Non-replicative transduction particles and transduction particle-based reporter systems

09771622 ยท 2017-09-26

Assignee

Inventors

Cpc classification

International classification

Abstract

Methods and systems are provided for packaging reporter nucleic acid molecules into non-replicative transduction particles for use as reporter molecules. The non-replicative transduction particles can be constructed from viruses and use viral transduction and replication systems. The reporter nucleic acid molecules include a reporter gene, such as a reporter molecule or selectable marker, for detecting target genes or cells. Methods and systems are provided for detection of cells and target nucleic acid molecules using the non-replicative transduction particles as reporter molecules.

Claims

1. A method for producing and collecting a plurality of non-replicative transduction particles (NRTPs), comprising: (a) inducing a lytic phase of the bacterial cell packaging system, wherein said bacterial cell packaging system comprises: a host bacteria cell; a first nucleic acid construct inside the host bacteria cell, comprising of a bacteriophage genome having a first bacteriophage gene that contains a non-functional packaging initiation site sequence, wherein the non-functional packaging initiation site sequence prevents packaging of the bacteriophage genome into the NRTP; and a second nucleic acid construct inside the host bacteria cell and separate from the first nucleic acid construct, comprising of a reporter nucleic acid molecule having a reporter gene and a second bacteriophage gene that contains a functional packaging initiation site sequence for facilitating packaging of a replicon of the reporter nucleic acid molecule into the NRTP, wherein the functional packaging initiation site sequence within the bacteriophage gene on the second nucleic acid construct complements the non-functional packaging initiation site sequence in the bacteriophage genome on the first nucleic acid construct; (b) allowing the replicon of the reporter nucleic acid molecule to be packaged to produce the NRTPs; and (c) collecting a lysate comprising the plurality of NRTPs.

2. The method of claim 1, wherein the lysate is stable at room temperature.

3. The method of claim 1, wherein the reporter gene is luxAB.

4. The method of claim 1, wherein the reporter gene is operatively linked to a constitutive promoter.

5. The method of claim 4, wherein the constitutive promoter is a Staphylococcus aureus (S. aureus) clpB promoter.

6. The method of claim 4, wherein the constitutive promoter is an Enterobacteriaceae -lactamase gene bla promoter.

7. The method of claim 1, wherein the reporter nucleic acid molecule is a plasmid comprising at least one origin of replication.

8. The method of claim 7, wherein the at least one origin of replication is a pT181-derived origin of replication.

9. The method of claim 7, wherein the at least one origin of replication is a pBBR1-derived origin of replication.

10. The method of claim 1, wherein the bacteriophage is 80.

11. The method of claim 1, wherein the bacteriophage is P1.

12. A method for detecting a presence or an absence of a bacterial cell in a sample, comprising: (a) contacting the sample with a lysate comprised of a plurality of non-replicative transduction particles (NRTPs) such that the plurality of NRTPs transduces one or more of the bacterial cells in the sample, wherein the plurality of NRTPs are produced by (i) inducing a lytic phase of a bacterial cell packaging system, wherein said bacterial cell packaging system comprises: a host bacteria cell; a first nucleic acid construct inside the host bacteria cell, comprising of a bacteriophage genome having a first bacteriophage gene that contains a non-functional packaging initiation site sequence, wherein the non-functional packaging initiation site sequence prevents packaging of the bacteriophage genome into the NRTP; and a second nucleic acid construct inside the host bacteria cell and separate from the first nucleic acid construct, comprising of a reporter nucleic acid molecule having a reporter gene and a second bacteriophage gene that contains a functional packaging initiation site sequence for facilitating packaging of a replicon of the reporter nucleic acid molecule into the NRTP, wherein the functional packaging initiation site sequence within the bacteriophage gene on the second nucleic acid construct complements the non-functional packaging initiation site sequence in the bacteriophage genome on the first nucleic acid construct; (ii) allowing the replicon of the reporter nucleic acid molecule to be packaged to produce the NRTPs; (b) providing conditions for expression of the reporter gene; and (c) detecting the presence or absence of a signal produced by the reporter gene, wherein the presence of the signal indicates the presence of the bacteria cell, and wherein the absence of the signal indicates the absence of the bacteria cell.

13. The method of claim 12, wherein the bacterial cell is Staphylococcus aureus (S. aureus).

14. The method of claim 12, further comprising providing an antimicrobial agent to the sample and detecting for the presence or absence of a signal produced by the reporter gene to determine whether the sample contains a cell that is resistant or susceptible to the antimicrobial agent.

15. The method of claim 1 wherein the second bacteriophage gene is a terminase gene.

16. The method of claim 12 wherein the second bacteriophage gene is a terminase gene.

17. The method of claim 16 wherein the terminase gene is a 80 small terminase (terS) gene.

18. The method of claim 16 wherein the terminase gene is a P1 pacA terminase gene.

19. The method of claim 15, wherein the terminase gene is a 80 small terminase (terS) gene.

20. The method of claim 15, wherein the terminase gene is a P1 pacA terminase gene.

Description

BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWINGS

(1) These and other features, aspects, and advantages of the present invention will become better understood with regard to the following description, and accompanying drawings, where:

(2) FIG. 1 illustrates an example of the design and function of the silent mutation/complementation-based P1 plasmid packaging system, according to an embodiment of the invention.

(3) FIG. 2 illustrates a schematic of the pGWP10001 vector, according to an embodiment of the invention.

(4) FIG. 3 illustrates an example of the design and function of a pac-site deletion/complementation plasmid packaging system, according to an embodiment of the invention.

(5) FIG. 4 illustrates a schematic of the pGW80A0001 vector, according to an embodiment of the invention.

(6) FIG. 5 depicts the process for genomic island (GI) packaging by a bacteriophage, according to an embodiment of the invention.

(7) FIG. 6 depicts an example of the design and function of a GI-based packaging system, according to an embodiment of the invention.

(8) FIG. 7 depicts the design and function of a GI-based packaging system that lacks the integrase gene, according to an embodiment of the invention.

(9) FIG. 8 depicts the design and function of a SaPIbov2-based packaging system that lacks the integrase gene, according to an embodiment of the invention.

(10) FIG. 9 depicts a system for the use of NRTPs for the detection of inducers to target gene promoters within viable cells, according to an embodiment of the invention.

(11) FIG. 10 depicts a reporter system that includes a reporter nucleic acid molecule (e.g., plasmid) that is constructed for detecting VanR, the inducer of the promoter of the vancomycin resistance (vanA) gene in Enterococcus faecium (or E. faecalis), according to an embodiment of the invention. The reporter plasmid carries a reporter gene that is operatively linked to the vanA gene promoter.

(12) FIG. 11 depicts a reporter system that includes a reporter nucleic acid molecule constructed for detecting TcdD, the inducer of the promoters of the toxins A and B genes (tcdA and tcdB, respectively) of C. difficile, according to an embodiment of the invention. The reporter nucleic acid molecule includes a reporter gene that is operatively linked to the tcdA gene promoter.

(13) FIG. 12 depicts a reporter system that includes a reporter nucleic acid molecule is constructed for detecting SarS, the inducer of the promoter of the Protein A gene (spa) in S. aureus, according to an embodiment of the invention. The reporter nucleic acid molecule includes the bacterial luciferase genes luxA and luxB operatively linked to the spa gene promoter (P.sub.spa).

(14) FIG. 13 shows a reporter system that comprises a system for the detection of intracellular enzymes within viable cells that employs caged substrate molecules that can be un-caged by a target intracellular enzyme, according to an embodiment of the invention.

(15) FIG. 14 depicts the design and function of a -lactamase enzyme detection system, according to an embodiment of the invention.

(16) FIG. 15 shows a reporter system for the detection of intracellular molecules within viable cells that employs switchable molecules capable of generating a detectable signal upon their binding to a target molecule, according to an embodiment of the invention.

(17) FIG. 16 depicts the design and function of a bacteriophage/switchable-aptamer (SA)-based intracellular molecule reporter system, according to an embodiment of the invention.

(18) FIG. 17 depicts an example of a system that uses a cis-repression mechanism that can target the 5 UTR (untranslated region) of a reporter sequence on a reporter transcript, according to an embodiment of the invention.

(19) FIG. 18 shows an example of a system for detecting the presence of a target transcript in a cell that is based on a cis-repression mechanism targeting the ribosome binding site (RBS) of a reporter sequence in a reporter transcript, according to an embodiment of the invention.

(20) FIG. 19 illustrates an exemplary system for detecting the presence of a target transcript in a cell that is based on a cis-repression mechanism targeting the coding region (AUG) of a reporter sequence in a reporter transcript, according to an embodiment of the invention.

(21) FIG. 20 illustrates an example system for detecting the presence of a target transcript in a cell that is based on a repression mechanism using an unstable reporter transcript, according to an embodiment of the invention.

(22) FIG. 21 shows the results of the transduction assay in which 36 tetracycline-sensitive MRSA were exposed to transduction particles carrying pGW80A0001 and then were spotted onto media plates containing 5 ug/mL of tetracycline, according to an embodiment of the invention.

(23) FIG. 22 illustrates the luminescence measured from 80 clinical isolates of MRSA and 28 clinical isolates of methicillin sensitive S. aureus (MSSA) transduced with the transduction particle, according to an embodiment of the invention.

(24) FIG. 23 shows the results of S. aureus growth at 4, 8, 16, 32, 64, and 128 ug/mL of cefoxitin.

(25) FIG. 24 shows the RLU values obtained by the NRTP assay in the presence of 4, 8, 16, 32, 64, and 128 ug/mL cefoxitin. The x-axis in FIG. 24 is set at the MSSA RLU cutoff value.

(26) FIG. 25 shows a secondary structure of the mecA transcript generated based on the lowest energy conformation calculated by MFold and visualized with VARNA.

(27) FIG. 26 shows the terminal loop 23 (T23) of the mecA transcript (SEQ ID NO:23) that contains a YUNR consensus sequence.

(28) FIG. 27 depicts a cis-repressing sequence (SEQ ID NO: 24) added to the 5 terminus of the luxAB genes and designed to form a stem-loop structure that blocks the RBS sequence (AAGGAA) of the luxA gene.

(29) FIG. 28 shows a diagram of base pairing between the target transcript and the cis-repressing sequence of the reporter transcript.

(30) FIG. 29 shows an example of a target mecA gene sequence (SEQ ID NO: 15), according to an embodiment of the invention.

(31) FIG. 30 shows an exemplary mecA transcript sequence that can be used for designing a reporter transcript (SEQ ID NO:16), according to an embodiment of the invention.

(32) FIG. 31 is an example of a luxAB gene loci DNA sequence that can be used for designing a reporter transcript (SEQ ID NO: 17), according to an embodiment of the invention.

(33) FIG. 32 is an example of a luxAB transcript sequence that can be used for designing a reporter transcript (SEQ ID NO:18), according to an embodiment of the invention.

(34) FIG. 33 is an example of a luxAB cis-repressed transcript sequence that can be used in a reporter transcript (SEQ ID NO:19), according to an embodiment of the invention.

(35) FIG. 34 shows an example of a cell comprising a vector that encodes a reporter transcript, where there is no endogenous mecA transcript in the cell, according to an embodiment of the invention.

(36) FIG. 35 shows a vector introduced into a cell, where the vector encodes the reporter transcript, which includes a cis-repressing sequence and a reporter sequence (luxA and luxB genes). When the mecA transcript present in the cell binds to the cis-repressing sequence, the inhibitory hairpin loop opens up and the RBS for the luxA gene is exposed. Translation of the reporter sequences (luxA and luxB) can occur, resulting in the formation of a luxAB enzyme. The luxAB enzyme produces a detectable luminescent signal. In this manner, the transcript reporter vector reports the presence of endogenous mecA transcripts within a cell.

DETAILED DESCRIPTION OF THE INVENTION

I. Definitions

(37) Terms used in the claims and specification are defined as set forth below unless otherwise specified.

(38) As used herein, reporter nucleic acid molecule refers to a nucleotide sequence comprising a DNA or RNA molecule. The reporter nucleic acid molecule can be naturally occurring or an artificial or synthetic molecule. In some embodiments, the reporter nucleic acid molecule is exogenous to a host cell and can be introduced into a host cell as part of an exogenous nucleic acid molecule, such as a plasmid or vector. In certain embodiments, the reporter nucleic acid molecule can be complementary to a target gene in a cell. In other embodiments, the reporter nucleic acid molecule comprises a reporter gene encoding a reporter molecule (e.g., reporter enzyme, protein). In some embodiments, the reporter nucleic acid molecule is referred to as a reporter construct or nucleic acid reporter construct.

(39) A reporter molecule or reporter refers to a molecule (e.g., nucleic acid or protein) that confers onto an organism a detectable or selectable phenotype. The detectable phenotype can be colorimetric, fluorescent or luminescent, for example. Reporter molecules can be expressed from reporter genes encoding enzymes mediating luminescence reactions (luxA, luxB, luxAB, luc, mc, nluc), genes encoding enzymes mediating colorimetric reactions (lacZ, HRP), genes encoding fluorescent proteins (GFP, eGFP, YFP, RFP, CFP, BFP, mCherry, near-infrared fluorescent proteins), nucleic acid molecules encoding affinity peptides (His-tag, 3-FLAG), and genes encoding selectable markers (ampC, tet(M), CAT, erm). The reporter molecule can be used as a marker for successful uptake of a nucleic acid molecule or exogenous sequence (plasmid) into a cell. The reporter molecule can also be used to indicate the presence of a target gene, target nucleic acid molecule, target intracellular molecule, or a cell, as described herein. Alternatively, the reporter molecule can be a nucleic acid, such as an aptamer or ribozyme.

(40) In some aspects of the invention, the reporter nucleic acid molecule is operatively linked to a promoter. In other aspects of the invention, the promoter can be chosen or designed to contribute to the reactivity and cross-reactivity of the reporter system based on the activity of the promoter in specific cells (e.g., specific species) and not in others. In certain aspects, the reporter nucleic acid molecule comprises an origin of replication. In other aspects, the choice of origin of replication can similarly contribute to reactivity and cross-reactivity of the reporter system, when replication of the reporter nucleic acid molecule within the target cell contributes to or is required for reporter signal production based on the activity of the origin of replication in specific cells (e.g., specific species) and not in others. In some embodiments, the reporter nucleic acid molecule forms a replicon capable of being packaged as concatameric DNA into a progeny virus during virus replication.

(41) As used herein, a target transcript refers to a portion of a nucleotide sequence of a DNA sequence or an mRNA molecule that is naturally formed by a target cell including that formed during the transcription of a target gene and mRNA that is a product of RNA processing of a primary transcription product. The target transcript can also be referred to as a cellular transcript or naturally occurring transcript.

(42) As used herein, the term transcript refers to a length of nucleotide sequence (DNA or RNA) transcribed from a DNA or RNA template sequence or gene. The transcript can be a cDNA sequence transcribed from an RNA template or an mRNA sequence transcribed from a DNA template. The transcript can be protein coding or non-coding. The transcript can also be transcribed from an engineered nucleic acid construct.

(43) A transcript derived from a reporter nucleic acid molecule can be referred to as a reporter transcript. The reporter transcript can include a reporter sequence and a cis-repressing sequence. The reporter transcript can have sequences that form regions of complementarity, such that the transcript includes two regions that form a duplex (e.g., an intermolecular duplex region). One region can be referred to as a cis-repressing sequence and has complementarity to a portion or all of a target transcript and/or a reporter sequence. A second region of the transcript is called a reporter sequence and can have complementarity to the cis-repressing sequence. Complementarity can be full complementarity or substantial complementarity. The presence and/or binding of the cis-repressing sequence with the reporter sequence can form a conformation in the reporter transcript, which can block further expression of the reporter molecule. The reporter transcript can form secondary structures, such as a hairpin structure, such that regions within the reporter transcript that are complementary to each other can hybridize to each other.

(44) Introducing into a cell, when referring to a nucleic acid molecule or exogenous sequence (e.g., plasmid, vector, construct), means facilitating uptake or absorption into the cell, as is understood by those skilled in the art. Absorption or uptake of nucleic acid constructs or transcripts can occur through unaided diffusive or active cellular processes, or by auxiliary agents or devices including via the use of bacteriophage, virus, and transduction particles. The meaning of this term is not limited to cells in vitro; a nucleic acid molecule may also be introduced into a cell, wherein the cell is part of a living organism. In such instance, introduction into the cell will include the delivery to the organism. For example, for in vivo delivery, nucleic acid molecules, constructs or vectors of the invention can be injected into a tissue site or administered systemically. In vitro introduction into a cell includes methods known in the art, such as electroporation and lipofection. Further approaches are described herein or known in the art.

(45) A transduction particle refers to a virus capable of delivering a non-viral nucleic acid molecule into a cell. The virus can be a bacteriophage, adenovirus, etc.

(46) A non-replicative transduction particle refers to a virus capable of delivering a non-viral nucleic acid molecule into a cell, but does not package its own replicated viral genome into the transduction particle. The virus can be a bacteriophage, adenovirus, etc.

(47) A plasmid is a small DNA molecule that is physically separate from, and can replicate independently of, chromosomal DNA within a cell. Most commonly found as small circular, double-stranded DNA molecules in bacteria, plasmids are sometimes present in archaea and eukaryotic organisms. Plasmids are considered replicons, capable of replicating autonomously within a suitable host.

(48) A vector is a nucleic acid molecule used as a vehicle to artificially carry foreign genetic material into another cell, where it can be replicated and/or expressed.

(49) A virus is a small infectious agent that replicates only inside the living cells of other organisms. Virus particles (known as virions) include two or three parts: i) the genetic material made from either DNA or RNA molecules that carry genetic information; ii) a protein coat that protects these genes; and in some cases, iii) an envelope of lipids that surrounds the protein coat.

(50) MRSA refers to Methicillin-resistant Staphylococcus aureus.

(51) MSSA refers to Methicillin-sensitive Staphylococcus aureus.

(52) The term ameliorating refers to any therapeutically beneficial result in the treatment of a disease state, e.g., a disease state, including prophylaxis, lessening in the severity or progression, remission, or cure thereof.

(53) The term in situ refers to processes that occur in a living cell growing separate from a living organism, e.g., growing in tissue culture.

(54) The term in vivo refers to processes that occur in a living organism.

(55) The term mammal as used herein includes both humans and non-humans and include but is not limited to humans, non-human primates, canines, felines, murines, bovines, equines, and porcines.

(56) G, C, A and U each generally stand for a nucleotide that contains guanine, cytosine, adenine, and uracil as a base, respectively. T and dT are used interchangeably herein and refer to a deoxyribonucleotide wherein the nucleobase is thymine, e.g., deoxyribothymine. However, it will be understood that the term ribonucleotide or nucleotide or deoxyribonucleotide can also refer to a modified nucleotide, as further detailed below, or a surrogate replacement moiety. The skilled person is well aware that guanine, cytosine, adenine, and uracil may be replaced by other moieties without substantially altering the base pairing properties of an oligonucleotide comprising a nucleotide bearing such replacement moiety. For example, without limitation, a nucleotide comprising inosine as its base may base pair with nucleotides containing adenine, cytosine, or uracil. Hence, nucleotides containing uracil, guanine, or adenine may be replaced in the nucleotide sequences of the invention by a nucleotide containing, for example, inosine. Sequences comprising such replacement moieties are embodiments of the invention.

(57) As used herein, the term complementary, when used to describe a first nucleotide sequence in relation to a second nucleotide sequence, refers to the ability of an oligonucleotide or polynucleotide comprising the first nucleotide sequence to hybridize and form a duplex structure under certain conditions with an oligonucleotide or polynucleotide comprising the second nucleotide sequence, as will be understood by the skilled person. Complementary sequences are also described as binding to each other and characterized by binding affinities.

(58) For example, a first nucleotide sequence can be described as complementary to a second nucleotide sequence when the two sequences hybridize (e.g., anneal) under stringent hybridization conditions. Hybridization conditions include temperature, ionic strength, pH, and organic solvent concentration for the annealing and/or washing steps. The term stringent hybridization conditions refers to conditions under which a first nucleotide sequence will hybridize preferentially to its target sequence, e.g., a second nucleotide sequence, and to a lesser extent to, or not at all to, other sequences. Stringent hybridization conditions are sequence dependent, and are different under different environmental parameters. Generally, stringent hybridization conditions are selected to be about 5 C. lower than the thermal melting point (T.sub.m) for the nucleotide sequence at a defined ionic strength and pH. The T.sub.m is the temperature (under defined ionic strength and pH) at which 50% of the first nucleotide sequences hybridize to a perfectly matched target sequence. An extensive guide to the hybridization of nucleic acids is found in, e.g., Tijssen (1993) Laboratory Techniques in Biochemistry and Molecular BiologyHybridization with Nucleic Acid Probes part I, chap. 2, Overview of principles of hybridization and the strategy of nucleic acid probe assays, Elsevier, N.Y. (Tijssen). Other conditions, such as physiologically relevant conditions as may be encountered inside an organism, can apply. The skilled person will be able to determine the set of conditions most appropriate for a test of complementarity of two sequences in accordance with the ultimate application of the hybridized nucleotides.

(59) This includes base-pairing of the oligonucleotide or polynucleotide comprising the first nucleotide sequence to the oligonucleotide or polynucleotide comprising the second nucleotide sequence over the entire length of the first and second nucleotide sequence. Such sequences can be referred to as fully complementary with respect to each other herein. However, where a first sequence is referred to as substantially complementary with respect to a second sequence herein, the two sequences can be fully complementary, or they may form one or more, but generally not more than 4, 3 or 2 mismatched base pairs upon hybridization, while retaining the ability to hybridize under the conditions most relevant to their ultimate application. However, where two oligonucleotides are designed to form, upon hybridization, one or more single stranded overhangs, such overhangs shall not be regarded as mismatches with regard to the determination of complementarity. For example, a dsRNA comprising one oligonucleotide 21 nucleotides in length and another oligonucleotide 23 nucleotides in length, wherein the longer oligonucleotide comprises a sequence of 21 nucleotides that is fully complementary to the shorter oligonucleotide, may yet be referred to as fully complementary for the purposes described herein.

(60) Complementary sequences, as used herein, may also include, or be formed entirely from, non-Watson-Crick base pairs and/or base pairs formed from non-natural and modified nucleotides, in as far as the above requirements with respect to their ability to hybridize are fulfilled. Such non-Watson-Crick base pairs includes, but not limited to, G:U Wobble or Hoogstein base pairing.

(61) The terms complementary, fully complementary and substantially complementary herein may be used with respect to the base matching between two strands of a dsRNA, or between the antisense strand of a dsRNA and a target sequence, between complementary strands of a single stranded RNA sequence or a single stranded DNA sequence, as will be understood from the context of their use.

(62) As used herein, a duplex structure comprises two anti-parallel and substantially complementary nucleic acid sequences. Complementary sequences in a nucleic acid construct, between two transcripts, between two regions within a transcript, or between a transcript and a target sequence can form a duplex structure. In general, the majority of nucleotides of each strand are ribonucleotides, but as described in detail herein, each or both strands can also include at least one non-ribonucleotide, e.g., a deoxyribonucleotide and/or a modified nucleotide. The two strands forming the duplex structure may be different portions of one larger RNA molecule, or they may be separate RNA molecules. Where the two strands are part of one larger molecule, and therefore are connected by an uninterrupted chain of nucleotides between the 3-end of one strand and the 5-end of the respective other strand forming the duplex structure, the connecting RNA chain is referred to as a hairpin loop. Where the two strands are connected covalently by means other than an uninterrupted chain of nucleotides between the 3-end of one strand and the 5-end of the respective other strand forming the duplex structure, the connecting structure is referred to as a linker. The RNA strands may have the same or a different number of nucleotides. The maximum number of base pairs is the number of nucleotides in the shortest strand of the duplex minus any overhangs that are present in the duplex. Generally, the duplex structure is between 15 and 30 or between 25 and 30, or between 18 and 25, or between 19 and 24, or between 19 and 21, or 19, 20, or 21 base pairs in length. In one embodiment the duplex is 19 base pairs in length. In another embodiment the duplex is 21 base pairs in length. When two different siRNAs are used in combination, the duplex lengths can be identical or can differ.

(63) As used herein, the term region of complementarity refers to the region on the antisense strand that is substantially complementary to a sequence, for example a target sequence, as defined herein. Where the region of complementarity is not fully complementary to the target sequence, the mismatches are most tolerated in the terminal regions and, if present, are generally in a terminal region or regions, e.g., within 6, 5, 4, 3, or 2 nucleotides of the 5 and/or 3 terminus.

(64) The term percent identity, in the context of two or more nucleic acid or polypeptide sequences, refer to two or more sequences or subsequences that have a specified percentage of nucleotides or amino acid residues that are the same, when compared and aligned for maximum correspondence, as measured using one of the sequence comparison algorithms described below (e.g., BLASTP and BLASTN or other algorithms available to persons of skill) or by visual inspection. Depending on the application, the percent identity can exist over a region of the sequence being compared, e.g., over a functional domain, or, alternatively, exist over the full length of the two sequences to be compared.

(65) For sequence comparison, typically one sequence acts as a reference sequence to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are input into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. The sequence comparison algorithm then calculates the percent sequence identity for the test sequence(s) relative to the reference sequence, based on the designated program parameters.

(66) Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981), by the homology alignment algorithm of Needleman & Wunsch, J. Mol. Biol. 48:443 (1970), by the search for similarity method of Pearson & Lipman, Proc. Nat'l. Acad. Sci. USA 85:2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wis.), or by visual inspection (see generally Ausubel et al., infra).

(67) One example of an algorithm that is suitable for determining percent sequence identity and sequence similarity is the BLAST algorithm, which is described in Altschul et al., J. Mol. Biol. 215:403-410 (1990). Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (www.ncbi.nlm.nih.gov/).

(68) The term sufficient amount means an amount sufficient to produce a desired effect, e.g., an amount sufficient to produce a detectable signal from a cell.

(69) The term therapeutically effective amount is an amount that is effective to ameliorate a symptom of a disease. A therapeutically effective amount can be a prophylactically effective amount as prophylaxis can be considered therapy.

(70) It must be noted that, as used in the specification and the appended claims, the singular forms a, an and the include plural referents unless the context clearly dictates otherwise.

II. Lysogenic and Lytic Cycle of Viruses

(71) Viruses undergo lysogenic and lytic cycles in a host cell. If the lysogenic cycle is adopted, the phage chromosome can be integrated into the bacterial chromosome, or it can establish itself as a stable plasmid in the host, where it can remain dormant for long periods of time. If the lysogen is induced, the phage genome is excised from the bacterial chromosome and initiates the lytic cycle, which culminates in lysis of the cell and the release of phage particles. The lytic cycle leads to the production of new phage particles which are released by lysis of the host.

(72) Certain temperate phage can exhibit lytic activity, and the propensity for this may vary with varying host bacteria. To illustrate this phenomenon, the lytic activity of two temperate S. aureus phages on ten MRSA clinical isolates was examined via plaque assay (Table 1). The phage 11 exhibited lytic activity on 10 out of 10 clinical MRSA isolates and 80 exhibited lytic activity on six of the 10 clinical MRSA isolates. Thus, reporter assays relying on the natural lysogenic cycle of phages can be expected to exhibit lytic activity sporadically.

(73) TABLE-US-00001 TABLE 1 Lytic activity (denoted by the letter x) of the S. aureus temperate phages 11 and 80 on ten clinical MRSA isolates MRSA isolate 11 80 1 x 2 x 3 x x 4 x x 5 x x 6 x 7 x x 8 x 9 x x 10 x x

(74) In addition, virus-based reporter assays, such as phage-based reporters, can suffer from limited reactivity (i.e., analytical inclusivity) due to limits in the phage host range caused by host-based and prophage-derived phage resistance mechanisms. These resistance mechanisms target native phage nucleic acid that can result in the degradation or otherwise inhibition of the phage DNA and functions. Such resistance mechanisms include restriction systems that cleave phage DNA and CRISPR systems that inhibit phage-derived transcripts.

(75) Both lytic activity and phage resistance can be inhibitory to assays based on reporter phages. Lytic activity can inhibit signal by destroying or otherwise inhibiting the cell in its ability to generate a detectable signal and thus affecting limits of detection by reducing the amount of detectable signal or preventing the generation of a detectable signal. Phage resistance mechanisms can limit the host range of the phage and limit the inclusivity of the phage-based reporter, similarly affecting limits of detection by reducing the amount of detectable signal or preventing the generation of a detectable signal. Both lytic activity and phage resistance caused by the incorporation of phage DNA in a reporter phage can lead to false-negative results in assays that incorporate these phage reporters.

III. Methods for Producing Non-Replicative Transduction Particles (NRTP)

(76) A. Disruption/Complementation-Based Methods for Producing Non-Replicative Transduction Particles

(77) 1) Silent Mutation/Complementation Packaging System

(78) The invention includes methods for producing NRTPs using a silent mutation/complementation-based method.

(79) This non-replicative transduction particle packaging system is based on introducing a silent mutation into a component of the genome of a virus that is recognized by the viral packaging machinery as the element from which genomic packaging is initiated during viral production. Examples of such an element include the pac-site sequence of pac-type bacteriophages and the cos-site sequence of cos-type bacteriophages.

(80) Because these packaging initiation sites are often found within coding regions of genes that are essential to virus production, the silent mutation is introduced such that the pac-site is no longer recognized as a site of packaging initiation by the viral packaging machinery. At the same time, the mutation does not disrupt the gene in which the site is encoded. By disrupting the packaging site sequence, the mutated virus is able to undergo a lytic cycle, but is unable to package its genomic DNA into its packaging unit.

(81) An exogenous reporter nucleic acid molecule, such as plasmid DNA, can be introduced into a host cell that has been lysogenized with a viral genome with a mutated packaging initiation site sequence. The exogenous reporter nucleic acid molecule can include a native packaging initiation site sequence. The exogenous reporter nucleic acid molecule can be introduced into the cell and replicated in the cell. When the mutated virus is undergoing a lytic cycle, the expressed viral packaging machinery packages the exogenous reporter nucleic acid molecule with the native packaging initiation site sequence into the viral packaging unit. The viral genome is not packaged into the packaging unit because its packaging initiation site sequence has been mutated. In certain embodiments, the mutation in the packaging initiation site sequence comprises a silent mutation that prevents cleavage of the packaging initiation sequence, but does not disrupt the expression of the gene product that encompasses the packaging initiation site sequence. This produces non-replicative transduction particles, e.g., viral structural components carrying the replicated exogenous nucleic acid molecule.

(82) An example of such a system is based on the bacteriophage P1, a pac-type phage. In an embodiment, a plasmid including a native P1 pac site is transformed into a cell. The cell is lysogenized with a P1 prophage genome. The P1 prophage genome includes a silent mutation in the pac-site sequence encoded within the pacA gene of P1. When the lytic cycle of the prophage is induced, the system results in the production of P1-based transduction particles carrying the plasmid DNA. An example of a silent mutation that is suitable for this system is described in U.S. Pub. No. 2005/0118719, filed on Nov. 7, 2002, which is incorporated by reference in its entirety. An example is also found in SEQ ID NO: 2, listed below (P1 pac-site with silent mutations, lower case letters signify mutated bases).

(83) FIG. 1 illustrates an example of the design and function of the silent mutation/complementation-based P1 plasmid packaging, according to an embodiment of the invention. In this system, an E. coli cell 101 is lysogenized with a P1 prophage 102 that includes a silent mutation in its packaging initiation site sequence (e.g., pac-site). The cell is transformed with a plasmid containing the native pac-site 103, and the plasmid is replicated in the cell to form plasmid concatamers 104. The plasmid can also include a reporter gene that encodes a reporter molecule. When the lytic cycle of the P1 prophage is induced, the P1 prophage is excised from the bacterial genome and the P1 structural components, such as capsid proteins, 105 are expressed. The P1 structural components only package DNA that contains a native pac-site (e.g., plasmid DNA), thus producing non-replicative transduction particles carrying plasmid DNA 106 (e.g., a reporter gene).

(84) An example vector for use in the silent mutation/complementation-based P1 plasmid packaging system is shown in FIG. 2. Details about how to construct the strains and vectors of the silent mutation/complementation-based P1 plasmid packaging system are described in detail in Example 1 below.

(85) 2) Deletion/Complementation-Based Packaging System

(86) The invention includes methods for producing NRTPs using a deletion/complementation-based method.

(87) This non-replicative transduction particle packaging system is based on deletion of a component of the genome of a virus that is recognized by the viral packaging machinery as the element from which genomic packaging is initiated during viral production. Examples of such an element include the pac-site sequence of pac-type bacteriophages and the cos-site sequence of cos-type bacteriophages. These packaging initiation sites are often found within coding regions of genes that are essential to virus production. In some embodiments, the packaging initiation site alone is deleted, which allows the mutated virus to undergo a lytic cycle but does not allow the virus to package its genomic DNA. For example, SEQ ID NO: 6 is an example of a P1 pacA gene with a deleted pac-site sequence (lower case letters indicate the deleted pac-site sequence). In other embodiments, the entire gene comprising the packaging initiation site is deleted. For example, SEQ ID NO: 8 shows the deletion of the terS gene (lower case characters show the deleted sequence).

(88) In one example, a cell's genome is lysogenized with a viral genome where the packaging initiation site has been deleted. A complementing plasmid is introduced into the cell, and the plasmid DNA includes a gene with a packaging initiation site sequence that complements the deleted packaging initiation site sequence in the viral genome. When the mutated virus is undergoing a lytic cycle, the viral packaging proteins package a replicon of the plasmid DNA into the packaging unit because of its packaging initiation site, and non-replicative transduction particles are produced carrying the replicated plasmid DNA.

(89) In some embodiments, it is preferable that the deletion/complementation is designed such that there is no homology between the mutated virus DNA and the complementing exogenous DNA. This is because lack of homology between the mutated virus DNA and the complementing exogenous DNA avoids the possibility of homologous recombination between the two DNA molecules that can result in re-introduction of a packaging sequence into the virus genome. To accomplish a lack of homology, one strategy is to delete the entire gene that contains the packaging initiation site sequence from the virus genome and then complement this gene with an exogenous DNA molecule that contains no more than exactly the DNA sequence that was deleted from virus. In this strategy, the complementing DNA molecule is designed to express the gene that was deleted from the virus.

(90) Another example of such a system is provided using the bacteriophage 80, a pac-type phage. The phage genome is lysogenized in a host bacterial cell, and the phage genome includes a small terminase gene where the pac-site of a pac-type prophage 80 has been deleted. A plasmid including a complementary small terminase gene with a native pac-site is transformed into the cell. When the lytic cycle of the lysogenized prophage is induced, the bacteriophage packaging system packages plasmid DNA into progeny bacteriophage structural components, rather than packaging the native bacteriophage DNA. The packaging system thus produces non-replicative transduction particles carrying plasmid DNA.

(91) FIG. 3 illustrates an example of the design and function of a pac-site deletion/complementation plasmid packaging system 300, according to an embodiment of the invention. A bacterial cell 301 is lysogenized with a pac-type phage 302 that has its small terminase (terS) gene deleted. The cell is transformed with a rolling circle replication plasmid 303 that includes a small terminase gene that complements the terS gene deletion in the phage. The small terminase gene contains the packaging initiation site sequence, e.g., a pac-site. The plasmid 303 can also include a reporter gene that encodes a reporter molecule.

(92) A protein complex comprising the small terminase and large terminase proteins is able to recognize and cleave a double-stranded DNA molecule at or near the pac-site, and this allows the plasmid DNA molecule to be packaged into a phage capsid. When the prophage in the cell is induced, the lytic cycle of the phage produces the phage's structural proteins 304 and the phage's large terminase protein 305. The complementing plasmid is replicated, and the small terminase protein 306 is expressed. The replicated plasmid DNA 307 containing the terS gene (and the reporter gene) are packaged into phage capsids, resulting in non-replicative transduction particles carrying only plasmid DNA 308. FIG. 4 shows an example of a resulting vector used in the pac-site deletion/complementation plasmid packaging system. Further details about the components and construction of pac-site deletion/complementation plasmid packaging system are in Example 2 below.

(93) B. Pathogenicity Island-Based Packaging System

(94) Pathogenicity islands (PTIs) are a subset of horizontally transferred genetic elements known as genomic islands. There exists a particular family of highly mobile PTIs in Staphylococcus aureus that are induced to excise and replicate by certain resident prophages. These PTIs are packaged into small headed phage-like particles and are transferred at frequencies commensurate with the plaque-forming titer of the phage. This process is referred to as the SaPI excision replication-packaging (ERP) cycle, and the high-frequency SaPI transfer is referred to as SaPI-specific transfer (SPST) to distinguish it from classical generalized transduction (CGT). The SaPIs have a highly conserved genetic organization that parallels that of bacteriophages and clearly distinguishes them from all other horizontally acquired genomic islands. The SaPI1-encoded and SaPIbov2-encoded integrases are required for both excision and integration of the corresponding elements, and it is assumed that the same is true for the other SaPIs. Phage 80 can induce several different SaPIs, including SaPI1, SaPI2, and SaPIbov1, whereas 11 can induce SaPIbov1 but neither of the other two SaPIs.

(95) FIG. 5 depicts the natural process for genomic island (GI) packaging 500 by a bacteriophage. In nature, a bacterial cell 501 lysogenized with a suitable prophage 503 and carrying a GI 504 can produce phage particles carrying GI concatamers 512. In this process, when the phage is induced into its lytic cycle, the phage genome is excised (not shown) from the bacterial genome 502, which then expresses bacteriophage proteins including capsid constituents 505 and the large terminase protein (TerL) 506. Prophage induction also triggers GI excision via the expression of the GI integrase protein (int) 507. In a similar manner to the excised phage genome (not shown), the GI circularizes 508, expresses its own small terminase protein (TerS) 509, and begins to replicate forming a GI concatamer 510. The phage TerL gene and GI TerS gene can then combine bind and cleave the GI concatamer via a pac-site sequence in the GI genome, and the GI concatamer can then be packaged into phage capsids 511 resulting in phage particles carrying GI concatamers 512.

(96) In natural systems, as depicted in FIG. 5, the resulting lysate produced from phage production includes both native phage particles, as well as GI-containing phage particles. The native phage particles are a result of packaging of the native phage genome due to recognition of the pac-site within phage genome concatamers.

(97) 1) Genomic Island (GI) Packaging System Design and Function

(98) Methods of the invention for producing NRTPs include a GI based-packaging system.

(99) Compared to a plasmid packaging system, the natural GI-packaging system benefits from the fact that the DNA that is packaged is derived from a genomic region within the bacterial genome and thus does not require the maintenance of a plasmid by the bacterial host.

(100) In some embodiments, the invention includes a bacterial cell packaging system for packaging a reporter nucleic acid molecule into a non-replicative transduction particle, wherein the bacterial cell comprises a lysogenized bacteriophage genome lacking a packaging gene, and a genomic island, cryptic phage, or other nucleic acid molecule requiring a bacteriophage (e.g., a heper phage) for mobilization of the nucleic acid molecule and comprising a reporter nucleic acid molecule and a packaging gene. Genomic island-based systems can be based on S. aureus Pathogenicity Islands (SaPIs), the E. coli criptic phage P4 and helper phage P2, and the Enterococci criptic phage P7 and helper phage P1, for example.

(101) GI-packaging systems can be exploited such that exogenous nucleic acid sequences are packaged by the bacteriophage. This can be accomplished by incorporating such exogenous nucleic acids sequences into the GI.

(102) In order to eliminate the native phage from this process, the small terminase gene of the prophage can be deleted. The small terminase gene sequence contains the pac-site sequence of the native phage, and this deletion has the effect of preventing the packaging of native phage DNA. In other embodiments, only the pac site of the small terminase gene can be deleted. The GI that will be packaged includes its own pac-site and a small terminase gene that expresses a suitable small terminase protein, and only GI DNA will be amenable for packaging in this system.

(103) FIG. 6 depicts an example of the design and function of a GI-based packaging system 600, according to an embodiment of the invention. In this system, a bacterial cell 601 has its genome lysogenized with a suitable prophage 603 that has its small terminase gene deleted, and the cell's genome 602 carries a GI 604. When the phage is induced into its lytic cycle, the phage genome is excised (not shown) from the bacterial genome 602. The phage genome expresses bacteriophage proteins, including capsid constituents 605 and the large terminase protein (TerL) 606. Prophage induction also triggers GI excision via the expression of the GI integrase protein (int) 607. In a similar manner to the excised phage genome (not shown), the GI circularizes 608 and expresses its own small terminase protein (TerS) 609 and is replicated forming a GI concatamer 610. The phage TerL gene and GI TerS gene can then combine, bind and cleave the GI concatamer via a pac-site sequence in the GI DNA. The GI concatamer can then be packaged into phage capsids 611 resulting in phage particles carrying GI concatamers 612. In this system, phage DNA will not be packaged into phage particles, since it lacks the terS gene that contains the phage's pac-site sequence, and thus cannot be recognized by the expressed GI TerS and phage TerL proteins.

(104) When phage particles containing packaged GI DNA are administered to a recipient cell, the phage will bind to the recipient cell's surface and then introduce the packaged GI DNA concatamer into the cell. Once inside the cell, the GI can again express its integrase protein, and the GI can then integrate into its specific site in the recipient cell's genome. If exogenous DNA sequences are included in the GI prior to packaging, the packaging system thus allows for delivering exogenous DNA sequences to a recipient cell and integrating these exogenous DNA sequences into the recipient cell's genome.

(105) 2) GI-Based Packaging System Lacking Integrase

(106) In another embodiment, the packaging system described above is designed such that packaged GI DNA cannot integrate into a recipient cell's genome. This can be accomplished by deleting the integrase gene in the GI and complementing the deletion by causing the expression of the integrase gene in trans from the GI. In this manner, the integrase protein is available for excision of the GI in the packaging host cell, and the GI DNA that has been packaged in a bacteriophage does not contain the integrase gene and cannot express the integrase protein, thus preventing integration of the delivered GI.

(107) FIG. 7 depicts the design and function of a GI-based packaging system that lacks the int gene 700, according to an embodiment of the invention. In this system, a bacterial cell 701 is lysogenized with a suitable prophage that has had its small terminase gene deleted 703. The cell's genome 702 carries a GI that has its integrase (int) gene deleted 704 and also carries the deleted int gene operatively linked to a suitable promoter 705. The int gene can thus express the integrase protein (Int) in trans from the GI 706. When the phage is induced into its lytic cycle, the phage genome is excised (not shown) from the bacterial genome 702, which then expresses bacteriophage proteins including capsid constituents 707 and the large terminase protein (TerL) 708. Prophage induction also triggers GI excision via the expression of the integrase protein 707. In a similar manner to the excised phage genome (not shown), the excised GI circularizes 709, expresses its own small terminase protein (TerS) 710, and begins to replicate forming a GI concatamer 711. The phage TerL gene and GI TerS gene can then combine, bind and cleave the GI concatamer via a pac-site sequence in the GI DNA, and the GI concatamer can then be packaged into phage capsids 712 resulting in phage particles carrying GI concatamers 713. In this system, phage DNA will not be packaged since it lacks the terS gene that contains the phage's pac-site sequence and thus cannot be recognized by the expressed GI TerS and phage TerL proteins.

(108) When phage particles containing packaged GI DNA lacking the int gene are administered to a recipient cell, the phage will bind to the recipient cell's surface and then introduce the packaged GI DNA concatamer into the cell. Once inside the cell, the GI cannot express its integrase protein due to the lack of the integrase gene and the GI cannot then integrate into its specific site in the recipient cell's genome. If exogenous DNA sequences are included in the GI prior to packaging, the packaging system thus allows for delivering exogenous DNA sequences to a recipient cell and the delivered DNA sequences do not integrate into the recipient cell's genome at the specific site for GI integration.

(109) 3) Design and Function of SaPIbov2-Based Packaging Lacking Integrase

(110) In some embodiments, the method of producing NRTPs employ a GI SaPIbov2 and a bacteriophage 11 in a GI-based packaging system. Alternative embodiments can employ other SaPI GI's and other suitable bacteriophages, including the SaPI's SaPI1, SaPI2, SaPIbov1, and SaPIbov2 along with the bacteriophage 80, and the SaPI's SaPIbov1 and SaPIbov2 along with the bacteriophage 11. Based on the description below, one of skill in the art would know how to develop a GI-based packaging system that does not lack the int gene, as described in Section II A.

(111) FIG. 8 depicts the design and function of a SaPIbov2-based packaging system 800 that lacks the int gene, according to an embodiment of the invention. In this system, a S. aureus cell 801 is lysogenized with 11 that has its small terminase gene deleted 803. The cell's genome 802 carries SaPIbov2 that has its integrase (int) gene deleted 804 and also carries the deleted int gene operatively linked the constitutively expressed PclpB gene promoter 805. The int gene can express the integrase protein (Int) in trans from SaPIbov2 806. When the phage is induced into its lytic cycle, the phage genome is excised (not shown) from the bacterial genome 802, which then expresses bacteriophage proteins including capsid constituents 807 and the large terminase protein (TerL) 808. Prophage induction also triggers SaPIbov2 excision via the expression of the integrase protein 806. In a similar manner to the excised phage genome (not shown), the excised SaPIbov2 circularizes 809, expresses its own small terminase protein (TerS) 810 and begins to replicate forming a SaPIbov2 concatamer 811. The phage TerL gene and SaPIbov2 TerS gene can then combine bind and cleave the SaPIbov2 concatamer via a pac-site sequence in the SaPIbov2 DNA and the SaPIbov2 concatamer can then be packaged into phage capsids 812 resulting in phage particles carrying SaPIbov2 concatamers 813. In this system, phage DNA will not be packaged since it lacks the terS gene that contains the phage's pac-site sequence and thus cannot be recognized by the expressed SaPIbov2 TerS and phage TerL proteins.

IV. Reporters

(112) In some embodiments, the NRTPs and constructs of the invention comprise a reporter nucleic acid molecule including a reporter gene. The reporter gene can encode a reporter molecule, and the reporter molecule can be a detectable or selectable marker. In certain embodiments, the reporter gene encodes a reporter molecule that produces a detectable signal when expressed in a cell.

(113) In certain embodiments, the reporter molecule can be a fluorescent reporter molecule, such as, but not limited to, a green fluorescent protein (GFP), enhanced GFP, yellow fluorescent protein (YFP), cyan fluorescent protein (CFP), blue fluorescent protein (BFP), red fluorescent protein (RFP) or mCherry, as well as near-infrared fluorescent proteins.

(114) In other embodiments, the reporter molecule can be an enzyme mediating luminescence reactions (luxA, luxB, luxAB, luc, ruc, nluc, etc.). Reporter molecules can include a bacterial luciferase, a eukaryotic luciferase, an enzyme suitable for colorimetric detection (lacZ, HRP), a protein suitable for immunodetection, such as affinity peptides (His-tag, 3-FLAG), a nucleic acid that function as an aptamer or that exhibits enzymatic activity (ribozyme), or a selectable marker, such as an antibiotic resistance gene (ampC, tet(M), CAT, erm). Other reporter molecules known in the art can be used for producing signals to detect target nucleic acids or cells.

(115) In other aspects, the reporter molecule comprises a nucleic acid molecule. In some aspects, the reporter molecule is an aptamer with specific binding activity or that exhibits enzymatic activity (e.g., aptazyme, DNAzyme, ribozyme).

(116) Reporters and reporter assays are described further in Section V herein.

V. NRTPs and Reporter Assays

(117) A. Inducer Reporter Assay

(118) The invention comprises methods for the use of NRTPs as reporter molecules for use with endogenous or native inducers that target gene promoters within viable cells. The NRTPs of the invention can be engineered using the methods described in Section III and below in Examples 1-6.

(119) In some embodiments, the method comprises employing a NRTP as a reporter, wherein the NRTP comprises a reporter gene that is operably linked to an inducible promoter that controls the expression of a target gene within a target cell. When the NRTP that includes the reporter gene is introduced into the target cell, expression of the reporter gene is possible via induction of the target gene promoter in the reporter nucleic acid molecule.

(120) FIG. 9 depicts a genomic locus of a target cell 900 with two genes, a gene encoding an inducer 902 and a target gene 903. Also depicted is a reporter nucleic acid molecule 904 that includes a reporter gene 905 that is operatively linked to the promoter 906 of the target gene of the target cell. The reporter nucleic acid molecule 904 can be introduced into the cell via a NRTP. In the native cell, when the inducer gene 902 is expressed and produces the inducer protein 907, the inducer protein 907 is able to induce the target gene promoter 906 that is operatively linked to the target gene, thus causing the expression of the target gene and the production of the target gene product 908.

(121) When the reporter nucleic acid molecule 904 is present within the target organism, the inducer 907 is also able to induce the target gene promoter 906 present within the reporter nucleic acid molecule 904, thus causing the expression of the reporter gene 905 resulting in the production of a reporter molecule 909 capable of generating a detectable signal.

(122) Thus, the production of a detectable signal from the reporter molecule 909 is indicative of the presence of the cell, based on the presence of the inducer protein 907 within a target cell.

(123) 1) VanR Reporter System

(124) In one embodiment, the reporter system includes NRTP comprising a reporter nucleic acid molecule (e.g., plasmid). The reporter nucleic acid molecule can be constructed for detecting VanR, the inducer of the promoter of the vancomycin resistance (vanA) gene in Enterococcus faecium (or E. faecalis). The reporter plasmid carries a reporter gene that is operatively linked to the vanA gene promoter.

(125) FIG. 10 outlines the design and function of a VanR reporter system. FIG. 10 depicts a region of the transposon Tn1546 1001 that may be present in E. faecium. The Tn1546 transposon can include the vanR inducer gene 1002 and the vanA target gene 1003. Also depicted in the figure is a reporter nucleic acid molecule 1004 that can be packaged in a NRTP and introduced into the cell. The reporter nucleic acid molecule 1004 includes a reporter gene 1005 that is operatively linked to a promoter P.sub.H 1006 that controls the expression of the vanHAX operon that includes the vanA gene. In the native cell, when the vanR gene 1002 is expressed and produces the VanR protein 1007, VanR is able to induce P.sub.H 1006 in the Tn1546 transposon, thus causing the expression of the vanA gene and thus producing the VanA protein 1008. When the reporter nucleic acid molecule 1003 (vector) is present within the target organism, VanR is also able to induce P.sub.H 1006 within the reporter nucleic acid molecule 1003, thus causing the expression of a reporter molecule 1009. Thus, the production of a reporter molecule is indicative of the presence of VanR within a target cell.

(126) Examples of promoters that are suitable for the development of a VRE assay include: the vanA gene promoter and a vanB gene promoter. Arthur, M., et al., The VanS sensor negatively controls VanR-mediated transcriptional activation of glycopeptide resistance genes of Tn1546 and related elements in the absence of induction. J. Bacteriol., 1997. 179(1): p. 97-106.

(127) 2) TcdD Reporter System

(128) In another embodiment of this system, a reporter nucleic acid molecule is introduced into a cell using a NRTP. The reporter nucleic acid molecule can be constructed for detecting TcdD, the inducer of the promoters of the toxins A and B genes (tcdA and tcdB, respectively) of C. difficile. The reporter nucleic acid molecule includes a reporter gene that is operatively linked to the tcdA gene promoter.

(129) FIG. 11 outlines the design and function of a TcdD reporter system, according to an embodiment of the invention. FIG. 11 depicts a region of the transposon PaLoc 1101 that may be present in C. difficile. The PaLoc transposon may contain the tcdD gene 1102 and the tcdA target gene 1103. Also depicted in the figure is a reporter nucleic acid molecule 1104 (e.g., vector) that is introduced into the cell using a NRTP. The reporter nucleic acid molecule 1104 includes the reporter gene 1105 that operatively linked to the tcdA gene promoter (P.sub.tcdA) 1106.

(130) In the native cell, when the tcdD gene is expressed and produces the TcdD protein 1107, TcdD is able to induce P.sub.tcdA 1106 in the PaLoc transposon 1101, thus causing the expression of the tcdA gene 1103 and thus producing the toxin A protein 1108.

(131) When the reporter nucleic acid molecule 1104 is present within the target organism, TcdD is also able to induce P.sub.tcdA 1106 within the reporter vector, thus causing the expression of a reporter molecule 1109. Thus, the production of a reporter molecule 1109 is indicative of the presence of TcdD within a target cell.

(132) Examples of promoters suitable for the development of a C. difficile assay include: the tcdA gene promoter and the tcdB gene promoter. Karlsson, S., et al., Expression of Clostridium difficile Toxins A and B and Their Sigma Factor TcdD Is Controlled by Temperature. Infect. Immun., 2003. 71(4): p. 1784-1793.

(133) Target Cells and Inducers:

(134) Target cells can include eukaryotic and prokaryotic cell targets and associated inducers.

(135) Vector Delivery Systems:

(136) The delivery of the vector containing the recombinant DNA can by performed by abiologic or biologic systems. Including but not limited to liposomes, virus-like particles, transduction particles derived from phage or viruses, and conjugation.

(137) 3) Bacteriophage-Based SarS Reporter System

(138) In another embodiment of the invention, a reporter nucleic acid molecule is constructed for detecting SarS, the inducer of the promoter of the Protein A gene (spa) in S. aureus. The reporter nucleic acid molecule can be introduced into the cell in a NRTP and includes the bacterial luciferase genes luxA and luxB operatively linked to the spa gene promoter (P.sub.spa). The reporter nucleic acid molecule is delivered to S. aureus via a NRTP, for example. If SarS is present in the cell, it will induce the expression of the luxAB genes, thus producing luciferase enzyme that is capable of generating a luminescent signal.

(139) FIG. 12 outlines the design and function of a SarS reporter system, according to one embodiment of the invention. FIG. 12 depicts a region of the S. aureus genome 1201 that contain the sarS gene 1202 and spa gene 1203. Also depicted in the figure is a reporter nucleic acid molecule (e.g., vector) 1204 delivered by NRTP to the cell and that includes the luxAB reporter genes 1205 that operatively linked to the promoter P.sub.spa 1206 that controls the expression of the spa gene 1203.

(140) In the native cell, when the sarS gene 1202 is expressed, producing SarS protein 1207, the protein is able to induce P.sub.spa 1206 in the S. aureus genome transposon, thus causing the expression of the spa gene 1203 and producing the Protein A 1208.

(141) When the reporter nucleic acid molecule 1204 is present within the target organism, SarS 1207 is also able to induce P.sub.spa 1206 within the reporter nucleic acid molecule 1204, thus causing the expression of luxAB resulting in the production of the luciferase enzyme 1209 that can generate a luminescent signal. Thus, the production of luciferase is indicative of the presence of SarS within a target cell.

(142) B. Enzyme Reporter Assay

(143) The invention comprises a system for the detection of intracellular enzymes within viable cells that employs caged substrate molecules that can be un-caged by a target intracellular enzyme, according to an embodiment of the invention.

(144) FIG. 13 depicts the design and function of an intracellular enzyme detection system. A reporter molecule-expressing vector 1301 is delivered to a target cell 1302 with a NRTP (not shown). The reporter molecule-expressing vector 1301 is able to penetrate the target cell 1302 via the NRTP and deliver a reporter molecule gene 1303 into the target cell 1302, and a reporter molecule 1304 can then be expressed from the reporter molecule gene 1303. A caged substrate 1305 is also added to the target cell 1302 and is able to penetrate into the target cell 1302. If a target intracellular enzyme 1307 is present in the target cell 1306, the enzyme 1307 is able to remove the caging component of the caged substrate 1305, thus producing an un-caged substrate 1308. The un-caged substrate 1308 can then react with the reporter molecule 1304 inside of the cell 1302, and the product of this reaction results in a detectable signal 1309.

(145) Target Cells and Enzymes:

(146) Target cells can include eukaryotic and prokaryotic cell targets and associated enzymes, including, for example, -lactamases in S. aureus.

(147) Vector Delivery Systems:

(148) The delivery of the vector containing the recombinant DNA can by performed by abiologic or biologic systems. Including but not limited to liposomes, virus-like particles, transduction particles derived from phage or viruses, and conjugation.

(149) Reporter Molecules and Caged Substrates:

(150) Various reporter molecules and caged substrates can be employed as those described in Daniel Sobek, J. R., Enzyme detection system with caged substrates, 2007, Zymera, Inc.

(151) 1) Bacteriophage-Based -Lactamase Reporter

(152) In one embodiment, a reporter molecule-expressing vector can be carried by a NRTP, such that the vector can be delivered into a bacterial cell. The reporter molecule to be expressed can be Renilla luciferase, and the caged substrate can be Renilla luciferin that is caged, such that a -lactamase enzyme that is endogenous to the target cell is able to cleave the caging compound from the caged luciferin and release un-caged luciferin.

(153) FIG. 14 depicts the design and function of a -lactamase enzyme detection system, according to an embodiment of the invention. A Renilla luciferase-expressing vector carried by a bacteriophage-based NRTP 1401 is added to a target S. aureus cell 1402. The Renilla luciferase-expressing vector is able to penetrate the target cell 1402 using a NRTP comprising the vector. The NRTP delivers the Renilla luciferase gene 1403 into the target cell 1402, and Renilla luciferase 1404 can then be expressed from its gene. Caged Renilla luciferin 1405 is also added to the target cell 1402 and is able to penetrate into the target cell 1402. If an intracellular -lactamase 1407 is present in the target cell 1402, the enzyme is able to remove the caging component of the caged luciferin 1406, thus producing an un-caged luciferin 1408. The un-caged luciferin 1408 can then react with the Renilla luciferase 1404 inside of the cell 1402, and the product of this reaction results in luminescence 1409.

(154) In this manner, when a target cell that contains the -lactamase is exposed to the NRTP and caged luciferin, the cell will exhibit a luminescent signal that is indicative of the presence of the -lactamase present in the cell.

(155) C. Intracellular Molecule Reporter

(156) The invention includes a system for the detection of intracellular molecules within viable cells that employs switchable molecules capable of generating a detectable signal upon their binding to a target molecule.

(157) FIG. 15 depicts the design and function of a switchable molecule (SM)-based intracellular molecule detection system. A SM-expressing vector 1501 is delivered to a target cell 1502 in a NRTP. The SM-expressing vector 1501 is able to penetrate the target cell 1502 and deliver a SM gene 1503 into the target cell 1502. A SM protein 1504 can then be expressed from the SM gene 1503. The SM protein 1504 can then bind to a target molecule 1505 inside of the cell and thus forms an SM-target molecule complex 1506. The binding of the SM 1504 to the target molecule 1505 results in a conformational change in the SM 1504 that makes the bound SM amenable to binding of a substrate. A substrate 1508 is added to the cell 1507 and is able to penetrate into the cell 1502. Bound SM inside of the cell 1502 is able to also bind the substrate, thus forming a SM-target molecule-substrate complex 1509. Finally, the binding of the substrate 1508 by the target molecule-bound SM has the effect of producing a detectable signal 1510. Thus a detectable signal generated by the system is Indicative of the Presence of a Target Molecule Inside of a Cell.

(158) Target Cells and Molecules:

(159) Various eukaryotic and prokaryotic cell targets can be employed and switchable aptamer-based SM's can be designed to target various nucleic acid and amino acid-based intracellular molecular targets as described in Samie Jaffrey, J. P., Coupled recognition/detection system for in vivo and in vitro use, 2010, Cornell University.

(160) Vector Delivery Systems:

(161) The delivery of the vector containing the recombinant DNA can by performed by abiologic or biologic systems. Including but not limited to liposomes, virus-like particles, transduction particles derived from phage or viruses, and conjugation.

(162) 1) Non-Replicative Transduction Particle/Switchable Aptamer-Based Intracellular Molecule Reporter System

(163) In one example of this method, a switchable molecule-expressing vector can be carried by a bacteriophage-based transduction particle such that the vector can be delivered into a bacterial cell. The switchable molecule to be expressed can be a switchable aptamer that is designed to undergo a conformational change upon its binding to an intracellular target molecule. The conformational change allows the aptamer to then bind a fluorophore that exhibits enhanced fluorescence when bound by the aptamer.

(164) FIG. 16 depicts the design and function of a bacteriophage/switchable-aptamer (SA)-based intracellular molecule reporter system. A SA-expressing vector carried by a NRTP 1601 is added to a target cell 1602. The NRTP 1601 is able to deliver the SA-expressing vector and the SA-expressing gene 1603 into the target cell 1602. An SA protein 1604 can then be expressed from the SA gene 1603. The SA protein 1604 can then bind to a target molecule 1605 inside of the cell and thus form an SA-target molecule complex 1606. The binding of the SA 1604 to the target molecule 1605 results in a conformational change in the SA that makes the bound SA amenable to binding of a fluorophore 1608. A fluorophore 1607 is added to the cell and is able to penetrate into the cell 1608. Bound SA inside of the cell is able to also bind the fluorophore thus forming an SA-target molecule-fluorophore complex 1609. Finally, the binding of the fluorophore by the target molecule-bound SA has the effect of enhancing the fluorescence of the fluorophore 1610. Thus, a detectable fluorescent signal generated by the system is indicative of the presence of a target molecule inside of a cell.

(165) D. Transcript Reporter Assay

(166) The invention comprises a reporter assay comprising an antisense RNA-based method for detecting target transcripts within viable cells by causing the expression of a reporter molecule if a target transcript is present within a cell.

(167) Certain intracellular methods in the art for inhibiting gene expression employ small interfering RNA, such as double-stranded RNA (dsRNA), to target transcribed genes in cells. The dsRNA comprise antisense and sense strands that are delivered into or expressed in cells, and the strands of the dsRNA act via a trans-acting inhibition mechanism, where one strand (typically the antisense strand) binds to a target gene sequence (RNA transcript) and prevents expression of the target gene sequence. Double-stranded RNA molecules have been shown to block (knock down) gene expression in a highly conserved regulatory mechanism known as RNA interference (RNAi). WO 99/32619 (Fire et al.) discloses the use of a dsRNA of at least 25 nucleotides in length to inhibit the expression of genes in C. elegans. dsRNA has also been shown to degrade target RNA in other organisms, including plants (see, e.g., WO 99/53050, Waterhouse et al.; and WO 99/61631, Heifetz et al.), Drosophila (see, e.g., Yang, D., et al., Curr. Biol. (2000) 10:1191-1200), and mammals (see WO 00/44895, Limmer; and DE 101 00 586.5, Kreutzer et al.). However, binding of a strand of the dsRNA to the target gene can be non-specific. If a similar mechanism were to be applied to a detection system, this non-specific binding can result in high false positive rates, which make it unsuitable for the development of clinically useful detection systems.

(168) Previous trans-acting inhibition mechanisms have been shown to be unsuitable for development of clinically useful detection systems. For example, some methods result in high levels of non-specific signals and up to 90% false positive rate, when achieving a 90% sensitivity of the assay. See U.S. Pat. No. 8,329,889. Certain methods for post-transcriptional regulation of gene expression have been developed that use a cis-repressed marker transcript, such as a green fluorescent protein marker, where the ribosomal binding site of the marker is blocked by the cis-repressing sequence, along with a trans-activating RNA transcript. When the trans-activating RNA transcript binds to the cis-repressed marker transcript, the hairpin structure of the cis-repressed marker transcript is altered, and the upstream ribosome binding site of the marker gene is exposed, allowing transcription and expression of the marker gene. However, these methods have not previously been used for the detection of endogenous transcripts, nor successful beyond a basic switching mechanism for controlling expression of genes in cells.

(169) 1) Nucleic Acid Molecule Interactions and Mechanisms

(170) The methods of the invention take advantage of the transcript-level regulation mechanisms, including antisense RNA (asRNA) mechanism in cells, to deliver nucleic acid molecules into cells. The antisense mechanism includes all forms of sequence-specific mRNA recognition leading to reduced, eliminated, increased, activated, or otherwise altered expression of a target transcript. See Good, L., Translation Repression By Antisense Sequences. Cellular and Molecular Life Sciences, 2003. 60(5): p. 854-861, and Lioliou, E., RNA-mediated regulation in bacteria: from natural to artificial systems, New Biotechnology. 2010. 27(3): p. 222-235. Naturally occurring asRNAs are found in all three kingdoms of life, and they affect messenger RNA (mRNA) destruction, repression and activation, as well as RNA processing and transcription. See Sabine, B., Antisense-RNA regulation and RNA Interference. Biochimica et Biophysica Acta (BBA)Gene Structure and Expression, 2001. 1575(1-3): p. 15-25. This mechanism has been exploited in inhibiting protein synthesis for therapeutic applications.

(171) Antisense RNA is a single-stranded RNA that is complementary to a messenger RNA (mRNA) strand transcribed within a cell. asRNA may be introduced into a cell to inhibit translation of a complementary mRNA by base pairing to it and physically obstructing the translation machinery. Antisense RNA anneal to a complementary mRNA target sequence, and translation of the mRNA target sequence is disrupted as a result of steric hindrance of either ribosome access or ribosomal read through.

(172) The antisense RNA mechanism is different from RNA interference (RNAi), a related process in which double-stranded RNA fragments (dsRNA, also called small interfering RNAs (siRNAs)) trigger catalytically mediated gene silencing, most typically by targeting the RNA-induced silencing complex (RISC) to bind to and degrade the mRNA. Annealing of a strand of the dsRNA molecule to mRNA or DNA can result in fast degradation of duplex RNA, hybrid RNA/DNA duplex, or duplex RNA resembling precursor tRNA by ribonucleases in the cell, or by cleavage of the target RNA by the antisense compound itself.

(173) The RNAi pathway is found in many eukaryotes and is initiated by the enzyme Dicer, which cleaves long double-stranded RNA (dsRNA) molecules into short double stranded fragments of 20 nucleotides that are called siRNAs. Each siRNA is unwound into two single-stranded RNAs (ssRNA), namely the passenger strand and the guide strand. The passenger strand is degraded, and the guide strand is incorporated into the RNA-induced silencing complex (RISC). In post-transcriptional gene silencing, the guide strand base pairs with a complementary sequence in a messenger RNA molecule, and cleavage is induced by a protein called Argonaute, the catalytic component of the RISC complex.

(174) In regards to the nucleic acid interactions of the mechanisms of the invention, interactions between a reporter transcript and a target transcript can rely on base pairings between loops present in both transcripts (e.g., kissing complexes), or between a loop and a single-stranded (ss) region. In some cases, the kissing complex formation suffices for mediating the desired effect of the interaction, and in other cases, propagation of the primary contacts will lead to an interaction resulting in the desired effect.

(175) 2) Mechanisms for Cis-Repression and Trans-Activation of Translation of a Reporter Construct Via Transcript-Level Regulation

(176) The following description illustrates transcript reporter systems based on various repression/activation mechanisms that can be used, according to embodiments of this invention. In each of FIGS. 17-20, a vector includes a reporter construct comprising a reporter sequence, and the regions on the reporter construct are shown in each of the figures, including regions that can be targeted for repression by a cis-repressing sequence. The description below provides non-limiting examples of various inhibition mechanisms, including transcription attenuation, translation attenuation, and destabilization of the transcript, and various activation mechanisms including conformational changes and cleavage.

(177) FIG. 17 depicts an example of a system 1700 that uses a cis-repression mechanism that can target the 5 UTR (untranslated region) 1701 of the reporter sequence 1702 on a reporter transcript 1703. The regions within the reporter sequence 1702 (5UTR (1701), RBS, Coding Region and 3UTR) are also shown. The cis-repressing sequence 1705 is upstream of the reporter sequence and up to the 5 UTR 1701 of the reporter sequence. An RNA polymerase 1704 transcribes the sequence of the reporter construct 1703 from the vector 1706.

(178) At some point during transcription, the transcription process is stopped by the formation of a transcription termination (TT) stem-loop structure 1707 in the reporter transcript 1703, due to an interaction within the transcribed cis-repressing sequence 1705. The transcription termination 1707 structure stops 1708 the RNA polymerase 1704 from transcribing the vector 1706. In some embodiments, a transcription termination protein (e.g., NusA in E. coli) binds to RNA polymerase and/or to the transcription termination 1707 structure to cease transcription of the reporter construct.

(179) When a target transcript 1709 is present in the cell, the target transcript 1709 binds to the reporter transcript 1703. In some embodiments, the binding between the target transcript and the reporter transcript is by base pairing of the nucleotides in each sequence. The interaction between the target transcript 1709 and the reporter transcript 103 causes the transcription termination (TT) stem-loop structure 1707 to be cleaved 1710. Cleavage of the reporter transcript 1703 can occur by a cellular enzyme, such as RNase III, for example. In this case, the secondary structure of a target transcript is analyzed for the presence of an RNAse III consensus sequence among the ssRNA regions of the secondary structure, for example 5-nnWAWGNNNUUN-3 (SEQ ID NO: 20) or 5-NAGNNNNCWUWnn-3 (SEQ ID NO: 21) where N and n are any nucleotide and W is A or U and N indicates a relatively strict requirement for Watson-Crick base pairing, while n indicates a minimal requirement for base pairing. When such a consensus sequence is found on a target transcript, the loop of the transcription termination structure 1707 can be designed to be complementary to said RNAse III consensus sequence such that when the ssRNA in each RNA molecule hybridize, the RNAse III cleavage site is formed allowing for cleavage of the transcription termination structure 1707. In the mecA transcript, loop T23, starting at nucleotide 1,404, has the sequence CAGAUAACAUUUU (SEQ ID NO: 22) that is suitable for such an approach.

(180) In some embodiments, a cleavage site is engineered in the reporter construct, such that the reporter transcript is cleaved after transcription. The cleavage, in the example provided, can occur immediately adjacent to the location of the loop in the transcription terminator structure. Transcription is re-initiated 1711 by the RNA polymerase 104. Cleavage of the transcription termination (TT) stem-loop structure 1707 allows the remainder of the reporter sequence 1702 to be transcribed and subsequently translated. This results in the production of a detectable or selectable marker from the translated reporter molecule.

(181) In prokaryotes, the transcription termination structure 1707 involves a Rho-independent mechanism with a stem-loop structure that is 7-20 base pairs in length, rich in cytosine-guanine base pairs and is followed by a chain of uracil residues. NusA binds to the transcription termination stem-loop structure 1707 causing RNA polymerase to stall during transcription of the poly-uracil sequence. Weak Adenine-Uracil bonds lower the energy of destabilization for the RNA-DNA duplex, allowing it to unwind and dissociate from the RNA polymerase. In eukaryotes, the transcription termination structure 1707 is recognized by protein factors and involves cleavage of the new transcript followed by polyadenylation.

(182) FIG. 18 shows an example of a system 1800 for detecting the presence of a target transcript in a cell that is based on a cis-repression mechanism targeting the ribosome binding site (RBS) 1801 of the reporter sequence 1702 in the reporter transcript 1703. The RBS 1801 is a sequence of mRNA that is bound by the ribosome 1802 when initiating protein translation. The cis-repressing sequence 1705 is designed to bind to the RBS 1801 (e.g., the cis-repressing sequence 1705 is complementary to the RBS sequence 1801). The RBS 1801 binds to the cis-repressing sequence 1705 and becomes sequestered (inaccessible by a ribosome 1802), preventing the translation of the reporter transcript 1703. When a target transcript 109 from the cell binds to the reporter transcript 1703, the target transcript 1709 has a higher binding affinity for the RBS sequence 1801, and a conformational change occurs in the reporter transcript 1703 in a manner that releases the binding between the cis-repressing 1705 sequence and the RBS sequence 1801. This allows the ribosome 1802 to bind to the RBS 1801, thereby allowing for translation of the reporter transcript 1703.

(183) FIG. 19 illustrates an exemplary system 1900 for detecting the presence of a target transcript in a cell that is based on a cis-repression mechanism targeting the coding region (AUG) 1901 of the reporter sequence 1702 in the reporter transcript 1703. The cis-repressing sequence 1705 is constructed such that it binds with (e.g., complementary to) the coding region 1901 of the reporter sequence 1702. The AUG start codon is shown as part of the coding region 1901. The binding of the cis-repressing sequence 1705 and the coding region 1901 results in a conformation that leads to cleavage 1902 of the reporter construct 1703. Cleavage of the reporter transcript 1703 prevents translation.

(184) When a target transcript 1709 is present in the cell, the target transcript 1709 binds to the cis-repressing sequence 1705 in a manner that causes a conformational change in the reporter transcript 1703. This conformational change prevents or removes the interaction between the cis-repressing sequence 1705 and the coding region 1901 of the reporter sequence 1702, thereby allowing for translation of the reporter sequence 1702.

(185) FIG. 20 illustrates an example system 2000 for detecting the presence of a target transcript in a cell that is based on a repression mechanism using an unstable reporter transcript 2001. The reporter transcript 2001 is designed to be unstable such that it forms an unstable conformation that prevents the translation of the reporter transcript 2001. A reporter transcript 2001 is defined to be unstable if it is prone to rapid degradation due to a variety of factors, such as activity of exosome complexes or a degradosome. A target transcript 1709 in the cell binds to a portion of the unstable reporter transcript 2001. In this example, the portion responsible for destabilizing the transcript is located in the 3 UTR 2005 of the reporter sequence, and the 3 UTR 2005 acts like the cis-repressing sequence of the reporter construct 1703. The binding of the target transcript 1709 with the 3 UTR 2005 of the reporter sequence results in a cleaving event 2003 that stabilizes the reporter transcript 2001 and allows for translation 2004 of the reporter transcript 2001. Cleavage occurs upon binding of the target transcript 1709 and serves to remove the portion of sequence that is responsible for destabilizing the transcript. In this example, the target transcript 1709 binds to the 3 UTR 405 of the reporter sequence, but the system 400 can also be designed such that binding and cleavage occurs in the 5 UTR, upstream of the 5 UTR, or downstream of the 3 UTR. Binding and cleavage can occur anywhere outside of regions necessary for translation of the reporter sequence 1702.

(186) In some embodiments, the cis-repressing sequence itself comprises two sequences that can bind to each other (e.g., complementary to each other), and the conformation of the reporter transcript that results from the binding of the two sequences of the cis-repressing sequence prevents translation of the reporter sequence in the reporter transcript.

(187) 3) Naturally Occurring and Synthetic Systems for Repression/Activation Mechanisms

(188) Several naturally occurring and synthetically produced transcript-level mechanisms have been described that demonstrate the individual mechanisms (i.e., conformational change and cleavage) employed in each of the examples illustrated in FIGS. 17-20.

(189) Transcription termination has been observed in antisense RNA (asRNA)-mediated transcriptional attenuation. In one example, two loop-loop interactions between RNAIII/repR mRNA are subsequently followed by the formation of a stable duplex. This complex stabilizes a Rho-independent terminator structure to arrest elongation by RNA polymerase (RNAP).

(190) The RBS sequestration mechanism has been described via the development of a synthetic riboswitch system. In this system, a sequence complementary to a RBS is placed upstream of the RBS, allowing the presence of a linker sequence between the two regions. After transcription of the mRNA, the two complementary regions hybridize. creating a hairpin that prevents docking of the ribosome. To activate translation, a synthetic trans-activating RNA carrying the RBS sequence binds to the hybridized RNA, allowing the RBS to be exposed and available for translation.

(191) The prevention of translation due to the cleaving of RNA has also been described in a natural system where the asRNA MicC targets a sequence inside the coding region of ompD mRNA. The interaction, which is promoted by Hfq, causes the cleaving of the mRNA by RNase E.

(192) Yet another natural mechanism demonstrates a cleaving event to activate translation rather than inhibiting it. The E. coli GadY asRNA targets the intergenic region between two genes of the gadXW operon. Following the formation of a stable helix between GadY and the 3UTR of gadX, an RNase cleavage occurs in the transcript and stabilizes gadX transcript allowing for its translation.

(193) 4) Mechanism of Conformational Change by Cis-Repression of the Reporter Sequence and by Binding of a Target Transcript

(194) The general mechanisms employed in the invention are intermolecular nucleic acid molecule interactions that may result in two subsequent mechanisms: (1) a conformational change in the secondary structure of the nucleic acid molecules, and (2) a cleaving event. Described herein are methods for designing reporter transcripts that can undergo a conformational change between a cis-repressed conformation and a de-repressed conformation, such that the conformational change is induced by binding of a target transcript to the reporter transcript.

(195) As described above, a reporter transcript can comprise a reporter sequence and be designed such that translation of the reporter gene sequence is blocked by cis-repression of the ribosome binding site (RBS) of the reporter gene.

(196) In some embodiments, the following tools can be used for designing the reporter transcripts of the invention.

(197) 1) RNA secondary structure is calculated using secondary structure program, such as Mfold available at a server maintained by The RNA Institute College of Arts and Sciences, University at Albany, State University of New York (Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res. 31 (13), 3406-15, (2003)).

(198) 2) Intermolecular RNA interactions are calculated using a software program such as RNA-RNA InterACTion prediction using Integer Programming (RactIP) available at a server maintained by the Graduate School of Information Science, Nara Institute of Science and Technology (NAIST), Department of Biosciences and Informatics, Keio University Japan.

(199) 3) RNA secondary structure is visualized using Visualization Applet for RNA (VARNA), which is a Java lightweight Applet dedicated to drawing the secondary structure of RNA.

(200) A secondary structure of the target transcript can be generated based on the lowest energy conformation calculated by MFold and visualized with VARNA.

(201) ssRNA regions or target regions can be identified within the target transcript that can be ideal for binding to a reporter transcript. In some instances, the secondary structure of the target transcript includes a consensus sequence or loop sequence that can bind to a portion of the reporter sequence. For example, in the mecA transcript of methicillin-resistant S. aureus, there is a terminal loop that includes a consensus YUNR sequence (UUGG) that can be used to bind to a cis-repressing sequence of a reporter transcript. Analysis of the secondary structure of the target transcript can reveal these one or more ssRNA regions that can be suitable for binding to a cis-repressing sequence. The cis-repressing sequence of the reporter transcript can then be designed to bind to these one or more ssRNA regions.

(202) In some embodiments, the cis-repressing sequence can be designed to bind to the RBS of the reporter sequence in the reporter transcript and form a stem-loop structure within the reporter transcript, such that the cis-repressing sequence blocks binding of an RNA polymerase to the RBS of the reporter sequence. Upon binding of the cis-repressing sequence to the ssRNA region of the target transcript, the RBS of the reporter sequence can be exposed and translation of the reporter sequence can be initiated.

(203) In some embodiments, the cis-repressing sequence of the reporter transcript can be designed to be positioned at the 5 terminus of the reporter sequence and designed to generate a stem-loop structure in the reporter sequence, such that the RBS sequence of the reporter sequence is blocked. The cis-repressing stem-loop structure can be designed to block the RBS sequence based on the lowest energy conformation of the reporter transcript, as calculated by MFold and visualized with VARNA. The predicted inter-molecular interactions between the target transcript and the cis-repressing sequence of the reporter transcript can be calculated by RactIP and visualized by VARNA. A diagram can be drawn to visualize the base pairing between the target transcript and the cis-repressing sequence of the reporter transcript, as shown in FIG. 28 below.

(204) The interaction can include base pairing between 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 or more nucleotides in the target sequence and cis-repressing sequence. The complementary binding between the two sequences can be fully complementary, substantially complementary or partially complementary. The base pairing can be across contiguous nucleotide sequences or regions within the target and cis-repressing sequences, for example, as shown in FIG. 28.

(205) 5) Cleavage Mechanisms for Cis-Repressed Transcripts or Reporter Transcripts

(206) The general mechanisms employed in the invention are intermolecular nucleic acid molecule interactions that may result in two subsequent mechanisms: (1) a conformational change in the secondary structure of the nucleic acid molecules, and (2) a cleaving event. Described herein are methods and systems for designing reporter transcripts that employ a cleaving event.

(207) In some embodiments, a cleaving mechanism can be employed in the system and methods of the invention for cis-repression or for trans-activation. For example, as described above in FIGS. 17, 19 and 20, a system can be designed to take advantage of a cleaving mechanism by exposing a nucleic acid sequence of the reporter transcript to a cleaving enzyme (RNase) or sequestering a single-stranded sequence that is recognized by a sequence specific RNAase.

(208) In one example, an ribonuclease E (RNAse E) site can be designed in the reporter transcript (* indicates the cleaving site): (G,A)N(C,A)N(G)(G,U,A)*(A,U)(C,U)N(C,A)(C,A) (SEQ ID NO: 25). See Kaberdin et al., Probing the substrate specificity of E. coli RNase E using a novel oligonucleotide-based assay. Nucleic Acids Research, 2003, Vol. 31, No. 16 (doi: 10.1093/nar/gkg690).

(209) In a cis-repression system, a cis-repressing sequence can be incorporated in the design of a reporter transcript, such that when transcribed, the conformation of the reporter transcript exposes a single stranded region containing a sequence RNAse E recognition motif at the desired site to be cleaved. In some embodiments, the cleavage site can be involved in repression of the transcription of the reporter transcript, for example, if the cleavage site is within the coding region of the reporter gene.

(210) For a trans-derepression system, the cis-repressed transcript can be engineered to bind to a target transcript, such that the interaction causes a conformational change in the reporter transcript that sequesters the single-stranded region containing the RNAse E site.

(211) The system can be designed such that the cis-repressing mechanism is due to a specific secondary structure generated by a conformation of the cis-repressing sequence, such as the transcription termination structure described above. In this example, a cleaving event serves to de-repress the reporter sequence. This can be accomplished by designing the cis-repressing sequence to interact with (bind to) a naturally-occurring plasmid or other cellular transcript, such that the interaction results in the generation of a single-stranded region containing the RNAse E site that can be cleaved and thus removes the cis-repressing sequence from the reporter transcript.

(212) In some embodiments, when a cleavage event is employed for expression of the reporter, the RNAse E site is designed to be outside of the coding region of a reporter sequence with enough sequence length in the 5 and 3 UTR in order to allow for a viable reporter transcript. In this case, the RNAse E site is designed to be at least 0, 1, 2, 3, 4, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, or more base pairs upstream of the start codon in prokaryotic systems and at least 18, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, or more base pairs upstream of the start codon in eukaryotic systems or at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, or more base pairs downstream of the stop codon. In other embodiments, when a cleavage event is employed for repression of the reporter, the RNAse E site is designed to be within the coding region of the reporter sequence or otherwise placed in order to inhibit expression of the reporter.

(213) 6) Transcripts

(214) As described above, a transcript is a length of nucleotide sequence (DNA or RNA) transcribed from a DNA or RNA template sequence or gene. The transcript can be a cDNA sequence transcribed from an RNA template or an mRNA sequence transcribed from a DNA template. The transcript can be transcribed from an engineered nucleic acid construct. The transcript can have regions of complementarity within itself, such that the transcript includes two regions that can form an intra-molecular duplex. One region can be referred to as a cis-repressing sequence that binds to and blocks translation of a reporter sequence. A second region of the transcript is called a reporter sequence that encodes a reporter molecule, such as a detectable or selectable marker.

(215) The transcripts of the invention can be a transcript sequence that can be 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length. In other embodiments, the transcript can be at least 25, 30, 40, 50, 60, 70, 80, 90, 100, 500, 1000, 1500, 2000, 3000, 4000, 5000 or more nucleotides in length. The cis-repressing sequence and the reporter sequence can be the same length or of different lengths.

(216) In some embodiments, the cis-repressing sequence is separated from the reporter sequence by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, or more spacer nucleotides.

(217) 7) Vectors

(218) In another aspect, the transcripts (including antisense and sense sequences) of the invention are expressed from transcription units inserted into DNA or RNA vectors (see, e.g., Couture, A, et al., TIG. (1996), 12:5-10; Skillern, A., et al., International PCT Publication No. WO 00/22113, Conrad, International PCT Publication No. WO 00/22114, and Conrad, U.S. Pat. No. 6,054,299). These sequences can be introduced as a linear construct, a circular plasmid, or a viral vector, including bacteriophage-based vectors, which can be incorporated and inherited as a transgene integrated into the host genome. The transcript can also be constructed to permit it to be inherited as an extrachromosomal plasmid (Gassmann, et al., Proc. Natl. Acad. Sci. USA (1995) 92:1292).

(219) The transcript sequences can be transcribed by a promoter located on the expression plasmid. In one embodiment, the cis-repressing and reporter sequences are expressed as an inverted repeat joined by a linker polynucleotide sequence such that the transcript has a stem and loop structure.

(220) Recombinant expression vectors can be used to express the transcripts of the invention. Recombinant expression vectors are generally DNA plasmids or viral vectors. Viral vectors expressing the transcripts can be constructed based on, but not limited to, adeno-associated virus (for a review, see Muzyczka, et al., Curr. Topics Micro. Immunol. (1992) 158:97-129)); adenovirus (see, for example, Berkner, et al., BioTechniques (1998) 6:616), Rosenfeld et al. (1991, Science 252:431-434), and Rosenfeld et al. (1992), Cell 68:143-155)); or alphavirus as well as others known in the art. Retroviruses have been used to introduce a variety of genes into many different cell types, including epithelial cells, in vitro and/or in vivo (see, e.g., Eglitis, et al., Science (1985) 230:1395-1398; Danos and Mulligan, Proc. Natl. Acad. Sci. USA (1998) 85:6460-6464; Wilson et al., 1988, Proc. Natl. Acad. Sci. USA 85:3014-3018; Armentano et al., 1990, Proc. Natl. Acad. Sci. USA 87:61416145; Huber et al., 1991, Proc. Natl. Acad. Sci. USA 88:8039-8043; Ferry et al., 1991, Proc. Natl. Acad. Sci. USA 88:8377-8381; Chowdhury et al., 1991, Science 254:1802-1805; van Beusechem. et al., 1992, Proc. Natl. Acad. Sci. USA 89:7640-19; Kay et al., 1992, Human Gene Therapy 3:641-647; Dai et al., 1992, Proc. Natl. Acad. Sci. USA 89:10892-10895; Hwu et al., 1993, J. Immunol. 150:4104-4115; U.S. Pat. No. 4,868,116; U.S. Pat. No. 4,980,286; PCT Application WO 89/07136; PCT Application WO 89/02468; PCT Application WO 89/05345; and PCT Application WO 92/07573). Recombinant retroviral vectors capable of transducing and expressing genes inserted into the genome of a cell can be produced by transfecting the recombinant retroviral genome into suitable packaging cell lines such as PA317 and Psi-CRIP (Comette et al., 1991, Human Gene Therapy 2:5-10; Cone et al., 1984, Proc. Natl. Acad. Sci. USA 81:6349). Recombinant adenoviral vectors can be used to infect a wide variety of cells and tissues in susceptible hosts (e.g., rat, hamster, dog, and chimpanzee) (Hsu et al., 1992, J. Infectious Disease, 166:769), and also have the advantage of not requiring mitotically active cells for infection.

(221) Any viral vector capable of accepting the coding sequences for the transcript(s) to be expressed can be used, for example, vectors derived from adenovirus (AV); adeno-associated virus (AAV); retroviruses (e.g., lentiviruses (LV), Rhabdoviruses, murine leukemia virus); herpes virus, and the like. The tropism of viral vectors can be modified by pseudotyping the vectors with envelope proteins or other surface antigens from other viruses, or by substituting different viral capsid proteins, as appropriate.

(222) For example, lentiviral vectors featured in the invention can be pseudotyped with surface proteins from vesicular stomatitis virus (VSV), rabies, Ebola, Mokola, and the like. AAV vectors featured in the invention can be made to target different cells by engineering the vectors to express different capsid protein serotypes. Techniques for constructing AAV vectors which express different capsid protein serotypes are within the skill in the art; see, e.g., Rabinowitz J E et al. (2002), J Virol 76:791-801, the entire disclosure of which is herein incorporated by reference.

(223) Selection of recombinant viral vectors suitable for use in the invention, methods for inserting nucleic acid sequences for expressing the transcripts into the vector, and methods of delivering the viral vector to the cells of interest are within the skill in the art. See, for example, Dornburg R (1995), Gene Therap. 2: 301-310; Eglitis M A (1988), Biotechniques 6: 608-614; Miller A D (1990), Hum Gene Therap. 1: 5-14; Anderson W F (1998), Nature 392: 25-30; and Rubinson D A et al., Nat. Genet. 33: 401-406, the entire disclosures of which are herein incorporated by reference.

(224) Viral vectors can be derived from AV and AAV. A suitable AV vector for expressing the transcripts featured in the invention, a method for constructing the recombinant AV vector, and a method for delivering the vector into target cells, are described in Xia H et al. (2002), Nat. Biotech. 20: 1006-1010. Suitable AAV vectors for expressing the transcripts featured in the invention, methods for constructing the recombinant AV vector, and methods for delivering the vectors into target cells are described in Samulski R et al. (1987), J. Virol. 61: 3096-3101; Fisher K J et al. (1996), J. Virol, 70: 520-532; Samulski R et al. (1989), J. Virol. 63: 3822-3826; U.S. Pat. No. 5,252,479; U.S. Pat. No. 5,139,941; International Patent Application No. WO 94/13788; and International Patent Application No. WO 93/24641, the entire disclosures of which are herein incorporated by reference.

(225) The promoter driving transcript expression in either a DNA plasmid or viral vector featured in the invention may be a eukaryotic RNA polymerase I (e.g., ribosomal RNA promoter), RNA polymerase II (e.g., CMV early promoter or actin promoter or U1 snRNA promoter) or generally RNA polymerase III promoter (e.g., U6 snRNA or 7SK RNA promoter) or a prokaryotic promoter, for example the T7 promoter, provided the expression plasmid also encodes T7 RNA polymerase required for transcription from a T7 promoter. The promoter can also direct transgene expression to the pancreas (see, e.g., the insulin regulatory sequence for pancreas (Bucchini et al., 1986, Proc. Natl. Acad. Sci. USA 83:2511-2515)).

(226) In addition, expression of the transcript can be precisely regulated, for example, by using an inducible regulatory sequence and expression systems such as a regulatory sequence that is sensitive to certain physiological regulators, e.g., circulating glucose levels, or hormones (Docherty et al., 1994, FASEB J. 8:20-24). Such inducible expression systems, suitable for the control of transgene expression in cells or in mammals include regulation by ecdysone, by estrogen, progesterone, tetracycline, chemical inducers of dimerization, and isopropyl-beta-D-1-thiogalactopyranoside (IPTG). A person skilled in the art would be able to choose the appropriate regulatory/promoter sequence based on the intended use of the dsRNA transgene.

(227) Generally, recombinant vectors capable of expressing transcript molecules are delivered as described below, and persist in target cells. Alternatively, viral vectors can be used that provide for transient expression of transcript molecules. Such vectors can be repeatedly administered as necessary. Once expressed, the transcript binds to target RNA and modulates its function or expression. Delivery of transcript expressing vectors can be systemic, such as by intravenous or intramuscular administration, by administration to target cells ex-planted from the patient followed by reintroduction into the patient, or by any other means that allows for introduction into a desired target cell.

(228) Transcript expression DNA plasmids are typically transfected into target cells as a complex with cationic lipid carriers (e.g., Oligofectamine) or non-cationic lipid-based carriers (e.g., Transit-TKO). Multiple lipid transfections for dsRNA-mediated knockdowns targeting different regions of a single PROC gene or multiple PROC genes over a period of a week or more are also contemplated by the invention. Successful introduction of vectors into host cells can be monitored using various known methods. For example, transient transfection can be signaled with a reporter, such as a fluorescent marker, such as Green Fluorescent Protein (GFP). Stable transfection of cells ex vivo can be ensured using markers that provide the transfected cell with resistance to specific environmental factors (e.g., antibiotics and drugs), such as hygromycin B resistance.

(229) The delivery of the vector containing the recombinant DNA can by performed by abiologic or biologic systems. Including but not limited to liposomes, virus-like particles, transduction particles derived from phage or viruses, and conjugation.

(230) 8) Reporters for Transcript Assay

(231) In some embodiments, the nucleic acid construct comprises a reporter sequence (e.g., a reporter gene sequence). The reporter gene encodes a reporter molecule that produces a signal when expressed in a cell. In some embodiments, the reporter molecule can be a detectable or selectable marker. In certain embodiments, the reporter molecule can be a fluorescent reporter molecule, such as a green fluorescent protein (GFP), yellow fluorescent protein (YFP), cyan fluorescent protein (CFP), blue fluorescent protein (BFP), or red fluorescent protein (RFP). In other embodiments, the reporter molecule can be a chemiluminescent protein.

(232) Reporter molecules can be a bacterial luciferase, an eukaryotic luciferase, a fluorescent protein, an enzyme suitable for colorimetric detection, a protein suitable for immunodetection, a peptide suitable for immunodetection or a nucleic acid that function as an apatamer or that exhibits enzymatic activity.

(233) Selectable markers can also be used as a reporter. The selectable marker can be an antibiotic resistance gene, for example.

(234) 9) Cells and Target Genes for Transcript Reporter Assay

(235) Examples of cells that can be used for detection include Gram-positive and Gram-negative bacteria, such as S. aureus, E. coli, K. pneumoniae, etc., fungi such as Streptomyces coelicolor, and other eukaryotic cells, including cells from humans, other mammals, insects, invertebrates, or plants.

(236) Target transcripts can include any endogenous transcript, whether coding or non-coding. Target transcripts can be derived from eukaryotic and prokaryotic cells, including, for example, mecA transcript in S. aureus cells (indicative of MRSA), the tcdB transcript in C. difficile (indicative of toxigenic C. diff), and HPV E6/E7 transcripts in cervical epithelial cells (indicative of cervical cancer). Genes associated with infectious agents, such as viruses, can be targets as well, including HIV, HPV, etc. Other examples of target genes include non-coding RNA such as transfer RNA (tRNA) and ribosomal RNA (rRNA), as well as RNAs such as snoRNAs, microRNAs, siRNAs, snRNAs, exRNAs, and piRNAs and ncRNAs.

EXAMPLES

(237) Below are examples of specific embodiments for carrying out the present invention. The examples are offered for illustrative purposes only, and are not intended to limit the scope of the present invention in any way. Efforts have been made to ensure accuracy with respect to numbers used (e.g., amounts, temperatures, etc.), but some experimental error and deviation should, of course, be allowed for.

(238) The practice of the present invention will employ, unless otherwise indicated, conventional methods of protein chemistry, biochemistry, recombinant DNA techniques and pharmacology, within the skill of the art. Such techniques are explained fully in the literature. See, e.g., T. E. Creighton, Proteins: Structures and Molecular Properties (W.H. Freeman and Company, 1993); A. L. Lehninger, Biochemistry (Worth Publishers, Inc., current addition); Sambrook, et al., Molecular Cloning: A Laboratory Manual (2nd Edition, 1989); Methods In Enzymology (S. Colowick and N. Kaplan eds., Academic Press, Inc.); Remington's Pharmaceutical Sciences, 18th Edition (Easton, Pa.: Mack Publishing Company, 1990); Carey and Sundberg Advanced Organic Chemistry 3.sup.rd Ed. (Plenum Press) Vols A and B(1992).

Example 1: Silent Mutation/Complementation Packaging System

(239) The following is an example of the design and construction of a silent mutation/complementation-based packaging system for producing non-replicative transduction particles.

(240) The materials used for developing the packaging system are listed below:

(241) Bacterial Strains: N1706, an E. coli K-12 P1 c1-100 Tn9 lysogen

(242) Vectors: Y14439 (pBHR1 backbone)

(243) The following GenBank accession numbers (N.B., the sequences referred to by accession number are those listed in the database as of the priority date of this application) or SEQ ID NOs. can be used for the vector backbone and cassette sequences: X06758 (bacterial luciferase genes luxAB) SEQ ID NO:1 (Native P1 pac-site) SEQ ID NO:3 (P1 lytic replicon containing the C1 repressor-controlled P53 promoter, the promoter P53 antisense, the repL genes, and an in-frame deletion of the kilA gene) SEQ ID NO:4 (Pblast promoter driving luxAB expression)

(244) Construction of N1706(Pac): pacA Mutated Strain:

(245) An exemplary sequence of a pacA mutated sequence is shown in SEQ ID NO: 2, shown in the informal sequence listing below. The mutation can be accomplished by constructing the mutated sequence via gene synthesis and then replacing the native sequence in N1706 with the mutated sequence via an allelic exchange approach.

(246) Construction of the GWP10001 Reporter Vector:

(247) The GWP10001 vector contains the pBHR1 origin of replication exhibiting broad Gram-negative activity, two selectable markers for kanamycin and chloramphenicol, the native bacteriophage P1 pac-site sequence, the luxA and luxB genes are from Vibrio harveyi operatively linked to the constitutive blasticillin promoter (Pblast), and the P1 lytic replicon containing the C1 repressor-controlled P53 promoter, the promoter P53 antisense, the repL genes, and an in-frame deletion of the kilA gene.

(248) FIG. 2 shows the resulting vector (GWP10001, SEQ ID NO:11), which can be constructed in a variety of manners that are known to one of skill in the art including obtaining the cassettes via PCR from their native sources or via gene synthesis and assembly of the vector via traditional restriction enzyme-based cloning or alternative techniques such as Gibson assembly.

(249) Silent/Complementation Packaging System:

(250) The packaging system includes the pacA mutant strain N1706(pac) complemented with the vector pGWP10001. As known to one of skill in the art, the manner of constructing this system can be accomplished by transformation N1706(pac) with vector pGWP10001. The vector pGWP10001 can be maintained in cultures of the transformed N1706(pac) by growing the transformant in the presence of 50 ug/mL of kanamycin.

(251) Production of Transduction Particles Carrying Plasmid DNA:

(252) Non-replicative transduction particles carrying vector pGWP10001 can be produced from N1706(pac) transformants via thermal induction at 42 C. Incubation at 42 C. results in induction of the P1 lytic cycle in which the prophage excises from the N1706 genome, produces phage structural elements, and packages pGWP10001 concatameric DNA formed by the lytic replicon in progeny phage particles, as depicted in FIG. 1. The resulting cell lysate is then collected and contains non-replicative transduction particles, each consisting of bacteriophage P1 particles carrying a linear concatamer of pGWP10001 DNA.

Example 2: Deletion/Complementation Packaging System

(253) The following is an example of the design and construction of a deletion/complementation-based packaging system for producing non-replicative transduction particles.

(254) The materials used for developing the packaging system are listed below:

(255) Bacterial Strains:

(256) RN4220 is a restriction defective S. aureus strain that is a non-lysogenic derivative of NCTC 8325 and is an efficient recipient for E. coli DNA. It was first described in Kreiswirth, B. N. et al., The toxic shock syndrome exotoxin structural gene is not detectably transmitted by a prophage. Nature, 1983. 305(5936): p. 709-712.

(257) RN10616 is derived by lysogenizing RN4220 with bacteriophage 80. Ubeda, C. et al., Specificity of staphylococcal phage and SaPI DNA packaging as revealed by integrase and terminase mutations. Molecular Microbiology, 2009. 72(1): p. 98-108.

(258) ST24 is derived from deleting the small terminase gene terS from the lysogenized bacteriophage 80 in RN10616. Ubeda, C. et al., Specificity of staphylococcal phage and SaPI DNA packaging as revealed by integrase and terminase mutations. Molecular Microbiology, 2009. 72(1): p. 98-108.

(259) Vectors:

(260) Examples of plasmids that can be used as source plasmids for cassettes, in some embodiments of the invention are described in Charpentier, E., et al., Novel Cassette-Based Shuttle Vector System for Gram Positive Bacteria. Appl. Environ. Microbiol., 2004. 70(10): p. 6076-6085.

(261) The following GenBank accession numbers can be used for cassette sequences: SEQ ID NO:5 (S. aureus pT181 plasmid origin or replication copy number variant pT181cop-623 repC) M21136 (tetA(M)) SEQ ID NO:12 (P.sub.clpB promoter sequence) SEQ ID NO:9 (11 small terminase (terS) gene sequence) L09137 (amp ColE1 ori) X06758 (luxAB) M62650 (Transcription Termination)

(262) terS Deletion:

(263) The construction of the terS knockout strain ST24 can be accomplished via an allelic-exchange-based strategy resulting in an in-frame deletion removing most of the coding sequence of the 80 small terminase gene. The details of this strategy are described in Ubeda, C. et al., Specificity of staphylococcal phage and SaPI DNA packaging as revealed by integrase and terminase mutations. Molecular Microbiology, 2009. 72(1): p. 98-108.

(264) An exemplary sequence of a terS knockout strain is shown in SEQ ID NO:13, (shown in the sequence listing below). SEQ ID NO:13 is a RN10616 genomic sequence loci showing the 80 terS deletion and complementation.

(265) Vector Construction:

(266) The GW80A0001 vector is an E. coli/S. aureus shuttle vector. The vector contains S. aureus (pT181cop-623 repC) and E. coli (ColE1ori) origins of replication, the selectable markers for ampicillin (amp) and tetracycline (tet(M)) resistance for selection in E. coli and S. aureus, respectively, the 11 small terminase (terS) gene sequence that includes its own promoter, the luxA and luxB genes are from Vibrio harveyi operatively linked to the constitutive S. aureus P.sub.clpB promoter, and a transcription termination sequence (TT).

(267) FIG. 4 shows the resulting vector (pGW80A0001, SEQ ID NO:14), which can be constructed in a variety of manners that are known to one of skill in the art. In one example, the tet(M) cassette and luxAB genes can be obtained via PCR amplification from the publically available pCN36 and pCN58 vectors (Charpentier, E., et al.). P.sub.clpB can be obtained from PCR amplification from S. aureus RN4220 and terS can be obtained via PCR amplification from RN10616. A vector backbone can be obtained by removing the ermC gene from the publically available vector pCN48 (Charpentier, E., et al.), and the various components of the final vector pGW80A0001 can be assembled onto this vector backbone via appropriately designed restriction enzyme-based cloning.

(268) Deletion/Complementation Packaging System:

(269) The packaging system can include the terS knockout strain ST24 complemented with the vector pGW80A0001 to generate strain GW24. As known to one of skill in the art, the manner of constructing this system can be accomplished by transformation ST24 with vector pGW80A0001. The vector pGW80A0001 can be maintained in cultures of the transformed ST24 by growing the transformant in the presence of 5 ug/mL of tetracycline.

(270) Production of Transduction Particles Carrying Plasmid DNA:

(271) Non-replicative transduction particles carrying vector pGW80A0001 can be produced from GW24 via a Mitomycin C-induction method that was first demonstrated in E. coli and is now a standard technique for obtaining prophages from lysogenized bacteria. Otsuji, N. et al., Induction of Phage Formation in the Lysogenic Escherichia coli K-12 by Mitomycin C. Nature, 1959. 184(4692): p. 1079-1080. This prophage induction method results in induction of the 80 lytic cycle in which the prophage excises from the GW24 genome, produces phage structural elements, and packages pGW80A0001 concatameric DNA in progeny phage particles, as depicted in FIG. 2. The resulting cell lysate is then collected and contains non-replicative transduction particles, each consisting of bacteriophage 80 particles carrying a linear concatamer of pGW80A0001 DNA.

Example 3: SaPIbov2-Based Packaging System Lacking Integrase

(272) The following is an example of the design and construction of a SaPIbov2-based packaging system for producing non-replicative transduction particles.

(273) The materials used for developing the packaging system are listed below:

(274) The following materials can be used to develop a SaPIbov2-based packaging system lacking integrase.

(275) Bacterial Strains:

(276) RN451 is a S. aureus strain lysogenized with bacteriophage 11.

(277) JP2131 is RN451 that has been lysogenized with SaPIbov2. See Maiques, E. et al., Role of Staphylococcal Phage and SaPI Integrase in Intra- and Interspecies SaPI Transfer. J. Bacteriol., 2007. 189(15): p. 5608-5616.

(278) JP2488 is strain JP2131 in which the int gene has been deleted from SapIbov2 (SaPIbov2int). Maiques, E. et al., Role of Staphylococcal Phage and SaPI Integrase in Intra-and Interspecies SaPI Transfer. J. Bacteriol., 2007. 189(15): p. 5608-5616.

(279) Bacteriophage:

(280) Bacteriophage 11 can be obtained from S. aureus strain RN0451 via a Mitomycin C-induction method that was first described in E. coli and is now a standard technique for obtaining prophages from lysogenized bacteria. Otsuji, N. et al., Induction of Phage Formation in the Lysogenic Escherichia coliK-12 by Mitomycin C. Nature, 1959. 184(4692): p. 1079-1080.

(281) Promoters:

(282) P.sub.clpB can be used as a promoter in this example. The clpB gene promoter is a constitutive promoter used for controlling the expression of the int gene. The S. aureus clpB (P.sub.clpB) gene promoter sequence was first described in 2004. Frees, D., et al., Clp ATPases are required for stress tolerance, intracellular replication and biofilm formation in Staphylococcus aureus. Molecular Microbiology, 2004. 54(5): p. 1445-1462. It was also first employed for controlling the gene expression in a plasmid in 2004. Arnaud, M., A. Chastanet, and M. Debarbouille, New Vector for Efficient Allelic Replacement in Naturally Nontransformable, Low-GC-Content, Gram Positive Bacteria. Appl. Environ. Microbiol., 2004. 70(11): p. 6887-6891. The promoter can be obtained from S. aureus RN4220 using primers described in 2004. Id.

(283) Production of 11/SaPIbov2Int Co-Lysogen (RN451(11 SaPIbov2Int)):

(284) The strain JP2488(11 SaPIbov2int) can be produced by lysogenizing JP2488 with 11.

(285) Deletion of 11 terS (RN451(11terS SaPIbov2Int)):

(286) The strain RN451(11terS SaPIbov2int) can be produced by deleting the 11 terS gene from RN451(11SaPIbov2int), as described in Tormo, M. A. et al., Staphylococcus aureus Pathogenicity Island DNA Is Packaged in Particles Composed of Phage Proteins. J. Bacteriol., 2008. 190(7): p. 2434-2440.

(287) Incorporation of P.sub.clpB-Int into S. aureus Genome (RN451(11terS SaPIbov2Int P.sub.clpB-Int)):

(288) RN451(11terS SaPIbov2int P.sub.clpB-int) can be produced by first fusing P.sub.clpB and int via standard molecular biology techniques then inserting the P.sub.clpB-int fusion into the genome of RN451(11terS SaPIbov2int) and then selecting clones that have P.sub.clpB-int inserted outside of the 11 and SaPIbov2 regions.

(289) Production of 11 Particles Carrying Only SaPIbov2Int P.sub.clpB-Int Concatamers:

(290) 11 particles carrying only SaPIbov2int P.sub.clpB-int concatamers can be produced via mitomycin-C induction of RN451(11terS SaPIbov2int P.sub.clpB-int), as described by Otsuji, N. et al., Induction of Phage Formation in the Lysogenic Escherichia coliK-12 by Mitomycin C. Nature, 1959. 184(4692): p. 1079-1080. The cell lysate contains non-replicative transduction particles, each consisting of bacteriophage 11 structural proteins carrying a linear concatamer of GI-derived DNA.

(291) One of skill in the art will understand how to construct the NRTPs of the invention using the above-referenced materials and well-known molecular biology and genetic techniques in the art.

Example 4: terS Deletion/Complementation-Based SarS Reporter Transduction Particles

(292) The following is an example of an inducer reporter-based SarS reporter system that employs a terS deletion/complementation-based non-replicative transduction particle.

(293) Reporter Gene:

(294) Bacterial luciferase (luxAB). The luxA and luxB genes are from Vibrio harveyi. They lack a transcriptional promoter and each contains their own ribosomal binding site.

(295) Spa gene promoter (P.sub.spa): The spa gene promoter will be used for controlling the expression of the luxAB genes.

(296) Construction of P.sub.spa-luxAB Fusion:

(297) The luxAB genes can be fused to the P.sub.spa promoter sequence such that the luxAB genes are operatively linked to the P.sub.spa promoter.

(298) Construction of the luxAB-Expressing Reporter Vector

(299) The luxAB-expressing reporter vector can be constructed via standard molecular biological techniques by incorporating the P.sub.spa-luxAB fusion product into the MCS of the shuttle vector depicted below.

(300) ##STR00001##

(301) E. coli/S. aureus shuttle vector that carries a S. aureus (pT181cop-623 repC) and E. coli (ColElori) origins of replication, genes for ampicillin (amp) and tetracycline (tet(M)) resistance, the 11 small terminase (terS) gene under the control of a constitutive promoter (P.sub.clpB), a multiple cloning site (MCS), and a transcription termination sequence (TT).

(302) GenBank Accession Numbers for Cassette Sequences:

(303) J01764 (pT181 replicons)

(304) M21136 (tetA(M))

(305) Accession Number not Yet Available (P.sub.clpB)

(306) AF424781 REGION: 16526 . . . 16966 (terS)

(307) L09137 (amp ColE1 ori)

(308) M62650 (TT)

(309) Propagation of the vector for conducting in vitro manipulations and for verification of manipulations can be accomplished via the E. coli Top 10 and the final modified vector can then be introduced into S. aureus RN0451terS. Transduction particles carrying shuttle vector can be produced from the RN0451terS transformants via a Mitomycin C-induction method that was first described in E. coli 1959 and is now a standard technique for obtaining prophages from lysogenized bacteria. Otsuji, N., et al., Induction of Phage Formation in the Lysogenic Escherichia coliK-12 by Mitomycin C. Nature, 1959. 184(4692): p. 1079-1080. The cell lysate is then collected and contains non-replicative transduction particles each consisting of bacteriophage 11 structural proteins carrying a linear concatamer of plasmid DNA capable of reporting on the presence of SarS in target S. aureus cells.

Example 5: terS Deletion/Complementation-Based R-Lactamase Reporter Transduction Particles

(310) The following is an example of an intracellular enzyme reporter-based -lactamase reporter system that employs a terS deletion/complementation-based non-replicative transduction particle.

(311) Reporter Gene:

(312) Renilla luciferase (ruc)

(313) Promoter:

(314) The promoter can be P.sub.blaZ. The constitutive beta-lactamase promoter can be used for driving the expression of the mc gene.

(315) Caged Substrate:

(316) Caged coelenterazine-phosphate as described in Daniel Sobek, J. R., Enzyme detection system with caged substrates, 2007, Zymera, Inc.

(317) Construction of P.sub.blaZ-ruc Fusion:

(318) The ruc genes can be fused to the P.sub.blaZ promoter sequence such that the ruc genes are operatively linked to the P.sub.blaZ promoter.

(319) Construction of the Ruc-Expressing Reporter Vector:

(320) The ruc-expressing reporter vector can be constructed via standard molecular biological techniques by incorporating the P.sub.blaZ-ruc fusion product into the MCS of the shuttle vector depicted in Section V, A, 3), i) above.

(321) Propagation of the vector for conducting in vitro manipulations and for verification of manipulations can be accomplished via the E. coli Top 10 and the final modified vector can then be introduced into S. aureus RN0451terS. Transduction particles carrying shuttle vector can be produced from the RN0451terS transformants via a Mitomycin C-induction method that was first described in E. coli 1959 and is now a standard technique for obtaining prophages from lysogenized bacteria. Otsuji, N., et al., Induction of Phage Formation in the Lysogenic Escherichia coliK-12 by Mitomycin C. Nature, 1959. 184(4692): p. 1079-1080. The cell lysate is then collected and contains NRTPs each consisting of bacteriophage 11 structural proteins carrying a linear concatamer of plasmid DNA capable of expressing Renilla luciferase within viable S. aureus cells within the 11 host range.

Example 6: terS Deletion/Complementation-Based Intracellular Molecule Reporter Transduction Particles

(322) The following is an example of an intracellular molecule reporter-based reporter system that employs a terS deletion/complementation-based non-replicative transduction particle.

(323) Promoter:

(324) The promoter can be P.sub.blaZ. The constitutive beta-lactamase promoter can be used for driving the expression of the ruc gene.

(325) Switchable Aptamer:

(326) Switchable aptamers can be designed and constructed as described in Samie Jaffrey, J. P., Coupled recognition/detection system for in vivo and in vitro use, 2010, Cornell University.

(327) Fluorophore Substrate:

(328) Corresponding fluorophore substrates in conjunction with the above switchable aptamers can be designed and constructed as described in Samie Jaffrey, J. P., Coupled recognition/detection system for in vivo and in vitro use, 2010, Cornell University.

(329) Construction of P.sub.blaZ-SA Fusion:

(330) The SA gene can be fused to the P.sub.blaZ promoter sequence such that the SA gene is operatively linked to the P.sub.blaZ promoter.

(331) Construction of the SA-Expressing Reporter Vector:

(332) The SA-expressing reporter vector can be constructed via standard molecular biological techniques by incorporating the P.sub.blaZ-SA fusion product into the MCS of the shuttle vector depicted in Example 4 above. Propagation of the vector for conducting in vitro manipulations and for verification of manipulations can be accomplished via the E. coli Top 10 and the final modified vector can then be introduced into S. aureus RN0451terS. Transduction particles carrying shuttle vector can be produced from the RN0451terS transformants via a Mitomycin C-induction method that was first described in E. coli 1959 and is now a standard technique for obtaining prophages from lysogenized bacteria. Otsuji, N. et al., Induction of Phage Formation in the Lysogenic Escherichia coli K-12 by Mitomycin C. Nature, 1959. 184(4692): p. 1079-1080. The cell lysate is then collected and contains non-replicative transduction particles each consisting of bacteriophage 11 structural proteins carrying a linear concatamer of plasmid DNA capable of expressing the SA within viable S. aureus cells within the 11 host range.

Example 7: Non-Replicative Transduction Particle-Based Reporter System

(333) The non-replicative transduction particles described above can be used in a reporter system for detecting the presence of viable bacteria via the expression of a reporter molecule (e.g. luxAB). When this transduction particle introduces a reporter vector (e.g. pGW80A0001) into a cell within the host range of the transduction particle, cells in which the promoter (e.g. P.sub.clpB) is recognized by the cells transcription machinery are able to drive the expression of the reporter molecule within that cell.

(334) To test the functionality of non-replicative transduction particles as reporters for detecting the presence of S. aureus cells, various MSSA/MRSA reporter assays were developed. In an embodiment, a non-replicative transduction particle was developed from a S. aureus-specific bacteriophage, and the bacterial luciferase genes luxAB under the control of a constitutive promoter were incorporated. When the non-replicative transduction particle delivered the reporter nucleic acid into S. aureus, the constitutive promoter expressed luxAB suitable for reporting on the presence of a viable S. aureus.

(335) In addition, the antibiotic cefoxitin was added prior to, simultaneously with, or after the addition of the transduction particles to a sample containing S. aureus cells. If the cells were not phenotypically resistant to cefoxitin (i.e., were not MRSA), luminescence was decreased or eliminated, indicating that the cells were MSSA. If, however, the cells were phenotypically resistant to cefoxitin (i.e., were MRSA), increased or detectable luminescence was observed, indicating that the cells were MRSA.

(336) Non-Replicative Transduction Particle-Based Viable Cell Reporter Assay Function

(337) The function of the non-replicative transduction particle as a reporter was assayed. The transduction host range of the bacteriophage 80-based non-replicative transduction particle was examined in 101 clinical MRSA isolates. The transduction assay was conducted by exposing cultures of each bacterial isolate grown in modified TSB to GW24 cell lysate containing the non-replicative transduction particles and culturing the mixture on solid media containing tetracycline.

(338) In this example, the non-replicative transduction particle carried a tetracycline selectable marker. Cells transduced with the non-replicative transduction particles were expected to be resistant to tetracycline. In addition, transduction was examined via luminescence assay by exposing each bacterial isolate in liquid culture to cell lysate containing the non-replicative transduction particles and evaluating the mixture for bacterial luciferase luminescence activity after an incubation period.

(339) The transduction assay showed that the 80-based non-replicative transduction particle was able to transduce all of the 101 clinical isolates of MRSA and none of the non-S. aureus Staphylococci.

(340) FIG. 21 shows the results of the transduction assay in which 36 tetracycline-sensitive MRSA were exposed to transduction particles carrying pGW80A0001 and then were spotted onto media plates containing 5 ug/mL of tetracycline. The results show that all 36 MRSA strains grew on the media containing tetracycline due to transduction with pGW80A0001. Control experiments in which MRSA isolates were spotted onto tetracycline containing media without exposure to transduction particles showed no growth (not shown). Furthermore, plasmid isolation from transduced MRSA strains demonstrated recovery of the pGW80A0001 plasmid as confirmed via sequencing of the isolated plasmid. The transduction results thus demonstrated that the origin of replication of the reporter plasmid exhibits activity on all of the MRSA isolates tested.

(341) FIG. 22 illustrates the luminescence measured from 80 clinical isolates of MRSA and 28 clinical isolates of methicillin sensitive S. aureus (MSSA) transduced with the transduction particle. In the experiment, cultures of MRSA and MSSA were grown to an optical density at 600 nm of 0.1 and then 100 uL of the cultures grown in Modified TSB were mixed with 10 uL of GW24 cell lysates containing transduction particles and further incubated at 37 C. for a period of 4 hours prior to assaying for luminescence. Luminescence measurements were conducted by adding 10 uL of a 1 mM solution of Decanal, an aldehyde that triggers a luminescent reaction within cells expressing bacterial luciferase. As expected, luminescence was observed from both MRSA and MSSA transduced with the S. aureus-specific non-replicative transduction particle. Furthermore, when cefoxitin was added to the cell cultures at the same time as the addition of transduction particles, luminescence was observed from MRSA but not from MSSA, thus demonstrating the ability for the transduction particles to report on both the presence of MSSA and of MRSA. The luminescence results thus demonstrate that the promoter driving luxAB expression exhibits activity on all of the S. aureus isolates tested.

(342) Optimization of Non-Replicative Transduction Particle-Based Viable Cell Reporter MRSA AssayTransduction Particle Reagent Formulation

(343) The production and formulation of the non-replicative transduction particle reagent was optimized to a final formulation. In summary, a 15 L scale fermentation was performed using TSB media including peroxide induction of GW24. The 15 L fermenter batch was inoculated from a 200 mL overnight seed culture (an inoculum ratio of 1.3% (v/v)). The culture was induced at an O.D. of 0.8 with hydrogen peroxide and cooled to 25 C. post induction without pH or DO control. Culture supernatant was harvested by tangential flow filtration (TFF) the following morning for the purpose of clarifying the phage transduction particles from the cell debris. The material was then further concentrated and diafiltered into SM Buffer without gelatin and stored at 2-8 C. prior to final sterile filtration and storage.

(344) A detailed summary of the process is outlined below:

(345) Seed Flask Growth

(346) (1) Inoculate 200 mL of TSB containing 5 ug/mL tetracycline with GW24 (2) Incubate at 37 C., 200 RPM for 10-18 hours.
Fermentation Innoculation (15 L TSB with 5 ug/mL Tetracycline) (1) Prepare the fermenter skid with the following fermentation conditions: 37 C., agitation at 250 RPM, airflow at 15 LPM, and backpressure at 3 psig. (2) Inoculate the fermentor using the 200 mL overnight seed culture.
Induce Culture (1) Once the OD600 nm reaches 0.8 (0.6-0.9), induce the culture with 0.5 mM H2O2 (2) Increase temperature setpoint of fermenter to 42 C.
Post-Induction Conditions and Monitoring (1) Once 30 minute induction is complete, reset temperature target for fermenter to 25 C. (2) One hour post cooling, turn off air feed to fermenter and set agitation to zero (3) Monitor the fermentation culture at hour intervals, or more frequently as necessary, until the OD600 nm has decreased to or below 0.40.
Harvest/Clarification (1) After the fermentation culture OD600 has reached a minimum less than or equal to 0.40, take a 20 mL aseptic sample and add 30 L of Benzonase to the fermentor. (2) Reset agitation to 250 rpm. Allow 60 minutes with agitation for Benzonase incubation. (3) Clarify the EOF sample with a 15 minute centrifugation at 3000 g. (4) Pass the clarified material through a 0.45 uM membrane filter
Concentration and Buffer Exchange (1) Concentrate the clarified culture by TFF using 500 kDa flat sheet membrane 10-fold. (2) Diafilter the concentrated culture at a constant volume against SM Buffer without gelatin using the 500 kDa TFF membrane used for concentration
Final Filtration (1) Filter the concentrated buffer exchanged material through a 0.2 m filter. (2) Store the final filtered phage material at 2-8 C.

(347) Various other reagents and formulations can be used as known to those of skill in the art to derive the formulation.

(348) Optimization of Non-Replicative Transduction Particle-Based Viable Cell Reporter MRSA AssayGrowth Media Formulation

(349) A growth media formulation was optimized for the NRTP-based viable cell reporter MRSA assay. In order to produce luminescence in the NRTP-based MRSA Assay, the media needs to be balanced for Staphylococcus aureus growth and have adequate concentration of cations and additives to favor NRTP transduction. The TSBmod media used in assays prior to this development study was known to have precipitation issues that would affect the stability of the media. Growth media formulation required stability in the final formulation with a goal of 1 year at room temperature.

(350) Methods/Procedures: Cells Preparation for MRSA Assay (1) Ten unique strains of MRSA for the Subset Assay and one unique strains of MSSA were tested in the MRSA Assay. (2) Overnight cultures were started in a deep 96 well plate at a 1:50 dilution in TSB from a frozen one-time use stock and incubated at 37 C. on an orbital shaker for >15 hours. MRSA/MSSA (8 l) in TSB (392 l) (3) The next day, a day culture at a 1:50 dilution from the overnight culture was started in TSB in 96 well deep well plate (392 l TSB+8 l cells) and incubated at 37 C. on an orbital shaker for 4 hours. (4) Cells were spun in a centrifuge for 5 minutes at 1800 g force and 10 C., spent media was aspirated without disturbing the pellet. (5) Spun cells were washed in 50 mM Tris-HCl pH 7.2, centrifuged, buffer aspirated without disturbing pellet and re-suspended in 400 l RPMI. RPMI is used in order to reduce variability in the metabolic state of cells and to mimic low metabolism as found in clinical samples. (6) Plate was covered with airpore seal and incubated on bench for 48 hrs. (7) OD was read by transferring 200 l of RPMI culture in a shallow well OD plate and blank well with RPMI media alone was used to subtract blank OD. (8) Cells were normalized to OD 0.1 in 100 l (9) Another dilution was made 1:10 in RPMI to yield an OD of 0.005

(351) Assay base media was prepared to be tested as shown in Table 2 and a representative set of media modifications in preparation for MRSA assay are shown in Table 3.

(352) TABLE-US-00002 TABLE 2 Base Media for Growth Media Formulation Development Components TSB B2 BSS-2 Notes Enzymatic Digest of Soybean 3 0 3 Adjust pH to Meal (g) 7.2 with 10N Enzymatic Digest of Casein (g) 17 10 10 NaOH. Yeast Extract (g) N/A 25 25 Autoclave or Sodium Chloride (g) 5 25 25 filter sterilize Dipotassium Phosphate (g) 2.5 1 0 alpha-D Glucose (g) 2.5 5 5 Volume (litre) 1 1 1

(353) TABLE-US-00003 TABLE 3 Base Media Modifications for Growth Media Formulation Development Concentration of salt/additives for modification Base media Mod CaCl2 MgCl2 BGP Tris-HCl EDTA HEPES (30 ml) number (mM) (mM) (mM) pH 7.0 (mM) (mM) (mM) B2 M53 5.0 2.0 0.0 50.0 10.0 0.0 BSS-2 M50 10.0 2.0 60.0 50.0 10.0 0.0 BSS-2 M54 6.7 3.3 60.0 50.0 0.0 0.0 BSS-2 M55 5.0 5.0 60.0 50.0 0.0 0.0 BSS-2 M56 6.7 3.3 60.0 0.0 0.0 10.0 BSS-2 M57 5.0 5.0 60.0 0.0 0.0 10.0 TSB M1 5.0 10.0 60.0 0.0 0.0 0.0 (original) TSB M58 5.0 10.0 60.0 0.0 11.1 0.0

(354) To each media preparation, NRTP and Cefoxitin was added according to Table 4 below to make the NRTP media reagent:

(355) TABLE-US-00004 TABLE 4 MRSA Assay Growth Media/Transduction particle reagent combination 30 ml media Final Concentration Cefoxitin 5 ug/ml GW24 Lysate 30X

(356) The MRSA Assay was run with the following steps: (1) Assay Plate Setup: Add 198 l of Phage Media Reagent and 2.0 l of each dilution of bacteria 0.05 OD and 0.005 OD in RPMI (roughly equivalent to 20,000 and 2,000 CFU/mL, respectively) or 2.0 uL of RPMI as a blank. (2) Incubate Assay Plate: Incubate Assay plate on orbital shaker at 100 rpm for 4 hours at 37 C. (3) Prepare Luminometer (Molecular Devices SpectraMax L): Wash reagent line with 70% ethanol followed by DI water then prime with the substrate reagent. Set up software as Fast Kinetic with injection of 50 L of substrate reagent at 250 l/sec after 10 baseline points and read at 40 points every 0.25 seconds. (4) Run Assay: Test each bacterial dilution plate, after letting plate equilibrate to room temperature for 5 minutes.

(357) Analysis (1) Determine cutoff by averaging blank RLU across all replicates and time points and adding three standard deviations. (2) Determine maximum RLU for each sample using SoftMaxPro. (3) Determine if the maximum RLU was greater than the cutoff RLU, and if so, then the sample data was used for comparisons of media performance. (4) Normalize all max RLU values to the Max RLU in TSB M1 (media in use until development started) for the strain being analyzed at the specific dilution. (5) Average the normalized RLU values across all MRSA strains for a particular media and its modification (6) Average the averages for the two dilution plates, ultimately leading to a single numerical value representing the fold increase in performance based on RLU of a particular media across 10 different MRSA strains in 2 cell dilutions tested.

(358) Results of NRTP-Based Viable Cell Reporter MRSA Assay

(359) Determination of Cutoff RLU: The average and standard deviation of the RLU was calculated across all time points (25) for each blank replicate (4). The cutoff was calculated for each plate as the average blank RLU plus three standard deviations.

(360) Determination of Relative Improvements: The maximum RLU was exported for each sample (blanks, MSSA and MRSA at all dilutions) from SoftMaxPro and compared to the cutoff RLU. If the sample had 2 data points greater than the cutoff for phage concentration, then the max RLU value was utilized for analysis.

(361) The values were normalized by dividing a particular max RLU by the max RLU of its control condition (that strain in TSB M1-original media, at the dilution being analyzed). The ratios obtained were averaged across 10 MRSA for each media condition and each dilution, as shown in Table 5. The average across the two dilutions is also shown in the table.

(362) TABLE-US-00005 TABLE 5 MRSA Assay Results from Various Growth Media Formulations Average for Media Plate 1 Plate 2 both dilutions B2 M53 1.89 1.88 1.89 BSS-2 M50 1.37 1.47 1.42 BSS-2 M54 1.50 1.76 1.63 BSS-2 M55 1.82 2.90 2.36 BSS-2 M56 2.38 6.00 4.19 BSS-2 M57 2.00 3.92 2.96 TSB M1 1.00 1.00 1.00 TSB M58 1.18 0.96 1.07

(363) Conclusions

(364) BSS2-M56 exhibited the best performance on average across the various media tested. HEPES buffer based media performed better than Tris-HCl buffered media. HEPES is known to be a biologically favorable buffering system as opposed to Tris-HCl. B2 based base/broth had better performance than TSB based broth.

(365) Various other reagents and formulations can be used as known to those of skill in the art to derive the formulation. Other suitable formulations were developed via similar experiments as described above. Examples of other suitable formulations are included below in Tables 6, 7, and 8.

(366) TABLE-US-00006 TABLE 6 BSC Media Formulation BSC Components Amount Enzymatic Digest of Casein 14.5 g Yeast Extract 35.5 g Sodium Chloride 35.5 g alpha-D Glucose 7 g Total Vol 1 L

(367) TABLE-US-00007 TABLE 7 BSC Media Modification BSC-M64 Chemical Name Final (Assay) Conc BGP (mM) 60.0 HEPES (mM) 10.0 LiCl(mM) 84.0 BSC To 1 L

(368) TABLE-US-00008 TABLE 8 Transduction Particle Media Modification Transduction Particle Formulation (PM4) Chemicals Final (Assay) conc CaCl2 (M) 0.00667 MgCl2 (M) 0.00335 HEPES (M) 0.01000 GW24 lysate stock 0.01250 Sodium Azide (%) 0.0006 Water To 1 mL

(369) Optimization of Non-Replicative Transduction Particle-Based Viable Cell Reporter MRSA AssaySubstrate Reagent Formulation

(370) In order to produce luminescence in the MRSA Assay, the Substrate Reagent must include an aldehyde as a substrate for luciferase. An initially developed aliphatic aldehyde formulation (4.2 mM Tridecanal in TSB) was not stable and formed a heterogeneous emulsion rather than a solution. This example outlines the development of a Substrate Reagent formulation that addresses these issues with a goal of 6 months at room temperature or 2-8 C. stability.

(371) This example describes the steps that were taken to develop the Substrate Reagent to a final formulation.

(372) Methods/Procedures

(373) All screening and stability experiments were tested using a Model System that consists of S. aureus strain RN4220 harboring a LuxAB-expressing plasmid. The typical preparation and testing method was as follows. (1) Overnight Culture: 2 mL TSB+1 uL of 10 mg/mL Tetracycline+1 colony of Model System Bacteria from TSA plate, shaking at 225 rpm overnight at 37 C. (2) Day Culture: Diluted overnight culture 1:50 or 1:100 into TSB+5 ug/mL Tetracycline, shaking at 225 rpm for 1.5-2 hours at 37 C. (3) Normalize Day Culture: Measured 1 mL of day culture on Nanodrop with cuvette at 600 nm, blanking with TSB+5 ug/mL Tetracycline. Diluted to 0.1 OD with TSB+5 ug/mL Tetracycline. (4) Dilute Culture for Testing: Diluted 0.1 OD Culture with TSB+5 ug/mL Tetracycline to a 1:200, 1:2000 and 1:20000 dilution which was roughly equivalent to 100000, 10000 and 1000 CFU/mL. (5) Plate Bacteria: Added 200 uL of each dilution and a blank (TSB+5 ug/mL Tetracycline with no bacteria) in three replicates to a Greiner Bio-one white assay plate for each substrate to be tested. (6) Prepare Luminometer (SpectraMax L): Wash reagent line with 70% ethanol followed by DI water then prime with the substrate. Set up software as Fast Kinetic with injection of 50 uL substrate at 250 ul/sec after 10 baseline points and read at 40 points every 0.25 seconds. (7) Run Assay: Test each formulation of Substrate Reagents with washing and priming SpectraMax L between each substrate. Bring all Substrate Reagents to room temperature before testing.

(374) All confirmation experiments were tested using the MRSA Assay in order to ensure similar results on the actual assay as the Model System used to screen new formulations. (1) Prepare Culture: Ten MRSA low performing strains and one MSSA strain were grown to log-phase in TSB in a 2 mL deep well block. Cells were spun down, washed with 1PBS then resuspended in RPMI media. (2) Normalize Bacteria: Measure 200 uL of RPMI culture and RPMI blank in Greiner Bio-one clear plate on VersaMax at 600 nm. Subtract blank OD from each strain. Normalize each strain to 0.05 OD in RPMI media. (3) Dilute Bacteria: Dilute 0.05 OD culture 1:10 in RPMI media to 0.005 OD. (4) Prepare Phage Media Reagent: Add Phage, Cefoxitin and Sodium Pyruvate to BSS-M56 including: a. Cefoxitin (5 ug/mL) b. GW24 lysate stock (0.03) c. Sodium Pyruvate (0.025M) (5) Set up Assay Plate=Add 198 uL of Phage Media Reagent and 2 uL of each dilution of bacteria (0.05 OD and 0.005 OD in RPMI, roughly equivalent to 20000 or 2000 CFU/mL) or 2 uL of RPMI as a blank in two replicates. (6) Incubate Assay Plate=Incubate Assay plate on orbital shaker at 100 rpm (speed 3) for 4 hours at 37 C. (7) Prepare Luminometer (SpectraMax L)=Wash reagent line with 70% ethanol followed by DI water then prime with the substrate. Set up software as Fast Kinetic with injection of 50 uL substrate at 250 ul/sec after 10 baseline points and read at 40 points every 0.25 seconds. (8) Run Assay=Test each formulation of Substrate Reagents with washing and priming SpectraMax L between each substrate.

(375) Experiments for the development of Substrate Reagent formulation were designed to improve the following: (1) Improve solubility via adding surfactants (Tween 20, Triton X-100, NP-40, Brij-35, SNS, etc.), adding solvents (Ethanol, Methanol, DMSO, etc.), adding non-volatile oils (Castor Oil) (2) Improve stability via adding stabilizers (Triethanolamine, Cyclodextrin etc.), adding antioxidants (Vitamin E, Vitamin E Acetate, Vitamin E PEG 1000, Oxyrase, etc.), adjust method of Tridecanal addition (with surfactant, with solvent, into final solution, with antioxidant, etc.), storing Tridecanal and Substrate Reagent under nitrogen to reduce oxidation of aldehyde, and reducing possibility of microbial contamination by adding preservatives such as ProClin and by sterile filtration of the Substrate Reagent. (3) Improve Assay Performance via adjustment of the pH of the formulation and the pH buffer system (4) Improve overall performance via determining the aldehyde with highest RLU output (tested aldehydes from 6-14 carbons in multiple formulations to determine if an improvement in solubility, stability and assay performance was observed). (5) Improve overall performance via adding antifoam in order to reduce foaming during preparation of reagent and addition of reagent to sample during the assay.

(376) Analysis and Results

(377) The kinetic reaction was plotted for each sample and a line fit to the average at each read point of three replicates. Typically results showed at 1:2000 dilution of 0.1 OD model system bacteria, roughly equivalent to 10,000 CFU/mL or 2,000 CFU/assay.

(378) The normalized maximum RLU to that of the reference substrate reagent was analyzed for stability experiments. At each stability time point, maximum RLU for each sample was normalized to the reference substrate maximum RLU. Normalized Maximum RLU was plotted over time points and linear regression with 95% CI was plotted.

(379) Conclusions

(380) The key parameters adjusted from the reference formulation for producing a final Substrate Reagent formulation are summarized in Table 9.

(381) TABLE-US-00009 TABLE 9 Summary of Reagent Formulation Development Results Modification to Substrate Reagent Reason 4.2 mM Tridecanal + TSB Original Substrate Reagent Remove TSB Reduce possibility of contamination Add 1% Tween 20 Improve Solubility Adjust to pH 3 with 79.45% 0.1M Improve Assay Performance Citric Acid-19.55% 0.2M Sodium Phosphate Dibasic Buffer Add Tridecanal directly to Improve Stability concentrated surfactant Add Filtering of Substrate Reagent Improve Stability through 0.2 um PES membrane Add 0.05% ProClin 300 Improve Stability Add Triethanolamine Improve Stability Change 1% Tween 20 to 0.5% Triton Improve Stability, Improve X-100 Solubility Change from 79.45% 0.1M Citric Improve Assay Performance, Acid-19.55% 0.2M Sodium Phos- reduce possibility of precipita- phate Dibasic Buffer to 82% 0.1M tion with removal of phosphate Citric Acid-18% 0.1M Sodium buffer Citrate Buffer, remain at pH 3 Add 100 ppm Antifoam Y30 Improve Assay Performance Add 0.5% Vitamin E Acetate Improve Stability, reduce precipitation Change Primary Tridecanal Improve Assay Performance Manufacturer from Alfa Aesar to Sigma/OmegaChem Change 0.5% Vitamin E Acetate to Improve Assay Performance, 1-2% Vitamin E PEG 1000 Improve Solubility, Improve Stability

(382) Two Substrate Reagent Formulations were prepared for two different storage temperatures, one for storage at 2-8 C. and one at 18-24 C.

(383) Final Substrate Reagent Formulations Stored at 2-8 C.

(384) Formulation: 0.5% Triton X-100+4.2 mM Tridecanal+0.5% Vitamin E Acetate+100 ppm Antifoam Y30+0.5% Triethanolamine+82% 0.1 M Citric Acid+18% 0.1 M Sodium Citrate @pH3+0.05% ProClin 300. The formulation did not precipitate after 1 month at 2-8 C. and was able to detect MRSA strains the same as on Day 0.

(385) Final Substrate Reagent Formulations Stored at 18-24 C.

(386) Formulation: 0.5% Triton X-100+6.3 mM Tridecanal+100 ppm Antifoam Y30+0.5% Triethanolamine+82% 0.1 M Citric Acid+18% 0.1 M Sodium Citrate @pH3+2% a-Tocopherol-PEG 1000 Succinate+0.05% ProClin 300. The formulation did not precipitate after 1 month at 18-24 C. and was able to detect MRSA strains the same as on Day 0.

(387) Various other reagents and formulations can be used as known to those of skill in the art to derive the formulation.

(388) Analytical Performance of Non-Replicative Transduction Particle-Based Viable Cell Reporter MRSA Assay

(389) The analytical performance of the optimized NRTP MRSA assay was examined, including an analysis of the assay's limit of detection and an analysis of the cross-reactivity and microbial interference of the assay when challenged with non-target organisms.

(390) A) Limit of Detection Assay

(391) The Limit of Detection of the NRTP assay was assessed via determining the lowest amount of MRSA cells representing various strains that could produce a relative light unit (RLU) signal above that of a threshold determined from blank samples. MRSA strains included the SCCmec Types I, II, and IV as well as a MRSA strain carrying the mecA gene variant mecCa strain of MRSA that conventional FDA-cleared MRSA PCR assays have failed to detect.

(392) The following key materials were used in the clinical performance study:

(393) Growth Media Reagent: BSS-M56

(394) Substrate Reagent: Final Substrate Reagent Formulations to be stored at 18-24 C. as described above.

(395) Transduction Particle Reagent: BSS-M56 base with 10 ug/mL (i.e. 2 concentration) cefoxitin and transduction particle reagent as described above at 2 concentration.

(396) LoD Study Protocol:

(397) Overnight Culture:

(398) For each MRSA strain and a MSSA negative control strain, 2 mL of TSB were inoculated with a colony of the strain previously grown on TSA plates. Overnight MRSA cultures included 5 ug/mL cefoxitin. All samples were incubated overnight at 37 C. in a shaking incubator.

(399) Day Culture:

(400) 20 uL of each of the overnight cultures were transferred into a new culture tube containing 2 mL of Growth Media Reagent. The inoculums were then incubated at 37 C with shaking for approximately 1 hr 45 min, until the OD(600 nm) reached 0.1.

(401) Serial Dilutions: a) 1000 uL of each of the samples were dispensed into row A of 2 mL deep well 96-well plate. b) The remaining rows (B-H) were then filled with 900 uL of Growth Media Reagent. c) 10-fold serial dilutions were then prepared taking 100 uL from row A and mixing in row B, etc., such that row H contained samples of row A material at 10.sup.7 dilution.

(402) Enumeration of Bacterial Load:

(403) 5 uL of each well of row E was spotted onto a TSA plate which was then tilted to allow the spot of liquid to spread onto the plate (in order to later facilitate colony counting). (Row E is a 10.sup.4 dilution of row A). Plates were then incubated overnight at 37 C.

(404) Assay Preparation:

(405) a) Wells of a white 96 well assay plate were filled with 100 uL of 2 Transduction Particle Reagent.

(406) b) Rows F and G (i.e., 10.sup.5 and 10.sup.6-fold dilutions of row A, respectively) were then used to fill wells of the 96 well assay plate containing Transduction Particle Reagent such that each sample was added to the plate in four-replicates.

(407) c) The plate was then sealed with a breathable seal and incubated for 4 hours at 37 C. with moderate shaking, 50 rpm.

(408) At the end of 4 hours, the plate was remove from incubator and immediately measured for luminescence on a SpectraMax L that injected 50 l of the Substrate Reagent and measured luminescence for a period of 1 minute.

(409) Analysis:

(410) The luminescence data from each sample was plotted as RLU vs. time. Blank samples were used to determine a Cutoff calculated from all time points of the blank samples using the following formula: (Mean Blank RLU+3*SD Blank RLU)

(411) The average peak RLU post-substrate injection was then obtained for each sample in order to determine the sample of highest dilution for which an RLU value was generated that was above the blank samples Cutoff. The colony forming unit (CFU) counts at the highest dilution for which an RLU value was generated that was above the blank samples Cutoff was determined from the enumeration study, and this CFU count was reported as the LoD in the study.

(412) Results:

(413) The LoD for all MRSA samples tested was determined to be below 10 CFU. Table 11 summarizes the results of the lowest LoDs obtained in the study.

(414) TABLE-US-00010 TABLE 11 Results of the lowest LoDs obtained in the LoD study. SCCmec Type LoD (CFU) I 3 II 2 IV 3 mecC 1

(415) All MRSA strains tested resulted in fewer than 10 CFU detected with the NRTP assay above a Cutoff calculated from blank samples. MSSA did not generate RLU values above the blank samples Cutoff

(416) RLU values are shown at the highest dilution for which an RLU value was generated that was above the blank samples Cutoff were plotted as the average RLU value and standard deviation for the four replicates tested for each sample. The horizontal axis is set at the blank samples Cutoff and the CFU counts for the sample that generated each RLU data point is superimposed with the data. All MRSA samples generated RLU values above the Cutoff while MSSA did not.

(417) Cross-Reactivity and Microbial Interference Study

(418) A cross-reactivity and microbial interference study was performed. The purpose of the study was to test a set of bacterial strains commonly encountered in clinical samples and known to potentially be in the host range of the bacteriophage 80 in the MRSA Assay to see if there was cross reactivity or interference of these strains with phage or substrate used in the test.

(419) Previous experiments with clinical samples had resulted in false positive results with a presence of Enterococci faecalis and Staphylococcus epidermidis as indicated from the presence of blue and white colonies when plating on BBL CHROMagar Staph aureus plates. In addition, Listeria monocytogenes and Listeria innocua may be within the infective or penetrative host range of the phage 80 which may also contribute to cross-reactivity in the MRSA assay. The study tested Enterococci faecalis, Staphylococcus epidermidis, Listeria monocytogenes and Listeria innocua for cross reactivity/interference with Viability MRSA assay. Each strain was tested at high cell numbers in the order of 10.sup.6, 10.sup.7 or 10.sup.8 cells in the assay volume. Tests were done without the addition of GW24 lysate to address potential autoluminescence of strains.

(420) Experiment 1 tested various strains (MSSA-S121, NRS#9-Staphylococcus haemolyticus, NRS #6Staphylococcus epidermidis, ATCC 12228-Staphylococcus epidermidis, ATCC 15305Staphylococcus saprophyticus, ATCC 29212-Enterococcus. faecalis, ATCC 60193-Candida albicans, ATCC 12453-Proteus mirabilis) for luminescence at high cell numbers under normal assay conditions.

(421) Experiment 2: A subset of strains that were luminescent from Experiment 1 were re-assayed in the presence of various antibiotics at various concentrations to quench background luminescence.

(422) Experiment 3: E. faecalis and S32 (MRSA) were tested with various substrate formulations developed as described above without GW24 lysate and without incubation.

(423) Experiment 4: ATCC 33090-Listeria innocua and ATCC 19111-Listeria monocytogenes were tested for background signal and non-specific luminescence and retested with various substrate formulations developed as described above along with E. faecalis and S. epidermidis.

(424) Experiment 5: E. faecalis was retested with a final substrate formulation developed as described above.

(425) Substrate Reagent formulations tested in this study are summarized in Table 9.

(426) TABLE-US-00011 TABLE 10 Substrate Reagent Formulations Experi- ment Substrate Description 1 Original 1% Tween20 + 4.2 mM Tridecanal, pH 3.0 Substrate 2 Original Substrate 3 Substrate 1 6.3 mM Tridecanal + 0.5% Vitamin E Acetate, pH 3.0 Substrate 2 20 mM Nonanal + 0.5% Vitamin E Acetate, pH 3.0 Substrate 3 8.4 mM Tridecanal + 0.5% Vitamin E Acetate, pH 3.0 Substrate 4 6.3 mM Tridecanal + 1% a-Tocopherol-PEG 1000 Succinate, pH 3.0 4 Original 1% Tween20 + 4.2 mM Tridecanal, pH 3.0 substrate Substrate 5 0.5% Triton + 4.2 mM Tridecanal (Sigma) + 0.5% Vitamin E Acetate, pH 3.0 5 Substrate 6 6.3 mM Tridecanal + 2% VitE PEG, pH 3.0

(427) Methods/Procedures:

(428) The following were steps performed for the MRSA Assay.

(429) A) Strains Grown for Experiments 1-5

(430) On the day before the assay, an overnight culture was started in a deep 96 well plate at a 1:50 dilution in TSB from a frozen one-time use stock and incubated at 37 C. on an orbital shaker for >15 hours. Bacteria (8 uL) in TSB (392 uL).

(431) The absorbance of culture was measured on Versamax. The TSB was set as blank in template on SoftmaxPro. Optical density (OD) was measured at 600 nm.

(432) On the day of the assay, cells were re-suspended to an OD 0.5 to set up the assays. Prepared BSS-M56 for Experiments 1-5.

(433) B) Transduction Particle Media Reagent was Prepared for all Experiments 1, 2, 4 and 5 (No Transduction Particle Reagent Used in Experiment 3):

(434) 15 ug/mL cefoxitin+GW24 lysate stock from as described above at 30.

(435) C) Sample Preparation:

(436) Various dilutions were made from overnight cultures of strains. All strains were diluted BSS M56.

(437) D) MRSA Assay was Run for Experiments 1-5

(438) Media was loaded with or without phage and cefoxitin at 5 g/ml to assay plate. 2.5 ul cells were added. The assay plate was incubated with a plate lid at 37 C. on an orbital shaker with the speed set to approximately 100 rpm for 4 hours.

(439) Next, the assay plates were measured on the SpectraMax L with the following standard assay parameters:

(440) Fast Kinetic Luminescence

(441) Read for 20 time points at 0.5 second intervals. Substrate was injected with M injector with 50 uL/well at 250 ul/sec including 5 baseline reads. No incubation temperature was set and was read at room temperature.

(442) The SpectraMax L was primed with Substrate Reagent before running the assay.

(443) The results were analyzed with the following:

(444) A) Determined cutoff by averaging blank RLU across all replicates and time points and adding three standard deviations.

(445) B) Determined maximum RLU for each sample using SoftMaxPro.

(446) C) Determined if the maximum RLU was greater than the cutoff RLU, and if so, then the sample data was used for analysis.

(447) Results Summary

(448) Experiment 1: Various strains were tested for cross reactivity and interference using the Original Substrate formulation, out of those tested, NRS#9S. haemolyticus, NRS #6S. epidermidis and E. faecalis tested false positive in MRSA assay.

(449) Experiment 2: Out of the three strains tested, NRS #9 and E. faecalis tested MRSA positive with all Cefoxitin conditions tested. All three strains (NRS #9, E. faecalis, NRS #6) tested positive when no transduction particle reagent was used in the assay, indicating that non-specific luminescence was not transduction particle reagent-dependent but rather strain and substrate reagent dependent. Carb (Carbencillin) at all concentrations tested was effective in removing the false positive signal.

(450) Experiment 3: E. faecalis gave a positive signal without transduction particle reagent. MRSA strain S32 also gave a positive signal without transduction particle reagent. This result was indicative of the substrate reagent causing background luminescence. Substrate 4 was effective in eliminating background signal in the assay.

(451) Experiment 4: Strains ATCC 33090Listeria innocua, ATCC 19111-Listeria monocytogenes, were tested for luminescence with transduction particle reagent and substrate reagent as Listeria sp. can be within the host range of the bacteriophage used in the MRSA assay. Luminescence was observed from L. innocua with and without transduction particle reagent using Original Substrate formulation indicating that the luminescence was due to non-specific reaction potentially with the substrate. Substrate 5 was effective in eliminating luminescence from Listeria but not E. faecalis.

(452) Experiment 5: Retested E. faecalis with Substrate 6. In two independent runs on two different days with high load of cells at 0.5 OD, the assay yielded negative results.

(453) Conclusions

(454) The cross-reactivity study demonstrated background luminescence from several bacterial species at high loads. The light output did not require transduction particle reagent and certain substrate formulations utilizing phosphate ions contributed to non-specific signal. Because no light output from cross-reactive species was observed from the use of transduction particle reagent, in the case that 80 penetrates cross-reactive species, light output is prevented from the lack of activity of the S. aureus PclpB promoter that is operatively linked to the bacterial luciferase genes and/or the lack of activity of the S. aureus pT181 origin of replication within these species.

(455) Replacing the buffer from sodium phosphate dibasic in the formulation with sodium citrate and citric acid eliminated background luminescence from all cross-reactive species tested except for E. faecalis. Substrate 6 with the added ingredient of a tocopherol-PEG 1000 Succinate eliminated the remaining non-specific signal from E. faecalis.

(456) Clinical Performance of Non-Replicative Transduction Particle-Based Viable Cell Reporter MRSA AssayResults with Reference to Direct Plating onto CHROMAgar MRSA II

(457) A MRSA screening assay was developed employing 80-based luxAB expressing non-replicative transduction particles (NRTP). The assay consisted of adding NRTP to a clinical sample suspected of containing MRSA, incubating the sample for a period of 4 hours at 37 C., and then assaying the incubated sample by injecting an aldehyde into the sample while measuring for luminescence with a photomultiplier tube. The results of the assay were compared to that of commercially available chromogenic media designed for the detection of MRSA as a reference in order to determine the sensitivity and specificity of the assay. The NRTP-based assay was expected to correlate well with the culture-based reference since both require the presence of viable MRSA cells and both rely on the expression of the MRSA phenotype. The results showed excellent correlation with the reference.

(458) The purpose of the study was to determine the performance of the NRTP-based MRSA Assay with reference to CHROMAgar MRSA II from testing remnant nasal swab samples collected for the purpose of MRSA screening.

(459) Scope:

(460) De-identified nasal swab samples collected from patients for the purpose of MRSA surveillance by a clinical institution were tested for the presence of MRSA using the NRTP-based MRSA Assay, CHROMAgar MRSA II, CHROMAgar SA and Blood Agar TSA via direct plating and via enriched culture followed by plating. The results of the NRTP-based MRSA Assay were compared with the results of the CHROMAgar MRSA II assay in order to calculate the sensitivity and specificity of the NRTP-based MRSA Assay with reference to CHROMAgar MRSA II.

(461) The following key materials were used in the clinical performance study:

(462) Growth Media Reagent: BSS-M56

(463) Substrate Reagent: Final Substrate Reagent Formulations to be stored at 18-24 C. as described as described above

(464) Transduction Particle Reagent: BSS-M56 base with 10 ug/mL (i.e. 2 concentration) cefoxitin and transduction particle reagent as described above at 2 concentration.

(465) Methods/Procedures

(466) Clinical Sample Description:

(467) Sample transport tubes containing liquid Amies (220093BD BBL CultureSwab Liquid Amies) were provided to a clinical institution for collecting de-identified remnant nasal swabs collected by the clinical institution. Prior to placing the nasal swabs into the provided sample transport tube, the clinical institution used the swab for performing their own direct culture MRSA screening by streaking the swab onto a culture plate. More specifically, anterior nares specimens were collected at the clinical institution internal standard procedures and using the clinical institution's standard collection swab. The clinical institution then performed direct culture screening with the swab. The remnant swab was then added to the sample transport tube in which the swab tip was submerged in the Amies buffer in the sample transport tube. Samples were then kept at room temperature for 2-24 hours prior to further processing.

(468) Sample Handling:

(469) Upon receipt, samples were stored overnight at room temperature in a biosafety cabinet upright to ensure swab immersion in the sample transport tube Amies buffer. After overnight storage, samples were further processed as follows.

(470) Clinical Sample Preparation

(471) Using a 1 mL Pipette, 300 l of Growth Media Reagent was added to 15 mL falcon tubes.

(472) The swabs from remnant nasal swabs were removed from the original transport tube and immersed into the Growth Media Reagent in a corresponding falcon tube. The swab contents were then eluted into the Growth Media Reagent in the falcon tube by rolling it back and forth in the Growth Media Reagent 4-6 times. The swab was then placed back into the original transport tube and stored at 2-8 C. until the end of the study while the eluted clinical samples in the falcon tube were transferred to 1.5 mL tubes and kept at room temperature until further processing.

(473) Running the NRTP MRSA Assay:

(474) The following samples were loaded directly into a white 96 well assay plate.

(475) Clinical Samples: 100 l of the eluted material of each clinical sample in singlet.

(476) MRSA positive control: 2 l of a thoroughly mixed 0.1 OD culture of a known MRSA isolate into 98 uL of Growth Media Reagent in triplicate.

(477) MSSA negative control: 2 l of a thoroughly mixed 0.1 OD culture of a known MSSA isolate into 98 uL of Growth Media Reagent in triplicate.

(478) Blanks: 100 l of Growth Media Reagent in triplicate.

(479) To each sample, 100 L of Transduction Particle Reagent was added. The assay plate was then placed in an incubator set at 37 C., shaking on orbital shaker for 4 hours. At the end of 4 hours, the plate was removed from incubator and immediately measured for luminescence on a SpectraMax L that injected 50 l of the Substrate Reagent and measured luminescence for a period of 1 minute.

(480) Bacteria Plating for Clinical Sample CFU Enumeration:

(481) Each eluted clinical sample was plated in order to determine bacterial colony counts on CHROMAgar MRSA II, CHROMAgar SA and Blood Agar (TSA II) via direct and enriched culture as follows. Organism CFU counts were determined by direct plating. MRSA CFU counts were determined by plating on CHROMAgar MRSA II. S. aureus CFU counts were determined by plating on CHROMAgar SA plate. CFU counts of any organism whose growth is supported by Blood Agar TSA were determined by plating on Blood Agar TSA. In the case that direct plating did not produce colonies due to the load of organisms being below the limit of detection of the plates used, sample enrichment was also performed by incubating a portion of the eluted clinical sample in TSB overnight at 37 C. with shaking and then again plating the enriched culture on CHROMAgar MRSA II. All plates were incubated for 20-24 hours at 37 C. After incubation, the CFU counts of any colonies appearing on each plate were recorded.

(482) Analysis:

(483) The presence and CFU load of MRSA, S. aureus, and total organisms per eluted clinical sample were calculated based on the CFU counts obtained on CHROMAgar MRSA II, CHROMAgar SA, and Blood Agar TSA, respectively.

(484) NRTP Assay Analysis:

(485) Data from each sample were plotted as RLU vs. time.

(486) Cutoff Determination:

(487) The Assay Cutoff was calculated from all time points of the blank samples using the following formula: (Mean Blank RLU+3*SD Blank RLU).

(488) MRSA Positive Determination:

(489) The RLU of each time point after substrate injection was determined to be above or below the Assay Cutoff. If two or more data points after injection were above the Assay Cutoff then the sample was designated as MRSA Positive.

(490) Results:

(491) The MRSA positive results of the NRTP Assay were compared to those of the direct and enriched culture plating onto CHROMAgar MRSA II. The following calculations were conducted in order to determine the NTRP Assay Sensitivity and Specificity with reference to CHROMAgar MRSA II. True Positive (TP) Sample that produced a MRSA positive result on both the NRTP Assay and CHROMAgar MRSA II True Negative (TN) Sample that produced a MRSA negative result on both the NRTP Assay and CHROMAgar MRSA II False Positive (FP) Sample that produced a MRSA positive result on the NRTP Assay and a MRSA negative result on CHROMAgar MRSA II False Negative (FN) Sample that produced a MRSA negative result on the NRTP Assay and a MRSA positive result on CHROMAgar MRSA II Sensitivity=TP/(TP+FN) Specificity=TN/(TN+FP)

(492) Results with Reference to Direct Plating onto CHROMAgar MRSA II

(493) Table 11 shows following results were obtained comparing the NRTP Assay with reference to direct plating on CHROMAgar MRSA II.

(494) TABLE-US-00012 TABLE 11 NRTP Assay Results vs. Direct Plating on CHROMAgar MRSA II Results CHROMAgar CHROMAgar NRTP NRTP Total MRSA II MRSA II ASSAY ASSAY True True False False Samples Positive Negative Positive Negative Positive Negative Positive Negative 69 7 62 12 57 7 57 5 0

(495) Based on the above data, the sensitivity and specificity of the assay with reference to direct plating onto CHROMAgar MRSA II were calculated to be:

(496) Sensitivity=100%

(497) Specificity=92%

(498) Clinical Performance of Non-Replicative Transduction Particle-Based Viable Cell Reporter MRSA AssayResults with Reference to Enriched Culture, Followed by Plating onto CHROMAgar MRSA II

(499) Based on the results with reference to direct plating on CHROMAgar MRSA II, all clinical samples were re-tested with reference to enriched culture, followed by plating on CHROMAgar MRSA II. The rationale for the follow-on testing was based on the possibility that false positive results when compared to direct plating may indeed be true positives that were detected by the NRTP assay but may have been missed by direct plating. A portion of the remaining eluted swab samples were re-tested via the NRTP assay as described above. Another portion of the remaining eluted swab samples were also tested via enriched culture, followed by plating onto CHROMAgar MRSA II. Enriched culture testing consisted of adding 100 uL of the remaining eluted swab material to 2 mL of TSB and incubating at 37 C with shaking for a period of 18-24 hours. The resulting culture was then streaked onto CHROMAgar MRSA II in order to determine the presence of MRSA in the culture. Table 12 summarizes the data from both the direct plating and enrichment followed by plating assaysonly the samples that produced a MRSA positive result on either NRTP Assay or CHROMAgar MRSA II are shown.

(500) TABLE-US-00013 TABLE 12 NRTP Assay Results vs. Direct Plating and Enriched Culture followed by Plating on CHROMAgar MRSA II Only the samples that produced a MRSA positive result on either NRTP Assay or CHROMAgar MRSA II are shown. Direct Enrichment + Sample CHROMagar Enrichment + CHROMagar # NRTP Assay MRSA II NRTP Asssay MRSA II 1 + + + + 2 + + + + 3 + + + + 4 + + + + 5 + + + + 6 + + + + 7 + + + + 8 + + + 9 + + + 10 + + + 11 + + + 12 + +

(501) Table 13 shows following results were obtained comparing the NRTP Assay with reference to enriched culture of clinical samples, followed by plating on CHROMAgar MRSA II.

(502) TABLE-US-00014 TABLE 13 NRTP Assay Results vs. Enriched Culture Followed By Plating on CHROMAgar MRSA II Results CHROMAgar CHROMAgar NRTP NRTP Total MRSA MRSA ASSAY ASSAY True True False False Samples II Positive II Negative Positive Negative Positive Negative Positive Negative 69 11 58 12 57 11 57 1 0

(503) Based on the above data, the sensitivity and specificity of the assay with reference to enriched culture followed by plating onto CHROMAgar MRSA II was calculated to be: Sensitivity=100% Specificity=98.3%

Example 8: NRTP-Based Assay for Antimicrobial Susceptibility TestingCorrelation of Minimum Inhibitory Concentration to Luminescence Output

(504) In another example, a S. aureus cefoxitin susceptibility assay was developed to determine the minimum inhibitory concentration of cefoxitin required to inhibit the growth of cefoxitin resistant S. aureus. Unlike a MRSA cefoxitin resistance assay as described above, which differentiates cefoxitin sensitive from cefoxitin resistant S. aureus, the MRSA cefoxitin susceptibility assay in this example describes the development of an assay to determine the minimum amount of cefoxitin needed to inhibit the grown of S. aureus in the presence of cefoxitin.

(505) The following key materials were used in the clinical performance study:

(506) Growth Media Reagent:

(507) BSS-M56

(508) Substrate Reagent:

(509) Final Substrate Reagent Formulations to be stored at 1824 C. as described in Example 7.

(510) Transduction Particle Reagent:

(511) BSS-M56 base with 10 ug/mL (i.e. 2 concentration) cefoxitin and transduction particle reagent as described in Example 7 at 2 concentration MIC Study Protocol.

(512) Overnight Culture:

(513) For each MRSA strain (NRS35 and S7) and a MSSA negative control strain (MSSA121), 2 mL of TSB were inoculated with a colony of the strain previously grown on TSA plates. Overnight MRSA cultures included 5 ug/mL cefoxitin. All samples were incubated overnight at 37 C. in a shaking incubator.

(514) Day Culture:

(515) 20 uL of each of the overnight cultures were transferred into a new culture tube containing 2 mL of Growth Media Reagent. The inoculums were then incubated at 37 C with shaking for approximately 1 hr 45 min, until the OD(600 nm) reached 0.1.

(516) MIC Determination Via Plating:

(517) a) Each of the day cultures was streaked onto TSA plates containing cefoxitin at 4, 8, 16, 32, 64, and 128 ug/mL.

(518) b) Plates were incubated for 18 hours at 37 C to determine growth.

(519) NRTP Assay Preparation:

(520) a) Wells of a white 96 well assay plate were filled with 100 uL of 2 Transduction Particle Reagent.

(521) b) For each of the day cultures, five wells were then filled with 100 uL of day culture.

(522) c) For each of the day cultures, cefoxitin was added to one well each such that the cefoxitin concentration in the well was at 4, 8, 16, 32, 64, and 128 ug/mL.

(523) d) The plate was then sealed with a breathable seal and incubated for 4 hours at 37 C. with moderate shaking, 50 rpm.

(524) At the end of 4 hours, the plate was remove from incubator and immediately measured for luminescence on a SpectraMax L that injected 50 l of the Substrate Reagent and measured luminescence for a period of 1 minute.

(525) Analysis:

(526) The maximum luminescence value after Substrate Reagent addition from each sample was plotted. MSSA sample RLU values were used to determine a Cutoff calculated using the following formula: (Mean MSSA RLU+3*SD MSSA RLU).

(527) Results:

(528) FIG. 23 shows the results of S. aureus growth at 4, 8, 16, 32, 64, and 128 ug/mL of cefoxitin. FIG. 24 shows the RLU values obtained by the NRTP assay in the presence of 4, 8, 16, 32, 64, and 128 ug/mL cefoxitin. The x-axis in FIG. 24 is set at the MSSA RLU cutoff value.

(529) As can be seen in FIG. 23, MRSA NRS25 exhibited a MIC of 128 ug/mL cefoxitin while MRSA S7 exhibited a MIC of 64 ug/mL cefoxitin. Correspondingly, MRSA NRS25 exhibited appreciable luminescence above the MSSA RLU cutoff to a cefoxitin concentration up to 64 ug/mL cefoxitin while MRSA S7 exhibited luminescence above the MSSA RLU cutoff to a cefoxitin concentration up to 32 ug/mL.

(530) Based on the above data, the NRTP assay demonstrates that RLU values obtained from the assay correlate with MIC results and thus the NRTP assay may be used to develop antibiotic susceptibility assays.

Example 9: Transcript Reporter Assay: Mechanism of Conformational Change by RBS-Blocking Cis-Repression of Luxab Translation Activated by the mecA Gene Transcript of Mrsa

(531) As described above, a reporter transcript can be designed such that translation of the reporter gene sequence is blocked by cis-repression of the ribosome-binding site (RBS) of the reporter gene.

(532) The following tools were used for designing the reporter transcripts of the invention.

(533) 1) RNA secondary structure was calculated using secondary structure program, such as Mfold.

(534) 2) Intermolecular RNA interactions were calculated using a software program such as RNA-RNA InterACTion prediction using Integer Programming (RactIP).

(535) 3) RNA secondary structure was visualized using Visualization Applet for RNA (VARNA).

(536) FIG. 25 shows a secondary structure of the mecA transcript generated based on the lowest energy conformation calculated by MFold and visualized with VARNA. The terminal loop 23 (T23) contains a YUNR sequence UUGG consisting of bases 1,487-1,490 of the mecA transcript sequence. Analysis of the secondary structure of the mecA gene transcript revealed several ssRNA regions that were suitable for designing a cis-repressed luxAB reporter that can be de-repressed via interactions between the reporter and an ssRNA region.

(537) As shown in detail in FIG. 26, the terminal loop 23 (T23) of the mecA transcript contains a YUNR consensus sequence. A YUNR (pYrimidine-Uracil-Nucleotide-puRine) consensus sequence has been shown to be a critical target for intermolecular RNA complexes in natural systems. A cis-repressing sequence was designed to form a stem-loop structure with the RBS of the reporter sequence, such that the cis-repressing sequence blocks binding of an RNA polymerase to the RBS of the reporter sequence. The reporter sequence was exposed upon binding of the loop of the cis-repressing stem-loop structure with T23 of the mecA transcript.

(538) As shown in FIG. 27, a cis-repressing sequence 2701 was added to the 5 terminus of the luxAB genes and designed to form a stem-loop structure that blocks the RBS sequence (AAGGAA) 2702 of the luxA gene. The cis-repressing stem-loop structure was predicted to block the luxA RBS (AAGGAA) sequence, based on the lowest energy conformation of the luxAB transcript including the cis-repressing sequence at the 5 terminus of the luxAB transcript, as calculated by MFold and visualized with VARNA.

(539) The first 61 nucleotides of the cis-repressed luxAB genes are shown in FIG. 7, up to the start codon AUG of the luxA gene. The RBS sequence AAGGAA includes bases 47-52. This terminal loop of the reporter transcript was designed to interact with (bind to) the terminal loop 23 (T23) of the mecA transcript, which contains a YUNR sequence.

(540) The terminal loop of the cis-repressing sequence was designed to interact with T23 of the mecA transcript, such that hybridization of the cis-repressed luxAB transcript and the mecA transcript via the interaction of the loop from the cis-repressing stem-loop structure and T23 of the mecA transcript results in exposure of the RBS of the luxA gene. FIG. 28 shows the predicted inter-molecular interactions between the mecA T23 sequence and the cis-repressing sequence on the luxAB transcript calculated by RactIP and visualized by VARNA. Lines indicate base pairing between the mecA transcript and the cis-repressed luxAB transcript. The interaction between the two sequences results in exposure of the luxA RBS sequence AAGGAA and thus de-repression of the luxAB reporter.

Example 10: Transcript Reporter Assay: Methods of Detecting Target Transcripts or Genes Using a mecAluxAB Reporter System

(541) In another example, a method for detecting a target mecA gene is provided using a mecA-luxAB reporter system. Here, mecA is the target transcript, and luxAB is the reporter molecule.

(542) 1. Construction of the Reporter Construct

(543) A vector comprising a reporter construct encoding luxAB can be constructed via standard molecular biological techniques by incorporating the reporter construct into a shuttle vector capable of propagating in both E. coli and S. aureus. The vector can contain an origin of replication that is functional in E. coli and a selectable marker that is expressed in E. coli and suitable for allowing the growth of E. coli cells transformed with the vector and grown under selective conditions. The vector can also contain an origin of replication that is functional in S. aureus and a selectable marker that is expressed in S. aureus and suitable for allowing the growth of E. coli cells transformed with the vector and grown under selective conditions. Propagation of the vector for conducting in vitro manipulations and for verification of manipulations can be accomplished via a suitable laboratory cloning strain of E. coli and the final modified vector can then be introduced into S. aureus strains.

(544) The reporter construct can be first introduced into a S. aureus cell for transcribing the construct and producing the reporter transcript.

(545) 2. Construction of a Cis-Repressed Reporter Transcript

(546) Methods are provided for constructing a cis-repressed reporter transcript that can bind to a mecA-target transcript. The reporter transcript can be constructed via standard molecular biological techniques. The luxA and luxB genes serve as reporter genes and can be derived from Vibrio harveyi. The genes lack a transcriptional promoter, and each contains its own ribosomal binding site (RBS). When both the luxA and luxB genes are translated in a cell, the luxA and luxB proteins complex to form the active luciferase enzyme (LuxAB). See Farinha, M. A. and A. M. Kropinski, Construction of broad-host-range plasmid vectors for easy visible selection and analysis of promoters. J. Bacteriol., 1990. 172(6): p. 3496-3499.

(547) The cis-repressing sequence can be situated upstream of the luxAB genes and downstream of a promoter and includes a sequence that is complementary to the luxA RBS. A linker sequence can separate the complementary regions of the cis-repressing sequence and the luxA sequence. After transcription of the vector, the complementary regions of the cis-repressing sequence and the luxA RBS sequence complex, creating a stem loop that prevents docking of a ribosome and hence translation.

(548) The stem loop of the reporter transcript is designed to destabilize and form an open complex when it interacts with a naturally-occurring mecA transcript sequence (endogenous to the cell). To activate translation of the luxA gene sequence, the natural mecA transcript serves as a trans-activating RNA that binds to the cis-repressed reporter transcript and opens the inhibitory stem loop that sequesters the RBS of the luxA gene. Once the RBS is not sequestered by the cis-repressing sequence, translation of luxA can occur. Transcription of the reporter construct is accomplished via operatively linking the reporter sequence to a constitutive promoter, upstream of the cis-repressing sequence.

(549) An example of a target mecA gene sequence is shown in FIG. 29. The sequence is a mecA gene loci DNA sequence (from Staphylococcus aureus subsp. aureus SA40, complete genome GenBank: CP003604.1; SEQ ID NO:15) and can be used for generating a reporter construct comprising a reporter sequence and a cis-repressing sequence. The 10 position 2901, the transcription start position 2902, the RBS 2903, the coding region (in grey 904) and the transcription termination sequence 2905 are shown.

(550) FIG. 30 shows an exemplary mecA transcript sequence that can be used for designing a reporter transcript (SEQ ID NO:16), according to an embodiment of the invention. The RBS 3001 and the coding sequence 3002 are shown for mecA.

(551) FIG. 31 is an example of a luxAB gene loci DNA sequence that can be used for designing a reporter transcript, according to an embodiment of the invention. The luxAB gene loci DNA sequence was obtained from Vibrio fischeri genes luxA and luxB for luciferase alpha and beta subunits (GenBank: X06758.1) (SEQ ID NO: 17). The 10 position 3101, the transcription start position 3102, the RBS for lux A 3103, the luxA coding sequence 3104 (gray shading), the RBS for luxB 3105, and the luxB coding sequence (gray shading) 3106 are shown.

(552) FIG. 32 is an example of a luxAB transcript sequence that can be used for designing a reporter transcript (SEQ ID NO:18). The RBS for lux A 3201, the luxA coding sequence 3202 (gray shading), the RBS for luxB 3203, and the luxB coding sequence (gray shading) 3204 are shown.

(553) FIG. 33 is an example of a luxAB cis-repressed transcript sequence that can be used in a reporter transcript (SEQ ID NO:19). The cis-repressing sequence (dotted line box) 3301, the RBS for lux A 3302, the luxA coding sequence 3303 (gray shading), the RBS for luxB 3304, and the luxB coding sequence (gray shading) 3305 are shown.

(554) 3. Methods for Detecting the Presence or Absence of a mecA Target Transcript Using the Reporter Transcript

(555) Examples are provided for detecting the presence or absence of a mecA target transcript in a cell using the reporter transcripts of the invention. FIG. 34 shows an example of a cell comprising a vector 3400 that encodes a reporter transcript 1410, where there is no endogenous mecA transcript in the cell 3401 (e.g., the cell's genome does not contain the mecA gene). In this case, the cis-repressing sequence 3420 binds to the RBS 3430 of the luxAB genes. In some embodiments, the cis-repressing sequence 3420 can bind to a portion of or all of the RBS of the luxA gene, the RBS of the luxB gene, or both. This binding event blocks and prevents the translation of the luxAB genes, and the reporter molecule (e.g., luciferase) is not produced in the cell. Thus, no signal is detected, indicating the absence of the mecA gene in the cell.

(556) In another example, the cell includes an endogenous mecA transcript (e.g., the cell's genome contains the mecA gene). FIG. 35 shows a vector 3400 introduced into a cell 3401. The vector 3400 encodes the reporter transcript 3410, which includes a cis-repressing sequence 3420 and a reporter sequence (luxA and luxB genes). When the mecA transcript 3510 present in the cell binds to the cis-repressing sequence 1420, the inhibitory hairpin loop opens up and the RBS 3430 for the luxA gene is exposed. Translation of the reporter sequences (luxA and luxB) can occur, resulting in the formation of a luxAB enzyme 3520. The luxAB enzyme 3520 produces a detectable luminescent signal 3530. In this manner, the transcript reporter vector 3400 reports the presence of endogenous mecA transcripts 3510 within a cell 3401.

(557) While the invention has been particularly shown and described with reference to a preferred embodiment and various alternate embodiments, it will be understood by persons skilled in the relevant art that various changes in form and details can be made therein without departing from the spirit and scope of the invention.

(558) All references, issued patents and patent applications cited within the body of the instant specification are hereby incorporated by reference in their entirety, for all purposes.

REFERENCES CITED

(559) 1. Michael G. Schmidt, D. A. S., Caroline Westwater, Joseph W. Dolan, Brian D. Hoel, Philip A. Werner, James S. Norris, Laura M. Kasman, Nucleic Acid Delivery and Expression, 2005. 2. Kreiswirth, B. N. et al., The toxic shock syndrome exotoxin structural gene is not detectably transmitted by a prophage. Nature, 1983. 305(5936): p. 709-712. 3. Ubeda, C. et al., Specificity of staphylococcal phage and SaPI DNA packaging as revealed by integrase and terminase mutations. Molecular Microbiology, 2009. 72(1): p. 98-108. 4. Otsuji, N. et al., Induction of Phage Formation in the Lysogenic Escherichia coliK-12 by Mitomycin C. Nature, 1959. 184(4692): p. 1079-1080. 5. Brantl, S. (2007) Regulatory mechanisms employed by cis-encoded antisense RNAs. Curr. Opin. Microbiol. 10, 102-109. 6. Isaacs, F. J. et al. (2004) Engineered riboregulators enable post-transcriptional control of gene expression. Nat. Biotechnol. 22, 841-847. 7. Pfeiffer, V. et al. (2009) Coding sequence targeting by MicC RNA reveals bacterial mRNA silencing downstream of translational initiation. Nat. Struct. Mol. Biol. 16, 840-846. 8. Opdyke, J. A. et al. (2004) GadY, a small-RNA regulator of acid response genes in Escherichia coli. J. Bacteriol. 186, 6698-6705. 9. Carriere, C., et al., Conditionally replicating luciferase reporter phages: Improved sensitivity for rapid detection and assessment of drug susceptibility of Mycobacterium tuberculosis. Journal of Clinical Microbiology, 1997. 35(12): p. 3232-3239. 10. Merten, O.-W. and M. Al-Rubeai, Viral Vectors for Gene Therapy: Methods and Protocols. Methods in Molecular Biology. Vol. 737. 2011. 11. Lofdahl, S., J. E. Sjostrom, and L. Philipson, CLONING OF RESTRICTION FRAGMENTS OF DNA FROM STAPHYLOCOCCAL BACTERIOPHAGE-PHI-11. Journal of Virology, 1981. 37(2): p. 795-801. 12. Charpentier, E., et al., Novel Cassette-Based Shuttle Vector System for Gram-Positive Bacteria. Appl. Environ. Microbiol., 2004. 70(10): p. 6076-6085. 13. Novick, R. P., I. Edelman, and S. Lofdahl, Small staphylococcus-auerus plasmids are transduced as linear multimers that are formed and resolved by replicative processes. Journal of Molecular Biology, 1986. 192(2): p. 209-220. 14. Westwater, C., et al., Development of a P1 phagemid system for the delivery of DNA into Gram-negative bacteria. Microbiology, 2002. 148(4): p. 943-950. 15. Norris, J. U., et al., Tissue-Specific and Pathogen-Specific Toxic Agents and Ribozymes. 1999. 16. Maiques, E., et al., Role of Staphylococcal Phage and SaPI Integrase in Intra- and Interspecies SaPI Transfer. J. Bacteriol., 2007. 189(15): p. 5608-5616. 17. Frees, D., et al., Clp ATPases are required for stress tolerance, intracellular replication and biofilm formation in Staphylococcus aureus. Molecular Microbiology, 2004. 54(5): p. 1445-1462. 18. Arnaud, M., A. Chastanet, and M. Debarbouille, New Vector for Efficient Allelic Replacement in Naturally Nontransformable, Low-GC-Content, Gram-Positive Bacteria. Appl. Environ. Microbiol., 2004. 70(11): p. 6887-6891. 19. Tormo, M. A., et al., Staphylococcus aureus Pathogenicity Island DNA Is Packaged in Particles Composed of Phage Proteins. J. Bacteriol., 2008. 190(7): p. 2434-2440. 20. Arthur, M., et al., The VanS sensor negatively controls VanR-mediated transcriptional activation of glycopeptide resistance genes of Tn1546 and related elements in the absence of induction. J. Bacteriol., 1997. 179(1): p. 97-106. 21. Karlsson, S., et al., Expression of Clostridium difficile Toxins A and B and Their Sigma Factor TcdD Is Controlled by Temperature. Infect. Immun., 2003. 71(4): p. 1784-1793. 22. Daniel Sobek, J. R., Enzyme detection system with caged substrates, 2007, Zymera, Inc. 23. Samie Jaffrey, J. P., Coupled recognition/detection system for in vivo and in vitro use, 2010, Cornell University. 24. Good, L., Translation repression by antisense sequences. Cellular and Molecular Life Sciences, 2003. 60(5): p. 854-861. 25. Sabine, B., Antisense-RNA regulation and RNA interference. Biochimica et Biophysica Acta (BBA)Gene Structure and Expression, 2002. 1575(1-3): p. 15-25.

INFORMAL SEQUENCE LISTING

(560) TABLE-US-00015 NativeP1pac-site SEQIDNO:1 CCACTAAAAAGCATGATCATTGATCACTCTAATGATCAACATGCAGGTGATCACATTGCGGC TGAAATAGCGGAAAAACAAAGAGTTAATGCCGTTGTCAGTGCCGCAGTCGAGAATGCGAAGC GCCAAAATAAGCGCATAAATGATCGTTCAGATGATCATGACGTGATCACCCGC P1pac-sitewithsilentmutations,lowercaseletters signifymutatedbases SEQIDNO:2 CCACTAAAAAGCATGATaATaGAcCACTCTAAcGAcCAACATGCAGGgGAgCACATTGCGGC TGAAATAGCGGAAAAgCAgAGgGTgAATGCCGTTGTCAGTGCCGCAGTCGAGAATGCGAAGC GCCAAAATAAGCGCATAAAcGAcCGTTCAGAcGAcCATGACGTtATtACCCGC P1lyticrepliconcontainingtheC1repressor- controlledP53promoter,thepromoterP53antisense, therepLgenes,andanin-framedeletionofthekilAgene SEQIDNO:3 CACTATAGGGCGAATTGGCGGAAGGCCGTCAAGGCCGCATTTGGGCCCGGCGCGCCGGATCC GCTAGCTCTAGACTGGCAGGTTTCTGAGCAGATCGTCCAACCCGATCTGGATCGGGTCAGAA AAATTTGCTCTAATAAATTTCGTTTTCTAAGTGCAAAGAATCACCATTTCGAGCTGGTGATT GAAGGTTGATGCAAATTTGGAGAAAAAATGCAACAAACATTCAATGCGGATATGAATATATC AAACCTTCATCAAAATGTCGATCCTTCAACCACTCTGCCCGTTATTTGTGGTGTTGAAATTA CGACCGACCGCGCTGGCCGTTACAACCTTAATGCTCTACACAGAGCGAGCGGACTCGGTGCC CATAAAGCGCCAGCTCAATGGCTAAGAACGCTGTCAGCTAAACAGCTCATCGAAGAGCTTGA AAAAGAAACTATGCAGAATTGCATAGTTTCGTTCACAAGCAATGGAAGCAGGATTTCTTTCA CGACTCGTATAACCGGCAAAGGTCAGCAGTGGCTGATGAAGCGATTGCTTGATGCTGGTGTG CTGGTACCTGTCGCGGCAACGCGCTAACAGACGTAGTAAGAACCACCAGCATTGTAATGCTG GCTAAAGTCACTTTCCTGAGCTGTATAACGATGAGCGATTTTACTTTTTCTGGCTATGAATT GGCCTGCTTTGTAACACACTCCGGTCTATCCCGTAGCGCCGGGCATATCCTGTCGCAATGTG CAAATCTCGCGGCAACAACCAGTGAATACTTCATTCACAAGCCTCACCGCCTGATCGCGGCA GAAACTGGTTATAGCCAATCAACCGTCGTTCGTGCATTCCGTGAAGCTGTAAACAAAGGAAT TCTGTCTGTAGAGATTGTTATCGGCGATCACCGTGAACGTCGCGCTAACCTGTACCGGTTTA CACCATCCTTTTTGGCCTTCGCACAACAAGCCAAAAATGCGCTGATAGAAAGCAAATTAAAG ATCTCTTCAGCGGCAACCAAGGTTAAAGCTGTTCTCGCTAAGACATTGGCTTTATTTAATTT TTTATCCACACCCCCATGTCAAAATGATACCCCCTCCCCCTGTCAGGATGACGTGGCAATAA AGAATAAGAAGTCACAAGTTAAAAAAACAAAAAGATCAGTTTCCGGCGGTGCCGGAACAACC AGCCTCAAAAAATTGACTTCATGGATCGCTAAGGCAAAAGCAAAGGCTGACAATCTGCGGTT ATCCAAAAAACGCACTCAAAAACATGAGTTCAAGCAGAAAGTAGAGGCGGCTGCGCGGAAAT ATGCTTACCTGAAGAACAAGCGTTCGCCTGATATTGGCGGGATATCAAACTTCGATAACCTA CCGCATTGCATGACGGTAAACGAAGCTCTTAATGCGGTTTTAGCCAAAAATAAAGATAACGA ACAATGGGGTATACCGGCAGGATTCAGAGGGTAATGAATTGCTCTAATTATAACCATGCATA CTTTCAACACCTCTAGTTTGCCATGAGGCAAACTCATAGGTGTCCTGGTAAGAGGACACTGT TGCCAAAACTGGACGCCCCATTATTGCAATTAATAAACAACTAACGGACAATTCTACCTAAC AATAAGTGGCTTAAAAAAACCCGCCCCGGCGGGTTTTTTTATCTAGAGCTAGCGGATCCGGC GCGCCGGGCCCTTCTGGGCCTCATGGGCCTTCCGCTCACTGCCCGCTTTCCAG Pblastpromotersequence SEQIDNO:4 CGTCAGGTGGCACTTTTCGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTCTAAATACA TTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAG GAAGAGT S.aureuspT181plasmidoriginorreplicationcopy numbervariantpT181cop-623repC SEQIDNO:5 TTTGCGGAAAGAGTTAGTAAGTTAACAGAAGACGAGCCAAACCTAAATGGTTTAGCAGGAAA CTTAGATAAAAAAATGAATCCAGAATTATATTCAGAACAGGAACAGCAACAAGAGCAACAAA AGAATCAAAAACGAGATAGAGGTATGCACTTATAGAACATGCATTTATGCCGAGAAAACTTA TTGGTTGGAATGGGCTATGTGTTAGCTAACTTGTTAGCGAGTTGGTTGGACTTGAATTGGGA TTAATCCCAAGAAAGTACCGGCTCAACAACCCATAAAGCCCTGTAGGTTCCGNCCAATAAGG AAATTGGAATAAAGCAATAAAAGGAGTTGAAGAAATGAAATTCAGAGAAGCCTTTGAGAATT TTATAACAAGTAAGTATGTACTTGGTGTTTTAGTAGTCTTAACTGTTTACCAGATAATACAA ATGCTTAAATAAAAAAAGACTTGATCTGATTAGACCAAATCTTTTGATAGTGTTATATTAAT AACAAAATAAAAAGGAGTCGCTCACGCCCTACCAAAGTTTGTGAACGACATCATTCAAAGAA AAAAACACTGAGTTGTTTTTATAATCTTGTATATTTAGATATTAAACGATATTTAAATATAC ATCAAGATATATATTTGGGTGAGCGATTACTTAAACGAAATTGAGATTAAGGAGTCGATTTT TTATGTATAAAAACAATCATGCAAATCATTCAAATCATTTGGAAAATCACGATTTAGACAAT TTTTCTAAAACCGGCTACTCTAATAGCCGGTTGGACGCACATACTGTGTGCATATCTGATCC AAAATTAAGTTTTGATGCAATGACGATCGTTGGAAATCTCAACCGAGACAACGCTCAGGCCC TTTCTAAATTTATGAGTGTAGAGCCCCAAATAAGACTTTGGGATATTCTTCAAACAAAGTTT AAAGCTAAAGCACTTCAAGAAAAAGTTTATATTGAATATGACAAAGTGAAAGCAGATAGTTG GGATAGACGTAATATGCGTATTGAATTTAATCCAAACAAACTTACACGAGATGAAATGATTT GGTTAAAACAAAATATAATAAGCTACATGGAAGATGACGGTTTTACAAGATTAGATTTAGCC TTTGATTTTGAAGATGATTTGAGTGACTACTATGCAATGTCTGATAAAGCAGTTAAGAAAAC TATTTTTTATGGTCGTAATGGTAAGCCAGAAACAAAATATTTTGGCGTGAGAGATAGTAATA GATTTATTAGAATTTATAATAAAAAGCAAGAACGTAAAGATAATGCAGATGCTGAAGTTATG TCTGAACATTTATGGCGTGTAGAAATCGAACTTAAAAGAGATATGGTGGATTACTGGAATGA TTGCTTTAGTGATTTACATATCTTGCAACCAGATTGGAAAACTATCCAACGCACTGCGGATA GAGCAATAGTTTTTATGTTATTGAGTGATGAAGAAGAATGGGGAAAGCTTCACAGAAATTCT AGAACAAAATATAAGAATTTGATAAAAGAAATTTCGCCAGTCGATTTAACGGACTTAATGAA ATCGACTTTAAAAGCGAACGAAAAACAATTGCAAAAACAAATCGATTTTTGGCAACATGAAT TTAAATTTTGGAAATAGTGTACATATTAATATTACTGAACAAAAATGATATATTTAAACTAT TCTAATTTAGGAGGATTTTTTTATGAAGTGTCTATTTAAAAATTTGGGGAATTTATATGAGG TGAAAGAATAATTTACCCCTATAAACTTTAGCCACCTCAAGTAAAGAGGTAAAATTGTTTAG TTTATATAAAAAATTTAAAGGTTTGTTTTATAGCGTTTTATTTTGGCTTTGTATTCTTTCAT TTTTTAGTGTATTAAATGAAATGGTTTTAAATGTTTCTTTACCTGATATTGCAAATCATTTT AATACTACTCCTGGAATTACAAACTGGGTAAACACTGCATATATGTTAACTTTTTCGATAGG AACAGCAGTATATGGAAAATTATCTGATTATATAAATATAAAAAAATTGTTAATTATTGGTA TTAGTTTGAGCTGTCTTGGTTCATTGATTGCTTTTATTGGGCCCACCTAGGCAAATATGCTC TTACGTGCTATTATTTAAGTGACTATTTAAAAGGAGTTAATAAATATGCGGCAAGGTATTCT TAAATAAACTGTCAATTTGATAGCGGGAACAAATAATTAGATGTCCTTTTTTAGGAGGGCTT AGTTTTTTGTACCCAGTTTAAGAATACCTTTATCATGTGATTCTAAAGTATCCAGAGAATAT CTGTATGCTTTGTATACCTATGGTTATGCATAAAAATCCCAGTGATAAAAGTATTTATCACT GGGATTTTTATGCCCTTTTGGGTTTTTGAATGGAGGAAAATCACATGAAAATTATTAATATT GGAGTTTTAGCTCATGTTGATGCAGGAAAAACTACCTTAACAGAAAGCTTATTATATAACAG TGGAGCGATTACAGAATTAGGAAGCGTGGACAAAGGTACAACGAGGACGGATAATACGCTTT TAGAACGTCAGAGAGGAATTACAATTCAGACAGGAATAACCTCTTTTCAGTGGGAAAATACG AAGGTGAACATCATAGACACGCCAGGACATATGGATTTCTTAGCAGAAGTATATCGTTCATT ATCAGTTTTAGATGGGGCAATTCTACTGATTTCTGCAAAAGATGGCGTACAAGCACAAACTC GTATATTATTTCATGCACTTAGGAAAATGGGGATTCCCACAATCTTTTTTATCAATAAGATT GACCAAAATGGAATTGATTTATCAACGGTTTATCAGGATATTAAAGAGAAACTTTCTGCCGA AATTGTAATCAAACAGAAGGTAGAACTGTATCCTAATATGTGTGTGACGAACTTTACCGAAT CTGAACAATGGGATACGGTAATAGAGGGAAACGATAACCTTTTAGAGAAATATATGTCCGGT AAATCATTAGAAGCATTGGAACTCGAACAAGAGGAAAGCATAAGATTTCAGAATTGTTCTCT GTTCCCTCTTTATCATGGAAGTGCAAAAAGTAATATAGGGATTGATAACCTTATAGAAGTTA TTACTAATAAATTTTATTCATCAACACATCGAGGTCCGTCTGAACTTTGCGGAAATGTTTTC AAAATTGAATATACAAAAAAAAGACAACGTCTTGCATATATACGCCTTTATAGTGGAGTACT ACATTTACGAGATTCGGTTAGAGTATCAGAAAAAGAAAAAATAAAAGTTACAGAAATGTATA CTTCAATAAATGGTGAATTATGTAAGATTGATAGAGCTTATTCTGGAGAAATTGTTATTTTG CAAAATGAGTTTTTGAAGTTAAATAGTGTTCTTGGAGATACAAAACTATTGCCACAGAGAAA AAAGATTGAAAATCCGCACCCTCTACTACAAACAACTGTTGAACCGAGTAAACCTGAACAGA GAGAAATGTTGCTTGATGCCCTTTTGGAAATCTCAGATAGTGATCCGCTTCTACGATATTAC GTGGATTCTACGACACATGAAATTATACTTTCTTTCTTAGGGAAAGTACAAATGGAAGTGAT TAGTGCACTGTTGCAAGAAAAGTATCATGTGGAGATAGAACTAAAAGAGCCTACAGTCATTT ATATGGAGAGACCGTTAAAAAATGCAGAATATACCATTCACATCGAAGTGCCGCCAAATCCT TTCTGGGCTTCCATTGGTTTATCTGTATCACCGCTTCCGTTGGGAAGTGGAATGCAGTATGA GAGCTCGGTTTCTCTTGGATACTTAAATCAATCATTTCAAAATGCAGTTATGGAAGGGGTAC GCTATGGTTGCGAACAAGGATTATATGGTTGGAATGTGACGGATTGTAAAATCTGTTTTAAG TACGGTTTATACTATAGCCCTGTTAGTACTCCAGCAGATTTTCGGATGCTTACTCCTATTGT ACTGGAGCAAGCCTTTAGAAAAGCTGGAACAGAATTGTTAGAGCCATATCTTAGTTTTAAAG TTTATGCACCACAGGAATATCTTTCNCGGGCATATAACGATGCTCCCAAATATTGTGCAAAT ATCGTAAATACTCAACTGAAAAATAATGAGGTCATTATTATTGGAGAAATTCCTGCTCGATG TATTCAAGATTATCGCAATGATTTAACTTTTTTTACAAATGGGCTTAGTGTTTGTTTAGCAG AGCTAAAAGGATATCAGGTTACCACTGGCGAACCTGTTTGCCAGACCCGTCGTCTAAATAGT CGGATAGATAAAGTAAGATATATGTTCAATAAAATAACTTAGTGCGTTTTATGTTGTTATAT AAATATGGTTTCTTATTAAATAAGATGAAATATTCTTTAATATAGATTTGAATTAAAGTGGA AAGGAGGAGATTGTTATTATAAACTACAAGTGGATATTGTGTCCTATTTGTGGAAATAAAAC AAGACTACGAATACGAGTGGATACTATACTTAAAAATTTCCCTTTATACAGCCCCAAATGTA AGAACGAAACTTTAATTAATGTTCAAAAAATGAATATAATAACAATCAAAGAGCCAGACGCC AAGACGCAGAGCCGATAATTTGAGAAATGAAACTCTCATCTTATCGGCTCTTTTTGTTTATC TGAATTTTACTGACTAGCCTTCAATATTTCC P1pacAgene,lowercaseletterssignifydeleted pac-sitesequence SEQIDNO:6 GTGACCTGGGACGATCACAAGAAGAATTTTGCTCGCCTGGCGCGAGATGGTGGTTACACCAT CGCACAGTATGCCGCCGAGTTTAATCTTAACCCTAATACCGCACGTCGTTATCTCCGTGCCT TCAAAGAAGACACCAGGACTACGGACAGCCGCAAGCCAAATAAGCCAGTCAGGAAGccacta aaaagcatgatcattgatcactctaatgatcaacatgcaggtgatcacattgcggctgaaat agcggaaaaacaaagagttaatgccgttgtcagtgccgcagtcgagaatgcgaagcgccaaa ataagcgcataaatgatcgttcagatgatcatgacgtgatcacccgcGCCCACCGGACCTTA CGTGATCGCCTGGAACGCGACACCCTGGATGATGATGGTGAACGCTTTGAATTCGAAGTTGG CGATTACCTGATAGATAACGTTGAAGCGCGGAAGGCCGCGCGCGCTATGTTGCGTCGGTCCG GGGCCGATGTTCTGGAAACCACTCTTCTGGAAAAGTCTCTTTCTCATCTCCTTATGCTGGAG AACGCCAGGGATACGTGTATTCGCCTGGTGCAGGAAATGCGCGATCAGCAAAAAGACGATGA TGAAGGTACTCCGCCTGAATACCGTATCGCGAGCATGCTAAACAGCTGTTCCGCGCAGATAA GCAGCCTGATCAACACCATTTACAGCATCCGGAATAACTATCGAAAAGAAAGCCGGGAGGCG GAAAAGCACGCTTTATCTATGGGGCAAGCTGGCATTGTTAAGCTGGCATACGAACGAAAGCG TGAAAATAACTGGTCAGTGCTGGAAGCGGCTGAATTCATCGAGGCGCATGGAGGAAAAGTGC CGCCCCTGATGCTGGAGCAAATCAAAGCCGATCTGCGTGCTCCTAAGACCAATACCGATGAT GAGGAAAACCAAACAGCATCTGGCGCTCCATCACTTGAAGATCTGGATAAAATCGCGCGAGA ACGGGCCGCCAGCCGCCGCGCTGATGCCGCATTGTGGATTGAGCATCGTAGAGAAGAAATTG CCGATATCGTCGATACAGGTGGTTATGGTGATGTCGATGCGGAAGGCATATCAAACGAAGCA TGGCTTGAACAGGATCTGGACGAAGACGAGGAGGAAGACGAAGAAGTTACCCGCAAACTGTA CGGGGATGATGATTAA NativeP1pacAgene SEQIDNO:7 GTGACCTGGGACGATCACAAGAAGAATTTTGCTCGCCTGGCGCGAGATGGTGGTTACACCAT CGCACAGTATGCCGCCGAGTTTAATCTTAACCCTAATACCGCACGTCGTTATCTCCGTGCCT TCAAAGAAGACACCAGGACTACGGACAGCCGCAAGCCAAATAAGCCAGTCAGGAAGCCACTA AAAAGCATGATCATTGATCACTCTAATGATCAACATGCAGGTGATCACATTGCGGCTGAAAT AGCGGAAAAACAAAGAGTTAATGCCGTTGTCAGTGCCGCAGTCGAGAATGCGAAGCGCCAAA ATAAGCGCATAAATGATCGTTCAGATGATCATGACGTGATCACCCGCGCCCACCGGACCTTA CGTGATCGCCTGGAACGCGACACCCTGGATGATGATGGTGAACGCTTTGAATTCGAAGTTGG CGATTACCTGATAGATAACGTTGAAGCGCGGAAGGCCGCGCGCGCTATGTTGCGTCGGTCCG GGGCCGATGTTCTGGAAACCACTCTTCTGGAAAAGTCTCTTTCTCATCTCCTTATGCTGGAG AACGCCAGGGATACGTGTATTCGCCTGGTGCAGGAAATGCGCGATCAGCAAAAAGACGATGA TGAAGGTACTCCGCCTGAATACCGTATCGCGAGCATGCTAAACAGCTGTTCCGCGCAGATAA GCAGCCTGATCAACACCATTTACAGCATCCGGAATAACTATCGAAAAGAAAGCCGGGAGGCG GAAAAGCACGCTTTATCTATGGGGCAAGCTGGCATTGTTAAGCTGGCATACGAACGAAAGCG TGAAAATAACTGGTCAGTGCTGGAAGCGGCTGAATTCATCGAGGCGCATGGAGGAAAAGTGC CGCCCCTGATGCTGGAGCAAATCAAAGCCGATCTGCGTGCTCCTAAGACCAATACCGATGAT GAGGAAAACCAAACAGCATCTGGCGCTCCATCACTTGAAGATCTGGATAAAATCGCGCGAGA ACGGGCCGCCAGCCGCCGCGCTGATGCCGCATTGTGGATTGAGCATCGTAGAGAAGAAATTG CCGATATCGTCGATACAGGTGGTTATGGTGATGTCGATGCGGAAGGCATATCAAACGAAGCA TGGCTTGAACAGGATCTGGACGAAGACGAGGAGGAAGACGAAGAAGTTACCCGCAAACTGTA CGGGGATGATGATTAA terSgene,lowercasecharacterssignifydeletedsequence SEQIDNO:8 ATGAACGAAAAACAAAAGAGATTCGCAGATGAATATATAATGAATGGATGTAATGGTAAAAA AGCAGCAATTTCAGCAggttatagtaagaaaacagcagagtctttagcaagtcgattgttaa gaaatgttaatgtttcggaatatattaaagaacgattagaacagatacaagaagagcgttta atgagcattacagaagctttagcgttatctgcttctattgctagaggagaacctcaagaggc ttacagtaagaaatatgaccatttaaacgatgaagtggaaaaagaggttacttacacaatca caccaacttttgaagagcgtcagagatctattgaccacatactaaaagttcatggtgcgtat atcgacaaaaaagaaattactcagaagaatattgagattaatattAGATCTATTGACCACAT ACTAAAAGTTCATGGTGCGTATATCGACAAAAAAGAAATTACTCAGAAGAATATTGAGATTA ATATTGGTGAGTACGATGACGAAAGTTAA SequencecontainingnativeterSgene SEQIDNO:9 AATTGGCAGTAAAGTGGCAGTTTTTGATACCTAAAATGAGATATTATGATAGTGTAGGATAT TGACTATCTTACTGCGTTTCCCTTATCGCAATTAGGAATAAAGGATCTATGTGGGTTGGCTG ATTATAGCCAATCCTTTTTTAATTTTAAAAAGCGTATAGCGCGAGAGTTGGTGGTAAATGAA ATGAACGAAAAACAAAAGAGATTCGCAGATGAATATATAATGAATGGATGTAATGGTAAAAA AGCAGCAATTTCAGCAGGTTATAGTAAGAAAACAGCAGAGTCTTTAGCAAGTCGATTGTTAA GAAATGTTAATGTTTCGGAATATATTAAAGAACGATTAGAACAGATACAAGAAGAGCGTTTA ATGAGCATTACAGAAGCTTTAGCGTTATCTGCTTCTATTGCTAGAGGAGAACCTCAAGAGGC TTACAGTAAGAAATATGACCATTTAAACGATGAAGTGGAAAAAGAGGTTACTTACACAATCA CACCAACTTTTGAAGAGCGTCAGAGATCTATTGACCACATACTAAAAGTTCATGGTGCGTAT ATCGACAAAAAAGAAATTACTCAGAAGAATATTGAGATTAATATTGGTGAGTACGATGACGA AAGTTAAATTAAACTTTAACAAACCATCTAATGTTTTCAACAG SaPibov2integrasegene SEQIDNO:10 TCATAAATATTTAACTATTTCTTTCTGTGTACTAGGGTACAAATGACCGTATCGGTTATATA CTTCATTACTATCAGCATGGCCTAAACGCTGTGCTATTACCATGATACTTGCGCCATGATTG ACTAGCATAGACGCATGGCTATGTCTTAACTCATGAATTACAATTCTAGGGAATGTCTGACC GTCTGGTAGTTGTTCATCTAATACTTTTAATGCAGCGGTAAACCAACGATCTATAGTTGATT CACTATAAGCTTTGAAGAATGTACCGAATAATACATAATCATCTTTATATACATTGTTTTCT TTGTACCATTTTAAATATTCTTTGATATCATTCATCATGTGAACAGGTAAGTATATATCACG TATTGCTGCTTTTGTTTTAGGGGCTGTCACTTCACCGTGATAGTCTGTTTTGTTAATATGTA TGAAATCATCATCATAGTTAATATCACGCCATGTGAGGGCTCTAATTTCGCCCTTACGTGCA CCAGAGTAAAACAGTAGCTTAAAGAATAACTTTTGTTGTTGTGTAGCTAAAGCCTCATAGAA TTGATTGAATTGTTCTAATGTCCAATAGTTCAAACGCTTATTTGATTCTATTTCAAAGTTAC CTACTAGAGAGGCTACATTTTGCTTTAGATCATGAAACTTCATAGCATGGTTAAGTAACGAT ACTAAGAACACGTGCATTTTCTTTAGGTACTCTCCAGAGTGTCCCTCTTTTAACTTCGTATT CTGAAACTTCATAATATCTTGTGTAGTCATATTAAACACGTCCATAGACTTAAAATAGGGTA GCAAATGGTTGTTTGTATGTGTCTTTAATGCTTTCACACTAGATGACTTACGACGTGCAGAA TACCACTCTATATACTCATCTACGAGCTTATCAAAGGGCAGTTTGTTTATCTGTCCTACACC CTCTAACTCGTCCATAATTTCATTACATTTCTTCAATGCCTCTTTACGCTGTTTAAAGCCAC TCTTTTTTATTTCTTTACGTTGATTAAATTTATCATAGTATTTTATACGAAAATAGTATGTA CCACGTTTAGCGTCTTTATATATGTTGTGGGATAGGTTTAAGTTGTGTTCTATGGGAATCAC pGWP10001fullsequence SEQIDNO:11 CTCGGGCCGTCTCTTGGGCTTGATCGGCCTTCTTGCGCATCTCACGCGCTCCTGCGGCGGCC TGTAGGGCAGGCTCATACCCCTGCCGAACCGCTTTTGTCAGCCGGTCGGCCACGGCTTCCGG CGTCTCAACGCGCTTTGAGATTCCCAGCTTTTCGGCCAATCCCTGCGGTGCATAGGCGCGTG GCTCGACCGCTTGCGGGCTGATGGTGACGTGGCCCACTGGTGGCCGCTCCAGGGCCTCGTAG AACGCCTGAATGCGCGTGTGACGTGCCTTGCTGCCCTCGATGCCCCGTTGCAGCCCTAGATC GGCCACAGCGGCCGCAAACGTGGTCTGGTCGCGGGTCATCTGCGCTTTGTTGCCGATGAACT CCTTGGCCGACAGCCTGCCGTCCTGCGTCAGCGGCACCACGAACGCGGTCATGTGCGGGCTG GTTTCGTCACGGTGGATGCTGGCCGTCACGATGCGATCCGCCCCGTACTTGTCCGCCAGCCA CTTGTGCGCCTTCTCGAAGAACGCCGCCTGCTGTTCTTGGCTGGCCGACTTCCACCATTCCG GGCTGGCCGTCATGACGTACTCGACCGCCAACACAGCGTCCTTGCGCCGCTTCTCTGGCAGC AACTCGCGCAGTCGGCCCATCGCTTCATCGGTGCTGCTGGCCGCCCAGTGCTCGTTCTCTGG CGTCCTGCTGGCGTCAGCGTTGGGCGTCTCGCGCTCGCGGTAGGCGTGCTTGAGACTGGCCG CCACGTTGCCCATTTTCGCCAGCTTCTTGCATCGCATGATCGCGTATGCCGCCATGCCTGCC CCTCCCTTTTGGTGTCCAACCGGCTCGACGGGGGCAGCGCAAGGCGGTGCCTCCGGCGGGCC ACTCAATGCTTGAGTATACTCACTAGACTTTGCTTCGCAAAGTCGTGACCGCCTACGGCGGC TGCGGCGCCCTACGGGCTTGCTCTCCGGGCTTCGCCCTGCGCGGTCGCTGCGCTCCCTTGCC AGCCCGTGGATATGTGGACGATGGCCGCGAGCGGCCACCGGCTGGCTCGCTTCGCTCGGCCC GTGGACAACCCTGCTGGACAAGCTGATGGACAGGCTGCGCCTGCCCACGAGCTTGACCACAG GGATTGCCCACCGGCTACCACTATAGGGCGAATTGGCGGAAGGCCGTCAAGGCCGCATTTGG GCCCGGCGCGCCGGATCCGCTAGCTCTAGACCTCTAGACCAGCCAGGACAGAAATGCCTCGA CTTCGCTGCTGCCCAAGGTTGCCGGGTGACGCACACCGTGGAAACGGATGAAGGCACGAACC CAGTGGACATAAGCCTGTTCGGTTCGTAAGCTGTAATGCAAGTAGCGTGCCCGTTCCGGGCC TTTTGACATGTGACTTTCGTTACCCTCGCGTCAAAAAGAGTTTTTACGAAAGGAAGCATAAG TGACCTGGGACGATCACAAGAAGAATTTTGCTCGCCTGGCGCGAGATGGTGGTTACACCATC GCACAGTATGCCGCCGAGTTTAATCTTAACCCTAATACCGCACGTCGTTATCTCCGTGCCTT CAAAGAAGACACCAGGACTACGGACAGCCGCAAGCCAAATAAGCCAGTCAGGAAGCCACTAA AAAGCATGATCATTGATCACTCTAATGATCAACATGCAGGTGATCACATTGCGGCTGAAATA GCGGAAAAACAAAGAGTTAATGCCGTTGTCAGTGCCGCAGTCGAGAATGCGAAGCGCCAAAA TAAGCGCATAAATGATCGTTCAGATGATCATGACGTGATCACCCGCGCCCACCGGACCTTAC GTGATCGCCTGGAACGCGACACCCTGGATGATGATGGTGAACGCTTTGAATTCGAAGTTGGC GATTACCTGATAGATAACGTTGAAGCGCGGAAGGCCGCGCGCGCTATGTTGCGTCGGTCCGG GGCCGATGTTCTGGAAACCACTCTTCTGGAAAAGTCTCTTTCTCATCTCCTTATGCTGGAGA ACGCCAGGGATACGTGTATTCGCCTGGTGCAGGAAATGCGCGATCAGCAAAAAGACGATGAT GAAGGTACTCCGCCTGAATACCGTATCGCGAGCATGCTAAACAGCTGTTCCGCGCAGATAAG CAGCCTGATCAACACCATTTACAGCATCCGGAATAACTATCGAAAAGAAAGCCGGGAGGCGG AAAAGCACGCTTTATCTATGGGGCAAGCTGGCATTGTTAAGCTGGCATACGAACGAAAGCGT GAAAATAACTGGTCAGTGCTGGAAGCGGCTGAATTCATCGAGGCGCATGGAGGAAAAGTGCC GCCCCTGATGCTGGAGCAAATCAAAGCCGATCTGCGTGCTCCTAAGACCAATACCGATGATG AGGAAAACCAAACAGCATCTGGCGCTCCATCACTTGAAGATCTGGATAAAATCGCGCGAGAA CGGGCCGCCAGCCGCCGCGCTGATGCCGCATTGTGGATTGAGCATCGTAGAGAAGAAATTGC CGATATCGTCGATACAGGTGGTTATGGTGATGTCGATGCGGAAGGCATATCAAACGAAGCAT GGCTTGAACAGGATCTGGACGAAGACGAGGAGGAAGACGAAGAAGTTACCCGCAAACTGTAC GGGGATGATGATTAATTAAAAAAACCCGCCCCGGCGGGTTTTTTTATCTAGAGCTAGCGGAT CCGGCGCGCCGGGCCCTTCTGGGCCTCATGGGCCTTCCGCTCACTGCCCGCTTTCCAGCACT ATAGGGCGAATTGGCGGAAGGCCGTCAAGGCCGCATTTGGGCCCGGCGCGCCGGATCCGCTA GCTCTAGACTGGCAGGTTTCTGAGCAGATCGTCCAACCCGATCTGGATCGGGTCAGAAAAAT TTGCTCTAATAAATTTCGTTTTCTAAGTGCAAAGAATCACCATTTCGAGCTGGTGATTGAAG GTTGATGCAAATTTGGAGAAAAAATGCAACAAACATTCAATGCGGATATGAATATATCAAAC CTTCATCAAAATGTCGATCCTTCAACCACTCTGCCCGTTATTTGTGGTGTTGAAATTACGAC CGACCGCGCTGGCCGTTACAACCTTAATGCTCTACACAGAGCGAGCGGACTCGGTGCCCATA AAGCGCCAGCTCAATGGCTAAGAACGCTGTCAGCTAAACAGCTCATCGAAGAGCTTGAAAAA GAAACTATGCAGAATTGCATAGTTTCGTTCACAAGCAATGGAAGCAGGATTTCTTTCACGAC TCGTATAACCGGCAAAGGTCAGCAGTGGCTGATGAAGCGATTGCTTGATGCTGGTGTGCTGG TACCTGTCGCGGCAACGCGCTAACAGACGTAGTAAGAACCACCAGCATTGTAATGCTGGCTA AAGTCACTTTCCTGAGCTGTATAACGATGAGCGATTTTACTTTTTCTGGCTATGAATTGGCC TGCTTTGTAACACACTCCGGTCTATCCCGTAGCGCCGGGCATATCCTGTCGCAATGTGCAAA TCTCGCGGCAACAACCAGTGAATACTTCATTCACAAGCCTCACCGCCTGATCGCGGCAGAAA CTGGTTATAGCCAATCAACCGTCGTTCGTGCATTCCGTGAAGCTGTAAACAAAGGAATTCTG TCTGTAGAGATTGTTATCGGCGATCACCGTGAACGTCGCGCTAACCTGTACCGGTTTACACC ATCCTTTTTGGCCTTCGCACAACAAGCCAAAAATGCGCTGATAGAAAGCAAATTAAAGATCT CTTCAGCGGCAACCAAGGTTAAAGCTGTTCTCGCTAAGACATTGGCTTTATTTAATTTTTTA TCCACACCCCCATGTCAAAATGATACCCCCTCCCCCTGTCAGGATGACGTGGCAATAAAGAA TAAGAAGTCACAAGTTAAAAAAACAAAAAGATCAGTTTCCGGCGGTGCCGGAACAACCAGCC TCAAAAAATTGACTTCATGGATCGCTAAGGCAAAAGCAAAGGCTGACAATCTGCGGTTATCC AAAAAACGCACTCAAAAACATGAGTTCAAGCAGAAAGTAGAGGCGGCTGCGCGGAAATATGC TTACCTGAAGAACAAGCGTTCGCCTGATATTGGCGGGATATCAAACTTCGATAACCTACCGC ATTGCATGACGGTAAACGAAGCTCTTAATGCGGTTTTAGCCAAAAATAAAGATAACGAACAA TGGGGTATACCGGCAGGATTCAGAGGGTAATGAATTGCTCTAATTATAACCATGCATACTTT CAACACCTCTAGTTTGCCATGAGGCAAACTCATAGGTGTCCTGGTAAGAGGACACTGTTGCC AAAACTGGACGCCCCATTATTGCAATTAATAAACAACTAACGGACAATTCTACCTAACAATA AGTGGCTTAAAAAAACCCGCCCCGGCGGGTTTTTTTATCTAGAGCTAGCGGATCCGGCGCGC CGGGCCCTTCTGGGCCTCATGGGCCTTCCGCTCACTGCCCGCTTTCCAGCCAGCCTTCGACC ACATACCCACCGGCTCCAACTGCGCGGCCTGCGGCCTTGCCCCATCAATTTTTTTAATTTTC TCTGGGGAAAAGCCTCCGGCCTGCGGCCTGCGCGCTTCGCTTGCCGGTTGGACACCAAGTGG AAGGCGGGTCAAGGCTCGCGCAGCGACCGCGCAGCGGCTTGGCCTTGACGCGCCTGGAACGA CCCAAGCCTATGCGAGTGGGGGCAGTCGAAGGCGAAGCCCGCCCGCCTGCCCCCCGAGACCT GCAGGGGGGGGGGGGCGCTGAGGTCTGCCTCGTGAAGAAGGTGTTGCTGACTCATACCAGGC CTGAATCGCCCCATCATCCAGCCAGAAAGTGAGGGAGCCACGGTTGATGAGAGCTTTGTTGT AGGTGGACCAGTTGGTGATTTTGAACTTTTGCTTTGCCACGGAACGGTCTGCGTTGTCGGGA AGATGCGTGATCTGATCCTTCAACTCAGCAAAAGTTCGATTTATTCAACAAAGCCGCCGTCC CGTCAAGTCAGCGTAATGCTCTGCCAGTGTTACAACCAATTAACCAATTCTGATTAGAAAAA CTCATCGAGCATCAAATGAAACTGCAATTTATTCATATCAGGATTATCAATACCATATTTTT GAAAAAGCCGTTTCTGTAATGAAGGAGAAAACTCACCGAGGCAGTTCCATAGGATGGCAAGA TCCTGGTATCGGTCTGCGATTCCGACTCGTCCAACATCAATACAACCTATTAATTTCCCCTC GTCAAAAATAAGGTTATCAAGTGAGAAATCACCATGAGTGACGACTGAATCCGGTGAGAATG GCAAAAGCTTATGCATTTCTTTCCAGACTTGTTCAACAGGCCAGCCATTACGCTCGTCATCA AAATCACTCGCATCAACCAAACCGTTATTCATTCGTGATTGCGCCTGAGCGAGACGAAATAC GCGATCGCTGTTAAAAGGACAATTACAAACAGGAATCGAATGCAACCGGCGCAGGAACACTG CCAGCGCATCAACAATATTTTCACCTGAATCAGGATATTCTTCTAATACCTGGAATGCTGTT TTCCCGGGGATCGCAGTGGTGAGTAACCATGCATCATCAGGAGTACGGATAAAATGCTTGAT GGTCGGAAGAGGCATAAATTCCGTCAGCCAGTTTAGTCTGACCATCTCATCTGTAACATCAT TGGCAACGCTACCTTTGCCATGTTTCAGAAACAACTCTGGCGCATCGGGCTTCCCATACAAT CGATAGATTGTCGCACCTGATTGCCCGACATTATCGCGAGCCCATTTATACCCATATAAATC AGCATCCATGTTGGAATTTAATCGCGGCCTCGAGCAAGACGTTTCCCGTTGAATATGGCTCA TAACACCCCTTGTATTACTGTTTATGTAAGCAGACAGTTTTATTGTTCATGATGATATATTT TTATCTTGTGCAATGTAACATCAGAGATTTTGAGACACAACGTGGCTTTCCCCCCCCCCCCT GCAGGTCCCGAGCCTCACGGCGGCGAGTGCGGGGGTTCCAAGGGGGCAGCGCCACCTTGGGC AAGGCCGAAGGCCGCGCAGTCGATCAACAAGCCCCGGAGGGGCCACTTTTTGCCGGAGGGGG AGCCGCGCCGAAGGCGTGGGGGAACCCCGCAGGGGTGCCCTTCTTTGGGCACCAAAGAACTA GATATAGGGCGAAATGCGAAAGACTTAAAAATCAACAACTTAAAAAAGGGGGGTACGCAACA GCTCATTGCGGCACCCCCCGCAATAGCTCATTGCGTAGGTTAAAGAAAATCTGTAATTGACT GCCACTTTTACGCAACGCATAATTGTTGTCGCGCTGCCGAAAAGTTGCAGCTGATTGCGCAT GGTGCCGCAACCGTGCGGCACCCCTACCGCATGGAGATAAGCATGGCCACGCAGTCCAGAGA AATCGGCATTCAAGCCAAGAACAAGCCCGGTCACTGGGTGCAAACGGAACGCAAAGCGCATG AGGCGTGGGCCGGGCTTATTGCGAGGAAACCCACGGCGGCAATGCTGCTGCATCACCTCGTG GCGCAGATGGGCCACCAGAACGCCGTGGTGGTCAGCCAGAAGACACTTTCCAAGCTCATCGG ACGTTCTTTGCGGACGGTCCAATACGCAGTCAAGGACTTGGTGGCCGAGCGCTGGATCTCCG TCGTGAAGCTCAACGGCCCCGGCACCGTGTCGGCCTACGTGGTCAATGACCGCGTGGCGTGG GGCCAGCCCCGCGACCAGTTGCGCCTGTCGGTGTTCAGTGCCGCCGTGGTGGTTGATCACGA CGACCAGGACGAATCGCTGTTGGGGCATGGCGACCTGCGCCGCATCCCGACCCTGTATCCGG GCGAGCAGCAACTACCGACCGGCCCCGGCGAGGAGCCGCCCAGCCAGCCCGGCATTCCGGGC ATGGAACCAGACCTGCCAGCCTTGACCGAAACGGAGGAATGGGAACGGCGCGGGCAGCAGCG CCTGCCGATGCCCGATGAGCCGTGTTTTCTGGACGATGGCGAGCCGTTGGAGCCGCCGACAC GGGTCACGCTGCCGCGCCGGTAGCACTTGGGTTGCGCAGCAACCCGTAAGTGCGCTGTTCCA GACTATCGGCTGTAGCCGCCTCGCCGCCCTATACCTTGTCTGCCTCCCCGCGTTGCGTCGCG GTGCATGGAGCCGGGCCACCTCGACCTGAATGGAAGCCGGCGGCACCTCGCTAACGGATTCA CCGTTTTTATCAGGCTCTGGGAGGCAGAATAAATGATCATATCGTCAATTATTACCTCCACG GGGAGAGCCTGAGCAAACTGGCCTCAGGCATTTGAGAAGCACACGGTCACACTGCTTCCGGT AGTCAATAAACCGGTAAACCAGCAATAGACATAAGCGGCTATTTAACGACCCTGCCCTGAAC CGACGACCGGGTCGAATTTGCTTTCGAATTTCTGCCATTCATCCGCTTATTATACTTATTCA GGCGTAGCACCAGGCGTTTAAGGGCACCAATAACTGCCTTAAAAAAATTACGCCCCGCCCTG CCACTCATCGCACTCGTCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTT TATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTT CAATAATATTGAAAAAGGAAGAGTATGAAGTTTGGAAATATTTGTTTTTCGTATCAACCACC AGGTGAAACTCATAAGCTAAGTAATGGATCGCTTTGTTCGGCTTGGTATCGCCTCAGAAGAG TAGGGTTTGATACATATTGGACCTTAGAACATCATTTTACAGAGTTTGGTCTTACGGGAAAT TTATTTGTTGCTGCGGCTAACCTGTTAGGAAGAACTAAAACATTAAATGTTGGCACTATGGG GGTTGTTATTCCGACAGCACACCCAGTTCGACAGTTAGAAGACGTTTTATTATTAGATCAAA TGTCGAAAGGTCGTTTTAATTTTGGAACCGTTCGAGGGCTATACCATAAAGATTTTCGAGTA TTTGGTGTTGATATGGAAGAGTCTCGAGCAATTACTCAAAATTTCTACCAGATGATAATGGA AAGCTTACAGACAGGAACCATTAGCTCTGATAGTGATTACATTCAATTTCCTAAGGTTGATG TATATCCCAAAGTGTACTCAAAAAATGTACCAACCTGTATGACTGCTGAGTCCGCAAGTACG ACAGAATGGCTAGCAATACAAGGGCTACCAATGGTTCTTAGTTGGATTATTGGTACTAATGA AAAAAAAGCACAGATGGAACTCTATAATGAAATTGCGACAGAATATGGTCATGATATATCTA AAATAGATCATTGTATGACTTATATTTGTTCTGTTGATGATGATGCACAAAAGGCGCAAGAT GTTTGTCGGGAGTTTCTGAAAAATTGGTATGACTCATATGTAAATGCGACCAATATCTTTAA TGATAGCAATCAAACTCGTGGTTATGATTATCATAAAGGTCAATGGCGTGATTTTGTTTTAC AAGGACATACAAACACCAATCGACGTGTTGATTATAGCAATGGTATTAACCCTGTAGGCACT CCTGAGCAGTGTATTGAAATCATTCAACGTGATATTGATGCAACGGGTATTACAAACATTAC ATGCGGATTTGAAGCTAATGGAACTGAAGATGAAATAATTGCTTCCATGCGACGCTTTATGA CACAAGTCGCTCCTTTCTTAAAAGAACCTAAATAAATTACTTATTTGATACTAGAGATAATA AGGAACAAGTTATGAAATTTGGATTATTTTTTCTAAACTTTCAGAAAGATGGAATAACATCT GANGAAACGTTGGATAATATGGTAAAGACTGTCACGTTAATTGATTCAACTAAATATCATTT TAATACTGCCTTTGTTAATGAACATCACTTTTCAAAAAATGGTATTGTTGGAGCACCTATTA CCGCAGCTGGTTTTTTATTAGGGTTAACAAATAAATTACATATTGGTTCATTAAATCAAGTA ATTACCACCCATCACCCTGTACGTGTAGCAGAAGAAGCCAGTTTATTAGATCAAATGTCAGA GGGACGCTTCATTCTTGGTTTTAGTGACTGCGAAAGTGATTTCGAAATGGAATTTTTTAGAC GTCATATCTCATCAAGGCAACAACAATTTGAAGCATGCTATGAAATAATTAATGACGCATTA ACTACAGGTTATTGTCATCCCCAAAACGACTTTTATGATTTTCCAAAGGTTTCAATTAATCC ACACTGTTACAGTGAGAATGGACCTAAGCAATATGTATCCGCTACATCAAAAGAAGTCGTCA TGTGGGCAGCGAAAAAGGCACTGCCTTTAACATTTAAGTGGGAGGATAATTTAGAAACCAAA GAACGCTATGCAATTCTATATAATAAAACAGCACAACAATATGGTATTGATATTTCGGATGT TGATCATCAATTAACTGTAATTGCGAACTTAAATGCTGATAGAAGTACGGCTCAAGAAGAAG TGAGAGAATACTTAAAAGACTATATCACTGAAACTTACCCTCAAATGGACAGAGATGAAAAA ATTAACTGCATTATTGAAGAGAATGCAGTTGGGTCTCATGATGACTATTATGAATCGACAAA ATTAGCAGTGGAAAAAACAGGGTCTAAAAATATTTTATTATCCTTTGAATCAATGTCCGATA TTAAAGATGTAAAAGATATTATTGATATGTTGAACCAAAAAATCGAAATGAATTTACCATAA AGTAGTACTGTTGTAATTCATTAAGCATTCTGCCGACATGGAAGCCATCACAGACGGCATGA TGAACCTGAATCGCCAGCGGCATCAGCACCTTGTCGCCTTGCGTATAATATTTGCCCATGGT GAAAACGGGGGCGAAGAAGTTGTCCATATTGGCCACGTTTAAATCAAAACTGGTGAAACTCA CCCAGGGATTGGCTGAGACGAAAAACATATTCTCAATAAACCCTTTAGGGAAATAGGCCAGG TTTTCACCGTAACACGCCACATCTTGCGAATATATGTGTAGAAACTGCCGGAAATCGTCGTG GTATTCACTCCAGAGCGATGAAAACGTTTCAGTTTGCTCATGGAAAACGGTGTAACAAGGGT GAACACTATCCCATATCACCAGCTCACCGTCTTTCATTGCCATACGGAATTCCGGATGAGCA TTCATCAGGCGGGCAAGAATGTGAATAAAGGCCGGATAAAACTTGTGCTTATTTTTCTTTAC GGTCTTTAAAAAGGCCGTAATATCCAGCTGAACGGTCTGGTTATAGGTACATTGAGCAACTG ACTGAAATGCCTCAAAATGTTCTTTACGATGCCATTGGGATATATCAACGGTGGTATATCCA GTGATTTTTTTCTCCATTTTAGCTTCCTTAGCTCCTGAAAATCTCGATAACTCAAAAAATAC GCCCGGTAGTGATCTTATTTCATTATGGTGAAAGTTGGAACCTCTTACGTGCCGATCAACGT CTCATTTTCGCCAAAAGTTGGCCCAGGGCTTCCCGGTATCAACAGGGACACCAGGATTTATT TATTCTGCGAAGTGATCTTCCGTCACAGGTATTTATTCGAAGACGAAAGGGCCTCGTGATAC GCCTATTTTTATAGGTTAATGTCATGATAATAATGGTTTCTTAGACGTCAGGTGGCACTTTT CGGGGAAATGTGCGCGCCCGCGTTCCTGCTGGCGCTGGGCCTGTTTCTGGCGCTGGACTTCC CGCTGTTCCGTCAGCAGCTTTTCGCCCACGGCCTTGATGATCGCGGCGGCCTTGGCCTGCAT ATCCCGATTCAACGGCCCCAGGGCGTCCAGAACGGGCTTCAGGCGCTCCCGAAGGT S.aureusP.sub.clpBPromoterSequence SEQIDNO:12 GTCTAGTTAATGTGTAACGTAACATTAGCTAGATTTTTTTATTCAAAAAAATATTTACAAAT ATTAGGAAATTTAAGTGTAAAAGAGTTGATAAATGATTATATTGGGACTATAATATAATTAA GGTC RN10616genomicsequencelocishowingthe80 terS deletionandcomplementation. terS= BracketedText,Deletion= Underlined, Complement= Bold SEQIDNO:13 ATTAGACAACAAACAAGTCATTGAAAATTCCGACTTATTATTCAAAAAGAAATTTGATAGCG CAGATATACAAGCTAGGTTAAAAGTAGGCGATAAGGTAGAAGTTAAAACAATCGGTTATAGA ATACACTTTTTAAATTTATATCCGGTCTTATACGAAGTAAAGAAGGTAGATAAACAATGATT AAACAAATACTAAGACTATTATTCTTACTAGCAATGTATGAGTTAGGTAAGTATGTAACTGA GCAAGTATATATTATGATGACGGCTAATGATGATGTAGAGGTGCCGAGTGACTTCGCGAAGT TGAGCGATCAGTCAGATTTGATGAGGGCGGAGGTGACGGAGTAGATGATGTGGTTAGTCATA GCAATTATATTACTAGTCATCTTATTGTTTGGTGTGATGTTGCAAGCTGAACAGTTAAAAGG CGATGTGAAAGTTAAAGAGCGGGAGATAGAGATATTAAGAAGTAGATTGAGACATTTTGAAG ATTAAAAATATTTGTATGGAGGGTATTCATGACTAAAAAGAAATATGGATTAAAATTATCAA CAGTTCGAAAGTTAGAAGATGAGTTGTGTGATTATCCTAATTATCATAAGCAACTCGAAGAT TTAAGAAGTGAAATAATGACACCATGGATTCCAACAGATACAAATATAGGCGGGGAGTTTGT ACCGTCTAATACATCGAAAACAGAAATGGCAGTAACTAATTATCTTTGTAGTATACGAAGAG GTAAAATCCTTGAGTTTAAGAGCGCTATTGAACGTATAATCAACACATCAAGTAGGAAAGAA CGCGAATTCATTCAAGAGTATTATTTTAATAAAAAGGAATTAGTGAAAGTTTGTGATGACAT ACACATTTCTGATAGAACTGCTCATAGAATCAAAAGGAAAATCATATCTAGATTGGCGGAAG AGTTAGGGGAAGAGTGAAATTGGCAGTAAAGTGGCAGTTTTTGATACCTAAAATGAGATATT ATGATAGTGTAGGATATTGACTATCTTACTGCGTTTCCCTTATCGCAATTAGGAATAAAGGA TCTATGTGGGTTGGCTGATTATAGCCAATCCTTTTTTAATTTTAAAAAGCGTATAGCGCGAG AGTTGGTGGTAAATGAA [[ATGAACGAAAAACAAAAGAGATTCGCAGATGAATATATAATGAATGGATGTAATGGTAAA AAAGCAGCAATTTCAGCAGGTTATAGTAAGAAAACAGCAGAGTCTTTAGCAAGTCGATTGTT AAGAAATGTTAATGTTTCGGAATATATTAAAGAACGATTAGAACAGATACAAGAAGAGCGTT TAATGAGCATTACAGAAGCTTTAGCGTTATCTGCTTCTATTGCTAGAGGAGAACCTCAAGAG GCTTACAGTAAGAAATATGACCATTTAAACGATGAAGTGGAAAAAGAGGTTACTTACACAAT CACACCAACTTTTGAAGAGCGTCAGAGATCTATTGACCACATACTAAAAGTTCATGGTGCGT ATATCGACAAAAAAGAAATTACTCAGAAGAATATTGAGATTAATATTGGTGAGTACGATGAC GAAAGTTAA]] ATTAAACTTTAACAAACCATCTAATGTTTTCAACAGAAACATATTCGAAATACTAACCAATT ACGATAACTTCACTGAAGTACATTACGGTGGAGGTTCGAGTGGTAAGTCTCACGGCGTTATA CAAAAAGTTGTACTTAAAGCATTGCAAGACTGGAAATATCCTAGGCGTATACTATGGCTTAG AAAAGTCCAATCAACAATTAAAGATAGTTTATTCGAAGATGTCAAAGATTGTTTGATAAACT TCGGTATTTGGGACATGTGCCTTTGGAATAAGACTGATAACAAAGTTGAATTGCCAAACGGC GCAGTTTTTTTGTTTAAAGGATTAGATAACCCAGAGAAAATAAAGTCGATAAAAGGCATATC AGACATAGTCATGGAAGAAGCGTCTGAATTCACACTAAATGATTACACGCAATTAACGTTGC GTTTGAGGGAGCGTAAACACGTGAATAAGCAAATATTTTTGATGTTTAACCCAGTATCTAAA CTGAATTGGGTTTATAAGTATTTCTTTGAACATGGTGAACCAATGGAAAATGTCATGATTAG ACAATCTAGTTATCGAGATAATAAGTTTCTTGATGAAATGACACGACAAAACTTAGAGTTGT TAGCAAATCGTAATCCAGCATATTACAAAATTTATGCGTTAGGTGAATTTTCTACACTAGAC AAATTGGTTTTCCCTAAGTATGAAAAACGTTTAATAAATAAAGATGAGTTAAGACATTTACC TTCTTATTTTGGATTGGACTTTGGCTACGTTAATGATCCTAGTGCTTTTATACATTCTAAAA TAGATGTAAAGAAAAAGAAGTTATACATCATTGAAGAGTATGTTAAACAAGGTATGCTGAAT GATGAAATAGCTAATGTCATAAAGCAACTTGGTTATGCTAAAGAAGAAATTACAGCAGATAG TGCAGAACAAAAAAGTATAGCTGAATTAAGGAATCTAGGGCTTAAAAGGATTTTACCAACCA AAAAAGGGAAGGGCTCGGTTGTACAAGGGTTACAATTCTTAATGCAATTTGAAATCATTGTT GATGAACGTTGTTTCAAGACTATTGAAGAGTTTGACAACTACACATGGCAAAAGGACAAAGA TACAGGTGAATATACCAATGAACCAGTAGATACATACAATCATTGTATCGATTCGTTGCGTT ATTCAGTGGAACGATTC pGW80A0001FullSequence SEQIDNO:14 GGCGCCATGGTTAAGGGCCCTTTGCGGAAAGAGTTAGTAAGTTAACAGAAGACGAACCAAAA CTAAATGGTTTAGCAGGAAACTTAGATAAAAAAATGAATCCAGAATTATATTCAGAACAGGA ACAGCAACAAGAACAACAAAAGAATCAAAAACGAGATAGAGGTATGCACTTATAGAACATGC ATTTATGCCGAGAAAACTTATTGGTTGGAATGGGCTATGTGTTAGCTAACTTGTTAGCGAGT TGGTTGGACTTGAATTGGGATTAATCCCAAGAAAGTACCAACTCAACAACACATAAAGCCCT GTAGGTTCCGACCAATAAGGAAATTGGAATAAAGCAATAAAAGGAGTTGAAGAAATGAAATT CAGAGAAGCCTTTGAGAATTTTATAACAAGTAAGTATGTACTTGGTGTTTTAGTAGTCTTAA CTGTTTACCAGATAATACAAATGCTTAAATAAAAAAAGACTTGATCTGATTAGACCAAATCT TTTGATAGTGTTATATTAATAACAAAATAAAAAGGAGTCGCTCACGCCCTACCAAAGTTTGT GAACGACATCATTCAAAGAAAAAAACACTGAGTTGTTTTTATAATCTTGTATATTTAGATAT TAAACGATATTTAAATATACATCAAGATATATATTTGGGTGAGCGATTACTTAAACGAAATT GAGATTAAGGAGTCGATTTTTTATGTATAAAAACAATCATGCAAATCATTCAAATCATTTGG AAAATCACGATTTAGACAATTTTTCTAAAACCGGCTACTCTAATAGCCGGTTGGACGCACAT ACTGTGTGCATATCTGATCCAAAATTAAGTTTTGATGCAATGACGATCGTTGGAAATCTCAA CCGAGACAACGCTCAGGCCCTTTCTAAATTTATGAGTGTAGAGCCCCAAATAAGACTTTGGG ATATTCTTCAAACAAAGTTTAAAGCTAAAGCACTTCAAGAAAAAGTTTATATTGAATATGAC AAAGTGAAAGCAGATAGTTGGGATAGACGTAATATGCGTATTGAATTTAATCCAAACAAACT TACACGAGATGAAATGATTTGGTTAAAACAAAATATAATAAGCTACATGGAAGATGACGGTT TTACAAGATTAGATTTAGCCTTTGATTTTGAAGATGATTTGAGTGACTACTATGCAATGTCT GATAAAGCAGTTAAGAAAACTATTTTTTATGGTCGTAATGGTAAGCCAGAAACAAAATATTT TGGCGTGAGAGATAGTAATAGATTTATTAGAATTTATAATAAAAAGCAAGAACGTAAAGATA ATGCAGATGCTGAAGTTATGTCTGAACATTTATGGCGTGTAGAAATCGAACTTAAAAGAGAT ATGGTGGATTACTGGAATGATTGCTTTAGTGATTTACATATCTTGCAACCAGATTGGAAAAC TATCCAACGCACTGCGGATAGAGCAATAGTTTTTATGTTATTGAGTGATGAAGAAGAATGGG GAAAGCTTCACAGAAATTCTAGAACAAAATATAAGAATTTGATAAAAGAAATTTCGCCAGTC GATTTAACGGACTTAATGAAATCGACTTTAAAAGCGAACGAAAAACAATTGCAAAAACAAAT CGATTTTTGGCAACATGAATTTAAATTTTGGAAATAGTGTACATATTAATATTACTGAACAA AAATGATATATTTAAACTATTCTAATTTAGGAGGATTTTTTTATGAAGTGTCTATTTAAAAA TTTGGGGAATTTATATGAGGTGAAAGAATAATTTACCCCTATAAACTTTAGCCACCTCAAGT AAAGAGGTAAAATTGTTTAGTTTATATAAAAAATTTAAAGGTTTGTTTTATAGCGTTTTATT TTGGCTTTGTATTCTTTCATTTTTTAGTGTATTAAATGAAATGGTTTTAAATGTTTCTTTAC CTGATATTGCAAATCATTTTAATACTACTCCTGGAATTACAAACTGGGTAAACACTGCATAT ATGTTAACTTTTTCGATAGGAACAGCAGTATATGGAAAATTATCTGATTATATAAATATAAA AAAATTGTTAATTATTGGTATTAGTTTGAGCTGTCTTGGTTCATTGATTGCTTTTATTGGGC CCACCTAGGCAAATATGCTCTTACGTGCTATTATTTAAGTGACTATTTAAAAGGAGTTAATA AATATGCGGCAAGGTATTCTTAAATAAACTGTCAATTTGATAGCGGGAACAAATAATTAGAT GTCCTTTTTTAGGAGGGCTTAGTTTTTTGTACCCAGTTTAAGAATACCTTTATCATGTGATT CTAAAGTATCCAGAGAATATCTGTATGCTTTGTATACCTATGGTTATGCATAAAAATCCCAG TGATAAAAGTATTTATCACTGGGATTTTTATGCCCTTTTGGGTTTTTGAATGGAGGAAAATC ACATGAAAATTATTAATATTGGAGTTTTAGCTCATGTTGATGCAGGAAAAACTACCTTAACA GAAAGCTTATTATATAACAGTGGAGCGATTACAGAATTAGGAAGCGTGGACAAAGGTACAAC GAGGACGGATAATACGCTTTTAGAACGTCAGAGAGGAATTACAATTCAGACAGGAATAACCT CTTTTCAGTGGGAAAATACGAAGGTGAACATCATAGACACGCCAGGACATATGGATTTCTTA GCAGAAGTATATCGTTCATTATCAGTTTTAGATGGGGCAATTCTACTGATTTCTGCAAAAGA TGGCGTACAAGCACAAACTCGTATATTATTTCATGCACTTAGGAAAATGGGGATTCCCACAA TCTTTTTTATCAATAAGATTGACCAAAATGGAATTGATTTATCAACGGTTTATCAGGATATT AAAGAGAAACTTTCTGCCGAAATTGTAATCAAACAGAAGGTAGAACTGTATCCTAATATGTG TGTGACGAACTTTACCGAATCTGAACAATGGGATACGGTAATAGAGGGAAACGATAACCTTT TAGAGAAATATATGTCCGGTAAATCATTAGAAGCATTGGAACTCGAACAAGAGGAAAGCATA AGATTTCAGAATTGTTCTCTGTTCCCTCTTTATCATGGAAGTGCAAAAAGTAATATAGGGAT TGATAACCTTATAGAAGTTATTACTAATAAATTTTATTCATCAACACATCGAGGTCCGTCTG AACTTTGCGGAAATGTTTTCAAAATTGAATATACAAAAAAAAGACAACGTCTTGCATATATA CGCCTTTATAGTGGAGTACTACATTTACGAGATTCGGTTAGAGTATCAGAAAAAGAAAAAAT AAAAGTTACAGAAATGTATACTTCAATAAATGGTGAATTATGTAAGATTGATAGAGCTTATT CTGGAGAAATTGTTATTTTGCAAAATGAGTTTTTGAAGTTAAATAGTGTTCTTGGAGATACA AAACTATTGCCACAGAGAAAAAAGATTGAAAATCCGCACCCTCTACTACAAACAACTGTTGA ACCGAGTAAACCTGAACAGAGAGAAATGTTGCTTGATGCCCTTTTGGAAATCTCAGATAGTG ATCCGCTTCTACGATATTACGTGGATTCTACGACACATGAAATTATACTTTCTTTCTTAGGG AAAGTACAAATGGAAGTGATTAGTGCACTGTTGCAAGAAAAGTATCATGTGGAGATAGAACT AAAAGAGCCTACAGTCATTTATATGGAGAGACCGTTAAAAAATGCAGAATATACCATTCACA TCGAAGTGCCGCCAAATCCTTTCTGGGCTTCCATTGGTTTATCTGTATCGCCGCTTCCGTTG GGAAGTGGAATGCAGTATGAGAGCTCGGTTTCTCTTGGATACTTAAATCAATCATTTCAAAA TGCAGTTATGGAAGGGGTACGCTATGGTTGCGAACAAGGATTATATGGTTGGAATGTGACGG ATTGTAAAATCTGTTTTAAGTACGGTTTATACTATAGCCCTGTTAGTACTCCAGCAGATTTT CGGATGCTTACTCCTATTGTACTGGAGCAAGCCTTTAGAAAAGCTGGAACAGAATTGTTAGA GCCATATCTTAGTTTTAAAGTTTATGCACCACAGGAATATCTTTCACGGGCATATAACGATG CTCCCAAATATTGTGCAAATATCGTAAATACTCAACTGAAAAATAATGAGGTCATTATTATT GGAGAAATTCCTGCTCGATGTATTCAAGATTATCGCAATGATTTAACTTTTTTTACAAATGG GCTTAGTGTTTGTTTAGCAGAGCTAAAAGGATATCAGGTTACCACTGGCGAACCTGTTTGCC AGACCCGTCGTCTAAATAGTCGGATAGATAAAGTAAGATATATGTTCAATAAAATAACTTAG TGCGTTTTATGTTGTTATATAAATATGGTTTCTTATTAAATAAGATGAAATATTCTTTAATA TAGATTTGAATTAAAGTGGAAAGGAGGAGATTGTTATTATAAACTACAAGTGGATATTGTGT CCTAGTTGTGGAAATAAAACAAGACTACGAATACGAGTGGATACTATACTTAAAAATTTCCC TTTATACAGCCCCAAATGTAAGAACGAAACTTTAATTAATGTTCAAAAAATGAATATAATAA CAATCAAAGAGCCAGACGCCAAGACGCAGAGCCGATAATTTGAGAAATGAAACTCTCATCTT ATCGGCTCTTTTTGTTTATCTGAATTTTACTGACTAGCCTTCAATATTTCCGCGGCCAGCTT ACTATGCCATTATTAAGCTTGTAATATCGGAGGGTTTATTAATTGGCAGTAAAGTGGCAGTT TTTGATACCTTAAATGAGATATTATGATAGTGTAGGATATTGACTATCGTACTGCGTTTCCC TACCGCAAATTAGGAATAAAGGATCTATGTGGGTTGGCTGATTATAGCCAATCCTTTTTTAA TTTTAAAAAGCGTATAGCGCGAGAGTTGGTGGTAAATGAAATGAACGAAAAACAAAAGAGAT TCGCAGATGAATATATAATGAATGGATGTAATGGTAAAAAAGCAGCAATTACAGTAGGTTAT AGTAAGAAAACAGCAGAGTCTTTAGCAAGTCGATTGTTAAGAAATGTTAATGTTTCGGAATA TATTAAAGAACGATTAGAACAGGTACAAGAAGAGCGTTTAATGAGTATTACAGAAGCTTTAG CGTTATCTGCTTCTATTGCTAGAGGAGAACCTCAAGAGGCTTACAGTAAGAAATATGACCAT TTAAACGATGAAGTGGAAAAAGAGGTTACTTACACAATCACACCAACTTTTGAAGAGCGTCA GAGATCTATTGACCACATACTAAAAGTACATGGTGCGTATATCGATAAAAAAGAAATTACTC AGAAGAATATTGAGATTAATATTGGTGAGTACGATGACGAAAGTTAAATTGAACTTTAACAA ACCGTCTAATGTTTTCAATAGCCGCGGGGGCCCAACACACCAACTTTTGAAGAGCGTCAGAG ATCTATTGACCACATACTAAAAGTACATGGTGCGTATATCGATAAAAAAGAAATTACTCAGA AGAATATTGAGATTAATATTGGTGAGTACGATGACGAAAGTTAAATTAAACTTTAACAAACC GTCTAATGTTTTCAATAGCCGCGGGGGCCCAACGAGCGGCCGCATAGTTAAGCCAGCCCCGA CACCCGCCAACACCCGCTGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAG ACAAGCTGTGACCGTCTCCGGGAGCTGCATGTGTCAGAGGTTTTCACCGTCATCACCGAAAC GCGCGAGACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTTAATGTCATGATAATAATG GTTTCTTAGACGTCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATT TTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAAT AATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTT GCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGA AGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTG AGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGC GCGGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCA GAATGACTTGGTTGAGTACTCACCGGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAA GAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACA ACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCG CCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGA TGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCT TCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTC GGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCG GTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACG GGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGAT TAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTC ATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCT TAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTG AGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGG TGGTTTTTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGA GCGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTC TGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCG ATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCG GGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACCTGA GATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGG TATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGC CTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGAT GCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTG GCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAA CCGTATTACCGCCTTTGAGTGAGCTGGCGGGTCTAGTTAATGTGTAACGTAACATTAGCTAG ATTTTTTTATTCAAAAAAATATTTACAAATATTAGGAAATTTAAGTGTAAAAGAGTTGATAA ATGATTATATTGGGACTATAATATAATTAAGGTCGATTGAATTCGTTAACTAATTAATCACC AAAAAGGAATAGAGTATGAAGTTTGGAAATATTTGTTTTTCGTATCAACCACCAGGTGAAAC TCATAAGCAAGTAATGGATCGCTTTGTTCGGCTTGGTATCGCCTCAGAAGAGGTAGGGTTTG ATACATATTGGACCTTAGAACATCATTTTACAGAGTTTGGTCTTACGGGAAATTTATTTGTT GCTGCGGCTAACCTGTTAGGAAGAACTAAAACATTAAATGTTGGCACTATGGGGGTTGTTAT TCCGACAGCACACCCAGTTCGACAGTTAGAAGACGTTTTATTATTAGATCAAATGTCGAAAG GTCGTTTTAATTTTGGAACCGTTCGAGGGCTATACCATAAAGATTTTCGAGTATTTGGTGTT GATATGGAAGAGTCTCGAGCAATTACTCAAAATTTCTACCAGATGATAATGGAAAGCTTACA GACAGGAACCATTAGCTCTGATAGTGATTACATTCAATTTCCTAAGGTTGATGTATATCCCA AAGTGTACTCAAAAAATGTACCAACCTGTATGACTGCTGAGTCCGCAAGTACGACAGAATGG CTAGCAATACAAGGGCTACCAATGGTTCTTAGTTGGATTATTGGTACTAATGAAAAAAAAGC ACAGATGGAACTCTATAATGAAATTGCGACAGAATATGGTCATGATATATCTAAAATAGATC ATTGTATGACTTATATTTGTTCTGTTGATGATGATGCACAAAAGGCGCAAGATGTTTGTCGG GAGTTTCTGAAAAATTGGTATGACTCATATGTAAATGCGACCAATATCTTTAATGATAGCAA TCAAACTCGTGGTTATGATTATCATAAAGGTCAATGGCGTGATTTTGTTTTACAAGGACATA CAAACACCAATCGACGTGTTGATTATAGCAATGGTATTAACCCCGTAGGCACTCCTGAGCAG TGTATTGAAATCATTCAACGTGATATTGATGCAACGGGTATTACAAACATTACATGCGGATT TGAAGCTAATGGAACTGAAGATGAAATAATTGCTTCCATGCGACGCTTTATGACACAAGTCG CTCCTTTCTTAAAAGAACCTAAATAAATTACTTATTTGATACTAGAGATAATAAGGAACAAG TTATGAAATTTGGATTATTTTTTCTAAACTTTCAGAAAGATGGAATAACATCTGAAGAAACG TTGGATAATATGGTAAAGACTGTCACGTTAATTGATTCAACTAAATATCATTTTAATACTGC CTTTGTTAATGAACATCACTTTTCAAAAAATGGTATTGTTGGAGCACCTATTACCGCAGCTG GTTTTTTATTAGGGTTAACAAATAAATTACATATTGGTTCATTAAATCAAGTAATTACCACC CATCACCCTGTACGTGTAGCAGAAGAAGCCAGTTTATTAGATCAAATGTCAGAGGGACGCTT CATTCTTGGTTTTAGTGACTGCGAAAGTGATTTCGAAATGGAATTTTTTAGACGTCATATCT CATCAAGGCAACAACAATTTGAAGCATGCTATGAAATAATTAATGACGCATTAACTACAGGT TATTGCCATCCCCAAAACGACTTTTATGATTTTCCAAAGGTTTCAATTAATCCACACTGTTA CAGTGAGAATGGACCTAAGCAATATGTATCCGCTACATCAAAAGAAGTCGTCATGTGGGCAG CGAAAAAGGCACTGCCTTTAACGTTTAAGTGGGAGGATAATTTAGAAACCAAAGAACGCTAT GCAATTCTATATAATAAAACAGCACAACAATATGGTATTGATATTTCGGATGTTGATCATCA ATTAACTGTAATTGCGAACTTAAATGCTGATAGAAGTACGGCTCAAGAAGAAGTGAGAGAAT ACTTAAAAGACTATATCACTGAAACTTACCCTCAAATGGACAGAGATGAAAAAATTAACTGC ATTATTGAAGAGAATGCAGTTGGGTCTCATGATGACTATTATGAATCGACAAAATTAGCAGT GGAAAAAACAGGGTCTAAAAATATTTTATTATCCTTTGAATCAATGTCCGATATTAAAGATG TAAAAGATATTATTGATATGTTGAACCAAAAAATCGAAATGAATTTACCATAATAAAATTAA AGGCAATTTCTATATTAGATTGCCTTTTTGGCGCGCCTATTCTAATGCATAATAAATACTGA TAACATCTTATATTTTGTATTATATTTTGTATTATCGTTGACATGTATAATTTTGATATCAA AAACTGATTTTCCCTCTATTATTTTCGAGATTTATTTTCTTAATTCTCTTTAACAAACTAGA AATATTGTATATACAAAAAATTATAAATAATAGATGAATAGTTTAATTATAGGTGTTCATCA ATCGAAAAAGCAACGTATCTTATTTAAAGTGCGTTGCTTTTTTCTCATTTATAAGGTTAAAT AATTCTCATATATCAAGCAAAGTGACA (mecAgenelociDNASequence(fromStaphylococcus aureussubsp.aureusSA40,completegenomeGenBank: CP003604.1)) SEQIDNO:15 TATACTACAAATGTAGTCTTATATAAGGAGGATATTGATGAAAAAGATAAAAATTGTTCCAC TTATTTTAATAGTTGTAGTTGTCGGGTTTGGTATATATTTTTATGCTTCAAAAGATAAAGAA ATTAATAATACTATTGATGCAATTGAAGATAAAAATTTCAAACAAGTTTATAAAGATAGCAG TTATATTTCTAAAAGCGATAATGGTGAAGTAGAAATGACTGAACGTCCGATAAAAATATATA ATAGTTTAGGCGTTAAAGATATAAACATTCAGGATCGTAAAATAAAAAAAGTATCTAAAAAT AAAAAACGAGTAGATGCTCAATATAAAATTAAAACAAACTACGGTAACATTGATCGCAACGT TCAATTTAATTTTGTTAAAGAAGATGGTATGTGGAAGTTAGATTGGGATCATAGCGTCATTA TTCCAGGAATGCAGAAAGACCAAAGCATACATATTGAAAATTTAAAATCAGAACGTGGTAAA ATTTTAGACCGAAACAATGTGGAATTGGCCAATACAGGAACAGCATATGAGATAGGCATCGT TCCAAAGAATGTATCTAAAAAAGATTATAAAGCAATCGCTAAAGAACTAAGTATTTCTGAAG ACTATATCAAACAACAAATGGATCAAAATTGGGTACAAGATGATACCTTCGTTCCACTTAAA ACCGTTAAAAAAATGGATGAATATTTAAGTGATTTCGCAAAAAAATTTCATCTTACAACTAA TGAAACAGAAAGTCGTAACTATCCTCTAGAAAAAGCGACTTCACATCTATTAGGTTATGTTG GTCCCATTAACTCTGAAGAATTAAAACAAAAAGAATATAAAGGCTATAAAGATGATGCAGTT ATTGGTAAAAAGGGACTCGAAAAACTTTACGATAAAAAGCTCCAACATGAAGATGGCTATCG TGTCACAATCGTTGACGATAATAGCAATACAATCGCACATACATTAATAGAGAAAAAGAAAA AAGATGGCAAAGATATTCAACTAACTATTGATGCTAAAGTTCAAAAGAGTATTTATAACAAC ATGAAAAATGATTATGGCTCAGGTACTGCTATCCACCCTCAAACAGGTGAATTATTAGCACT TGTAAGCACACCTTCATATGACGTCTATCCATTTATGTATGGCATGAGTAACGAAGAATATA ATAAATTAACCGAAGATAAAAAAGAACCTCTGCTCAACAAGTTCCAGATTACAACTTCACCA GGTTCAACTCAAAAAATATTAACAGCAATGATTGGGTTAAATAACAAAACATTAGACGATAA AACAAGTTATAAAATCGATGGTAAAGGTTGGCAAAAAGATAAATCTTGGGGTGGTTACAACG TTACAAGATATGAAGTGGTAAATGGTAATATCGACTTAAAACAAGCAATAGAATCATCAGAT AACATTTTCTTTGCTAGAGTAGCACTCGAATTAGGCAGTAAGAAATTTGAAAAAGGCATGAA AAAACTAGGTGTTGGTGAAGATATACCAAGTGATTATCCATTTTATAATGCTCAAATTTCAA ACAAAAATTTAGATAATGAAATATTATTAGCTGATTCAGGTTACGGACAAGGTGAAATACTG ATTAACCCAGTACAGATCCTTTCAATCTATAGCGCATTAGAAAATAATGGCAATATTAACGC ACCTCACTTATTAAAAGACACGAAAAACAAAGTTTGGAAGAAAAATATTATTTCCAAAGAAA ATATCAATCTATTAACTGATGGTATGCAACAAGTCGTAAATAAAACACATAAAGAAGATATT TATAGATCTTATGCAAACTTAATTGGCAAATCCGGTACTGCAGAACTCAAAATGAAACAAGG AGAAACTGGCAGACAAATTGGGTGGTTTATATCATATGATAAAGATAATCCAAACATGATGA TGGCTATTAATGTTAAAGATGTACAAGATAAAGGAATGGCTAGCTACAATGCCAAAATCTCA GGTAAAGTGTATGATGAGCTATATGAGAACGGTAATAAAAAATACGATATAGATGAATAACA AAACAGTGAAGCAATCCGTAACGATGGTTGCTTCACTGTTTT (mecAtranscriptsequence) SEQIDNO:16 UAGUCUUAUAUAAGGAGGAUAUUGAUGAAAAAGAUAAAAAUUGUUCCACUUAUUUUAAUAGU UGUAGUUGUCGGGUUUGGUAUAUAUUUUUAUGCUUCAAAAGAUAAAGAAAUUAAUAAUACUA UUGAUGCAAUUGAAGAUAAAAAUUUCAAACAAGUUUAUAAAGAUAGCAGUUAUAUUUCUAAA AGCGAUAAUGGUGAAGUAGAAAUGACUGAACGUCCGAUAAAAAUAUAUAAUAGUUUAGGCGU UAAAGAUAUAAACAUUCAGGAUCGUAAAAUAAAAAAAGUAUCUAAAAAUAAAAAACGAGUAG AUGCUCAAUAUAAAAUUAAAACAAACUACGGUAACAUUGAUCGCAACGUUCAAUUUAAUUUU GUUAAAGAAGAUGGUAUGUGGAAGUUAGAUUGGGAUCAUAGCGUCAUUAUUCCAGGAAUGCA GAAAGACCAAAGCAUACAUAUUGAAAAUUUAAAAUCAGAACGUGGUAAAAUUUUAGACCGAA ACAAUGUGGAAUUGGCCAAUACAGGAACAGCAUAUGAGAUAGGCAUCGUUCCAAAGAAUGUA UCUAAAAAAGAUUAUAAAGCAAUCGCUAAAGAACUAAGUAUUUCUGAAGACUAUAUCAAACA ACAAAUGGAUCAAAAUUGGGUACAAGAUGAUACCUUCGUUCCACUUAAAACCGUUAAAAAAA UGGAUGAAUAUUUAAGUGAUUUCGCAAAAAAAUUUCAUCUUACAACUAAUGAAACAGAAAGU CGUAACUAUCCUCUAGAAAAAGCGACUUCACAUCUAUUAGGUUAUGUUGGUCCCAUUAACUC UGAAGAAUUAAAACAAAAAGAAUAUAAAGGCUAUAAAGAUGAUGCAGUUAUUGGUAAAAAGG GACUCGAAAAACUUUACGAUAAAAAGCUCCAACAUGAAGAUGGCUAUCGUGUCACAAUCGUU GACGAUAAUAGCAAUACAAUCGCACAUACAUUAAUAGAGAAAAAGAAAAAAGAUGGCAAAGA UAUUCAACUAACUAUUGAUGCUAAAGUUCAAAAGAGUAUUUAUAACAACAUGAAAAAUGAUU AUGGCUCAGGUACUGCUAUCCACCCUCAAACAGGUGAAUUAUUAGCACUUGUAAGCACACCU UCAUAUGACGUCUAUCCAUUUAUGUAUGGCAUGAGUAACGAAGAAUAUAAUAAAUUAACCGA AGAUAAAAAAGAACCUCUGCUCAACAAGUUCCAGAUUACAACUUCACCAGGUUCAACUCAAA AAAUAUUAACAGCAAUGAUUGGGUUAAAUAACAAAACAUUAGACGAUAAAACAAGUUAUAAA AUCGAUGGUAAAGGUUGGCAAAAAGAUAAAUCUUGGGGUGGUUACAACGUUACAAGAUAUGA AGUGGUAAAUGGUAAUAUCGACUUAAAACAAGCAAUAGAAUCAUCAGAUAACAUUUUCUUUG CUAGAGUAGCACUCGAAUUAGGCAGUAAGAAAUUUGAAAAAGGCAUGAAAAAACUAGGUGUU GGUGAAGAUAUACCAAGUGAUUAUCCAUUUUAUAAUGCUCAAAUUUCAAACAAAAAUUUAGA UAAUGAAAUAUUAUUAGCUGAUUCAGGUUACGGACAAGGUGAAAUACUGAUUAACCCAGUAC AGAUCCUUUCAAUCUAUAGCGCAUUAGAAAAUAAUGGCAAUAUUAACGCACCUCACUUAUUA AAAGACACGAAAAACAAAGUUUGGAAGAAAAAUAUUAUUUCCAAAGAAAAUAUCAAUCUAUU AACUGAUGGUAUGCAACAAGUCGUAAAUAAAACACAUAAAGAAGAUAUUUAUAGAUCUUAUG CAAACUUAAUUGGCAAAUCCGGUACUGCAGAACUCAAAAUGAAACAAGGAGAAACUGGCAGA CAAAUUGGGUGGUUUAUAUCAUAUGAUAAAGAUAAUCCAAACAUGAUGAUGGCUAUUAAUGU UAAAGAUGUACAAGAUAAAGGAAUGGCUAGCUACAAUGCCAAAAUCUCAGGUAAAGUGUAUG AUGAGCUAUAUGAGAACGGUAAUAAAAAAUACGAUAUAGAUGAAUAACAAAACAGUGAAGCA AUCCGUAACGAUGGUUGCUUCACUGUUUU (luxABgenelociDNAsequence(fromVibriofischeri genesluxAandluxBforluciferasealphaandbeta subunits-GenBank:X06758.1)) SEQIDNO:17 GGCTTAAATAAACAGAATCACCAAAAAGGAATAGAGTATGAAGTTTGGAAATATTTGTTTTT CGTATCAACCACCAGGTGAAACTCATAAGCTAAGTAATGGATCGCTTTGTTCGGCTTGGTAT CGCCTCAGAAGAGTAGGGTTTGATACATATTGGACCTTAGAACATCATTTTACAGAGTTTGG TCTTACGGGAAATTTATTTGTTGCTGCGGCTAACCTGTTAGGAAGAACTAAAACATTAAATG TTGGCACTATGGGGGTTGTTATTCCGACAGCACACCCAGTTCGACAGTTAGAAGACGTTTTA TTATTAGATCAAATGTCGAAAGGTCGTTTTAATTTTGGAACCGTTCGAGGGCTATACCATAA AGATTTTCGAGTATTTGGTGTTGATATGGAAGAGTCTCGAGCAATTACTCAAAATTTCTACC AGATGATAATGGAAAGCTTACAGACAGGAACCATTAGCTCTGATAGTGATTACATTCAATTT CCTAAGGTTGATGTATATCCCAAAGTGTACTCAAAAAATGTACCAACCTGTATGACTGCTGA GTCCGCAAGTACGACAGAATGGCTAGCAATACAAGGGCTACCAATGGTTCTTAGTTGGATTA TTGGTACTAATGAAAAAAAAGCACAGATGGAACTCTATAATGAAATTGCGACAGAATATGGT CATGATATATCTAAAATAGATCATTGTATGACTTATATTTGTTCTGTTGATGATGATGCACA AAAGGCGCAAGATGTTTGTCGGGAGTTTCTGAAAAATTGGTATGACTCATATGTAAATGCGA CCAATATCTTTAATGATAGCAATCAAACTCGTGGTTATGATTATCATAAAGGTCAATGGCGT GATTTTGTTTTACAAGGACATACAAACACCAATCGACGTGTTGATTATAGCAATGGTATTAA CCCTGTAGGCACTCCTGAGCAGTGTATTGAAATCATTCAACGTGATATTGATGCAACGGGTA TTACAAACATTACATGCGGATTTGAAGCTAATGGAACTGAAGATGAAATAATTGCTTCCATG CGACGCTTTATGACACAAGTCGCTCCTTTCTTAAAAGAACCTAAATAAATTACTTATTTGAT ACTAGAGATAATAAGGAACAAGTTATGAAATTTGGATTATTTTTTCTAAACTTTCAGAAAGA TGGAATAACATCTGANGAAACGTTGGATAATATGGTAAAGACTGTCACGTTAATTGATTCAA CTAAATATCATTTTAATACTGCCTTTGTTAATGAACATCACTTTTCAAAAAATGGTATTGTT GGAGCACCTATTACCGCAGCTGGTTTTTTATTAGGGTTAACAAATAAATTACATATTGGTTC ATTAAATCAAGTAATTACCACCCATCACCCTGTACGTGTAGCAGAAGAAGCCAGTTTATTAG ATCAAATGTCAGAGGGACGCTTCATTCTTGGTTTTAGTGACTGCGAAAGTGATTTCGAAATG GAATTTTTTAGACGTCATATCTCATCAAGGCAACAACAATTTGAAGCATGCTATGAAATAAT TAATGACGCATTAACTACAGGTTATTGTCATCCCCAAAACGACTTTTATGATTTTCCAAAGG TTTCAATTAATCCACACTGTTACAGTGAGAATGGACCTAAGCAATATGTATCCGCTACATCA AAAGAAGTCGTCATGTGGGCAGCGAAAAAGGCACTGCCTTTAACATTTAAGTGGGAGGATAA TTTAGAAACCAAAGAACGCTATGCAATTCTATATAATAAAACAGCACAACAATATGGTATTG ATATTTCGGATGTTGATCATCAATTAACTGTAATTGCGAACTTAAATGCTGATAGAAGTACG GCTCAAGAAGAAGTGAGAGAATACTTAAAAGACTATATCACTGAAACTTACCCTCAAATGGA CAGAGATGAAAAAATTAACTGCATTATTGAAGAGAATGCAGTTGGGTCTCATGATGACTATT ATGAATCGACAAAATTAGCAGTGGAAAAAACAGGGTCTAAAAATATTTTATTATCCTTTGAA TCAATGTCCGATATTAAAGATGTAAAAGATATTATTGATATGTTGAACCAAAAAATCGAAAT GAATTTACCATAATAAAATTAAAGGCAATTTCTATATTAGATTGCCTTTTTAAATTTC (luxABTranscriptSequence) SEQIDNO:18 AAUCACCAAAAAGGAAUAGAGUAUGAAGUUUGGAAAUAUUUGUUUUUCGUAUCAACCACCAG GUGAAACUCAUAAGCUAAGUAAUGGAUCGCUUUGUUCGGCUUGGUAUCGCCUCAGAAGAGUA GGGUUUGAUACAUAUUGGACCUUAGAACAUCAUUUUACAGAGUUUGGUCUUACGGGAAAUUU AUUUGUUGCUGCGGCUAACCUGUUAGGAAGAACUAAAACAUUAAAUGUUGGCACUAUGGGGG UUGUUAUUCCGACAGCACACCCAGUUCGACAGUUAGAAGACGUUUUAUUAUUAGAUCAAAUG UCGAAAGGUCGUUUUAAUUUUGGAACCGUUCGAGGGCUAUACCAUAAAGAUUUUCGAGUAUU UGGUGUUGAUAUGGAAGAGUCUCGAGCAAUUACUCAAAAUUUCUACCAGAUGAUAAUGGAAA GCUUACAGACAGGAACCAUUAGCUCUGAUAGUGAUUACAUUCAAUUUCCUAAGGUUGAUGUA UAUCCCAAAGUGUACUCAAAAAAUGUACCAACCUGUAUGACUGCUGAGUCCGCAAGUACGAC AGAAUGGCUAGCAAUACAAGGGCUACCAAUGGUUCUUAGUUGGAUUAUUGGUACUAAUGAAA AAAAAGCACAGAUGGAACUCUAUAAUGAAAUUGCGACAGAAUAUGGUCAUGAUAUAUCUAAA AUAGAUCAUUGUAUGACUUAUAUUUGUUCUGUUGAUGAUGAUGCACAAAAGGCGCAAGAUGU UUGUCGGGAGUUUCUGAAAAAUUGGUAUGACUCAUAUGUAAAUGCGACCAAUAUCUUUAAUG AUAGCAAUCAAACUCGUGGUUAUGAUUAUCAUAAAGGUCAAUGGCGUGAUUUUGUUUUACAA GGACAUACAAACACCAAUCGACGUGUUGAUUAUAGCAAUGGUAUUAACCCUGUAGGCACUCC UGAGCAGUGUAUUGAAAUCAUUCAACGUGAUAUUGAUGCAACGGGUAUUACAAACAUUACAU GCGGAUUUGAAGCUAAUGGAACUGAAGAUGAAAUAAUUGCUUCCAUGCGACGCUUUAUGACA CAAGUCGCUCCUUUCUUAAAAGAACCUAAAUAAAUUACUUAUUUGAUACUAGAGAUAAUAAG GAACAAGUUAUGAAAUUUGGAUUAUUUUUUCUAAACUUUCAGAAAGAUGGAAUAACAUCUGA AGAAACGUUGGAUAAUAUGGUAAAGACUGUCACGUUAAUUGAUUCAACUAAAUAUCAUUUUA AUACUGCCUUUGUUAAUGAACAUCACUUUUCAAAAAAUGGUAUUGUUGGAGCACCUAUUACC GCAGCUGGUUUUUUAUUAGGGUUAACAAAUAAAUUACAUAUUGGUUCAUUAAAUCAAGUAAU UACCACCCAUCACCCUGUACGUGUAGCAGAAGAAGCCAGUUUAUUAGAUCAAAUGUCAGAGG GACGCUUCAUUCUUGGUUUUAGUGACUGCGAAAGUGAUUUCGAAAUGGAAUUUUUUAGACGU CAUAUCUCAUCAAGGCAACAACAAUUUGAAGCAUGCUAUGAAAUAAUUAAUGACGCAUUAAC UACAGGUUAUUGUCAUCCCCAAAACGACUUUUAUGAUUUUCCAAAGGUUUCAAUUAAUCCAC ACUGUUACAGUGAGAAUGGACCUAAGCAAUAUGUAUCCGCUACAUCAAAAGAAGUCGUCAUG UGGGCAGCGAAAAAGGCACUGCCUUUAACAUUUAAGUGGGAGGAUAAUUUAGAAACCAAAGA ACGCUAUGCAAUUCUAUAUAAUAAAACAGCACAACAAUAUGGUAUUGAUAUUUCGGAUGUUG AUCAUCAAUUAACUGUAAUUGCGAACUUAAAUGCUGAUAGAAGUACGGCUCAAGAAGAAGUG AGAGAAUACUUAAAAGACUAUAUCACUGAAACUUACCCUCAAAUGGACAGAGAUGAAAAAAU UAACUGCAUUAUUGAAGAGAAUGCAGUUGGGUCUCAUGAUGACUAUUAUGAAUCGACAAAAU UAGCAGUGGAAAAAACAGGGUCUAAAAAUAUUUUAUUAUCCUUUGAAUCAAUGUCCGAUAUU AAAGAUGUAAAAGAUAUUAUUGAUAUGUUGAACCAAAAAAUCGAAAUGAAUUUACCAUAAUA AAAUUAAAGGCAAUUUCUAUAUUAGAUUGCCUUUU (cis-repressedluxABtranscriptsequence) SEQIDNO:19 AAAGGCAUGAAAAAACUUGGUAUCUUCACCAACACCUAGCUUUUUGAAGGAAUUGAGUAUGA AGUUUGGAAAUAUUGGUUGUUCGUAUCAACCACCAGGUGAAACUCAUAAGCUAAAGGCAUGA AAAAACUAGGUGAUCUUCACCAACACCUAGUUUUUUCAAGGAAUUGAGUAUGAAGUUUGGAA AUAUUUGUUUUUCGUAUCAACCACCAGGUGAAACUCAUAAGCUAAGUAAUGGAUCGCUUUGU UCGGCUUGGUAUCGCCUCAGAAGAGUAGGGUUUGAUACAUAUUGGACCUUAGAACAUCAUUU UACAGAGUUUGGUCUUACGGGAAAUUUAUUUGUUGCUGCGGCUAACCUGUUAGGAAGAACUA AAACAUUAAAUGUUGGCACUAUGGGGGUUGUUAUUCCGACAGCACACCCAGUUCGACAGUUA GAAGACGUUUUAUUAUUAGAUCAAAUGUCGAAAGGUCGUUUUAAUUUUGGAACCGUUCGAGG GCUAUACCAUAAAGAUUUUCGAGUAUUUGGUGUUGAUAUGGAAGAGUCUCGAGCAAUUACUC AAAAUUUCUACCAGAUGAUAAUGGAAAGCUUACAGACAGGAACCAUUAGCUCUGAUAGUGAU UACAUUCAAUUUCCUAAGGUUGAUGUAUAUCCCAAAGUGUACUCAAAAAAUGUACCAACCUG UAUGACUGCUGAGUCCGCAAGUACGACAGAAUGGCUAGCAAUACAAGGGCUACCAAUGGUUC UUAGUUGGAUUAUUGGUACUAAUGAAAAAAAAGCACAGAUGGAACUCUAUAAUGAAAUUGCG ACAGAAUAUGGUCAUGAUAUAUCUAAAAUAGAUCAUUGUAUGACUUAUAUUUGUUCUGUUGA UGAUGAUGCACAAAAGGCGCAAGAUGUUUGUCGGGAGUUUCUGAAAAAUUGGUAUGACUCAU AUGUAAAUGCGACCAAUAUCUUUAAUGAUAGCAAUCAAACUCGUGGUUAUGAUUAUCAUAAA GGUCAAUGGCGUGAUUUUGUUUUACAAGGACAUACAAACACCAAUCGACGUGUUGAUUAUAG CAAUGGUAUUAACCCUGUAGGCACUCCUGAGCAGUGUAUUGAAAUCAUUCAACGUGAUAUUG AUGCAACGGGUAUUACAAACAUUACAUGCGGAUUUGAAGCUAAUGGAACUGAAGAUGAAAUA AUUGCUUCCAUGCGACGCUUUAUGACACAAGUCGCUCCUUUCUUAAAAGAACCUAAAUAAAU UACUUAUUUGAUACUAGAGAUAAUAAGGAACAAGUUAUGAAAUUUGGAUUAUUUUUUCUAAA CUUUCAGAAAGAUGGAAUAACAUCUGAAGAAACGUUGGAUAAUAUGGUAAAGACUGUCACGU UAAUUGAUUCAACUAAAUAUCAUUUUAAUACUGCCUUUGUUAAUGAACAUCACUUUUCAAAA AAUGGUAUUGUUGGAGCACCUAUUACCGCAGCUGGUUUUUUAUUAGGGUUAACAAAUAAAUU ACAUAUUGGUUCAUUAAAUCAAGUAAUUACCACCCAUCACCCUGUACGUGUAGCAGAAGAAG CCAGUUUAUUAGAUCAAAUGUCAGAGGGACGCUUCAUUCUUGGUUUUAGUGACUGCGAAAGU GAUUUCGAAAUGGAAUUUUUUAGACGUCAUAUCUCAUCAAGGCAACAACAAUUUGAAGCAUG CUAUGAAAUAAUUAAUGACGCAUUAACUACAGGUUAUUGUCAUCCCCAAAACGACUUUUAUG AUUUUCCAAAGGUUUCAAUUAAUCCACACUGUUACAGUGAGAAUGGACCUAAGCAAUAUGUA UCCGCUACAUCAAAAGAAGUCGUCAUGUGGGCAGCGAAAAAGGCACUGCCUUUAACAUUUAA GUGGGAGGAUAAUUUAGAAACCAAAGAACGCUAUGCAAUUCUAUAUAAUAAAACAGCACAAC AAUAUGGUAUUGAUAUUUCGGAUGUUGAUCAUCAAUUAACUGUAAUUGCGAACUUAAAUGCU GAUAGAAGUACGGCUCAAGAAGAAGUGAGAGAAUACUUAAAAGACUAUAUCACUGAAACUUA CCCUCAAAUGGACAGAGAUGAAAAAAUUAACUGCAUUAUUGAAGAGAAUGCAGUUGGGUCUC AUGAUGACUAUUAUGAAUCGACAAAAUUAGCAGUGGAAAAAACAGGGUCUAAAAAUAUUUUA UUAUCCUUUGAAUCAAUGUCCGAUAUUAAAGAUGUAAAAGAUAUUAUUGAUAUGUUGAACCA AAAAAUCGAAAUGAAUUUACCAUAAUAAAAUUAAAGGCAAUUUCUAUAUUAGAUUGCCUUUU