteins (e.g. GFP, YFP, and RFP), 2 modified NTPs (e.g. 2 fluoro dC (fC), 2 amino and 2 OMe analogs), polyethylene glycol (PEG) transport molecules, acetyl-PEG-amine, Carboxy-PEG-Amine. In other aspects, the DDZ is linked to said nanoparticle by a linker through one or more high-affinity noncovalent bonds, designated a high affinity noncovalent linker (hancL), such as a linker that comprises biotin.
[0050] The DZ-NP conjugates can be configured to target different nucleic acids. One aspect is directed to a target nucleic acid which is an RNA, such as a viral RNA. In one aspect, the viral RNA is a genomic viral RNA, and in another aspect the viral RNA is a viral RNA transcript. Different types of viral RNAs may be targeted.
[0051] In one aspect the DZ-NP conjugate is designed to target a viral RNA is a Flavivirus RNA, such as a Flavivirus selected from a group consisting of in a mammalian tick-borne flaviviruses, mosquito-borne viruses, and viruses with no known arthropod vectors. In one aspect the Flavivirus is a mosquito-borne virus selected from the group consisting of Avian tembusu-related virus, Calbertado virus, Chaoyang virus, Aroa virus, dengue virus, Japanese encephalitis virus, Kokobera virus, Ntaya virus, Spondweni virus, Zika virus, and Yellow fever virus group. Another aspect is directed to a viral RNA wherein said virus is a Flavivirus, exemplified by dengue virus, and said dengue virus RNA is a dengue virus genomic RNA.
[0052] In one aspect the DZ-NP conjugate is designed to target a viral RNA is an Alphavirus RNA, such as an RNA from Alphavirus that is in a complex selected from the group consisting of Barmah Forest virus, Eastern equine encephalitis, Middleburg virus, Ndumu virus, Semliki Forest virus, Sindbis virus, Venezuelan equine encephalitis, Western equine encephalitis, unclassified Alphaviruses, and recombinant viruses within each complex. In another aspect, the DDZ-NP conjugate targets an Alphavirus is in the Semliki Forest Virus complex, such as chikungunya virus.
[0053] The DZ-NP conjugate may be designed to target specific residues within a target RNA. In one aspect the target region of a ribonucleic acid (target RNA) comprises at least one purine-pyrimidine dinucleotide motif within a coding sequence which encodes a polypeptide. In another aspect, the target region of a ribonucleic acid (target RNA) comprises at least one purine-pyrimidine dinucleotide motif within a noncoding sequence. In another aspect, the target region is a viral 5-3 Cyclization Sequence (CS). The target region of the conjugates designated DDZ-M or DDZin-M is a viral 5-3 Cyclization Sequence (CS), exemplified by the dengue virus
TABLE-US-00001 (SEQIDNO:15) 5-3 CSUGCTGAAACGCGAGAGAAA.
In other aspects, the target region of conjugates designated DDZ-1, DDZ-2, DDZ-3, and DDZ-4 is a conserved region, specific to each virus serotype, exemplified by
TABLE-US-00002 DDZ-1 (SEQIDNO:16) UCAAGAAGAAUGGAGCGAU; DDZ-2 (SEQIDNO:17) AGGCGAGAAAUACGCCUUU; DDZ-3 (SEQIDNO:18) ACAGCAGGAGUCUUGGCUA; and DDZ-4 (SEQIDNO:19) UCUGGAAAAAUGAACCAAC,
respectively.
[0054] The DDZ-NP conjugate has a catalytic core, which may vary depending on the class of DNAzyme. One aspect of the invention is directed to a DDZ-NP conjugate wherein said catalytic core (CC) is
TABLE-US-00003 (SEQIDNO:13) GGCTAGCTACAACGA.
[0055] The DDZ-NP conjugate also comprise a pair of specific sequences, designated arms that facilitate the binding of the conjugate to a target nucleic acid sequence. In one aspect, the DDZ-NP comprises a 5 Arm and a 3 Arm that are a pair of sequences selected from the group consisting of:
TABLE-US-00004 (SEQIDNO:1) TTTCTCTCG and (SEQIDNO:7) GTTTCAGCA; (SEQIDNO:2) ATCGCTCCA and (SEQIDNO:8) TCTTCTTGA; (SEQIDNO:3) AAAGGCGTA and (SEQIDNO:9) TTCTCGCCT; (SEQIDNO:4) TAGCCAAGA and (SEQIDNO:10) TCCTGCTGT; and (SEQIDNO:5) GTTGGTTCA and (SEQIDNO:11) TTTTCCAGA.
[0056] Another aspect of the invention is directed to intermediate products, comprising a nucleic acid targeting sequence conjugated to a linker, which can be activated under appropriate chemical conditions to facilitate attachment of the intermediate to a nanoparticle. One aspect of the invention is directed to a conjugate, or an intermediate, wherein said linker and said DNAzyme designated DDZ-1, DDZ-2, DDZ-3, DDZ-4, DDZ-in-M, are selected from the group consisting of:
TABLE-US-00005 thiol-DDZ-1(SH-DDZ-1) (SEQIDNO:22) 5-SH-(CH.sub.2).sub.6-d(ATCGCTCCAGGCTAGCTACAACGATCTTCTTG A)-3; thiol-DDZ-2(SH-DDZ-2) (SEQIDNO:23) 5-SH-(CH.sub.2).sub.6-d(AAAGGCGTAGGCTAGCTACAACGATTCTCGCC T)-3; thiol-DDZ-3(SH-DDZ-3) (SEQIDNO:24) 5-SH-(CH.sub.2).sub.6-d(TAGCCAAGAGGCTAGCTACAACGATCCTGCTG T)-3; thiolDDZ-4(SH-DDZ-4) (SEQIDNO:25) 5-SH-(CH.sub.2).sub.6-d(GTTGGTTCAGGCTAGCTACAACGAGTTTCAGC A)-3; and thiol-DDZin-M(SH-DDZin-M) (SEQIDNO:26) 5-SH-(CH.sub.2).sub.6-d(TTTCTCTCGAGCAACATCGATCGGGTTTCAGC A)-3,
respectively.
[0057] Another aspect is directed to a conjugate wherein DNAzyme and linker are conjugated to a metallic nanoparticle, such as a metallic gold nanoparticle (DNAzyme-AuNP).
[0058] The invention is also directed a method of detecting a viral nucleic acid in a sample, comprising the steps of (a) adding the DNAzyme-NP conjugate to a sample comprising nucleic acid in a form which can react with a complementary nucleic acid; (b) heating said sample under conditions which permit the 5 and 3 Binding Arms to bind to the target region in said viral nucleic acid and said catalytic core to cleave at least one purine-pyrimidine dinucleotide motif in said target region; and (c) measuring the increase in aggregation of said nanoparticle conjugates compared to a sample comprising unreacted DNAzyme-NP conjugates in a dispersed form.
[0059] One aspect of the invention is directed to a method wherein said NP is an AuNP, and said aggregation is measured by absorbance. Another aspect relates to a method wherein said aggregation is detected by visual inspection. The reaction may be carried out under different conditions, depending on the nature of the components, and the desired degree of sensitivity or speed of reaction. For convenience, the reaction may be carried out in volume of less than 50 l, in small tubes, for example, or in larger or smaller amounts depending on the number and format of samples being tested, and the instrument used, if required, to monitor the progress of the reaction. In one aspect, the reaction is carried out in the presence of sodium ion in an amount of about 0 to about 2 Moles/Liter, with magnesium ion in an amount of about 5 mM to about 20 mM.
[0060] The reaction may be supplemented with a variety of other compounds that facilitate the detection or exposure of nucleic acids in complex mixtures of cellular substances. One aspect of the invention is directed to a method wherein the reaction is carried in the presence of a chaotropic agent or a detergent, such as sodium dodecyl sulfate (SDS), guanidine isothiocyanate, guanidinium chloride, lithium perchlorate, lithium acetate, urea, thiourea, Triton X-100, Triton X-114, Tween 20, Tween 80, NP 40, Brij 35, Brij 80, Octyl glucoside, Octyl thioglucoside, and a zwitterionic detergent selected from CHAPS and CHAPSO. One aspect is directed to a reaction carried out in the presence of the detergent SDS, which may be present in an amount of about 0% to about 1% weight/volume.
[0061] The reactions may be carried out at different temperatures. It is convenient to carry out the reaction at room temperature (about 20 C.), but it may also be carried out at higher temperatures, such as from about 20 C. to about 80 C., depending on the stability of the conjugate at higher or lower temperatures, and the availability of thermal regulating equipment, to accelerate or decelerate the reaction as needed.
[0062] DZ-NP conjugates that are stable for long periods are desirable, to facilitate transport and storage of key components to diagnostic laboratories, or field locations, where the testing is performed. One aspect of the invention is directed to a conjugate which is stable for a period of at least a year, although shorter or longer periods, one week, one month, one year, two or more years, may be adequate for particular applications, depending on the sensitivity of the assay and the ability of a supplier to produce and ship a conjugate to local or remote locations across the globe.
[0063] The invention is also directed to a kit for detecting the presence, absence, or relative amount of a target nucleic acid in a sample comprising one or more types of DZ-NP conjugates described above. One aspect is direct to a kit, wherein the sample is obtained from mammalian tissue, cells, or extracellular fluid. The sample may be blood, for example, or a sample is obtained from a virus-infected cell. Another aspect is directed to a kit wherein the sample is obtained from insect tissue, cells, or extracellular fluid, such as a sample obtained from a virus-infected mosquito, or pool of mosquitos. A further aspect is a kit, wherein the sample comprises nucleic acid from one or more viruses that are co-endemic with dengue virus.
[0064] The invention is also directed to DZ-NP conjugates wherein the target region of a chikungunya-specific DNAzyme (CDZ), is a conserved region, specific to each virus serotype. One aspect is directed to a compound designated CDZ, wherein said target region is
TABLE-US-00006 SEQIDNO(28) AAUGCUAGAGCGUUCUCGCAU.
[0065] Another aspect is a compound wherein catalytic core (CC) is
TABLE-US-00007 (SEQIDNO:13) GGCTAGCTACAACGA.
[0066] Another aspect is a compound wherein said 5 Arm and said 3 Arm are a pair of sequences selected from the group consisting of:
TABLE-US-00008 (SEQIDNO:26) ATGCGAGAA; and (SEQIDNO:27) GCTCTAGCA.
[0067] Another aspect is a compound wherein said linker and said DNAzyme designated CDZ is
TABLE-US-00009 thiol-CDZ(SH-CDZ) (SEQIDNO:28) 5-SH-(CH2)6-d(TTTCTCTCOGGCTAGCTACAACGAGTTTCAGC A)-3.
[0068] While specific aspects of the invention have been described in detail, it will be appreciated by those skilled in the art that various modifications and alternatives to those details could be developed in light of the overall teachings of the disclosure. Accordingly, the particular arrangements disclosed are meant to be illustrative only, and not limiting as to the scope of the invention, which is to be given the full breadth of the appended claims, and any equivalent, thereof.
EXAMPLES
[0069] The foregoing discussion may be better understood in connection with the following representative examples which are presented for purposes of illustrating the principle methods and compositions of the invention, and not by way of limitation. Various other examples will be apparent to the person skilled in the art after reading the present disclosure without departing from the spirit and scope of the invention. It is intended that all such other examples be included within the scope of the appended claims.
General Materials and Methods Sources of Materials
[0070] All parts are by weight (e.g., % w/w), and temperatures are in degrees centigrade ( C.), unless otherwise indicated. Table E-1 presents a summary of the nucleotide and amino acid sequences described in this application.
TABLE-US-00010 TABLEE-1 TableofSequencesandConjugatedCompoundsforDENVTargets SEQID Name Description Length Type NO: DDZ-M5 Arm tttctctcg 9 DNA 1 DDZ-15 Arm atcgctcca 9 DNA 2 DDZ-25 Arm aaaggcgta 9 DNA 3 DDZ-35 Arm tagccaaga 9 DNA 4 DDZ-45 Arm gttggttca 9 DNA 5 DDZin-M5 Arm tttctctcg 9 DNA 6 DDZ-M3 Arm gtttcagca 9 DNA 7 DDZ-13 Arm tcttcttga 9 DNA 8 DDZ-23 Arm ttctcgcct 9 DNA 9 DDZ-33 Arm tcctgctgt 9 DNA 10 DDZ-43 Arm ttttccaga 9 DNA 11 DDZin-M3 Arm gtttcagca 9 DNA 12 DDZ-(M,1,2,3,4) ggctagctacaacga 15 DNA 13 CatalyticCore DDZin-M(Inactive agcaacatcgatcgg 15 DNA 14 CatalyticCore) DDZ-MTarget ugcugaaacgcgagagaaa 19 RNA 15 DDZ-1Target ucaagaagaauggagcgau 19 RNA 16 DDZ-2Target aggcgagaaauacgccuuu 19 RNA 17 DDZ-3Target acagcaggagucuuggcua 19 RNA 18 DDZ-4Target ucuggaaaaaugaaccaac 19 RNA 19 DDZin-MTarget ugcugaaacgcgagagaaa 19 RNA 20 SH-DDZ-M (n)tttctctcgggctagctacaacgagtttcagca 33+ DNA 21 whereThiollinkerHS-(CH.sub.2).sub.6-representedby(n)at position1isconjugatedtoDNAzymesequence, residues2-end SH-DDZ-1 (n)atcgctccaggctagctacaacgatcttcttga 33+ Linker- 22 whereThiollinkerHS-(CH.sub.2).sub.6-representedby(n)at DNA position1isconjugatedtoDNAzymesequence,residues 2-end SH-DDZ-2 (n)aaaggcgtaggctagctacaacgattctcgcct 33+ Linker- 23 whereThiollinkerHS-(CH.sub.2).sub.6-representedby(n)at DNA position1isconjugatedtoDNAzymesequence,residues 2-end SH-DDZ-3 (n)tagccaagaggctagctacaacgatcctgctgt 33+ Linker- 24 whereThiollinkerHS-(CH.sub.2).sub.6-representedby(n)at DNA position1isconjugatedtoDNAzymesequence,residues 2-end SH-DDZ-4 (n)gttggttcaggctagctacaacgagtttcagca 33+ Linker- 25 whereThiollinkerHS-(CH.sub.2).sub.6-representedby(n)at DNA position1isconjugatedtoDNAzymesequence,residues 2-end SH-DDZin-M (n)tttctctcgagcaacatcgatcgggtttcagca 33+ Linker- 26 whereThiollinkerHS-(CH.sub.2).sub.6-representedby(n)at DNA position1isconjugatedtoDNAzymesequence,residues 2-end
DNAzyme, RNA Probes, and AuNP
[0071] Thiol-modified and unmodified DNAzymes were synthesized and desalted by Life Science Technologies (Grand Island, N.Y., USA). The oligoribonucleotide target was synthesized and HPLC-purified by Life Science Technologies. Quantification of these oligonucleotides was performed with the ND-1000 spectrophotometer from NanoDrop (Wilmington, Del.). Gold colloidal solutions containing 1.610.sup.12 particles/mL gold nanoparticles (AuNPs) with a diameter of 15 nm were purchased from Cytodiagnostics (Burlington, ON, CA).
Cells, Virus and Antibody
[0072] Ae. albopictus C6/36 cells were obtained from ATCC, and maintained in Leibovitz's L-15 media (Atlanta Biologicals) supplemented with 10% FBS (Atlanta Biologicals), 10% TPB (triptose phosphate broth; Invitrogen/GIBCO), penicillin G (100 U/ml; Invitrogen/GIBCO) and streptomycin (100 U/ml; Invitrogen/GIBCO). The C6/36 cells used in this study were maintained in a 28 C. incubator and passaged every 4 days. Viral stocks were prepared as previously described [Li et al. (2012)].
[0073] The DENV strains and GenBank GenInfo identifiers for the four serotypes used in this study are as follows: DENV type 1 Hawaii: DQ672564.1, DENV type 2 strain New Guinea C (NGC): AF038403.1, DENV type 3 strain ThD3 0010 87 (strain H87): AY676352.1, DENV 4 strain DENV-4/SG/06K2270DK1/2005 (strain H241): GQ398256.1.
[0074] Design of the anti-DENV DNAzyme (DDZ) and Catalytically-Inactive form (DDZin) DENV sequence data was obtained from the National Center of Biotechnology Information (NCBI). Sequences representative of all four serotypes of dengue were aligned using ClustaIX [Jeanmougin et al. (1998)]. The aligned sequences comprise the following GenBank GenInfo identifiers: 12018173, 12018169, 12018171, 12659201, 2909798, 2909788, 2909786, 2909796, 6841603, 6841595, 6841605, 6841591, 6841601, 6841597, 6841593, 6841599, 6841587, 6841585, 6841589, 1000740, 1000738, 2909784, 1000736, 4926937, 4926935, 4926927, 4926929, 4926931, 2909794, 2909792, 1000742, 4926933, 2155257, 2723944, 323447, 6581076, 6581078, 2723942, 323449, 323650; 18644123, 1864412, 11119731, 19744844, 18644125, 18644127, 18643733, 4337012, 13386495, 1881708, 19071809, 13926152, 9280544, 14585842, 4926947, 4926939, 323654, 4926945, 4926943, 7329983, 7329981, 13540386, 14328931, 14485523, 323660, 17129645, 22901065, 22901063, 22901061, 1854040, 1854038, 1854036, 17129647, 24417519, 24417517, 24417515, 27656962, 24417513, 19071807, 14195698, 8927332, 14328929, 12711599, 323468, 25992053, 25992047, 25992041, 25992029, 25992025, 25992055, 25992033, 19071811, 25992043, 25992039, 25992037, 25992051, 25992031, and 25992057.
[0075] The 5 arms of DDZ-M and DDZin-M (Table E-2) were designed to bind to nucleotides 150 to 158 of the DENV genome. The 3 arms were designed to bind to the 5 end of the target region of the DENV genome that corresponds to nucleotides 140 to 148. These 5 and 3 arms of facilitated DDZ cleavage of the substrate DENV RNA between the purine-pyrimidine dinucleotide motifs G149 and C150.
[0076] The 5 arm of DDZ-1 was designed to bind nucleotides 319 to 327 of the DENV-1 genome. The 3 arm was designed to bind to the 5 end of the target region of the DENV genome that corresponds to nucleotides 309 to 317. These 5 and 3 arms facilitated DDZ cleavage of the substrate DENV RNA between the purine-pyrimidine dinucleotide motifs A318 and A319. The 5 arm of DDZ-1 was designed to bind nucleotides 319 to 327 of the DENV-1 genome. The 3 arm was designed to bind the 5 end of the target region of the DENV-1 genome that corresponds to nucleotides 309 to 317. These 5 and 3 arms facilitated DDZ-1 cleavage of the substrate DENV-1 RNA between the purine-pyrimidine dinucleotide motifs A318 and A319.
[0077] The 5 arm of DDZ-2 was designed to bind nucleotides 126 to 134 of the DENV-2 genome. The 3 arm was designed to bind the 5 end of the target region of the DENV-2 genome that corresponds to nucleotides 116 to 124. These 5 and 3 arms facilitated DDZ-2 cleavage of the substrate DENV-2 RNA between the purine-pyrimidine dinucleotide motifs A124 and A125.
[0078] The 5 arm of DDZ-3 was designed to bind nucleotides 288 to 296 of the DENV-3 genome. The 3 arm was designed to bind the 5 end of the target region of the DENV-2 genome that corresponds to nucleotides 278 to 286. These 5 and 3 arms facilitated DDZ-3 cleavage of the substrate DENV-3 RNA between the purine-pyrimidine dinucleotide motifs A287 and G288.
[0079] The 5 arm of DDZ-4 was designed to bind nucleotides 95 to 103 of the DENV-4 genome. The 3 arm was designed to bind the 5 end of the target region of the DENV-4 genome that corresponds to nucleotides 85 to 93. These 5 and 3 arms facilitated DDZ-4 cleavage of the substrate DENV-4 RNA between the purine-pyrimidine dinucleotide motifs A94 and A95.
TABLE-US-00011 TABLEE-2 NucleotidesequencesofactiveandnegativecontrolDNAzymesandcorresponding DENVtargets DNAzyme 5Arm(5->3) 3Arm(5->3) CatalyticCore RNATarget DDZ-M TTTCTCTCG GTTTCAGCA GGCTAGCTACAACGA UGCUGAAACGCGAGAGAAA (SEQIDNO:1) (SEQIDNO:7) (SEQIDNO:13) (SEQIDNO:15) DDZ-1 ATCGCTCCA TCTTCTTGA GGCTAGCTACAACGA UCAAGAAGAAUGGAGCGAU (SEQIDNO:2) (SEQIDNO:8) (SEQIDNO:13) (SEQIDNO:16) DDZ-2 AAAGGCGTA TTCTCGCCT GGCTAGCTACAACGA AGGCGAGAAAUACGCCUUU (SEQIDNO:3) (SEQIDNO:9) (SEQIDNO:13) (SEQIDNO:17) DDZ-3 TAGCCAAGA TCCTGCTGT GGCTAGCTACAACGA ACAGCAGGAGUCUUGGCUA (SEQIDNO:4) (SEQIDNO:10) (SEQIDNO:13) (SEQIDNO:18) DDZ-4 GTTGGTTCA TTTTCCAGA GGCTAGCTACAACGA UCUGGAAAAAUGAACCAAC (SEQIDNO:5) (SEQIDNO:11) (SEQIDNO:13) (SEQIDNO:19) NEGATIVECONTROL DDZin-M TTTCTCTCG GTTTCAGCA AGCAACATCGATCGG UGCUGAAACGCGAGAAA (SEQIDNO:6) (SEQIDNO:12) (SEQIDNO:14) (SEQIDNO:20)
The left column in Table E-2 lists the active (DDZ-M) and inactive (DDZin-M) DNAzymes used in this Example. The second and third columns list the sequences of the 5 and 3 binding arms of the catalytically active DNAzymes and the inactive DDZin-M, respectively. Also shown are the sequences of the catalytic cores of each DNAzyme. The right column lists the nucleotide sequence each binding arm binds to where applicable. All sequences are displayed in a 5 to 3 direction. See the methods section for a description of DNAzyme design.
[0080] The DDZ-M target site was selected by scanning the 5 CS domain for one of the purine-pyrimidine dinucleotide motifs required for DNAzyme catalysis [Cairns et al. (2003)]. An alignment of all four known DENV serotypes was performed to determine the ideal target sites for the serotype specific DNAzymes in our DDZ-AuNP detection method (
Preparation of DDZ-Tethered AuNP (DDZ-AuNP)
[0081] Preparation of DDZ-M-AuNP was performed as previously described with a few modifications [Liu and Lu (2006)]. The DTT-reduced [0082] thiol-DDZ-M 5-SH(CH2)6-d(TTTCTCTCGGGCTAGCTACAACGAGTTTCAGCA)-3 (SH-DDZ-M) (SEQ ID NO: 21)
was purified by ethanol precipitation. 3 ml of AuNP and 5 mM acetate buffer (pH 5.2) were transferred to a glass scintillation vial, capped and incubated for 24 hours at room temperature. Following incubation 5 mM Tris acetate (pH 8.2) buffer and 100 mM NaCl were added and the resulting mixture was incubated at room temperature for an additional 24 hours. These functionalized particles (500 l) were transferred into 1.7-ml microcentrifuge tubes and centrifuged at 16,110g at room temperature for 15 min to remove unreacted SH-DDZ-M. The nanoparticles were redispersed in 1 mL of buffer containing 100 mM NaCl, 25 mM Tris acetate, (pH 8.2) and 0.01% SDS, centrifuged again at 16,110g at room temperature for 15 min. The supernatant was removed and the nanoparticles were dispersed in 500 l of buffer containing 300 mM NaCl and 25 mM Tris acetate (pH 8.2), and re-centrifuged for 15 min to remove the remaining unreacted SH-DDZ-M. The cleaned DDZ-M-AuNP were redispersed into 200 L of buffer containing 100 mM NaCl, 25 mM Tris acetate, (pH 8.2) and 0.05% SDS. This same procedure was followed for the coupling of DENV serotype-specific DTT-reduced DNAzymes:
TABLE-US-00012 thiol-DDZ-1(SH-DDZ-1) (SEQIDNO:22) 5-SH-(CH.sub.2).sub.6-d(ATCGCTCCAGGCTAGCTACAACGATCTTCTTG A)-3; thiol-DDZ-2(SH-DDZ-2) (SEQIDNO:23) 5-SH-(CH.sub.2).sub.6-d(AAAGGCGTAGGCTAGCTACAACGATTCTCGCC T)-3; thiol-DDZ-3(SH-DDZ-3) (SEQIDNO:24) 5-SH-(CH.sub.2).sub.6-d(TAGCCAAGAGGCTAGCTACAACGATCCTGCTG T)-3; thiolDDZ-4(SH-DDZ-4) (SEQIDNO:25) 5-SH-(CH.sub.2).sub.6-d(GTTGGTTCAGGCTAGCTACAACGAGTTTCAGC A)-3; and thiol-DDZin-M(SH-DDZin-M) (SEQIDNO:26) 5-SH-(CH.sub.2).sub.6-d(TTTCTCTCGAGCAACATCGATCGGGTTTCAGC A)-3,
Analysis of DDZ-Tethered AuNPs in Detecting a Synthetic DENV-2 Artificial Target
[0083] DDZ-AuNPs (110.sup.5/mL) were combined in a 1.5 mL microcentrifuge tube with 10 mM MgCl.sub.2 for optimal DNAzyme activity, 1.0 M NaCl to drive aggregation of AuNPs, and synthetic DENV-2 RNA target (7.5 nM) corresponding to the 5 170 nucleotides of the virus genome was added [Cairns et al. (2003); Ogawa et al. (2008)]. Reaction mixes were incubated at 37C and inspected every 5 minutes over a 30 minute period. Photographs were taken with a Nikon CoolPix 53300 camera (Nikon USA, Melville, N.Y.).
Measurement of Mg.SUP.2+ .Resistance of Oligonucleotide-Tethered AuNPs
[0084] This analysis was performed as previously described [Ogawa et al. (2008)]. A mixture composed of 1 L of DDZ-tethered AuNPs, 50 mM Tris-HCl (pH 7.5), and increasing concentrations of MgCl.sub.2 (5 mM to 20 mM) 10 l were incubated at room temperature for 0 to .sup.30 min. Photos of these AuNPs at each incubation time were taken with a Nikon CoolPix 53300 camera, and absorbance units were measured with a ND-1000 spectrophotometer.
In Vitro Analysis of DDZ-Tethered AuNPs
[0085] DENV RNA was isolated from DENV infected Ae. albopictus C6/36 cells using the QiaAmp viral RNA Mini Kit (Qiagen) according to the manufacturer's protocol. 10 M of eluted DENV RNA was incubated with 110.sup.5 DDZ-AuNP/ml for 30 min at 37 C. 15 ul of this reaction mixture was added to an RT-PCR mix (Life Science Technologies) containing heterologous and random hexametric primers to amplify the digested fragments. These RT-PCR fragments were then separated on 1.75% agarose gels.
Sodium Dodecyl Sulfate (SDS) Titration Analysis
[0086] Ten microliters (10 l) of cell suspension containing 110.sup.6 DENV-2 NGC/mL, as determined by TCID.sub.50-IFA, was added to a mixture containing 150 mM Tris-HCl (pH 7.5), 10 mM MgCl.sub.2, 110.sup.5 DDZ-AuNP particles/mL, 1.5 M NaCl and SDS at concentrations ranging from 0% to 1% (w/v). Samples were incubated at 37 C. for 30 minutes and analyzed every 5 min by visual inspection for aggregation of AuNPs, an indicator of positive detection of in cell culture DENV-2. Photographs were taken with a Nikon CoolPix 53300 camera.
NaCl Titration Assay
[0087] DENV-2 NGC RNA were isolated from Aedes albopictus C6/36 cells using the QiaAmp Viral RNA mini kit, and added at a concentration of 0.6 M (.sup.10 L) to a reaction mixture containing 150 mM Tris-HCl (pH 7.5), 10 mM 10 mM MgCl.sub.2, 110.sup.5 DDZ-AuNP particles/mL, 0.5% (w/v) SDS, and NaCl (0 M to 2 M). Mixes were incubated at 37 C. for 30 minutes and analyzed every 5 min by visual inspection for aggregation of AuNPs. Samples were analyzed by visual inspection, and photographs taken. Positive detection of DENV-2 NGC RNAs was evident with a complete red to clear color transition occurring with the addition of 1.5 M NaCl.
Determination of DDZ-AuNP Specificity
[0088] Ten microliters (10 L) of cell culture fluid containing 110.sup.6/mL DENV-2 NGC or, as a negative control, CHIKV vaccine strain 181/25 [Plante et al. (2011)] was added to a mixture containing 150 mM Tris-HCl (pH 7.5), 10 mM 10 mM MgCl.sub.2, 110.sup.5 DDZ-M-AuNP, DDZin-M-AuNP or any of the serotype-specific DDZ tethered AuNPs/mL, 0.5% (w/v) SDS, and 1.5 M NaCl. Samples were mixed and incubated at 37 C. for 5 minutes, photographs were taken using the Nikon CoolPix 53300 camera, and spectrophotometric analysis was performed using the ND-1000 spectrophotometer.
Analysis of DDZ-AuNP Limits of DENV Detection
[0089] DENV-2 NGC of the titers indicated (
[0090] The DENV-2 NGC titers described above served as substrates for DDZ-AuNP colorimetric assays to determine their limits of DENV detection. Ten microliters (10 l) of each dilution stock was added to a buffered reaction mix containing 150 mM Tris-HCl (pH 7.5), 10 mM 10 mM MgCl.sub.2, 110.sup.5 DDZ-M-AuNP particles/mL, 1.5 M NaCl, and 0.5% (w/v) SDS. Samples were mixed and incubated at 37 C. for 5 minutes and photographs were taken Nikon CoolPix 53300 camera. UV/Vis spectrophotometric analysis was performed using the ND-1000 spectrophotometer.
Example 1
Method of Detecting Dengue Virus with DNAzyme Nanoparticle Conjugates
Results
Overview of the Colorimetric Detection of DENV by DNAzyme Activity Coupled with Non-Crosslinking AuNP Aggregation (DDZ-AuNP)
[0091] The dengue virus detection method described below (see
[0092] The colorimetric detection of DENV by DDZ-AuNP can be divided into three phases: targeting/cleavage of the DENV RNA genome by DDZ, activation of AuNPs, and aggregation of AuNPs and detection (
[0093] Design and in vitro cleavage assessment of the DENV detection system DDZAuNP DNAzymes are lab-derived, auto catalytic DNAs consisting of three intimately connected domains (
[0094] The 10-23 DNAzyme is capable of cleaving RNA with high sequence specificity at target sites containing purine-pyrimidine (R-Y) junctions [Santoro and Joyce (1997)]. We chose the 10-23 DNAzyme for use in our DENV detection system, because this DNAzyme is less dependent on secondary structure formation for its activity than other types of DNAzymes, and would be expected to perform better in our in vitro assays where biomolecular folding would be quite variable [Baum and Silverman (2008)]. The design of the anti-DENV 10-23 DNAzyme, DDZ-M (
[0095] Gold nanoparticles (AuNPs) ranging from 15 nm to 100 nm in diameter have been used in a number of detection assays [Cao et al. (2010)]. We chose to conjugate DDZ to 15 nm AuNPs, since fewer copies of single-stranded DNA are required to cover the surface of a 15 nm AuNP than any AuNP of larger size [Sato et al. (2005)], and interaction of only 7.5% of DNAs conjugated to the 15 nm AuNPs with the substrate RNA is required to initiate aggregation of the AuNPs [Ogawa and Maeda (2008)].
[0096] AuNP-conjugated DDZs were analyzed for their ability to cleave the DENV-2 NGC RNA in vitro. DENV-2 NGC viral RNAs were isolated from infected Ae. albopictus C6/36 cells, and incubated in a buffered solution containing 110.sup.5 DDZ-M-tethered AuNPs/mL for 30 minutes at 37 C. Digestion products were then amplified by RT-PCR using heterologous and hexamer primers designed to aid in the amplification of DDZ digestion products. Successful digestion of the DENV-2 NGC RNA genome by DDZ-M was demonstrated by the positive detection of 2 fragments of approximately 150 and 350 bases in size, indicative of DDZ-M catalysis (
Addition of an Artificial DENV-2 RNA Target Initiates Aggregation of DDZ Tethered AuNPs
[0097] As an initial test of the utility of our colorimetric detection method, a synthetic target was designed and synthesized that corresponds to the 5 170 bases of the DENV-2 NGC genome. This stretch of nucleotides included the highly conserved 5 CS domain and the initial 74 bases of the capsid gene [Alvarez et al. (2005)]. Synthetic target (7.5 nM) was added to a buffered mixture containing 110.sup.5 DDZAuNPs/mL, 10 mM MgCl.sub.2 and 1.0 M NaCl (
Optimization of NaCl Concentration
[0098] Sodium, in the form of NaCl, is an essential component of AuNP colorimetric detection assays because this monovalent salt drives aggregation of oligonucleotide-conjugated AuNPs following the interaction of the AuNP conjugated probes with complimentary oligonucleotide targets [Ogawa and Maeda (2008); Ogawa (2011)]. NaCl concentrations greater than 2 M have been reported to cause instability of conjugated AuNPs [Ogawa and Maeda (2008)]. Published reports also indicate that NaCl concentrations for effective AuNP aggregation can vary from 1.0 M to 1.5 M [Ogawa and Maeda (2009); Weil et al. (2004)]. In light of these observations, we evaluated the optimal NaCl concentration necessary to initiate aggregation of DDZ-M-AuNP following interaction with the DENV-2 genome.
[0099] DENV genomic RNAs (.sup.0.6 M), isolated from infected C6/36 cell supernatants, were added to a buffered reaction mixture containing DDZ-M-AuNP (.sup.110.sup.5 particles/mL), 10 mM MgCl.sub.2 and NaCl at concentrations ranging from 0 M to 2 M (
Determination of the Optimal SDS Concentration for Colorimetric DDZ-AuNP Detection of DENV
[0100] Our DDZ-AuNP assay system demonstrated utility in detecting purified DENV-2 RNAs. However, to improve this assay for field use we needed a protocol that has speed, efficacy, and simplicity in detecting DENV RNA directly from virions. Liberating the DENV RNA genome from virion particles using a low cost, non-toxic RNA extraction reagent that is stable in the reaction buffer and does not interfere with the assay would be ideal. Sodium dodecyl sulfate (SDS) is an effective non-ionic detergent for lysing virus particles [Becker et al. (1975)]. SDS may be considered an ideal component for our colorimetric detection assays because it is non-toxic, stable in the reaction buffer, and does not require additional manipulation during lysis.
[0101] The optimal concentration of SDS was determined by adding cellular supernatants containing 110.sup.6 DENV-2/mL to buffered reaction mixes containing DDZ-tethered AuNPs (DDZ-AuNP), 10 mM MgCl.sub.2 and SDS at concentrations of 0% (w/v), 0.5% (w/v) or 1.0% (w/v) (
Measurement of Mg.SUP.2+ Resistance of Oligonucleotide-Tethered AuNPs
[0102] Since DDZ is activated by 10 mM MgCl.sub.2, we needed to confirm that the positive detection of DENV-2 was due to specific recognition of the viral genome by DDZ-M-AuNP and not the result of a false positive from Mg.sup.2+ ion destabilization of DDZ-AuNPs [Ogawa and Maeda (2008)]. The stability of DDZ-M-AuNP was tested against increasing concentrations of MgCl.sub.2 (0 mM to 20 mM) at room temperature every 5 minutes for up to 30 minutes (
Specificity of DDZ-AuNP for DENV
[0103] Because chikungunya virus (CHIKV) and DENV co-infections have become more prevalent in South Asia and Africa [Caron et al. (2012)], we tested our DDZ-AuNP detection method for its specificity for DENV in the presence of CHIKV (
[0104] An important feature of using gold nanoparticles in colorimetric detection schemes is that the aggregation of AuNPs can be detected by UV/Vis spectroscopy. Since the absorption maximum of the 15 nm AuNPs used in this detection method is 520 nm, a decrease in absorbance at 520 nm can also be used to detect and quantitate aggregation. This was tested using reaction mixtures containing cell culture supernatants from DENV infected cells (
[0105] DENV shares similar symptoms with other closely related mosquito-borne flaviviruses, such as Yellow Fever (YFV; [Reed et al. (1900)]), Japanese Encephalitis (JEV; Kuwayama et al. (2005)), and Zika (ZV; [Macnamara (1954)]) viruses. These viruses also co-circulate with DENV and are often misdiagnosed as dengue. Therefore, a DENV detection method must demonstrate the ability to distinguish DENV, from other mosquito-borne flaviviruses. Although the 5-3 CS domains are largely (but not fully) conserved among flaviviruses, the entire DDZ-M binding site is not conserved among all these flaviviruses as demonstrated by a sequence alignment of our DDZ-M binding site with corresponding regions in YFV, JEV, and ZV viruses. We also performed a experimental analysis of our DDZ-M-AuNP assay to verify its ability to distinguish DENV over other flaviviruses. Separate reaction mixtures were assembled as previously described (see
[0106] Lastly, to be effective in epidemiological surveillance efforts, a DENV detection method must demonstrate the ability to detect each serotype independently of the other. An alignment of all four known DENV serotypes was performed to determine the ideal target sites for the design of serotype specific DNAzymes (
TABLE-US-00013 TABLE E-3 Summary of active and negative control DDZ-AuNP devices Serotype detected Designed DENV- DENV- Devices to detect DENV-1 DENV-2 3 4 DDZ-M-AuNP All + + + + Serotypes DDZ-1-AuNP DENV-1 + DDZ-2-AuNP DENV-2 + DDZ-3-AuNP DENV-3 + DDZ-4-AuNP DENV-4 + Negative Control DDZin-M-AuNP None
The left column lists the active (DDZ-M-AuNP and DDZ-1-AuNP through DDZ-4-AuNP) and inactive negative control (DDZin-M-AuNP) devices used in this report. The second column lists the serotype each device was designed to detect. The right column summarizes the results of the DENV detection devices and the negative control DDZin-M-AuNP.
[0107] The DENV-1 serotype-specific DDZ-1-AuNP positively detected the DENV-1 serotype as signified by a distinctive red to clear/colorless color transition. As expected, DDZ-1-AuNP did not detect DENV-2, -3, or -4, illustrating the serotype-specific nature of this approach (
The Limits of DDZ-AuNP Colorimetric Detection of DENV-2
[0108] The sensitivity of our DENV detection system was assessed using standardized titers of DENV-2 (
[0109] Positive DENV-2 detection was evident after only 5 minutes at 37 C., and demonstrated as little as 10.sup.1 DENV/ml could cause a color transition, although the samples containing 10.sup.1 and 10.sup.2 transitioned to a very pale purple rather than completely clear. In addition, we calculated the amount of DENV RNA corresponds to approximately 0.6 M (for 10.sup.6/ml), 6 nm (for 10.sup.4/ml), 0.6 nM (for 10.sup.2/ml), or 0.06 nM (for 10.sup.1/ml) of DENV RNA per reaction.
[0110] Further assessment of the sensitivity of our colorimetric DENV detection assay was further assessed by UV/Vis spectrophotometry using standardized titers of DENV-2 (
DISCUSSION
[0111] Simple and rapid diagnostic methods to screen mosquito and patient samples for the presence of viral pathogens can significantly facilitate diagnosis and treatment of virus borne diseases in field environments where sophisticated methods of virus detection are impractical. An ideal virus detection method must distinguish the target pathogen from other diseases exhibiting similar symptoms (such as malaria, leptospirosis, typhoid, typhus and chikungunya), be highly sensitive during the acute stage of infection, provide rapid results, be inexpensive, easy to use, and stable at temperatures greater than 30*C for use in a field environment [Peeling et al. (2010)]. Furthermore, DENV detection methods must show utility in epidemiological surveillance and outbreak monitoring by allowing independent detection of each serotype, and must have the ability to distinguish between primary and secondary infection [Peeling et al. (2010)].
[0112] In light of the caveats and pitfalls of the virus detection methods currently in use, the aim of this research was to explore the utility of a multiple DENV serotype targeting DNAzyme, called DDZ-M, and DENV-serotype specific DNAzymes, coupled to AuNPs for detecting DENV. DDZ was designed to target the most conserved region of the DENV genome that includes the 5-3 CS (
[0113] While our DDZ-AuNP colorimetric detection system demonstrates the capacity to target the highly conserved DENV 5 CS region, the utility of these molecules as detection agents requires a minimal subset of anti-DENV DNAzymes (DDZs) to be occupied for aggregation of AuNPs to occur. The high tolerance of DNAzymes to mismatched binding of the target oligonucleotides [Santoro and Joyce (1998)] makes DNAzymes ideal for detection of viruses because they will be able to detect many closely related variants. Prior studies have demonstrated aptazymes can detect synthetically produced segments of virus genomes [Cho et al. (2005)]. We have demonstrated that under optimal reaction conditions the full length genome of DENV-2 can also be detected through the aggregation of DDZ-tethered AuNPs following the interaction of the DDZ component with the DENV-2 RNA genome.
[0114] Our anti-DENV DNAzyme (DDZ), when conjugated with AuNPs, readily detects its cognate target sequence within a synthetic 170 base segment of the DENV-2 NGC RNA corresponding to the 5 UTR, 5 CS and the 5 74 bases of the capsid open reading frame (
[0115] Previous studies using oligonucleotide-tethered AuNPs have determined optimal aggregation occurs with NaCl concentrations from 1.0 M to 1.5 M, while concentrations 2.0 M destabilized conjugated AuNPs [Carter et al. 2013]. In our hands, a NaCl concentration of 1.5 M allows full aggregation of DDZ-AuNP in the presence of 0.6 M DENV-2 RNA (
[0116] DDZ-AuNP aggregation in our DENV detection assays was not driven by the loss of AuNP stability in the presence of 10 mM MgCl.sub.2 (
[0117] Sodium dodecyl sulfate (SDS) proved to be an effective, low cost, detergent for directly lysing virus particles in our assay [Becker et al. (1975)]. SDS titration experiments on cell culture fluids containing DENV-2 NGC (
[0118] Our DDZ-AuNP colorimetric assay is capable of distinguishing between DENV-2 NGC and CHIKV (
[0119] This DDZ-AuNP system allows for visual detection of DENV at titers as low as 10.sup.1/mL, which translates to a concentration of 0.06 nM DENV RNA (
[0120] Despite the fact that we are detecting 110.sup.6 TCID.sub.50 units, there are substantially more inactive virus particles present in a given sample [Aaskov et al (2006); Li et al. (2011)]. Adding SDS to lyse DENV particles enhanced the sensitivity of our DDZ-AuNP detection method for real world applications. DENV-infected patients exhibit titers of 10.sup.7 to 10.sup.8.5 TCID.sub.50 units [Vaughn (2000)]. Since we can detect approximately 6 to 7 orders of magnitude or more below this, our assay could potentially allow detection of DENV in infected patients prior to the manifestation of symptoms. Current methods for the detection of DENV lack consistent bedside detection of DENV prior to the manifestation of symptoms, a drawback of NS-1 antigen detection methods [Kabra et al. (1999); Tricou et al. (2010)]. Individual Ae. aegypti mosquitoes are typically infected at a titer of 10.sup.1 to 10.sup.2 TCID.sub.50 units [Apte et al. (2012)], well within the limits of detection for this assay, making it potentially ideal for surveillance of DENV in mosquito populations.
[0121] We have demonstrated that our multi-DENV serotype detecting DDZ-M-AuNP device can detect all four DENV serotypes directly from cell culture fluid without sample processing (
[0122] The simplicity of the DDZ-AuNP disclosed herein, provides distinct advantages over other virus detection methods. The assay can be packaged as a pre-mixed reaction solution in microcentrifuge tubes, and may be performed without any specialized equipment or training. This assay is also inexpensive, costing about $0.80 per sample, compared to serological testing or PCR-based methods which can cost $2 per sample or more to perform. Key assay components are stable for months at room temperature [Liu and Lu (2006)], and exhibit stability at temperatures greater than 30 C.
[0123] Further development of this assay will enable sensitive detection and discrimination of individual DENV serotypes in mosquito populations and patient derived samples as well as other virus derived RNAs. Detection prior to the onset of symptoms could allow more effective diagnosis and treatment of infected patients, and more rapid recovery from the disease. The simplicity of the assay makes it ideal as a means of early surveillance to target locations for more effective mosquito suppression strategies.
The DNAzyme-Nanoparticle Technology can be Applied to Facilitate the Detection of Other Viruses or Nucleic Acids
[0124] DNAzymes coupled to nanoparticles, such as AuNP can be used as a highly versatile tool to facilitate the detection of oligonucleotides, and not just viral RNAs, such as DENV and CHIKV (chikungunya virus) exemplified in the Examples, noted above. In the examples, aggregation of AuNP provides a visual, colorimetric readout of the nucleic acid detected, regardless of the catalytic oligonucleotide appended. The effectiveness of our method in using DNAzyme-nanoparticle conjugates to detect other types of viral genomes (whether RNA or DNA) or other oligonucleotide molecules, whether originating from a pathogenic agent or a host cell lies in the design of the DNAzyme. Host cells, for example, can be prokaryotic or eukaryotic, particularly non-human animal, and human cells.
[0125] The successful use of DDZ-AuNPs to facilitate the detection of nucleic acids obtained from any pathogen or cell requires: (1) that the nucleic acid composition of the 5 and 3 binding arms of the DDZ must be modified to complimentary to and base pair with the 3 and 5 ends of the target sequence of interest, respectively, such that the only nucleotide on the target sequence that is not bound by the DNAzyme binding arms is the purine of the purine-pyrimidine dinucleotide motif on the target sequence; and (2) the target sequence in question must contain a purine-pyrimidine dinucleotide motif to activate the corresponding DNAzyme. These criteria apply to any RNA or DNA segment of interest one wishes to detect using methods involving DNAzymes.
The DNAzyme-Nanoparticle Technology can be Performed in Other Test Formats
[0126] Other test formats can also be used to facilitate the detection of nucleic acids with DNAzyme-nanoparticle conjugates. Use of a handheld spectrophotometer, for example, could increase speed of diagnosis, as well as the overall sensitivity and accuracy of the method. Our results show that a spectrophotometer can detect aggregation of AuNPs resulting from DDZ interaction with virus genomes at levels that would not be detected visually. The use of a handheld spectrophotometer would enable the administration of treatments prior to the onset of symptoms since the concentration of pathogen derived RNA detected would be too low to display any definitive pathology. Dipstick formats based on DNAzyme-nanoparticle conjugates, that are less sensitive, or even slower, could be used in field locations, where sample tubes or handheld equipment are not available, or are inconvenient or expensive to use.
Conclusions
[0127] The results presented here show that the DDZ-M-AuNP, designed to be active against all forms of dengue virus, is capable of effectively detecting the DENV 2-NGC genome in a sequence specific manner. Serotype specific DNAzymes tethered to AuNPs demonstrate utility in the independent identification of DENV serotypes. Coupling DNAzyme catalysis with gold nanoparticle aggregation provides an attractive alternative to other DENV detection approaches for the identification of DENV in transformed mosquito cells and tissues.
Example 2
Method of Detecting Chikungunya Virus with DNAzyme Nanoparticle Conjugates
Introduction
[0128] Chikungunya virus (CHIKV) was first detected in Tanzania in 1952, and is an emerging human pathogen responsible for significant disease outbreaks annually [Higgs and Ziegler (2010)]. Aedes aegypti, Ae. albopictus, and Ae. vigilax serve as the principle mosquito vectors for CHIKV, while also playing a role in dengue virus dissemination [van den Hurk (2009); Jansen et al. (2009)].
[0129] The increasing incidence of this emerging pathogen necessitate the need for a rapid and cost effective CHIKV detection method that can facilitate surveillance of mosquito populations. In Example 1, we described a simple, rapid, and cost effective gold nanoparticle coupled DNAzyme-based detection assay for dengue viruses (later published as Carter et al, 2013). In this example, we adapted this technology for the rapid, sensitive, and cost effective detection method for CHIKV, that couples the robust catalysis of a CHIKV-specific DNAzyme (CDz) with the salt-induced aggregation of gold nanoparticles (AuNPs). The limits of sensitivity for this assay in terms of molar RNA concentrations, or as infectious units of virus, are described below.
Materials and Methods
AuNPs and DNAzymes
[0130] Gold colloidal solutions containing 1.610.sup.12 gold nanoparticles (AuNPs)/mL with a diameter of 15 nm were purchased from Cytodiagnostics (Burlington, ON, CA). Synthesized and desalted thiol-modified and unmodified DNAzymes and oligoribonucleotide CHIKV target molecules were purchased from Life Science Technologies (Grand Island, N.Y., USA). Quantification was performed with the ND-1000 spectrophotometer from NanoDrop (Wilmington, Del.).
Design of the Anti-CHIKV DNAzyme (CDZ) and Catalytically Inactive Form (CDZin)
[0131] CDZ and CDZin 5 arms were designed to bind to nucleotides 202 to 210 of the CHIKV genome:
TABLE-US-00014 SEQIDNO(25) (5-AATGCTAGAGCGTTCTCGCAT-3).
The 3 arms were designed to complimentarily base pair to the 5 end of the target region of the CHIKV genome that corresponds to nucleotides 192 to 200. These 5 and 3 arms of CDZ facilitated cleavage of the substrate CHIKV RNA between the purine-pyrimidine dinucleotide motifs at 201 and 202.
[0132] CHIKV sequence data was obtained from the National Center of Biotechnology Information (NCBI). Sequences representative of twenty five chikungunya viruses were aligned using ClustaIX [Jeanmougin et al. (1998)] (
[0133] The CDZ target site was selected by scanning the N51 region for one of the purine-pyrimidine dinucleotide motifs required for DNAzyme catalysis [Cairns et al. (2003); Jeanmougin et al. (1998); Larkin et al. (2007)]. The primary criterion for selection was that a purine-pyrimidine motif located within the target site must be present in all CHIKV sequences analyzed. Another important criterion for selecting suitable sites for CDZ cleavage, was that the length of conserved flanking arms be long enough to insure specificity of the DNAzyme for the target site. The optimal length for the 5 and 3 arms of CDZ was previously determined to be 9 bases for effective DNAzyme catalysis, which provides a high level of specificity, with minimal off-target effects [Cairns et al., (2003)].
TABLE-US-00015 TABLEE-4 TableofSequencesandConjugatedCompoundsforCHIKVtargets SEQ Name Description Length Type IDNO: CDZandCDZin5 5-AATGCTAGAGCGTTCTCGCAT-3 21 DNA 25 armtarget Correspondingtonucleotides202to210of theCHIKVgenome 5Arm(5->3 ATGCGAGAA 9 DNA 26 3Arm(5->3) GCTCTAGCA 9 DNA 27 CDZcatalyticcore GGCTAGCTACAACGA 15 DNA 13 SameastheDDZcatalyticcore CHIKVRNA AAUGCUAGAGCGUUCUCGCAU 21 RNA 28 Target thiol-CDZ 5-SH-(CH.sub.2).sub.6- 33 29 d(TTTCTCTCGGGCTAGCTACAACGAGTTTCAGCA)-3 forwardprimers TGACCGCCATTGTGTCATCGTTG 23 DNA 30 bindstonucleotidepositions2631-2653 reverseprimers GACCTCGTATCCACGATAGTCA 22 DNA 31 bindstonucleotideposition2788-2809 CHIKVCognate TGCTAGAGCGTTCTCGCAT 19 DNA 32 targetsequence correspondingtonucleotides192to210 oftheNS1gene TABLEE-5 NucleotidesequencesofactiveandnegativecontrolDNAzymesandcorrespondingtargets forCHIKV DNAzyme 5Arm(5->3) 3Arm(5->3) CatalyticCore RNATarget CDZ ATGCGAGAA GCTCTAGCA GGCTAGCTACAACGA AAUGCUAGAGCGUUCUCGCAU (SEQIDNO:26) (SEQIDNO:27) (SEQIDNO:13) (SEQIDNO:28)
CDZ-Tethered AuNP Preparation (CDZ-AuNP)
[0134] Preparation of CDZ-AuNP was performed as previously described [Carter et al. 2013]. Briefly, the DTT-reduced
TABLE-US-00016 thiol-CDZ(SH-CDZ) (SEQIDNO:29) 5-SH-(CH.sup.2).sup.6-d(TTTCTCTCGGGCTAGCTACAACGAGTTTCAG CA)-3
was purified by ethanol precipitation. A volume of 3 ml of AuNP and 5 mM acetate buffer (pH 5.2) were transferred to a NaOH-washed glass scintillation vial, capped and incubated for 24 hours at room temperature. Following incubation, 5 mM Tris acetate (pH 8.2) buffer and 100 mM NaCl were added and the resulting mixture was incubated once again at room temperature for an additional 24 hours. These functionalized particles (500 l) were transferred into 1.7-ml microcentrifuge tubes and centrifuged at 16,110g at room temperature for 15 min to remove unreacted SH-CDZ. The nanoparticles were resuspended in 1 mL of redispersal buffer 1 [100 mM NaCl, 25 mM Tris acetate, (pH 8.2) and 0.01% SDS], centrifuged again at 16,110g at room temperature for 15 min. The supernatant was removed and the nanoparticles were resuspended in 500 l of redispersal buffer 2 [300 mM NaCl and 25 mM Tris acetate (pH 8.2)], and re-centrifuged for 15 min to remove the remaining unreacted SH-CDZ. The cleaned CDZ-AuNP were redispersed into 200 L redispersal buffer 3 [100 mM NaCl, 25 mM Tris acetate, (pH 8.2) and 0.05% SDS] and stored at room temperature.
Detection of a Synthetic CHIKV RNA Target
[0135] CDZ-AuNPs (210.sup.8/mL) were combined in a 1.5 mL microcentrifuge tube with 10 mM MgCl.sub.2 for optimal DNAzyme activity [Liu et al. (2006)], 1.0M NaCl to drive aggregation of AuNPs, and synthetic CHIKV RNA target (7.5 nM) corresponding to the 5 200 nucleotides of the CHIKV RNA genome was added [Ogawa and Maeda (2008)]. Reaction mixes were incubated at 37 C. and inspected every 5 minutes over a 30 minute period. Photographs were taken with a Nikon CoolPix 53300 camera (Nikon USA, Melville, N.Y.).
In Vitro Digestion Analysis of CDZ-Tethered AuNPs
[0136] This analysis was performed as described in Example 1. Briefly, CHIKV RNA was isolated from CHIKV infected Ae. albopictus C6/36 cells using the QiaAmp viral RNA Mini Kit (Qiagen) according to the manufacturer's protocol. A volume of 10 M of eluted CHIKV RNA was incubated with 210.sup.8 DDZ-AuNP/ml for 30 min at 37 C. A volume of 15 ul of this reaction mixture was added to a RT-PCR mix (Super Script III, Life Science Technologies) containing heterologous and random hexametric primers to amplify the digested fragments. These RT-PCR fragments were then separated on 1.75% agarose gels.
Mg.SUP.2+ Resistance of CDZ-Tethered AuNPs
[0137] This analysis was performed as previously described [Carter et al. (2013)]. A mixture composed of 1 l CDZ-tethered AuNPs, 50 mM Tris-HCl (pH 7.5), and increasing concentrations of MgCl.sub.2 (5 mM to 20 mM) 10 L were incubated at room temperature for 0 to .sup.30 min. Absorbance units were measured with a ND-1000 spectrophotometer.
Transmission Electron Microscopy (TEM)
[0138] TEM of CDZ conjugated and unconjugated AuNPs was performed using the JEOL 1220 transmission electron microscope fitted with a tungsten electron source. Samples for TEM (2 l) were placed on TEM grids coated with a thin carbon support film, air dried, and images were taken. For AuNP applications, images were captured at 80 kV using 80,000 magnification.
Determination of Optimal Sodium Dodecyl Sulfate (SDS) Concentration
[0139] This was performed as previously described (Carter et al. 2013). Ten microliters (10 l) of cell suspension containing 110.sup.6 CHIKV TCID.sub.50 units/mL was added to a mixture containing 150 mM Tris-HCl (pH 7.5), 10 mM MgCl.sub.2, 210.sup.8 CDZ-AuNP particles, 1.5M NaCl and SDS at concentrations ranging from 0% to 1% (w/v). Samples were incubated at 37 C. for 30 minutes, and analyzed every 5 min by visual inspection for aggregation of AuNPs, an indicator of positive CHIKV detection in cell culture. Photographs were taken with a Nikon CoolPix 53300 camera.
CDZ-AuNP Specificity Determination
[0140] CDZ-AuNP specificity assays were performed as previously described for DENV detection with the anti-DENV DNAzyme (DDZ) conjugated AuNPs [Carter et al. 2013]. Ten microliters (10 uL) of cell culture fluid containing 110.sup.6/mL CHIKV vaccine strain 181/25 [Plante et al. (2011)], or DENV-2 NGC as a negative control, were added to a mixture containing 150 mM Tris-HCl (pH 7.5), 10 mM MgCl.sub.2, 210.sup.8 CDZ-AuNP or CDZin-AuNP particles, 0.5% (w/v) SDS, and 1.5M NaCl. Following incubated at 37 C. for 5 minutes, photographs were taken using the Nikon CoolPix 53300 camera, and spectrophotometric analysis was performed using the ND-1000 spectrophotometer.
Limits of CHIKV Detection with CDZ Conjugated AuNPs
[0141] CHIKV samples (
[0142] The CHIKV samples described above served as substrates for CDZ-AuNP colorimetric assays to determine their limits of CHIKV detection. Ten microliters (10 l) of each dilution stock was added to a buffered reaction mix containing 150 mM Tris-HCl (pH 7.5), 10 mM MgCl.sub.2, 210.sup.8 CDZ-AuNP particles, 1.5M NaCl, and 0.5% (w/v) SOS. Samples were mixed and incubated at 37 C. for 5 minutes, and photographs were taken with a Nikon CoolPix 53300 camera.
Real-Time RT-PCR Assays
[0143] The reaction mixture (final volume of 25 ul) contained 2SYBR green qRT-PCR Mastermix with Superscript III RT/Platinum Taq, 10 pmol of each primer, and 5 ul of extracted RNA from C6/36 cells infected with CHIKV vaccine strain 181/25, or uninfected C6/36 cells as a negative control. An additional negative control reaction was assembled that included RNA from uninfected C6/36 cells, but without CHIKV specific primers. Amplification of a fragment from the CHIKV RNA genome of 168 nt in length was performed using the following two primers:
[0144] A forward primer of the sequence
TABLE-US-00017 SEQIDNO:(30) TGACCGCCATTGTGTCATCGTTG
(which binds to nucleotide position 2631-2653), and a reverse primer of the sequence
TABLE-US-00018 SEQIDNO:(31) GACCTCGTATCCACGATAGTCA
(which binds to nucleotide position 2788-2809).
[0145] qRT-PCR amplification assays were performed on the 7500 Real-Time PCR System (Applied Biosystems) with the following settings: 50 C. for 15 min, 95 C. for 2 min, followed by 45 cycles of 95 C. for 15 s, 60 C. for 40 s. Data was collected at the 60 C. step.
[0146] The amount of viral RNA was calculated from a standard curve using a synthetic RNA transcript (Gene Script). The values of the quantity of CHIKV RNA/ml for each standard used was obtained using the in vitro transcript as a standard. The coefficient of determination for the standard curve that was generated had a value of (R.sup.2)>0.97.
Results
Design of Anti-CHIKV 10-23 DNAzyme Conjugated Gold Nanoparticles
[0147] DNAzymes (i.e., catalytic DNAs) have demonstrated utility and impressive sensitivity in detecting metal ions or RNA [Cairns et al. (2003); Geyer and Sen (1998)]. DNAzymes possess a catalytic core that is activated by binding a cofactor (e.g., Pb.sup.2+ or Mg.sup.2+) Cairns et al. (2003); Geyer and Sen (1998). Some DNAzymes, however, do not require cofactors for catalysis [Geyer et al. (1997)].
[0148] The 10-23 DNAzyme [Cairns et al (2003)] is capable of cleaving substrate RNAs with high sequence specificity at sites containing purine-pyrimidine (R-Y) junctions [Santoro and Joyce (1997)]. We chose this particular DNAzyme for use in our CHIKV detection system because of its decreased dependence on secondary structure for its activity versus other DNAzymes [Carter et al. (2013)], which was predicted to increase catalysis in our in vitro assays where biomolecular folding would be very erratic. The anti-CHIKV 10-23 DNAzyme, CDZ (
Assessment of CDZ-AuNP Targeting Using In Vitro Cleavage Assays
[0149] The colorimetric detection of CHIKV by CDZ-AuNP can be divided into three phases: targeting/cleavage, activation of AuNPs, and aggregation/detection (
[0150] Initial examination of the utility of our CDZ-AuNP colorimetric detection method was performed against a synthetic 19 base CHIKV substrate corresponding to nucleotides 188 to 207 of the NS1 gene. Our CDZ was designed to complimentarily base pair with this target sequence (Carter et al. 2013). In vitro assessment of the activity of CDZ-AuNP in the presence of CHIKV artificial substrate RNAs was performed as in Example 1 (Carter et al. 2013). The synthetic CHIKV substrate (7.5 nM) was combined with a buffered mixture containing 1.0 M NaCl, 10 mM MgCl.sub.2, and 210.sup.8 CDZ-AuNPs (
[0151] AuNP-conjugated CDZs were analyzed for their ability to target and cleave RNAs derived from CHIKV strain 181/25 in vitro. Viral RNAs were isolated from infected Ae. albopictus C6/36 cells, and incubated in a reaction mix containing 210.sup.8 CDZ-tethered AuNPs for 30 minutes at 37 C. Digestion products were then amplified by RT-PCR, as previously described [Carter et al. 2013], using heterologous and hexamer primers designed to aid in the amplification of CDZ digestion products.
[0152] Successful digestion of the CHIKV RNA genome by CDZ was demonstrated by the detection of 2 fragments of approximately 200 and 300 bases in size by RT-PCR (
Assessment of Mg.SUP.2+ Sensitivity
[0153] DNAzymes are typically activated in these assays by 10 mM MgCl.sub.2. We determined the necessity for MgCl.sub.2 on the overall stability of our CDZ conjugated AuNPs by incubating the conjugated nanoparticles in increasing concentrations of MgCl.sub.2 (0 mM to 20 mM) at room temperature, and assessed the activity every 5 minutes for up to 30 minutes (
Determination of Optimal SDS Concentration in CHIKV Detection
[0154] The efficiency of our colorimetric CDZ-AuNP assay for detection of CHIKV should be increased substantially by liberating the CHIKV RNA from virions. Sodium dodecyl sulfate (SDS), an effective nonionic detergent for lysing virus particles [Becker et al. (1975)], was previously demonstrated to be an ideal component for our colorimetric detection method [Carter et al. 2013] because it does not require additional manipulations during cell lysis, is non-toxic, low cost, stable in the reaction buffer, and does not interfere with the assay.
[0155] Cellular supernatants were added to a buffered reaction mix containing CDZ-AuNPs, 10 mM MgCl.sub.2 and SDS at concentrations ranging from 0% (w/v) to 1.0% (w/v) (
CDZ Conjugated AuNPs Maintain their Spherical Shape in a High Salt Environment
[0156] Basic morphology of AuNPs can be altered due to the conjugation procedure that is performed when DNAzymes are conjugated to AuNPs. Misshapen AuNPs can compromise the efficacy of virus detection methods that employ conjugated AuNPs. Transmission electron microscopy (TEM) is the best method to determine the structural integrity of spherical AuNPs, whether unconjugated or conjugated, by assessing their overall morphology. Consequently, we assessed the general structural integrity of unconjugated AuNPs and CDZ conjugated AuNPs in the storage buffer described in Materials and Methods, and CDZ conjugated AuNPs in the reaction buffer used in this CHIKV detection assay at 80,000 magnification (
Specificity Assay
[0157] Patients dually infected with CHIKV and DENV have increased in prevalence in South Asia and Africa [Caron et al. (2012] reflecting the co-incidence of these two viruses in mosquito populations. In light of this, we tested our CDZ-AuNP detection method for its specificity in detecting CHIKV in the presence of DENV (
Limits of Detection
[0158] The sensitivity of our CHIKV detection system was assessed using standardized titers of CHIKV (
[0159] Positive CHIKV detection was evident after only 5 minutes at 37 C., and demonstrated as little as 10.sup.1 CHIKV TCID.sub.50 units/ml could cause a color transition, although the samples containing 10.sup.1 and 10.sup.2 transitioned to a very pale purple rather than completely clear. Though it should be noted these concentrations are based on infectious units, and not copies of RNA. Nevertheless, we are greatly encouraged since these results demonstrate we can detect CHIKV approximately 6.5 orders of magnitude below the viremia of patients who present with symptoms of CHIKV infection [Vaughn et al. (2000)].
[0160] Although positive detection of CHIKV can be determined by the color change of the sample tubes, the desired full red to clear/colorless color change was not evident for 10.sup.1/ml or 10.sup.2/ml, but rather a red to pale purple color change was achieved. Though this color change signifies positive detection of CHIKV, further assessment of the sensitivity of our colorimetric CHIKV detection assay was performed by UV/Vis spectrophotometry using standardized titers of CHIKV (
[0161] Spectrophotometric results also demonstrated our colorimetric CHIKV detection assay is capable of detecting the presence of CHIKV RNA even in very dilute samples (Dil4). Earlier reports have also detected colorimetric change associated with AuNP aggregation in samples containing only femtomole amounts of substrate using spectrophotometry [Liu and Lu (2012)]. The ability to detect a co-circulating Flavivirus, DENV, at such low infectious unit titers may be due to the presence of immature/inactive virions, and RNA species that are not detected by TCID.sub.50-IFA, or even RT-PCR. For example, DENV and other viruses produce aberrant RNA species called defective RNAs [Li et al. (2011); Marriott and Dimmock et al. (2009); van der Schaar et al. (2008)] These RNAs contain defects in the form of intragenic stop codons, nucleotide insertions, or deletions, rendering many virions produced non-infectious [Li et al. (2011)]. Some of the defective RNAs appear to be maintained during natural cycles of transmission, potentially due to complementation with fully functional DENV RNA genomes [Li et al. (2011)]. Our dengue virus and CHIKV colorimetric detection methods, DDZ-AuNP and CDZ-AuNP, take advantage of the presence of immature/inactive virions and aberrant RNA species due to the presence of detergent in the reaction mixture, the catalytic nature of DNAzymes and the effect of this RNA-induced catalysis on AuNP aggregation dynamics [Carter et al. (2013)].
[0162] To assess the limits of detection with respect to RNA copy number, supernatants were collected at 4 dpi from C6/36 cells infected with the 181/25 vaccine strain of CHIKV (MOI=0.001) and were serially diluted for qRT-PCR and TCID.sub.50 assays to determine RNA copy number relative to infectious units (
Conclusions
[0163] Simple and rapid diagnostic methods to screen mosquito and patient samples for the presence of viral pathogens can significantly facilitate prevention, diagnosis, and treatment of virus borne diseases in field environments where sophisticated methods of virus detection are impractical. Ideally virus detection methods must distinguish the target pathogen from other diseases exhibiting similar symptoms (such as malaria, leptospirosis, typhoid, typhus and chikungunya), be highly sensitive during the acute stage of infection, provide rapid results enabling early detection, be cost effective, easy to use, and stable at temperatures greater than 30 C. for use in a field environment, and must show utility in epidemiological surveillance and outbreak prediction [Peeling et al. (2011)].
[0164] Example 1 illustrated our efforts to address the need for a more sensitive method to detect dengue virus. We demonstrated the effectiveness of a rapid, portable, low-tech method of virus detection that requires no specialized training, education, or equipment by coupling the RNA targeting ability of a DENV-specific DNAzyme (DDZ) with the aggregation properties of gold nanoparticles (AuNP). The DDZ-AuNP colorimetric DENV detection method is capable of detecting all four DENV serotypes directly from Aedes albopictus C6/36 cell culture fluids in a matter of minutes, without RNA isolation procedures [Carter et al. (2013)], and serves as an initial proof of concept for catalytic oligonucleotide tethered AuNP driven technologies that can be applied to the detection of viruses. In this example, we demonstrate the versatility of this method, by changing the oligonucleotide sequence of the 5 and 3 binding arms of the DNAzyme conjugates such that targeting of the CHIKV-specific RNAs would occur by way of complimentary base pairing. Our results suggest that DNAzyme targeting, coupled with non-crosslinking AuNP aggregation, satisfies many of these criteria, and is an attractive method for CHIKV detection.
[0165] The 5 and 3 binding arms of the previously described anti-DENV DNAzyme were changed to an oligonucleotide sequence of the 5 and 3 binding arms that would permit complimentary base pairing, allowing targeting of the most conserved region of the CHIKV genomic RNAs encompassing nucleotides 192 to 210, of the NS1 gene [Carter et al. (2013)]. The demonstrated ability of DNAzymes to successfully target small stretches of RNA makes these catalytic oligonucleotides highly useful for targeting conserved regions of virus genomes.
[0166] While our CDZ-AuNP colorimetric detection system demonstrates the capacity to target the highly conserved region located within the CHIKV NS1 gene, the utility of these molecules as detection agents requires a minimal subset of anti-CHIKV DNAzymes (CDZs) to be occupied for aggregation of AuNPs to occur. The high tolerance of DNAzymes to mismatched binding of the target oligonucleotides [Santoro and Joyce (1998)] makes DNAzymes ideal for detection of viruses because they will be able to detect many closely related variants. Prior studies have demonstrated aptazymes can detect synthetically produced segments of virus genomes [Cho et al. (2005)]. We have demonstrated that under optimal reaction conditions the genomic CHIKV RNAs can also be detected through the aggregation of CDZ-tethered AuNPs following the interaction of the CDZ component with the CHIKV RNA genome.
[0167] Our anti-CHIKV DNAzyme (CDZ), when conjugated with AuNPs, readily detects its cognate target sequence within a synthetic 19 base segment of the CHIKV RNA corresponding to nucleotides 192 to 210 of the NS1 gene.
TABLE-US-00019 (SEQIDNO:32) 5 TGCTAGAGCGTTCTCGCAT
[0168] The aggregation events result from deshielding of AuNPs from sodium ions following CDZ catalysis of the synthesized CHIKV target [Williams et al. (1995)]. The CDZ-AuNP conjugate also detects purified viral RNAs or genomic RNA liberated from cell culture derived CHIKV virions. RT-PCR analysis (
[0169] CHIKV infected cell culture supernatants were analyzed instead of patient blood samples or infected mosquitoes because it is more convenient to determine optimal experimentation parameters using a less complex cell culture system. These results provide the first confirmation of effective CHIKV detection using our CDZ-AuNP assay, by providing a catalytic nucleotide-based method can be used to detect CHIKV in fluids, and demonstrate the versatility of our colorimetric virus detection method. Though optimizing this system using a cell culture platform was successful, full development will include optimizing procedures for applications with infected patient serum or mosquito tissues.
[0170] Sodium dodecyl sulfate (SDS) has proved to be an effective, low cost, detergent for directly lysing virus particles [Becker et al. (1975)]. SDS titration experiments on cell culture fluids containing CHIKV (
[0171] The CDZ-AuNP colorimetric assay is capable of distinguishing between CHIKV and DENV-2 NGC (
[0172] Transmission electron microscopy of our CDZ-conjugated AuNPs (
[0173] Our CDZ-AuNP system has the ability to detect CHIKV at titers as low as 10.sup.1/mL, and is consistent with previous reports of RNA detection at sub-femtomole levels using gold nanoparticle detection systems [Bai et al. (2010)]. Moreover though we are detecting in the range of 110.sup.1 to 110.sup.6 virus particles, there are substantially more inactive virus particles present in a given sample [Aaskov et al. (2006)]. Consequently adding SDS to lyse CHIKV particles enhances the effectiveness of our colorimetric CDZ-AuNP detection method for real world applications. CHIKV-infected patients exhibit a viral load of 10.sup.9 or more [Parida et al. (2007)]. Since we can detect 8 orders of magnitude below this, our assay could potentially allow detection of CHIKV in infected patients prior to the manifestation of symptoms. Current CHIKV detection methods lack this feature. Secondly, Ae. albopictus mosquito larvae are typically infected with CHIKV at a titer of 10.sup.6 TCID.sub.50/larva, well within the sensitivity for this colorimetric CHIKV detection assay, making it potentially ideal for surveillance of CHIKV in mosquito populations [Reiskind et al. (2010); Westbrook et al. (2009)].
[0174] The detection of so few infectious units may be attributable to the presence of immature/inactive virions and RNA species that are not detected by TCID.sub.50-IFA, or even RT-PCR [Rodenhuis-Zybert et al. (2010) van der Schaar et al. (2007); van der Schaar et al. (2008)]. For example, DENV and other viruses produce aberrant RNA species called defective RNAs in the form of intragenic stop codons, nucleotide insertions, or deletions, rendering many virions produced non-infectious [Aaskov et al. (2006); Marriott et al. (2009); Wang et al. (2002)]. Our colorimetric method for CHIKV detection, CDZ-AuNP, takes advantage of immature/inactive virions and aberrant RNA species because of the placement of detergent in the reaction mixture, the choice of target sequence, the catalysis promoted by DNAzymes and the effect of this RNA-induced catalysis on AuNP aggregation kinetics.
[0175] Prior demonstration of DNAzyme conjugated AuNPs as a sensitive DENV detection method, coupled with the demonstrated ability to detect CHIKV with a similar DNAzyme-AuNP approach further validates the versatility of this method for the potential detection of a number of viruses [Carter et al. (2013)]. The simplicity of these colorimetric assays for virus detection provides distinct advantages over other detection methods. The colorimetric assay for virus detection can be packaged as a pre-mixed reaction solution, and may be performed without any specialized equipment. Furthermore, this assay is inexpensive as compared to serological testing or PCR-based methods. Components for detection are stable for months at room temperature (data not shown), and have displayed stability at temperatures greater than 30 C., making this assay ideal for CHIKV detection in tropical climates.
[0176] Further development of these colorimetric detection assays will enable sensitive identification of virus derived RNAs in mosquito and patient samples. Bedside virus detection could allow more effective diagnosis and treatment of infected patients, and more rapid recovery from disease symptoms. Furthermore, the simplicity of colorimetric AuNP-driven detection methods make these approaches optimal in early surveillance to target locations for more effective vector control strategies.
[0177] While the preferred embodiments of the invention have been illustrated and described in detail, it will be appreciated by those skilled in the art that various changes can be made therein without departing from the spirit and scope of the invention. Accordingly, the particular arrangements disclosed are meant to be illustrative only and not limiting as to the scope of the invention, which is to be given the full breadth of the appended claims and any equivalent thereof.
REFERENCES
[0178] All references, patents, or applications cited herein are incorporated by reference in their entirety, as if written herein. [0179] 1. Aaskov J, Buzacott K, Thu H M, Lowry K, Holmes E C: Long-term transmission of defective RNA viruses in humans and Aedes mosquitoes. Science 2006, 311:236-238. [0180] 2. Adalja A A, Sell T K, Bouri N, Franco C: Lessons learned during dengue outbreaks in the United States, 2001-2011. Emerg Infect Dis 2012, 18:608-614. [0181] 3. Alvarez D E, Lodeiro M F, Luduena S J, Pietrasanta L I, Gamarnik A V: Long-range RNA-RNA interactions circularize the dengue virus genome. J Virol 2005, 79:6631-6643. [0182] 4. Anez G, Heisey D A, Espina L M, Stramer S L, Rios M: Phylogenetic analysis of dengue virus types 1 and 4 circulating in Puerto Rico and Key west, Florida, during 2010 epidemics. AmJTrop Med Hyg 2012, 87:548-553. [0183] 5. Apte-Deshpande A, Paingankar M, Gokhale M D, Deobagkar D N: Serratia odorifera a midgut inhabitant of Aedes aegypti mosquito enhances its susceptibility to dengue-2 virus. PLoS One 2012, 7:e40401. [0184] 6. Auslander S, Ketzer P, Hartig J S: A ligand-dependent hammerhead ribozyme switch for controlling mammalian gene expression. Mol Biosyst 2010, 6:807-814. [0185] 7. Bai X, Shao C, Han X, Li Y, Guan Y, Deng Z: Visual detection of sub-femtomole DNA by a gold nanoparticle seeded homogeneous reduction assay: toward a generalized sensitivity-enhancing strategy. Biosens Bioelectron 2010, 25:1984-1988. [0186] 8. Baum D A, Silverman S K: Deoxyribozymes: useful DNA catalysts in vitro and in vivo. Cell Mol Life Sci 2008, 65:2156-2174. [0187] 9. Becker R, Helenius A, Simons K: Solubilization of the Semliki forest virus membrane with sodium dodecyl sulfate. Biochemistry 1975, 14:1835-1841. [0188] 10. Cairns M J, King A, Sun L Q: Optimisation of the 10-23 DNAzyme-substrate pairing interactions enhanced RNA cleavage activity at purine-cytosine target sites. Nucleic Acids Res 2003, 31:2883-2889. [0189] 11. Cao X, Ye Y, Liu S: Gold nanoparticle-based signal amplification for biosensing. Anal Biochem 2010, 417:1-16. [0190] 12. Caron M, Paupy C, Grard G, Becquart P, Mombo I, Nso B B, Kassa Kassa F, Nkoghe D, Leroy E M: Recent introduction and rapid dissemination of chikungunya virus and dengue virus serotype 2 associated with human and mosquito coinfections in Gabon, central Africa. Clin Infect Dis 2012, 55:e45-e53. [0191] 13. Carter J R, Keith J H, Barde P V, Fraser T S, Fraser M J Jr: Targeting of highly conserved dengue virus sequences with anti-dengue virus trans-splicing group I introns. BMC Mol Biol 2010, 11:84. [0192] 14. Carter, J. R., Balaraman, V., Kucharski, C. A., Fraser, T. S., and Fraser, M. J., Jr. A novel dengue virus detection method that couples DNAzyme and gold nanoparticle approaches. Virol J 10, 201. [0193] 15. Chisenhall D M, Vitek C I, Richards S L, Mores C N: A method to increase efficiency in testing pooled field-collected mosquitoes. J Am Mosq Control Assoc 2008, 24:311-314. [0194] 16. Cho S, Kim J E, Lee B R, Kim 1H, Kim B G: Bis-aptazyme sensors for hepatitis C virus replicase and helicase without blank signal. Nucleic Acids Res 2005, 33:e177. [0195] 17. Cieslak M, Szymanski J, Adamiak R W, Cierniewski C S: Structural rearrangements of the 10-23 DNAzyme to beta 3 integrin subunit mRNA induced by cations and their relations to the catalytic activity. J Biol Chem 2003, 278:47987-47996. [0196] 18. Clyde K, Kyle J L, Harris E: Recent advances in deciphering viral and host determinants of dengue virus replication and pathogenesis. J Virol 2006, 80:11418-11431. [0197] 19. Cordel, H., Quatresous, I., Paquet, C., and Couturier, E. (2006). Imported cases of chikungunya in metropolitan France, April 2005-February 2006. Euro Surveill 11, E060420 060423. [0198] 20. de Oliveira P C, Pavoni D P, Queiroz M H, de Borba L, Goldenberg S, dos Santos C N, Krieger M A: Dengue virus infections: comparison of methods for diagnosing the acute disease. J Clin Virol 2005, 32:272-277. [0199] 21. de Silva C, Walter N G: Leakage and slow allostery limit performance of single drug-sensing aptazyme molecules based on the hammerhead ribozyme. RNA 2009, 15:76-84. [0200] 22. Effler P V, Pang L, Kitsutani P, Vorndam V, Nakata M, Ayers T, Elm J, Tom T, Reiter P, Rigau-Perez J G, et al: Dengue fever, Hawaii, 2001-2002. Emerg Infect Dis 2005, 11:742-749. [0201] 23. Englebienne P: Use of colloidal gold surface plasmon resonance peak shift to infer affinity constants from the interactions between protein antigens and antibodies specific for single or multiple epitopes. Analyst 1998, 123:1599-1603. [0202] 24. Ferapontova E E, Gothelf K V: Effect of serum on an RNA aptamer-based electrochemical sensor for theophylline. Langmuir 2009, 25:4279-4283. [0203] 25. Figueiredo L T: Dengue in Brazil. Rev Soc Bras Med Trop 2012, 45:285. [0204] 26. Fronhoffs, S., Totzke, G., Stier, S., Wernert, N., Rothe, M., Bruning, T., Koch, B., Sachinidis, A., Vetter, H., and Ko, Y. (2002). A method for the rapid construction of cRNA standard curves in quantitative real-time reverse transcription polymerase chain reaction. Molecular and cellular probes 16, 99-110. [0205] 27. Geyer C R, Sen D: Evidence for the metal-cofactor independence of an RNA phosphodiester-cleaving DNA enzyme. Chem Biol 1997, 4:579-593. [0206] 28. Geyer C R, Sen D: Lanthanide probes for a phosphodiester-cleaving, lead-dependent, DNAzyme. J Mol Biol 1998, 275:483-489. [0207] 29. Goho, A: Gold quantum dots. Science News Sep. 11, 2004, 166(11): 174. [0208] 30. Gubler D J: Dengue and dengue hemorrhagic fever. Clin Microbiol Rev 1998, 11:480-496. [0209] 31. Hall B, Hesselberth J R, Ellington A D: Computational selection of nucleic acid biosensors via a slip structure model. Biosens Bioelectron 2007, 22:1939-1947. [0210] 32. Higgs, S., and Ziegler, S. A. A nonhuman primate model of chikungunya disease. J Clin Invest (2010) 120, 657-660. [0211] 33. Jansen, C. C., Prow, N. A., Webb, C. E., Hall, R. A., Pyke, A. T., Harrower, B. J., Pritchard, I. L., Zborowski, P., Ritchie, S. A., Russell, R. C., et al. (2009). Arboviruses isolated from mosquitoes collected from urban and peri-urban areas of eastern Australia. J Am Mosq Control Assoc 25, 272-278. [0212] 34. Jeanmougin, F., Thompson, J. D., Gouy, M., Higgins, D. G., and Gibson, T. J. (1998). Multiple sequence alignment with Clustal X. Trends Biochem Sci 23, 403-405. [0213] 35. Jing L, Yi Lu: A Highly Sensitive and Selective Catalytic DNA Biosensor for Lead Ions J Am Chem Soc 2006, 122:10466-10467. [0214] 36. Kabra S K, Jain Y, Singhal T, Ratageri V H: Dengue hemorrhagic fever: clinical manifestations and management. Indian J Pediatr 1999, 66:93-101. [0215] 37. Knudsen S M, Lee J, Ellington A D, Savran C A: Ribozyme-mediated signal augmentation on a mass-sensitive biosensor. J Am Chem Soc 2006, 128:15936-15937. [0216] 38. Kuwayama M, Ito M, Takao S, Shimazu Y, Fukuda S, Miyazaki K, Kurane I, Takasaki T: Japanese encephalitis virus in meningitis patients, Japan. Emerg Infect Dis 2005, 11:471-473. [0217] 39. Lanciotti R S, Calisher C H, Gubler D J, Chang G J, Vorndam A V: Rapid detection and typing of dengue viruses from clinical samples by using reverse transcriptase-polymerase chain reaction. J Clin Microbiol 1992, 30:545-551. [0218] 40. Li D, Lott W B, Lowry K, Jones A, Thu H M, Aaskov J: Defective interfering viral particles in acute dengue infections. PLoS One 2011, 6:e19447. [0219] 41. Liu J, Lu Y: Preparation of aptamer-linked gold nanoparticle purple aggregates for colorimetric sensing of analytes. Nat Protoc 2006, 1:246-252. [0220] 42. Liu Y, Wu Z, Zhou G, He Z, Zhou X, Shen A, Hu J: Simple, rapid, homogeneous oligonucleotides colorimetric detection based on non-aggregated gold nanoparticles. Chem Commun (Camb) 2012, 48:3164-3166. [0221] 43. Macnamara F N: Zika virus: a report on three cases of human infection during an epidemic of jaundice in Nigeria. Trans R Soc Trop Med Hyg 1954, 48:139-145. [0222] 44. Marchette N J, Garcia R, Rudnick A: Isolation of Zika virus from Aedes aegypti mosquitoes in Malaysia. AmJTrop Med Hyg 1969, 18:411-415. [0223] 45. Marriott, A. C., and Dimmock, N. J. Defective interfering viruses and their potential as antiviral agents. Rev Med Virol 20, 51-62. [0224] 46. Nawtaisong P, Keith J, Fraser T, Balaraman V, Kolokoltsov A, Davey R A, Higgs 5, Mohammed A, Rongsriyam Y, Komalamisra N, Fraser M J Jr: Effective suppression of dengue fever virus in mosquito cell cultures using retroviral transduction of hammerhead ribozymes targeting the viral genome. Virol J 2009, 6:73. [0225] 47. Nougairede, A., De Fabritus, L., Aubry, F., Gould, E. A., Holmes, E. C., and de Lamballerie, X. (2013). Random codon re-encoding induces stable reduction of replicative fitness of Chikungunya virus in primate and mosquito cells. PLoS Pathog 9, e1003172. [0226] 48. Ogawa A, Maeda M: Easy design of logic gates based on aptazymes and noncrosslinking gold nanoparticle aggregation. Chem Commun (Camb) 2009, 21:4666-4668. [0227] 49. Ogawa A, Maeda M: Simple and rapid colorimetric detection of cofactors of aptazymes using noncrosslinking gold nanoparticle aggregation. Bioorg Med Chem Lett 2008, 18:6517-6520. [0228] 50. Ogawa A: RNA aptazyme-tethered large gold nanoparticles for on-the-spot sensing of the aptazyme ligand. Bioorg Med Chem Lett 2011, 21:155-159. [0229] 51. Parida, M. M., Santhosh, S. R., Dash, P. K., Tripathi, N. K., Lakshmi, V., Mamidi, N., Shrivastva, A., Gupta, N., Saxena, P., Babu, J. P., et al. (2007). Rapid and real-time detection of Chikungunya virus by reverse transcription loop-mediated isothermal amplification assay. J Clin Microbiol 45, 351-357. [0230] 52. Peeling R W, Artsob H, Pelegrino J L, Buchy P, Cardosa M J, Devi S, Enria D A, Farrar J, Gubler D J, Guzman M G, et al: Evaluation of diagnostic tests: dengue. Nat Rev Microbiol 2010, 8:S30-538. [0231] 53. Plante K, Wang E, Partidos C D, Weger J, Gorchakov R, Tsetsarkin K, Borland E M, Powers A M, Seymour R, Stinchcomb D T, et al: Novel chikungunya vaccine candidate with an IRES-based attenuation and host range alteration mechanism. PLoS Pathog 2011, 7:e1002142. [0232] 54. Qi R F, Zhang L, Chi C W: Biological characteristics of dengue virus and potential targets for drug design. Acta Biochim Biophys Sin (Shanghai) 2008, 40:91-101. [0233] 55. Rai M A: Epidemic: Control of dengue fever in Pakistan. Nature 2011, 479:41. [0234] 56. Ramos M M, Mohammed H, Zielinski-Gutierrez E, Hayden M H, Lopez J L, Fournier M, Trujillo A R, Burton R, Brunkard J M, Anaya-Lopez L, et al: Epidemic dengue and dengue hemorrhagic fever at the Texas-Mexico border: results of a household-based seroepidemiologic survey, December 2005. AmJTrop Med Hyg 2008, 78:364-369. [0235] 57. Randolph S E, Rogers D J: The arrival, establishment and spread of exotic diseases: patterns and predictions. Nat Rev Microbiol 2010, 8:361-371. [0236] 58. Reed W, Carroll J, Agramonte A, Lazear J W: The etiology of yellow fever-a preliminary note. Publ Health Pap Rep 1900, 26:37-53. [0237] 59. Reiskind, M. H., Westbrook, C. J., and Lounibos, L. P. Exposure to chikungunya virus and adult longevity in Aedes aegypti (L.) and Aedes albopictus (Skuse). (2010) J Vector Ecol 35, 61-68. [0238] 60. Rigau-Perez J G, Clark G G, Gubler D J, Reiter P, Sanders E J, Vorndam A V: Dengue and dengue haemorrhagic fever. Lancet 1998, 352:971-977. [0239] 61. Roberts L: Mosquitoes and disease. Science 2002, 298:82-83. [0240] 62. Rodenhuis-Zybert, I. A., van der Schaar, H. M., da Silva Voorham, J. M., van der Ende-Metselaar, H., Lei, H. Y., Wilschut, J., and Smit, J. M. Immature dengue virus: a veiled pathogen? PLoS Pathog 6, e1000718. [0241] 63. Rueda D, Walter N G: Fluorescent energy transfer readout of an aptazyme-based biosensor. Meth Mol Biol 2006, 335:289-310. [0242] 64. Santoro S W, Joyce G F: A general purpose RNA-cleaving DNA enzyme. Proc Natl Acad Sci USA 1997, 94:4262-4266. [0243] 65. Santoro S W, Joyce G F: Mechanism and utility of an RNA-cleaving DNA enzyme. Biochemistry 1998, 37:13330-13342. [0244] 66. Sato K, Hosokawa K, Maeda M: Non-cross-linking gold nanoparticle aggregation as a detection method for single-base substitutions. Nucleic Acids Res 2005, 33:e4. [0245] 67. Shu P Y, Huang J H: Current advances in dengue diagnosis. Clin Diagn Lab Immunol 2004, 11:642-650. [0246] 68. Song K M, Cho M, Jo H, Min K, Jeon S H, Kim T, Han M S, Ku J K, Ban C: Gold nanoparticle-based colorimetric detection of kanamycin using a DNA aptamer. Anal Biochem 2011, 415:175-181. [0247] 69. Sun, L Q, Cairns, M J, Gerlach, W L., Witherington, C, Wang, L, King, A: Suppression of smooth muscle cell proliferation by a c-myc RNA-cleaving deoxyribozyme. J Biol Chem 1999, 274:17236-17241. [0248] 70. Thiboutot, M. M., Kannan, S., Kawalekar, O. U., Shedlock, D. J., Khan, A. S., Sarangan, G., Srikanth, P., Weiner, D. B., and Muthumani, K. Chikungunya: a potentially emerging epidemic? PLoS Negl Trop Dis 4, e623. [0249] 71. Thompson K M, Syrett H A, Knudsen S M, Ellington A D: Group I aptazymes as genetic regulatory switches. BMC Biotechnol 2002, 2:21. [0250] 72. Tricou V, Vu H T, Quynh N V, Nguyen C V, Tran H T, Farrar J, Wills B, Simmons C P: Comparison of two dengue NS1 rapid tests for sensitivity, specificity and relationship to viraemia and antibody responses. BMC Infect Dis 2010, 10:142. [0251] 73. Tsetsarkin, K., Higgs, S., McGee, C. E., De Lamballerie, X., Charrel, R. N., and Vanlandingham, D. L. (2006). Infectious clones of Chikungunya virus (La Reunion isolate) for vector competence studies. Vector Borne Zoonotic Dis 6, 325-337. [0252] 74. Tsetsarkin, K. A., McGee, C. E., Volk, S. M., Vanlandingham, D. L., Weaver, S. C., and Higgs, S. (2009). Epistatic roles of E2 glycoprotein mutations in adaption of chikungunya virus to Aedes albopictus and Ae. aegypti mosquitoes. PLoS One 4, e6835. [0253] 75. Van Bortel, W., Dorleans, F., Rosine, J., Blateau, A., Rousset, D., Matheus, S., Leparc-Goffart, I., Flusin, O., Prat, C., Cesaire, R., et al. (2014). Chikungunya outbreak in the Caribbean region, December 2013 to March 2014, and the significance for Europe. Euro Surveill 19. [0254] 76. van den Hurk, A. F., Hall-Mendelin, S., Pyke, A. T., Smith, G. A., and Mackenzie, J. S. Vector competence of Australian mosquitoes for chikungunya virus. Vector Borne Zoonotic Dis 10, 489-495. [0255] 77. van der Schaar, H. M., Rust, M. J., Chen, C., van der Ende-Metselaar, H., Wilschut, J., Zhuang, X., and Smit, J. M. (2008). Dissecting the cell entry pathway of dengue virus by single-particle tracking in living cells. PLoS Pathog 4, e1000244. [0256] 78. van der Schaar, H. M., Rust, M. J., Waarts, B. L., van der Ende-Metselaar, H., Kuhn, R. J., Wilschut, J., Zhuang, X., and Smit, J. M. (2007). Characterization of the early events in dengue virus cell entry by biochemical assays and single-virus tracking. J Virol 81, 12019-12028. [0257] 79. Vaughn D W, Green 5, Kalayanarooj S, Innis B L, Nimmannitya S, Suntayakorn S, Endy T P, Raengsakulrach B, Rothman A L, Ennis F A, Nisalak A: Dengue viremia titer, antibody response pattern, and virus serotype correlate with disease severity. J Infect Dis 2000, 181:2-9. [0258] 80. Wang, W. K., Lin, S. R., Lee, C. M., King, C. C., and Chang, S. C. (2002). Dengue type 3 virus in plasma is a population of closely related genomes: quasispecies. J Virol 76, 4662-4665. [0259] 81. Weill L, Louis D, Sargueil B: Selection and evolution of NTP-specific aptamers. Nucleic Acids Res 2004, 32:5045-5058. [0260] 82. Westbrook, C. J., Reiskind, M. H., Pesko, K. N., Greene, K. E., and Lounibos, L. P. Larval environmental temperature and the susceptibility of Aedes albopictus Skuse (Diptera: Culicidae) to Chikungunya virus. Vector Borne Zoonotic Dis 10, 241-247. [0261] 83. WHO: Dengue and dengue haemorrhagic fever, Fact sheet No 117. Geneva, Switzerland: WHO: Dengue and dengue haemorrhagic fever; 2012. [0262] 84. Wieland M, Berschneider B, Erlacher M D, Hartig J S: Aptazyme-mediated regulation of 16S ribosomal RNA. Chem Biol 2010, 17:236-242. [0263] 85. Williams DHaF I: Spectroscopic Methods in Organic Chemistry. 5th edition. Blacklick, Ohio, U.S.A: McGraw-Hill; 1995.