Combination of Elafibranor or derivatives thereof with an anti-NASH, anti-fibrotic or anti-cholestatic agent

11478440 · 2022-10-25

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention relates to a combination product and its use in therapy.

Claims

1. A method of delaying, reversing or slowing the progression of a disease, comprising administering to a subject in need of treatment a therapeutically effective amount of a combination product, said combination product comprises: (i) elafibranor, a pharmaceutically acceptable salt or a solvate thereof; and (ii) an anti-NASH, anti-fibrotic or anti-cholestatic agent selected from the group consisting of Selonsertib, GKT-831, PXS-4728A, Aramchol, PBI-4050, MSDC-0602k, VK-2809, MGL-3196, Vismodegib, CF-102 (Namodenoson), MT-3995 (Apararenone), JKB-121 (Nalmefene), emricasan, KD-025, and DUR-928 or a pharmaceutically acceptable salt thereof; wherein said disease is selected from the group consisting of liver fibrosis, liver cirrhosis, metabolic liver diseases, non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), drug-induced liver diseases, alcohol-induced liver diseases, infectious agent induced liver diseases, inflammatory liver diseases, immune system dysfunction-mediated liver diseases, dyslipidemia, cardiovascular diseases, restenosis, syndrome X, metabolic syndrome, diabetes, obesity, hypertension, chronic cholangiopathies, Primary Sclerosing Cholangitis (PSC), Primary Biliary Cholangitis (PBC), biliary atresia, progressive familial intrahepatic cholestasis type 3 (PFIC3), inflammatory bowel diseases, Crohn's disease, ulcerative colitis, liver cancer, hepatocallular carcinoma, gastrointestinal cancer, gastric cancer, colorectal cancer, metabolic disease-induced liver fibrosis or cirrhosis, NAFLD-induced fibrosis or cirrhosis, NASH-induced fibrosis or cirrhosis, alcohol-induced liver fibrosis or cirrhosis, drug-induced liver fibrosis or cirrhosis, infectious agent-induced liver fibrosis or cirrhosis, parasite infection-induced liver fibrosis or cirrhosis, bacterial infection-induced liver fibrosis or cirrhosis, viral infection-induced fibrosis or cirrhosis, HBV-infection induced liver fibrosis or cirrhosis, HCV-infection induced liver fibrosis or cirrhosis, HIV-infection induced liver fibrosis or cirrhosis, dual HCV and HIV-infection induced liver fibrosis or cirrhosis, radiation- or chemotherapy-induced fibrosis or cirrhosis, biliary tract fibrosis, liver fibrosis or cirrhosis due to any chronic cholestatic disease, gut fibrosis of any etiology, Crohn's disease-induced fibrosis, ulcerative colitis-induced fibrosis, small intestine fibrosis, colon fibrosis, stomach fibrosis, lung fibrosis, lung fibrosis consecutive to chronic inflammatory airway diseases, chronic obstructive pulmonary disease (COPD), asthma, emphysema, smoker's lung, tuberculosis, pulmonary fibrosis, and idiopathic pulmonary fibrosis (IPF).

2. The method according to claim 1, wherein component (i) is elafibranor.

3. The method according to claim 1, wherein said combination product does not contain cenicriviroc (CVC) or obeticholic acid (OCA).

Description

(1) FIG. 1: Effect of the combination of 1 mg/kg/day of ELA and 10 mg/kg/day of OCA on the measure of fibrotic surface.

(2) FIG. 2: Effect of the combination of 3 mg/kg/day of ELA and 10 mg/kg/day of OCA on the measure of fibrotic surface.

(3) FIG. 3: Effect of the combination of 1 mg/kg/day of ELA and 10 mg/kg/day of OCA on hepatic collagen.

(4) FIG. 4: Effect of the combination of 3 mg/kg/day of ELA and 10 mg/kg/day of OCA on hepatic collagen.

(5) FIG. 5: effect of the combination of 3 mg/kg/day of ELA and 10 mg/kg/day of OCA on fibrosis markers.

(6) FIG. 6: Differential antifibrotic effect of Elafibranor versus Cenicriviroc, and Bezafibrate in TGFb-induced hHSC.

(7) Serum-deprived HSC were preincubated for 1 hour with Elafibranor (A), Cenicriviroc (B), or Bezafibrate (PPAR pan α/γ/δ) before the activation with the profibrogenic cytokine TGFβ1 (1 ng/ml).

(8) After 48 hours of incubation, the expression of α-SMA was measured by ELISA.

(9) The obtained values were transformed into percentage inhibition over TGFβ1 control. Data are presented as mean (triplicates)±standard deviation (SD). Statistical analyses were performed by one-way ANOVA followed by Bonferroni post-hoc tests, using Sigma Plot 11.0 software. [*: p<0.05; **: p<0.01; ***: p<0.001 (comparison versus TGFβ1 1 ng/mL group)]. The curve fitting and the calculation of half maximal inhibitory concentration (IC.sub.50) were performed with XLFit software 5.3.1.3.

(10) FIG. 7: Combination of Elafibranor with Cenicriviroc synergistically inhibits α-SMA in TGFβ1-induced hHSC.

(11) Combinations were tested in a dose-response matrix format and analyzed according to the excess over Bliss (EOB) additivism model.

(12) Dilution series of Elafibranor (row) and Cenicriviroc (column) were prepared, including their respective DMSO controls.

(13) The resulting mixes were added to serum-deprived HSC, 1 hour prior to the activation with the profibrogenic cytokine TGFβ1 (1 ng/ml).

(14) (A) Percentage of α-SMA inhibition over the TGFβ1 control for all combination pairs. Data are presented as mean of quadruplicates.

(15) (B) EOB scores were calculated as described in Materials and Methods. Any compound pair with EOB values>10 was considered synergistic (colored from light grey to black). The total EOB score including all combinations was also calculated.

(16) (C) Data values derived from a synergistic combination pair were plotted in a bar graph representation. Data are presented as mean (quadruplicates)±standard deviation (SD). Statistical analyses were performed by one-way ANOVA followed by Bonferroni post-hoc tests, using Sigma Plot 11.0 software. [*: p<0.05; **: p<0.01; ***: p<0.001 (comparison versus ‘product combination’ group)].

(17) FIG. 8: Bezafibrate does not synergize with Cenicriviroc to reduce fibrosis in TGFβ1-induced hHSC.

(18) Combinations were tested in a dose-response matrix format and analyzed according to the excess over Bliss additivism model.

(19) Dilution series of Bezafibrate (row) and Cenicriviroc (column) were prepared, including their respective DMSO controls. The resulting mixes were added to serum-deprived HSC, 1 hour prior to the activation with the profibrogenic cytokine TGFβ1 (1 ng/ml).

(20) (A) Percentage inhibition of α-SMA over the TGFβ1 control.

(21) (B) Excess over Bliss (EOB) scores were calculated as described in Materials and Methods. Any compound pair with EOB values>10 was considered synergistic (colored from light grey to black). The total EOB score including all combinations was also calculated.

(22) FIG. 9: Combinations of elafibranor with MSDC-0602, PXS-4728A, Apararenone, CF-102, Vismodegib, PBI-4050, KD-025, DUR-928, VK-2809, and Emricasan synergistically inhibit α-SMA in TGFβ1-induced hHSC.

(23) Combinations were tested in a dose-response matrix format and analyzed according to the Excess Over Bliss (EOB) additivism model. Percentages of α-SMA inhibition over the TGFβ1 control were plotted in a bar graph representation for representative synergistic combinations. Data are presented as mean (quadruplicates)±standard deviation (SD). *: p<0.05; **: p<0.01; ***: p<0.001 using One-way ANOVA and Fisher's Least Significant Difference (LSD) post-hoc test. MSDC=MSDC-0602.

(24) FIG. 10: Combinations of elafibranor with CP-640186, GS-0976 or JKB-121 (Nalmefene) synergistically inhibit collagen production in liver microtissues.

(25) Microtissues were treated with a metabolic induction of NASH stimulus with or without elafibranor alone (white bar), compound (ii) alone (black bar) or a combination of both (grey bar). Combinations were tested in a dose-response matrix format and analyzed according to the Excess Over Bliss (EOB) additivism model. Percentages of inhibition over the NASH stimulus control were plotted in a bar graph representation for representative synergistic combinations. Data are presented as mean (triplicates)±standard deviation (SD). *: p<0.05; **: p<0.01; ***: p<0.001 using One-way ANOVA and Fisher's Least Significant Difference (LSD) post-hoc test.

(26) FIG. 11: Combination of elafibranor with gemcabene synergistically inhibits TNFα secretion in LPS-activated macrophages.

(27) Combinations were tested in a dose-response matrix format and analyzed according to the Excess Over Bliss (EOB) additivism model. Percentages of inhibition of TNFα secretion over the LPS control were plotted in a bar graph representation for representative synergistic combinations. Data are presented as mean (quadruplicates)±standard deviation (SD). *: p<0.05; **: p<0.01; ***: p<0.001 using One-way ANOVA and Fisher's Least Significant Difference (LSD) post-hoc test.

(28) FIG. 12: Combinations of Elafibranor with CP640186, VK-2809, Apararenone (Apa) or Aramchol (Aram) synergistically inhibit fat accumulation in HepG2.

(29) Combinations were tested in a dose-response matrix format and analyzed according to the Excess Over Bliss (EOB) additivism model. Percentages of inhibition of fat accumulation over the FFA-treated control were plotted in a bar graph representation for representative synergistic combinations. Data are presented as mean (quadruplicates)±standard deviation (SD). *: p<0.05; **: p<0.01; ***: p<0.001 using One-way ANOVA and Fisher's Least Significant Difference (LSD) post-hoc test.

(30) FIG. 13: Combination of elafibranor with MGL-3196 synergistically inhibits fat accumulation in 3D Huh7 spheroid culture.

(31) Spheroids were treated with a metabolic NASH stimulus with or without elafibranor alone (white bar), MGL3196 alone (grey bar) or a combination of both (black bar). Measurement of lipid accumulation was performed as described in material and methods. Standard deviations are shown as error bars (n=3). Calculated EOB value is stated in the top left. Significant differences (*p<0.05; **p<0.01***; p<0.001) following one-way analysis of variance (ANOVA) and Fisher's Least Significant Difference (LSD) test.

(32) FIG. 14: Elafibranor (GFT505, 3 mg/kg/day) and selonsertib (SEL, 30 mg/kg/day) synergize to reduce fibrosis, tissue remodeling and inflammatory markers in mice with NASH (CDFF-fed mice).

(33) (A) Percentage of fibrosis surface was assessed by morphometric quantification of picrosirius positive area relative to the liver section area.

(34) (B) Hepatic collagen content.

(35) (C) Plasma PIIINP concentration, surrogate markers of hepatic fibrosis.

(36) (D) Plasma TIMP1 concentration, surrogate markers of hepatic fibrosis.

(37) Expression of Col1α1 (E), MMP2 (F), TGFβ1 (G) as markers of fibrosis and tissue remodeling, and TNFα (H) and CCR2 (I), markers of inflammation, was assessed by real time quantitative PCR.

(38) Data are expressed as mean±SD. ¤ p<0.05, ¤¤ p<0.01, ¤¤¤ p<0.001 using one-tailed Student t-test with Welsh correction. HSA, Highest Single Agent model.

(39) FIG. 15: Elafibranor (GFT505, 1 or 3 mg/kg/day) and GKT-831 (GKT, 60 mg/kg/day) synergize to reduce NASH and fibrosis in mice with NASH (CDFF-fed mice).

(40) (A) Percentage of fibrosis surface was assessed by morphometric quantification of picrosirius positive area relative to the liver section area.

(41) (B) Histological evaluation of inflammatory foci on 10 microscope field areas (20×).

(42) (C) NAFLD activity score, assessed by the calculation of the sum of steatosis, ballooning and lobular inflammation grades (minimum 0-maximum 8) according to the NASH Clinical Research Network (Kleiner 2005, Brunt 1999).

(43) Data are expressed as mean±SD. ¤ p<0.05, ¤¤ p<0.01, ¤¤¤ p<0.001 using one-tailed Student t-test with Welsh correction. $ p<0.05, $$ p<0.01, $$$ p<0.001 using one-tailed Mann-Whitney U (non-parametric) test. HSA, Highest Single Agent model.

(44) FIG. 16: Elafibranor (GFT505, 1 mg/kg/day) and GS-0976 (GS, 30 mg/kg/day) synergize to reduce steatosis and body weight in mice with NASH (CDFF-fed mice).

(45) (A) Steatosis grade, assessed by histological examination according to the NASH Clinical Research Network guidelines.

(46) (B) Hepatic triglyceride content.

(47) (C) Body weight loss after 8 weeks of treatment compared to the controls.

(48) Data are expressed as mean±SD. ¤ p<0.05, ¤¤ p<0.01, ¤¤¤ p<0.001 using one-tailed Student t-test with Welsh correction. HSA, Highest Single Agent model.

EXAMPLES

Example 1: Combination Therapy Study Design

(49) Materials and Methods

(50) Compounds were dissolved in dimethyl sulfoxide (DMSO, Fluka cat #41640).

(51) 1. Illustration in the Model of TGF β1-Induced hHSC

(52) hHSC Culture

(53) The human primary hepatic stellate cells (hHSC) (Innoprot) were cultured in STeCM medium (ScienCell cat #5301) that was supplemented with 2% fetal bovine serum (FBS, ScienCell cat #0010), 1% penicillin/streptomycin (ScienCell cat #0503) and stellate cell growth supplement (SteCGS; ScienCell cat #5352). Cell culture flasks were coated with Poly-L Lysine (Sigma cat #P4707) for a better adherence.

(54) Preparation of Compositions

(55) 2 Components Combination Matrix

(56) For these experiments, a checkerboard matrix was generated. ELA and component (ii) stocks were serially diluted in DMSO in 5-points series in a row (ELA) and a 11-points series in a column (component (ii)) of a 96-well plate. Subsequently, the 5×11 combination matrix was generated by 1:1 mixing of all single agent concentrations. The test concentrations for each compound were chosen based on the respective IC.sub.50 of each compound as single agent obtained by measuring α-SMA content in the HSC model stimulated with TGF-β1.

(57) Activation of hHSC with TGF-β1 and Compound Treatment

(58) The human primary hepatic stellate cells (hHSC) (Innoprot) were cultured under standard conditions, as described above. The cells were subsequently plated at a density of 2×10.sup.4 cells/well into 96-well plates for the measure of α-SMA by ELISA. The next day, cell-culture medium was removed, and cells were washed with PBS (Invitrogen cat #14190). hHSC were deprived for 24 hours in serum-free and SteCGS-free medium. For the treatments with ELA, component (ii) and the respective ELA/component (ii) combinations, the serum-deprived hHSC were preincubated for 1 hour with the compounds followed by addition of the profibrogenic stimuli TGF-β1 (PeproTech cat #100-21, 1 ng/mL) in serum-free and SteCGS-free medium for an additional 48 hour period.

(59) α-SMA ELISA

(60) The level of α-SMA was measured using a Sandwich ELISA. Briefly, the wells of an ELISA plate were first coated with the capture antibody (mouse monoclonal anti-ACTA2, Abnova) at 4° C. overnight. After 3 washes in PBS+0.2% Tween 20, a blocking solution consisting of PBS+0.2% BSA was added for one hour followed by another washing cycle. The cell lysates were transferred into the wells for binding to the capture antibody for a period of 2 h at room temperature. After the washing procedure, the detection antibody (biotinylated mouse monoclonal anti-ACTA2, Abnova) was added for 2 hours at room temperature followed by 3 washes. For the detection, an HRP-conjugated Streptavidin (R&D Systems cat #DY998) was first applied for 30 min at room temperature. After washing, the HRP substrate TMB (BD, #555214) was added and incubated for 7 min at room temperature in the dark. Upon oxidation, TMB forms a water-soluble blue reaction product that becomes yellow with addition of sulfuric acid (solution stop), enabling accurate measurement of the intensity at 450 nm using a spectrophotometer. The developed color is directly proportional to the amount of α-SMA present in the lysate.

(61) 2. Illustration in the Model of HSC Activation in 3D Human Liver Microtissue

(62) 3D Human Liver Microtissue Culture

(63) Cryopreserved primary human hepatocytes (IPHH_11) and cryopreserved primary human non parenchymal cells (NPCs, IPHN_11) were obtained from BioreclamationIVT. The cryopreserved human primary hepatic stellate cells (hHSC) were obtained from Innoprot. 3D INSIGHT Human Liver Microtissues (MT-02-302-95; InSphero AG) were produced with the IPHH_11, the IPHN_11 and the hHSC in a 96-well hanging-drop culture platform (GravityPLUS). After microtissues formation, they were transferred into a microtissue-specific 96-well culture and assay platform (GravityTRAP). Further maintenance and compound treatments were performed in GravityTRAP plates. After tissue formation, the 3D microtissues were maintained in 3D INSIGHT Human Liver Maintenance Medium-INF (hLiMM CS-07-001b-01; InSphero AG) at 37° C. in a humidified 5% CO2 cell culture incubator for 4 days. Half of the culture medium was replenished every 2 days.

(64) Preparation of Compositions: 2 Components Combination Matrix

(65) For these experiments, a checkerboard matrix was generated. ELA and component (ii) stocks were serially diluted in DMSO in 2-points series in a row (ELA) and a 3-points series in a column (component (ii)) of a 96-well plate. Subsequently, the 2×3 combination matrix was generated by 1:1 mixing of all single agent concentrations.

(66) Metabolic Stimulation of 3D INSIGHT Human Liver Microtissues and Compound Treatment

(67) 3D INSIGHT human liver microtissue (InSPhero) were cultured under standard conditions, as described above. Microtissues were then deprived for 24 hours in serum-free medium. For the treatments with ELA, component (ii) and the respective ELA/component (ii) combinations, the serum-deprived microtissues were treated with both a metabolic induction of NASH stimulus and the compounds (Day 0) followed by the renewal of metabolic induction of NASH stimulus at Day 3 for an additional 3 days period. The supernatants for the measurement of Col1α1 were harvested at Day 6.

(68) Col1α1 ELISA

(69) The level of Col1α1 was measured using a Sandwich ELISA. Briefly, the wells of an ELISA plate were first coated with the capture antibody (Mouse Anti-Human Pro-Collagen I α 1 Capture Antibody, “Elisa Pro-Collagen I α1/COLIA1”, DuoSet ELISA, R&D, catalog No.: DY6220-05) at RT overnight. After 3 washes in PBS+0.05% Tween 20, a blocking solution consisting of PBS+1% BSA was added for one hour followed by another washing cycle. The culture supernatants were transferred into the wells for binding to the capture antibody for a period of 2 h at room temperature. After the washing procedure, the detection antibody (Biotinylated Sheep Anti-Human Pro-Collagen I α 1 Detection Antibody) was added for 2 hours at room temperature followed by 3 washes. For the detection, an HRP-conjugated Streptavidin was first applied for 20 min at room temperature. After washing, the HRP substrate TMB (BD, #555214) was added and incubated for 20 min at room temperature in the dark. Upon oxidation, TMB forms a water-soluble blue reaction product that becomes yellow with addition of sulfuric acid (solution stop), enabling accurate measurement of the intensity at 450 nm using a spectrophotometer. The developed color is directly proportional to the amount of col1α1 present in the supernatant.

(70) 3. Illustration in LPS-Activated Macrophages

(71) Differentiation of THP-1 Monocytes into Macrophages

(72) THP-1 monocytes (ECACC #88081201) were seeded at a density of 25550 cells per well in 384-well plate in RPMI1640 (Gibco, 21875) supplemented with 10% SVF and differentiated into macrophages using PMA (Phorbol 12-myristate 13-acetate, Sigma, P8139) at the final concentration of 100 ng/ml for 24 hours.

(73) Preparation of Compositions: 2 Components Combination Matrix

(74) For these experiments, a checkerboard matrix was generated. ELA and component stocks were serially diluted in DMSO in 6-points series in a column (ELA) and a 10-points series in a raw (component) of a 96-well plate for other compounds. Subsequently, the 6×10 combination matrix was generated by 1:1 mixing of all single agent concentrations.

(75) Compound Treatments and LPS Stimulation

(76) After 24 hrs with PMA, medium was removed, and replaced by serum free RPMI. For the treatments with ELA, component and the respective ELA/component combinations, the serum-deprived THP-1 macrophages were preincubated for 24 hours with the compounds followed by addition of lipopolysaccharide LPS (100 ng/ml, E. coli 055 B5, Sigma, L6529) for an additional 6 hours period.

(77) Human TNFα Quantification

(78) Human TNFα is quantified in the supernatants using the Homogeneous Time Resolved Fluorescence (HTRF) technology (Cisbio 62HTNFAPEG), based on FRET technology. FRET (Fluorescence Resonance Energy Transfer) is based on the transfer of energy between two fluorophores, a donor and an acceptor, when in close proximity. Molecular interactions between biomolecules can be assessed by coupling each partner with a fluorescent label and by detecting the level of energy transfer (665 nm). Cell supernatant, sample or standard were dispensed directly into the assay plate for the detection by HTRF® reagents. The antibodies labeled with the HTRF donor and acceptor were pre-mixed and added in a single dispensing step. Signal intensity is proportional to the number of antigen-antibody complex formed and therefore to the TNFα concentration. Seven points standard curve (from 39 pg/ml to 2500 pg/ml with supplied human TNFα) was obtained by fitting the data with the 4 Parameter Logistic model.

(79) 4. Illustration in Fat-Loaded Hepatocytes (HepG2)

(80) HepG2 Culture

(81) The human hepatocyte carcinoma were cultured in DMEM 4.5 g/L glucose (Gibco cat #31053 that was supplemented with 10% fetal bovine serum (FBS, Gibco cat #10270), 1% penicillin/streptomycin (Gibco cat #15140), 1% MEM NEAA (Gibco cat #11140), 1% L-Glutamine (Gibco cat #25030), and 1% Sodium Pyruvate (Gibco cat #11360).

(82) Preparation of Compositions: 2 Components Combination Matrix

(83) For these experiments, a checkerboard matrix was generated. ELA and component stocks were serially diluted in DMSO in 5-points series in a row (ELA) and a 11-points series in a column (component) of a 384-well plate. Subsequently, the 5×11 combination matrix was generated by 1:1 mixing of all single agent concentrations.

(84) Free Fatty Acid (FFA) Preparation

(85) Oleic (#O1383) and palmitic (P0500) acids were purchased at Sigma. FFA stock solutions (100 mM) were prepared in 0.1M NaOH at 80° C. Working solutions of 4.5 mM palmitate/10% bovine serum albumin (BSA) and 9 mM oleate/10% BSA were prepared by complexing an appropriate volume of stock solution to 10% BSA (FFA-free low endotoxin; Sigma-Aldrich, Bornem, Belgium) in a 55° C. water bath (15 min).

(86) Fat Loading and Compound Treatment

(87) HepG2 were plated at a density of 40000 cells/well into 384-well plates to assess lipid droplets content. The next day, cell-culture medium was removed, and cells were washed with PBS (Invitrogen cat #14190). HepG2 were deprived for 24 hours in serum-free medium. For the treatments with ELA, component and the respective ELA/component combinations, the serum-deprived HepG2 were pre-incubated for 24 hours with the compounds followed by the addition of an oleic:palmitic acids mixture (2:1) with a final concentration of 0.5 mM for an additional 24 hours period.

(88) Intra-Cellular Lipid Droplets Measurement

(89) To measure intracellular lipid droplets content, the cells were brought to room temperature and washed with 40 μL PBS. Cells were incubated 30 min at room temperature with 40 μL of diluted Adipored reagent (2.5 μL Adipored reagent per 200 μL PBS) (Lonza, Walkersville, Md.). The relative fluorescence was measured (k excitation at 485 nm, k emission at 580 nm) using a fluorescence spectrometer (Spark Tecan cat #30086376 SN #1801002745). The analyses were performed in quadruplicate.

(90) 5. Illustration in 3D Huh7 Spheroid Culture

(91) 3D Huh7 Spheroid Culture

(92) Cryopreserved Huh7 were purchased from ECACC. Cells were grown in ULA plates (Costar), William's medium (Sigma) containing 10% FBS (Gibco) at 37° C. in a humidified 5% CO2 cell culture incubator. Cells aggregated and formed spheroids within 5 days.

(93) Preparation of Compositions: 2 Components Combination Matrix

(94) For these experiments, a checkerboard matrix was generated. ELA and component (ii) stocks were serially diluted in DMSO in 2-points series in a row (ELA) and a 3-points series in a column (component (ii)) of a 96-well plate. Subsequently, the 2×3 combination matrix was generated by 1:1 mixing of all single agent concentrations.

(95) Metabolic Stimulation of 3D Huh7 Spheroid Culture and Compound Treatment

(96) 3D Huh7 spheroids were cultured under standard conditions, as described above. They were then deprived for 24 hours in serum-free medium. For the treatments with ELA, component (ii) and the respective ELA/component (ii) combinations, the serum-deprived spheroids were treated with both a metabolic NASH stimulus and the compounds (Day 0) followed by the renewal of the metabolic NASH stimulus and the compounds at Day 4 for an additional 3 days period. The spheroids were stained for lipid accumulation at Day 7.

(97) Lipids Staining & Quantification

(98) Intracellular lipid accumulation was quantified using the ADIPORED Assay Reagent (Lonza). Spheroids were subjected to fluorescence assay quantification at λexc: 485 nm and λem: 572 nm, using fluorescence plate reader (TECAN).

(99) Results and Discussion

(100) The abnormal persistence of differentiated myofibroblasts is a characteristic of many fibrotic diseases. Following liver injury, quiescent HSCs undergo a process of activation that is characterized by a differentiation into (α-SMA)-positive myofibroblasts. The PPAR agonist elafibranor has an antifibrotic activity in hHSC activated with the profibrogenic cytokine TGFβ1 (FIG. 9). It is herein surprisingly shown that combinations of MSDC-0602, PXS-4728, Apararenone, CF-102 (Namodenoson), Vismodegib, PBI-4050, emricasan, DUR-928, VK-2809 or KD-025 with elafibranor synergistically inhibited α-SMA production by HSC (FIG. 9).

(101) Since the liver is composed of different cell types (hepatocytes, immune cells, HSC) and as HSC activation can result from different stimuli involving the other hepatic cells, a liver microtissue model was also employed to test combination treatments on fibrosis. Treatment with a metabolic NASH stimulus increased collagen production by the microtissue. In this model, Elafibranor synergized with CP-640186, GS-0976 and Nalmefene to inhibit collagen production (FIG. 10).

(102) Taken together these results show synergistic antifibrotic effects of the combinations of elafibranor with MSDC-0602, PXS-4728, Apararenone, CF-102 (Namodenoson), Vismodegib, PBI-4050, emricasan, DUR-928, VK-2809, KD-025, CP-640186, GS-0976 or Nalmefene (JKB-121).

(103) Metabolic diseases such as NAFLD/NASH are associated with low-grade inflammation. Activation of immune cells produces cytokines that alter the metabolic functions of the liver and peripheral organs (adipose tissue, pancreas). Gut permeability, described in metabolic and hepatic diseases, results in increased circulating bacterial components (lipopolysaccharides or LPS) that activate macrophages in the liver and peripheral organs (adipose tissue). Since PPARs have anti-inflammatory activities, we investigated whether elafibranor and other compounds, could inhibit macrophage activation by LPS. In a model of THP1 monocytes differentiated into macrophages, LPS treatment activates macrophages, as measured by TNFα secretion. Elafibranor (1 μM) alone inhibited TNFα by 21% (FIG. 11). Surprisingly, the combination of elafibranor with gemcabene potently inhibited TNFα secretion by 50% (FIG. 11). Therefore, this result shows the capacity of elafibranor to synergize with other compounds to reduce the inflammatory tone observed in a number of diseases, including NASH and metabolic diseases.

(104) NAFLD/NASH is characterized by primary fat accumulation in hepatocytes (steatosis), which induces lipotoxicity, leading to inflammation, cell death, tissue remodeling and eventually fibrosis. As PPARα and PPARδ are known to induce fat oxidation and inhibit de novo lipogenesis, we wanted to see whether elafibranor combined with other compounds could prevent fat accumulation in hepatocytes. Therefore, HepG2 cells were treated with free fatty acid (FFA) to induce accumulation of lipid droplets. In this model, elafibranor (10 μM) alone reduced fat accumulation by 20%. Unexpectedly, the reduction reached 40% when elafibranor was combined to CP-640186, VK-2809, Apararenone or Aramchol (FIG. 12).

(105) A tridimensional (3D) vitro model of hepatocytes was also employed to address this question, allowing a more physiological reproduction of the liver architecture. In this model, fat accumulation was obtained by treatment with a metabolic NASH stimulus. Elafibranor (3 μM) reduced fat content by 12% (FIG. 13). Combination of elafibranor with MGL-3196 (1 μM) potently reduced hepatocyte lipid content by 28% (FIG. 13), showing a synergistic effect when both drugs were used together.

(106) Taken together, these results show that elafibranor synergizes with CP-640186, VK-2809, Apararenone, Aramchol and MGL-3196, in particular to reduce steatosis.

(107) In conclusion, these results show the capacity of elafibranor to synergize with MSDC-0602, PXS-4728, Apararenone, CF-102 (Namodenoson), Vismodegib, PBI-4050, emricasan, DUR-928, KD-025, CP-640186, GS-0976, Nalmefene (JKB-121), VK-2809, MGL-3196, and Aramchol, in particular to reduce NAFLD.

Example 2: Combination of ELA and OCA

(108) Materials and Methods

(109) Evaluation of Elafibranor, OCA and the combination Elafibranor+OCA in a chronic CDAA+1% cholesterol model (12 weeks).

(110) The preventive effects of Elafibranor alone, OCA alone and the combination of both were assessed in a fibrosing NASH-model of rats fed a CDAA+1% cholesterol diet. 150-175 g male Wistar rats were fed a control (CSAA) diet, CDAA+1% cholesterol diet, or CDAA+1% cholesterol diet supplemented with Elafibranor 1, 3 and 10 mg/kg/day, OCA 10 and 30 mg/kg/day or combined drugs (Elafibranor 1, 3 and 10 mg/kg/day combined to OCA 10 mg/kg/day) for 12 weeks.

(111) The body weight and the food intake were monitored twice per week. On the last day of treatment, rats were sacrificed after a 6 h fasting period. The liver was rapidly excised for biochemical and histological studies.

(112) All animal procedures were performed according to standard protocols and in accordance with the standard recommendations for the proper care and use of laboratory animals.

(113) Histology

(114) Tissue Embedding and Sectioning:

(115) The liver slices were first fixed for 12 hours in formalin 4% solution. Then, the liver pieces were washed 30 minutes in PBS, and dehydrated in ethanol solutions (successive baths at 70, 80, 95 and 100% ethanol). The liver pieces were incubated in three different baths of Xylene (Sigma-Aldrich cat #534056), followed by two baths in liquid paraffin (56° C.). Liver pieces were then put into racks that were gently filled with HISTOWAX to completely cover the tissue.

(116) The paraffin blocks containing the tissue pieces were removed from the racks and stored at room temperature. The liver blocks were cut into 3 μm slices.

(117) Hematoxylin/Eosin Staining

(118) Liver sections were deparaffinized, rehydrated and incubated for 3 minutes in Mayer's Hematoxylin (Microm, cat #F/C0303). Then, the liver sections were rinsed in water and incubated 1 minute in Eosin G (VWR, cat #1.09844.1000). Sections were rinsed in water then dehydrated, and mounted using the CV Mount medium (Leica, cat #14046430011).

(119) Picrosirius Red Staining

(120) Liver sections were deparaffinized, rehydrated and incubated for 15 minutes in a solution of Fast Green FCF 0.1% (Sigma-Aldrich, cat #F7258) before rinsing in a bath of 0.5% acetic acid (Panreac, cat #131008.1611). Then, the liver sections were rinsed in water and incubated 30 minutes in a solution of 0.1% sirius red (Direct Red 80, Fluka cat #43665) in saturated aqueous picric acid (Sigma-Aldrich cat #P6744). Sections were then dehydrated, and mounted using the CV Mount medium (Leica, cat #14046430011).

(121) Histological Examinations

(122) A technician blinded to the source of each liver specimen performed histological examinations. Virtual slides were generated using the Pannoramic 250 scanner from 3D Histech. For each animal, a score summarizing the main histological lesions of NASH was attributed according to the NASH Clinical Research Network (Kleiner 2005, Brunt 1999). Briefly, steatosis, lobular inflammation and hepatocytes ballooning were scored. The NAFLD Activity Score (NAS score) was established for each individual as the unweighted sum of the steatosis (0-3), lobular inflammation (0-3) and the ballooning (0-2) injury grading.

(123) Using Quant Center software (3D Histech, including Pattern Quant and Histo Quant modules), collagen-stained areas were quantified. Briefly, Pattern Quant was used to detect the tissue and measure its surface. Then, Histo Quant was used to detect the stained collagen content and measure its surface, based on a color threshold method. The fibrosis area was then expressed as the percentage of the collagen surface to the whole tissue per animal.

(124) Measurement of Hepatic Collagen Content

(125) The hepatic collagen content was determined using the appropriate QuickZyme kit (Total collagen assay, cat #QZB-totcol2). The assay is based on the detection of hydroxyproline, which is a non-proteinogenic amino acid mainly found in the triple helix of collagen. Thus, hydroxyproline in tissue hydrolysates can be used as a direct measure of the amount of collagen present in the tissue (without discrimination between procollagen, mature collagen and collagen degradation products).

(126) Complete hydrolysis of tissue samples in 6M HCl at 95° C. is required before dosing the hydroxyproline. The assay results in the generation of a chromogen with a maximum absorbance at 570 nm. Results are expressed as mg of collagen/g of liver.

(127) Alpha 2 Macroglobuline (α2M)

(128) The plasmatic concentration of α2M was determined using the Abcam kit (cat #ab157730), according to the manufacturer's instructions. Briefly, the microplate is pre-coated with an antibody specific for rat α 2M. Standards, controls, and samples are then pipetted into the wells and any α 2M present in the plasma is bound by the immobilized antibody. After washing, a horseradish peroxidase labeled secondary antibody is added to the wells. Following a wash, a substrate solution is added to the wells. The enzyme reaction is stopped by adding the Stop Solution. The intensity of the color measured at 450 nm is proportional to the amount of α 2M bound in the initial step. The sample values are then deduced from the standard curve. Results are expressed in ng/mL.

(129) Procollagen III N-Terminal Propeptide (PIIINP)

(130) The plasmatic concentration of PIIINP was determined using an ELISA assay from Cloud-Clone Corp (cat #SEA573Ra), according to the manufacturer's instructions. The microtiter plate is pre-coated with an antibody specific to PIIINP. Standards or samples are added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to PIIINP. Next, Avidin conjugated to Horseradish Peroxidase (HRP) is added to each microplate well and incubated. After TMB substrate solution is added, only those wells that contain PIIINP, biotin-conjugated antibody and enzyme-conjugated Avidin will exhibit a change in color. The enzyme-substrate reaction is terminated by the addition of sulphuric acid solution and the color change is measured spectrophotometrically at a wavelength of 450 nm±10 nm. The concentration of PIIINP in the samples is then determined by comparing the OD of the samples to the standard curve. Results are expressed in pg/mL.

(131) Hepatic Gene Expression Analysis

(132) Total RNA was isolated from rat livers using RNeasy Mini Kit (Qiagen) following manufacturer's instructions. Total RNA were reverse transcribed into cDNA using M-MLV RT (Moloney Murine Leukemia Virus Reverse Transcriptase) (Invitrogen cat #28025) in 1×RT buffer (Invitrogen), 0.5 mM DTT (Invitrogen), 0.18 mM dNTPs (Promega), 200 ng pdN6 (Amersham) and 30 U of RNase inhibitor (Promega).

(133) Quantitative PCR was then carried out using the CFX96 TOUCH Real-Time PCR Detection System (Biorad). Briefly, the PCR reactions were performed in 96-WP format in 25 μl of total volume containing 1 μL of reverse transcription reaction, 0.5 μL of reverse and forward primers (10 pmol each), and 12.5 μl of 2×iQ SYBR Green Supermix (BioRad), using the following primer sequences:

(134) TABLE-US-00001 Gene Forward Reverse RPLP0 CATGCTCAACATCTCCCCCT GGGAAGGTGTAATCCGTCTC TCTCC CACAG (SEQ ID NO: 1) (SEQ ID NO: 2) αSMA ACTGGGACGACATGGAAAAG CATCTCCAGAGTCCAGCACA (ACTA2) (SEQ ID NO: 3) (SEQ ID NO: 4) TIMP1 TCCCCAGAAATCATCGAGAC TCAGATTATGCCAGGGAACC (SEQ ID NO: 5) (SEQ ID NO: 6) TGFB1 TGAGTGGCTGTCTTTTGACG TGGGACTGATCCCATTGATT (SEQ ID NO: 7) (SEQ ID NO: 8) CCR5 CAGAACAGTCAACTTTGGGG ACGTGGAAAATGAGGACTGC (SEQ ID NO: 9) (SEQ ID NO: 10)

(135) Expression levels were normalized using the expression of RPLP0 gene as a housekeeping gene of reference in samples. For each gene, the standard curves were drawn by selecting the best points (at least three points) in order to have PCR reaction efficiency close to 100% and a correlation coefficient close to 1. Expression levels were determined using the standard curve equation for both the housekeeping gene and the target gene (taking into account the specific PCR efficiency of each target gene).

(136) Results and Discussion

(137) The results are reported in the following table and in FIGS. 1-5.

(138) TABLE-US-00002 GFT505 OCA GFT505 + 3 mg/kg/d 10 mg/kg/d OCA Fibrosis surface  34% ± 17%***  74% ± 45% 19% ± 4% # Hepatic collagen  45% ± 12%***  67% ± 23%** 34% ± 5% # content αSMA mRNA level  66% ± 27% 109% ± 68% 39% ± 18% # TIMP1 mRNA level  78% ± 23% 110% ± 43% 46% ± 13% ## TGFβ1 mRNA level  94% ± 20% 110% ± 23% 67% ± 16% ## CCR5 mRNA level.sup.+ 103% ± 51%  81% ± 28% 56% ± 17% # Percentage over the untreated CDAA + 1% cholesterol rats **p < 0.01, ***p < 0.001 vs CDAA + 1% cholesterol group (ANOVA + Bonferroni) # p < 0.05, ## p < 0.01 vs the best single agent (Student t-test) (.sup.+marker of inflammation)

(139) Western life style is invariably linked with high incidence rate of non-alcoholic steatohepatitis (NASH), a chronic liver disease that often progresses to liver fibrosis and cirrhosis and may ultimately lead to hepatocellular carcinoma. Currently, there is no approved therapy for NASH. Drug combinations directed simultaneously at multiple therapeutic targets have the potential to dramatically improve the drug response and to benefit the widest patient population. Drug combinations were previously tested in other systemic diseases, such as hypertension, dyslipidemia or type 2 diabetes and showed better control of the underlying diseases and decreased the morbidity and the mortality. In recent phase 2B studies, both elafibranor (PPAR α/δ agonist) and OCA (FXR agonist) have shown efficacy on NASH and fibrosis endpoints. We wanted to compare their action on relevant NASH pathology outcomes, and to look for therapeutic benefits of the combination.

(140) To achieve this aim, NASH histology and fibrosis were induced by feeding Wistar rats with a choline-deficient L-amino-acid-defined-diet that was supplemented with cholesterol (CDAA/chol diet). Animals in the intervention groups, received either elafibranor or OCA or both compounds for the entire study period. NASH and fibrosis development were evaluated by histology. Additional biochemical and molecular analyses were also performed on different relevant biomarkers.

(141) Wistar rats fed on the CDAA/chol diet developed NASH-related histology and fibrosis with high penetration of severe disease. Advanced steatosis, lobular inflammation and ballooning were present in all animals and NAS score varied between 6 and 8. Hepatic histology (picrosirius positive area) and biochemistry (hepatic collagen concentration) showed on average a fourfold increase in hepatic fibrosis content and fibrosis score was either 3 or 4 for all the animals on the CDAA/c diet that received no drug treatment. The expression of genes related to inflammation, oxidative stress, tissue remodeling and fibrosis was increased and consistent with gene signatures that were previously reported in NASH patients with severe disease.

(142) Elafibranor and OCA administration alone resulted in a very significant attenuation of fibrosis development. Similar efficacy on fibrosis was observed in animals that received both compounds, although at significantly lower doses. Hepatocyte damage, as judged by ballooning, was prevented or attenuated by elafibranor, in a dose-dependent manner. Instead, OCA has only showed partial ballooning attenuation at the doses that were used in this study. Lobular inflammation was attenuated by elafibranor in a dose-dependent manner and to a lesser extent with OCA. Finally, the administration of either drug candidate alone has partially attenuated the increase of tissue remodeling, inflammation and oxidative stress markers and the combination of both compounds was more efficient as compared to any single agent.

(143) Therefore, it is herein shown that the synergistic action of elafibranor and OCA on liver fibrosis in the CDAA/c diet-induced NASH model produced a comparable therapeutic benefit at significantly lower doses of both drug candidates, as compared to any single agent. From this study, it is credibly expected that doses of both drug candidates can be lowered by a factor of at least 1.5, 2, 2.5 or even at least 3 to obtain the results similar to the initial dose of each compound used individually. In addition, elafibranor showed a clear protective effect on liver damage. The effects of the OCA on ballooning and lobular inflammation were rather modest in this model. From this study, it can be concluded that Elafibranor/OCA combination would benefit a wider patient population and the associated therapeutic dose reduction would decrease the incidence of adverse drug effects.

Example 3: Combination of ELA and CVC

(144) Materials and Methods

(145) Compounds were dissolved in dimethyl sulfoxide (DMSO, Fluka cat #41640). CVC was obtained commercially from CLINISCIENCES (Réf: A13643-10, Batch number: 497223-25-3).

(146) Bezafibrate was synthesized at Genfit.

(147) hHSC Culture

(148) The human primary hepatic stellate cells (hHSC) (Innoprot) were cultured in STeCM medium (ScienCell cat #5301) that was supplemented with 2% fetal bovine serum (FBS, ScienCell cat #0010), 1% penicillin/streptomycin (ScienCell cat #0503) and stellate cell growth supplement (SteCGS; ScienCell cat #5352). Cell-culture flasks were coated with Poly-L Lysine (Sigma cat #P4707) for a better adherence.

(149) Preparation of Compositions

(150) 2 Components Combination Matrix (Elafibranor/CVC)

(151) For these experiments, a checkerboard matrix was generated. CVC and Elafibranor stocks were serially diluted in DMSO in a 5-points series in a row (Elafibranor) and a 6-points series in a column (Cenicriviroc) of a 96-well plate. Subsequently, the 6×7 combination matrix was generated by 1:1 mixing of all single agent concentrations. The test concentrations for each compound were chosen based on the respective IC.sub.50 of each compound as single agent obtained by measuring α-SMA content in the HSC model stimulated with TGF-β1.

(152) Activation of hHSC with TGF-β1 and Compound Treatment

(153) The human primary hepatic stellate cells (hHSC) (Innoprot) were cultured under standard conditions, as described above. The cells were subsequently plated at a density of 2×10.sup.4 cells/well into 96-well plates for the measure of α-SMA by ELISA.

(154) The next day, cell-culture medium was removed, and cells were washed with PBS (Invitrogen cat #14190). hHSC were deprived for 24 hours in serum-free and SteCGS-free medium. For the treatments with CVC, Elafibranor, Bezafibrate and the pairwise combinations of CVC/Elafibranor and CVC/Bezafibrate, the serum-deprived hHSC were preincubated for 1 hour with the compounds followed by addition of the profibrogenic stimuli TGF-β1 (PeproTech cat #100-21, 1 ng/mL) in serum-free and SteCGS-free medium for an additional 48 hour period.

(155) α-SMA ELISA

(156) The level of α-SMA was measured using a Sandwich ELISA. Briefly, the wells of an ELISA plate were first coated with the capture antibody (mouse monoclonal anti-ACTA2, Abnova) at 4° C. overnight. After 3 washes in PBS+0.2% Tween 20, a blocking solution consisting of PBS+0.2% BSA was added for one hour followed by another washing cycle. The cell lysates were transferred into the wells for binding to the capture antibody for a period of 2 h at room temperature. After the washing procedure, the detection antibody (biotinylated mouse monoclonal anti-ACTA2, Abnova) was added for 2 hours at room temperature followed by 3 washes. For the detection, an HRP-conjugated Streptavidin (R&D Systems cat #DY998) was first applied for 30 min at room temperature. After washing, the HRP substrate TMB (BD, #555214) was added and incubated for 7 min at room temperature in the dark. Upon oxidation, TMB forms a water-soluble blue reaction product that becomes yellow with addition of sulfuric acid (solution stop), enabling accurate measurement of the intensity at 450 nm using a spectrophotometer. The developed color is directly proportional to the amount of α-SMA present in the lysate.

(157) Determination of Synergism by Excess Over Bliss (EOB) Method

(158) The values obtained in the α-SMA ELISA assays were first transformed into percentage inhibitions over TGF-β1 control. Then, using these percentage inhibitions, EOB (Excess Over Bliss) was determined to define the synergistic effects of drug combinations. Expected Bliss additivism score (E) was firstly determined by the equation: E=(A+B)−(A×B) where A and B are the percentage inhibition of Elafibranor (A) (or Bezafibrate) and Cenicriviroc (B) at a given dose. The difference between the Bliss expectation and the observed inhibition of the combined CVC/Elafibranor (or Bezafibrate) at the same dose is the ‘Excess over Bliss’ score. Excess over Bliss score=0 indicates that the combination treatment is additive (as expected for independent pathway effects); Excess over Bliss score>0 indicates activity greater than additive (synergy); and Excess over Bliss score<0 indicates the combination is less than additive (antagonism).

(159) For the combinations Elafibranor+CVC and Bezafibrate+CVC, an additional total Bliss score was calculated by summation of all EOB.

(160) To validate the synergism, the experimental values corresponding to top EOB score for CVC/Elafibranor combination were plotted in a bar graph.

(161) The significance of the observed differences between CVC/Elafibranor or CVC/Bezafibrate over the highest single agent was determined by a student's t-test. [*: p<0.05; **: p<0.01; ***: p<0.001]

(162) Results and Conclusions:

(163) The abnormal persistence of differentiated myofibroblasts is a characteristic of many fibrotic diseases.

(164) Following liver injury, quiescent HSCs undergo a process of activation that is characterized by a differentiation into (α-SMA)-positive myofibroblasts.

(165) The PPAR agonist Elafibranor reveals an antifibrotic activity in hHSC activated with the profibrogenic cytokine TGFβ1. The α-SMA marker was reduced by 80% with an IC.sub.50 of 3.17 μM (FIG. 6A). However, other PPAR agonists like bezafibrate showed a weak antifibrotic profile (FIG. 6C), suggesting that PPAR agonists are not equivalent regarding their antifibrotic properties. CVC alone did not show a significant effect at all doses in TGFβ-activated HSC (FIG. 6B). In order to evaluate if a combination of Elafibranor with CVC could reduce fibrosis in a synergistic manner, combination matrix experiments were performed in TGFβ-induced HSCs. Briefly, CVC and Elafibranor solutions were serially diluted in a checkerboard format generating a 42 combinations matrix covering a large panel of Elafibranor/CVC ratios. Synergy was first determined by calculating Excess Over Bliss scores. These experiments revealed that Elafibranor could synergize with CVC to reduce α-SMA production in activated HSCs (FIGS. 7A and 7B). One of the best example of synergy is shown in FIG. 7C with 5 μM of each compound. Although 5 μM of CVC alone does not show any antifibrotic activity, its addition to 5 μM of Elafibranor could significantly increase in a synergistic manner the activity of Elafibranor and reached up to 60% of inhibition (in comparison to 40% with 5 μM of Elafibranor). In contrast, the combination of CVC with bezafibrate revealed much lower EOB scores (FIGS. 8A and 8B) and none of the combinations gave statistically significant results.

(166) In conclusion, the applicant has discovered unexpected antifibrotic activities for a combination of a ELA and CVC. These results suggest that a combination of a compound of Formula (I) with a CVC can be synergistic and can provide therapeutic benefits in multiple types of diseases such as fibrotic diseases.

Example 4: Combinations of Elafibranor with Selonsertib (SEL), GKT-831 or GS-0976 (GS): Evaluation in a Mouse Fibrosing-NASH Model (8 Weeks)

(167) The preventive effects of the combinations of elafibranor with selonsertib, GKT-831 or GS-0976 were assessed in mice fed a choline-deficient, I-amino acid-defined diet (CDAA) supplemented with 2% cholesterol, 30% milk fat diet and high fructose corn syrup 55 (55% fructose/45% glucose for a final concentration of 42 g/L) in drinking water (Mells et al J Nutr Biochem 2015) (CDFF diet). 5-6 weeks old male C57Bl/6J mice were fed a control (CSAA) diet (n=4), CDFF (n=12), or CDFF supplemented with elafibranor (1 or 3 mg/kg/day), selonsertib (30 mg/kg/day), GKT-831 (60 mg/kg/day) or GS-0976 (10 mg/kg/day) alone or in combination (n=8 per group) for 8 weeks.

(168) The body weight, the food and water intake were monitored twice per week. On the last day of treatment, plasma samples were obtained from retro-orbital blood sampling and mice were sacrificed after a 6 h-fasting period. The liver was rapidly excised for biochemical and histological analyses. All animal procedures were performed according to standard protocols and in accordance with the standard recommendations for the proper care and use of laboratory animals.

(169) Histology

(170) Tissue Embedding and Sectioning

(171) The liver slices were fixed in a formalin 4% solution. Then, the liver pieces were washed 30 minutes in PBS, and dehydrated in ethanol solutions (successive baths at 70, 80, 95 and 100% ethanol). The liver pieces were incubated in three different baths of Xylene (Honeywell cat #534056), followed by two baths in liquid paraffin (59° C.). Liver pieces were then put into racks that were gently filled with HISTOWAX to completely cover the tissue.

(172) The paraffin blocks containing the tissue pieces were removed from the racks and stored at room temperature. The liver blocks were cut into 3 μm slices.

(173) Hematoxylin/Eosin/Safranin Staining

(174) Liver sections were deparaffinized, rehydrated and incubated for 3 minutes in Mayer's Hematoxylin (Microm, cat #F/C0303). Then, the liver sections were rinsed in water and incubated 1 minute in a Eosin Y 0.5% alcoholic (VWR, cat #1.02439.0500) and Erythrosin 0.5% solution (VWR, cat #1.15936.0010), and rinsed in with ethanol. Sections were then incubated for 2 minutes in Safranin, and were eventually dehydrated and mounted using the CV Mount medium (Leica, cat #046430011).

(175) Picrosirius Red Staining

(176) Liver sections were deparaffinized, rehydrated and incubated for 15 minutes in a solution of Fast Green FCF 0.1% (Sigma-Aldrich, cat #F7258) before rinsing in a bath of 0.5% acetic acid (Panreac, cat #131008.1611). Then, the liver sections were rinsed in water and incubated 30 minutes in a solution of 0.1% sirius red (Direct Red 80, Fluka cat #43665) in saturated aqueous picric acid (Sigma-Aldrich cat #P6744). Sections were then dehydrated, and mounted using the CV Mount medium (Leica, cat #14046430011).

(177) Histological Examinations

(178) A technician blinded to the source of each liver specimen performed histological examinations. Virtual slides were generated using the Pannoramic 250 scanner from 3D Histech. For each animal, a score summarizing the main histological lesions of NASH was attributed according to the NASH Clinical Research Network (Kleiner 2005, Brunt 1999). Briefly, steatosis, lobular inflammation and hepatocyte ballooning were scored. The NAFLD Activity Score (NAS) was established for each individual as the unweighted sum of the steatosis (0-3), lobular inflammation (0-3) and the ballooning (0-2) injury grading.

(179) Using Quant Center software (3D Histech, including Pattern Quant and Histo Quant modules), collagen-stained areas were quantified. Briefly, Pattern Quant was used to detect the tissue and measure its surface. Then, Histo Quant was used to detect the stained collagen content and measure its surface, based on a color threshold method. The fibrosis area was then expressed as the percentage of the collagen surface to the whole tissue per animal.

(180) Biochemical Analyses of the Livers

(181) Measurement of Hepatic Collagen Content

(182) The hepatic collagen content was determined using the appropriate QuickZyme kit (Total collagen assay, cat #QZB-totcol2). The assay is based on the detection of hydroxyproline, which is a non-proteinogenic amino acid mainly found in the triple helix of collagen. Thus, hydroxyproline in tissue hydrolysates can be used as a direct measure of the amount of collagen present in the tissue (without discrimination between procollagen, mature collagen and collagen degradation products).

(183) Complete hydrolysis of tissue samples in 6M HCl at 95° C. is required before dosing the hydroxyproline. The assay results in the generation of a chromogen with a maximum absorbance at 570 nm. Results are expressed as mg of collagen/g of liver.

(184) Measurement of Hepatic Triglyceride Content

(185) Approximately 100 mg of frozen liver tissue were homogenized with a tissue homogenizer (PRECELLYS24, Bertin Technologies, France) in 150 mM NaCl buffer, containing 15.4 mM NaN3. Lipid fractions in homogenates were extracted with chloroform-methanol (2:1, v/v) followed by measurement of the triglycerides (Biolabo cat #80019).

(186) Plasma Procollagen III N-Terminal Propeptide (PIIINP) Measurement

(187) The plasmatic concentration of PIIINP was determined using an ELISA assay from Cloud-Clone Corp (cat #SEA573Mu), according to the manufacturer's instructions. The microtiter plate is pre-coated with an antibody specific to PIIINP. Standards or samples are added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to PIIINP. Next, Avidin conjugated to Horseradish Peroxidase (HRP) is added to each microplate well and incubated. After TMB substrate solution is added, only those wells that contain PIIINP, biotin-conjugated antibody and enzyme-conjugated Avidin will exhibit a change in color. The enzyme-substrate reaction is terminated by the addition of sulphuric acid solution and the color change is measured spectrophotometrically at a wavelength of 450 nm±10 nm. The concentration of PIIINP in the samples is then determined by comparing the OD of the samples to the standard curve. Results are expressed in pg/mL.

(188) Plasma Tissue Inhibitor of Matrix Metalloproteinases 1 (TIMP-1) Measurement

(189) The plasma TIMP-1 levels were measured using a quantitative sandwich ELISA assay from R&D Systems (cat #MTM100) according to the experimental protocol PRO_LIDO_000020. Briefly, a monoclonal antibody specific for mouse TIMP-1 has been pre-coated onto a microplate. Standards, control, and samples are pipetted into the wells and any mouse TIMP-1 present is bound by the immobilized antibody. After washing away any unbound substances, an enzyme-linked polyclonal antibody specific for mouse TIMP-1 is added to the wells. Following a wash to remove any unbound antibody-enzyme reagent, a substrate solution is added to the wells. The enzyme reaction yields a blue product that turns yellow when the Stop Solution is added. The intensity of the color measured is in proportion to the amount of mouse TIMP-1 bound in the initial step. The sample values are then calculated from the standard curve. Results are expressed in pg/ml.

(190) Hepatic Gene Expression Analysis

(191) Total RNA was isolated from mouse livers using RNeasy Mini Kit (Qiagen) following manufacturer's instructions. Total RNA were reverse transcribed into cDNA using M-MLV RT (Moloney Murine Leukemia Virus Reverse Transcriptase) (Invitrogen cat #28025) in 1×RT buffer (Invitrogen), 0.5 mM DTT (Invitrogen), 0.18 mM dNTPs (Promega), 200 ng pdN6 (Amersham) and 30 U of RNase inhibitor (Promega).

(192) Quantitative PCR was then carried out using the CFX96 TOUCH Real-Time PCR Detection System (Biorad). Briefly, the PCR reactions were performed in 96-WP format in 25 μl of total volume containing 1 μL of reverse transcription reaction, 0.5 μL of reverse and forward primers (10 pmol each), and 12.5 μl of 2×iQ SYBR Green Supermix (BioRad), using the following primer sequences:

(193) TABLE-US-00003 Gene Forward Reverse GAPDH TATGACTCCACTCACGGCAA TCCACGACATACTCAGCACC (SEQ ID NO: 11) (SEQ ID NO: 12) Col1α1 AGGCGAACAAGGTGACAGAG GCCAGGAGAACCAGCAGAG (SEQ ID NO: 13) (SEQ ID NO: 14) TGFβ1 TTGCTTCAGCTCCACAGAGA TGGTTGTAGAGGGCAAGGAC (SEQ ID NO: 15) (SEQ ID NO: 16) CCR2 TAATATGTTACCTCAGTTCA TGCTCTTCAGCTTTTTACAG TCCACGG CCTATC (SEQ ID NO: 17) (SEQ ID NO: 18) MMP2 TCCCTAAGCTCATCGCAGAC GCTTCCAAACTTCACGCTCT (SEQ ID NO: 19) (SEQ ID NO: 20) TNFα CGTGGAACTGGCAGAAGAGG AGACAGAAGAGCGTGGTGGC (SEQ ID NO: 21) (SEQ ID NO: 22)

(194) Expression levels were normalized using the expression of GAPDH gene as a housekeeping gene of reference in samples. For each gene, the standard curves were drawn by selecting the best points (at least three points) in order to have PCR reaction efficiency close to 100% and a correlation coefficient close to 1. Expression levels were determined using the standard curve equation for both the housekeeping gene and the target gene (taking into account the specific PCR efficiency of each target gene).

(195) Results and Conclusions:

(196) In recent clinical studies, elafibranor, selonsertib, GKT-831 and GS-0976 have shown efficacy on NASH and fibrosis endpoints. We wanted to compare their action on relevant NASH pathology outcomes, and to look for therapeutic benefits of the combination. To achieve this aim, NASH was induced by feeding C57Bl/6J mice with a choline-deficient L-amino acid-defined diet supplemented with cholesterol and milk fat, and high fructose corn syrup in drinking water (CDFF diet). Animals in the intervention groups received either elafibranor, selonsertib, GKT-831 or GS-0976 alone or in combination with elafibranor, for the entire study period. NASH development was evaluated by histology and biochemical measurements and hepatic expression of genes involved in pathways relevant for NASH pathology.

(197) CDFF-fed mice developed NASH with high penetration of severe disease. Advanced steatosis and lobular inflammation were present in all animals resulting in a high NAS score of 6 or 7 (FIG. 15-C). The expression of genes related to fibrogenesis, tissue remodeling and inflammation was increased and consistent with gene signatures that were previously reported in NASH patients with severe disease (FIG. 14-E-I).

(198) In this model, elafibranor (3 mg/kg/day) improves NASH histology by reducing steatosis and hepatic lobular inflammation resulting in a global reduction of the NAFLD activity score (not shown). Elafibranor also decreases the expression of genes related to inflammation, tissue remodeling and fibrogenesis (FIG. 14-E-I) resulting in marked reduction of hepatic fibrosis assessed by histology, hepatic collagen content and release of PIIINP and TIMP-1 in the blood (FIG. 14-A-D).

(199) Selonsertib (30 mg/kg/day) alone improved hepatic fibrosis in this model, albeit to a minor extent than elafibranor (FIG. 14). The combination of elafibranor (3 mg/kg/day) and selonsertib (30 mg/kg/day) resulted in a synergistic beneficial effect on hepatic fibrosis (assessed by histology, hepatic collagen content and release of PIIINP and TIMP-1) as well as on hepatic expression of genes involved in fibrogenesis, tissue remodeling and inflammation (FIG. 14).

(200) GKT-831 (60 mg/kg/day) alone had no beneficial effect on NASH and fibrosis in this model. However, when combined to a suboptimal dose of elafibranor (1 mg/kg/day), it reduced hepatic inflammatory infiltrates, the NAFLD activity score and fibrosis (FIG. 15).

(201) Treatment with GS-0976 (30 mg/kg/day) had a mild beneficial effect on liver fat and body weight in this model (FIG. 16). However, the combination with elafibranor at a suboptimal dose (1 mg/kg/day) led to a synergistic effect on whole body fat burning leading to 20% body weight loss and a spectacular decrease in liver steatosis and triglyceride content (FIG. 16).

(202) In conclusion, we found synergistic effects between elafibranor and MSDC-0602, PXS-4728, MT-3995 (Apararenone), CF-102 (Namodenoson), Vismodegib, PBI-4050, Gemcabene, CP-640186, GS-0976, JKB-121 (Nalmefene), VK-2809, MGL-3196, Aramchol, Emricasan, DUR-928 (25-hydroxycholesterol-3-sulfate), Selonsertib, KD-025, or GKT-831.

REFERENCES

(203) Brunt E M et al, 1999, Am J Gastroenterol; 94(9):2467-74 Kleiner D E et al, 2005, Hepatology; 41(6):1313-21