Fusion protein comprising diphtheria toxin non-toxic mutant CRM197 or fragment thereof
09764028 ยท 2017-09-19
Assignee
Inventors
- Shaowei Li (Xiamen, CN)
- Cuiling Song (Xiamen, CN)
- Chunyan Yang (Xiamen, CN)
- Ying Gu (Xiamen, CN)
- Wenxin Luo (Xiamen, CN)
- Ningshao Xia (Xiamen, CN)
Cpc classification
A61K39/05
HUMAN NECESSITIES
C12N7/00
CHEMISTRY; METALLURGY
C12N2760/16134
CHEMISTRY; METALLURGY
A61K39/39
HUMAN NECESSITIES
C12N2760/16122
CHEMISTRY; METALLURGY
C07K2319/55
CHEMISTRY; METALLURGY
C12N2770/28134
CHEMISTRY; METALLURGY
A61K2039/6037
HUMAN NECESSITIES
C07K2319/74
CHEMISTRY; METALLURGY
A61P1/16
HUMAN NECESSITIES
C12N2770/28122
CHEMISTRY; METALLURGY
International classification
A61K39/05
HUMAN NECESSITIES
C12N7/00
CHEMISTRY; METALLURGY
A61K39/39
HUMAN NECESSITIES
Abstract
Provided in the present invention are a diphtheria toxin non-toxic mutant CRM197 or a fragment thereof as an adjuvant in a fusion protein and the use thereof to enhance the immunogenicity of a target protein fused therewith, for example, an HEV capsid protein, or an influenza virus M2 protein or an immunogenic fragment thereof. Also provided is a method for enhancing the immunogenicity of a target protein, comprising the fusion expression of the CRM197 or the fragment thereof with the target protein to form a fusion protein. Further provided is a fusion protein comprising the CRM197 or the fragment thereof and a target protein, the CRM197 or the fragment thereof enhancing the immunogenicity of the target protein. The present invention also provides an isolated nucleic acid encoding the fusion protein, a construct and a vector comprising said nucleic acid, and a host cell comprising the nucleic acid.
Claims
1. A fusion protein comprising a fragment of CRM197 and a target protein, wherein said fragment of CRM197 enhances immunogenicity of the target protein, wherein said fragment of CRM197 consists of amino acids 1-389 of SEQ ID NO:2, and wherein said fragment of CRM197 is linked to the N-terminus and/or C-terminus of the target protein, optionally via a linker.
2. The fusion protein of claim 1, wherein the target protein is HEV capsid protein or an immunogenic fragment thereof.
3. The fusion protein of claim 2, wherein the immunogenic fragment of HEV capsid protein comprises or is HEV-239 (aa 368-606 of HEV capsid protein), E2 (aa 394-606 of HEV capsid protein) or E2s (aa 455-606 of HEV capsid protein).
4. The fusion protein of claim 2, wherein the fusion protein comprises (a) the fragment of CRM197, and (b) HEV capsid protein or the immunogenic fragment of HEV capsid protein; wherein (a) and (b) are linked together, optionally via a linker.
5. The fusion protein of claim 2, wherein the fusion protein has an amino acid sequence as set forth in SEQ ID NO: 8, 10, or 16.
6. The fusion protein of claim 1, wherein the target protein is influenza virus M2 protein or an immunogenic fragment thereof.
7. The fusion protein of claim 6, wherein the immunogenic fragment of M2 protein comprises or is M2e (aa 1-24 of M2 protein).
8. The fusion protein of claim 6, wherein the fusion protein comprises (a) the fragment of CRM197, and (b) influenza virus M2 protein or the immunogenic fragment of M2 protein; wherein (a) and (b) are linked together, optionally via a linker.
9. The fusion protein of claim 6, wherein the fusion protein has an amino acid sequence as set forth in SEQ ID NO: 36 or 42.
10. A polynucleotide encoding the fusion protein of claim 1.
11. An expression vector comprising the polynucleotide of claim 10.
12. A host cell comprising the polynucleotide of claim 10.
13. A pharmaceutical composition or vaccine comprising the fusion protein of claim 1 and a pharmaceutically acceptable carrier and/or excipient.
14. A method for preventing and/or treating HEV infection or a disease associated with HEV infection, comprising administering an effective amount of the fusion protein of claim 4 or a pharmaceutical composition comprising the fusion protein.
15. The method of claim 14, wherein the disease associated with HEV infection is Hepatitis E.
16. A method for preventing and/or treating influenza virus infection or a disease associated with influenza virus infection, comprising administering an effective amount of the fusion protein of claim 8 or a pharmaceutical composition comprising the fusion protein.
17. The method of claim 16, wherein the disease associated with influenza virus infection is influenza.
Description
DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12) Lane 1: the inclusion body obtained from the bacteria transformed with CRM197-L-M2e;
(13) Lane 2: the supernatant obtained from the bacteria transformed with CRM197-L-M2e;
(14) Lane 3: the inclusion body obtained from the bacteria transformed with 389-L-M2e;
(15) Lane 4: the supernatant obtained from the bacteria transformed with 389-L-M2e;
(16) Lane 5: the inclusion body obtained from the bacteria transformed with A-L-M2e;
(17) Lane 6: the supernatant obtained from the bacteria transformed with A-L-M2e.
(18)
(19) Lane 1: the inclusion body obtained from the bacteria transformed with M2e-L-A;
(20) Lane 2: the supernatant obtained from the bacteria transformed with M2e-L-A;
(21) Lane 3: the inclusion body obtained from the bacteria transformed with M2e-L-389;
(22) Lane 4: the supernatant obtained from the bacteria transformed with M2e-L-389;
(23) Lane 5: the inclusion body obtained from the bacteria transformed with M2e-L-CRM197;
(24) Lane 6: the supernatant obtained from the bacteria transformed with M2e-L-CRM197.
(25)
(26) Lane 1: A-L-M2e protein, not treated by boiling;
(27) Lane 2: A-L-M2e protein, treated by boiling;
(28) Lane 3: 389-L-M2e protein, not treated by boiling;
(29) Lane 4: 389-L-M2e protein, treated by boiling;
(30) Lane 5: CRM197-L-M2e protein, not treated by boiling;
(31) Lane 6: CRM197-L-M2e protein, treated by boiling.
(32)
(33) Lane 1: A-L-M2e protein, not treated by boiling;
(34) Lane 2: A-L-M2e protein, treated by boiling;
(35) Lane 3: 389-L-M2e protein, not treated by boiling;
(36) Lane 4: 389-L-M2e protein, treated by boiling;
(37) Lane 5: CRM197-L-M2e protein, not treated by boiling;
(38) Lane 6: CRM197-L-M2e protein, treated by boiling.
(39)
(40) Lane 1: M2e-L-A protein, not treated by boiling;
(41) Lane 2: M2e-L-A protein, treated by boiling;
(42) Lane 3: M2e-L-389 protein, not treated by boiling;
(43) Lane 4: M2e-L-389 protein, treated by boiling;
(44) Lane 5: M2e-L-CRM197 protein, not treated by boiling;
(45) Lane 6: M2e-L-CRM197 protein, treated by boiling.
(46)
(47) Lane 1: M2e-L-A protein, not treated by boiling;
(48) Lane 2: M2e-L-A protein, treated by boiling;
(49) Lane 3: M2e-L-389 protein, not treated by boiling;
(50) Lane 4: M2e-L-389 protein, treated by boiling;
(51) Lane 5: M2e-L-CRM197 protein, not treated by boiling;
(52) Lane 6: M2e-L-CRM197 protein, treated by boiling.
(53) The results shown in
(54)
(55)
(56)
(57)
SPECIFIC MODES FOR CARRYING OUT THE INVENTION
(58) The present invention is illustrated by reference to the following examples (which are used only for the purpose of illustrating the present invention and are not intended to limit the protection scope of the present invention).
(59) Unless indicated otherwise, the molecular biological experimental methods and immunological assays used in the present invention are carried out substantially in accordance with the methods as described in Sambrook J et al., Molecular Cloning: A Laboratory Manual (Second Edition), Cold Spring Harbor Laboratory Press, 1989, and F. M. Ausubel et al., Short Protocols in Molecular Biology, 3rd Edition, John Wiley & Sons, Inc., 1995; restriction endonucleases are used under the conditions recommended by manufacturers of the products. The reagents used in the present invention, whose manufacturers are not clearly indicated, are conventional products in the art or commercially available. Those skilled in the art understand that the examples are used for illustrating the present invention, but not intended to limit the protection scope of the present invention.
Example 1. Clone of CRM197 Gene
(60) Genomic DNA extracted from Diphtheria bacillus C7 ((3197) strain obtained from ATCC (NO 53281) was used as template for the PCR reaction, wherein the forward primer was CRM197F (SEQ ID NO: 19), and the reverse primer was CRM197R (SEQ ID NO: 20). The PCR reaction was performed in a PCR apparatus (Biometra T3) under the following conditions, to prepare the full-length gene encoding CRM197.
(61) TABLE-US-00002 94 C. denaturation 10 min 1 cycle 94 C. denaturation 1.5 min 20 cycles 58 C. annealing 1.5 min 72 C. elongation 1.5 min 72 C. elongation 10 min 1 cycle
(62) After PCR amplification, a product of about 1.6 kb in length, was obtained. After sequencing, the nucleotide sequence (SEQ ID NO: 1) of the amplification product (i.e. the full-length gene of CRM197) was obtained, and the amino acid sequence encoded thereby was set forth in SEQ ID NO: 2.
Example 2. Design and Clone of Fusion Proteins Comprising CRM197 or a Fragment Thereof and an HEV Capsid Protein Fragment
(63) In the Example, vectors expressing the fusion proteins were constructed exemplarily. The clone design of various exemplary fusion proteins constructed is shown in
(64) Clone of Fusion Proteins Comprising a Linker
(65) The amplification product (i.e. the full-length gene of CRM197) obtained in the Example 1 was used as template. The forward primer was CRM197F (SEQ ID NO: 19), at the 5 terminal of which the restriction endonuclease NdeI site CAT ATG was introduced, wherein ATG was the initiation codon in E. coli system. The reverse primers were CRM197-linker R (SEQ ID NO: 21), 389-linker R (SEQ ID NO: 22), and A-linker R (SEQ ID NO: 23), respectively, at the 5 terminal of which the restriction endonuclease BamHI site GGA TCC was introduced. The PCR reaction was performed in a PCR thermocycler (Biometra T3) under the following conditions. The sequences of the primers used were shown in Table 1.
(66) TABLE-US-00003 94 C. denaturation 10 min 1 cycle 94 C. denaturation 1.5 min 20 cycle 58 C. annealing 1.5 min 72 C. elongation 1.5 min 72 C. elongation 10 min 1 cycle
(67) The amplification products were DNA fragments of about 1600 bp, 1200 bp and 600 bp in length, respectively.
(68) In addition, pTO-T7-E2 (Li, et al. JBC. 2005. 28(5): 3400-3406) was used as template. The forward primers were E2F (SEQ ID NO: 24) and E2sF (SEQ ID NO: 25), respectively, at the 5 terminal of which the restriction endonuclease BamHI site GGA TCC was introduced. The reverse primer was Drp59R (SEQ ID NO: 26), at the 5 terminal of which the restriction endonuclease EcoRI site GAA TTC was introduced. The PCR reaction was performed in a PCR thermocycler (Biometra T3) under the following conditions.
(69) TABLE-US-00004 94 C. denaturation 10 min 1 cycle 94 C. denaturation 50 sec 20 cycle 58 C. annealing 50 sec 72 C. elongation 50 sec 72 C. elongation 10 min 1 cycle
(70) The amplification products were DNA fragments of about 600 bp and 450 bp in length, respectively.
(71) The amplification products as obtained above were linked into commercially available pMD 18-T vector (produced by TAKARA Co.), respectively, and designated as pMD 18-T-CRM197-L, pMD 18-T-389-L and pMD 18-T-A-L as well as pMD 18-T-E2 and pMD 18-T-E2s. As identified by NdeI/BamHI and BamHI/EcoRI enzyme cleavage, respectively, the positive clones pMD 18-T-CRM197-L, pMD 18-T-389-L, pMD 18-T-A-L, pMD 18-T-E2 and pMD 18-T-E2s were obtained.
(72) As confirmed by M13(+) primer, correct nucleotide sequences of interest were inserted into the obtained pMD 18-T-CRM197-L, pMD 18-T-389-L, pMD 18-T-A-L, pMD 18-T-E2 and pMD 18-T-E2s, respectively.
(73) The plasmids pMD 18-T-CRM197-L, pMD 18-T-389-L and pMD 18-T-A-L were digested by NdeI/BamHI enzyme. The fragments obtained by enzyme cleavage were linked into the prokaryotic expression vector pTO-T7 digested by NdeI/BamHI enzyme (Luo Wenxin et al., Chinese Journal of Biotechnology, 2000, 16:53-57), and were transformed into E. coli ER2566 (purchased from Invitrogen Co.); after extraction of plasmids, as identified by NdeI/BamHI enzyme cleavage, the positive plasmids pTO-T7-CRM197-L, pTO-T7-389-L and pTO-T7-A-L, into which CRM197-L, 389-L and A-L were inserted, respectively, were obtained.
(74) pTO-T7-CRM197-L, pTO-T7-389-L, pTO-T7-A-L, pMD 18-T-E2 and pMD 18-T-E2s were digested by BamHI/EcoRI enzyme. Each of the obtained E2 and E2s fragments was linked into the vectors pTO-T7-CRM197-L, pTO-T7-389-L and pTO-T7-A-L digested by BamHI/EcoRI enzyme, respectively. As identified by NdeI/EcoRI enzyme cleavage, the positive expression vectors pTO-T7-CRM197-L-E2, pTO-T7-CRM197-L-E2s, pTO-T7-389-L-E2, pTO-T7-389-L-E2s, pTO-T7-A-L-E2 and pTO-T7-A-L-E2s, into which CRM197-L-E2 (SEQ ID NO:3, 4), CRM197-L-E2s (SEQ ID NO:5, 6), 389-L-E2 (SEQ ID NO:7, 8), 389-L-E2s (SEQ ID NO:9, 10), A-L-E2 (SEQ ID NO:11, 12) or A-L-E2s (SEQ ID NO:13, 14) was inserted, respectively, were obtained.
(75) Clone of the Fusion Proteins 389-E2s and A-E2s without a Linker
(76) The vectors expressing 389-E2s and A-E2s were constructed by three PCR reactions. For the first PCR reaction, the full-length gene of CRM197 was used as template. The forward primer was CRM197F, at the 5 terminal of which the restriction endonuclease NdeI site CAT ATG was introduced, wherein ATG was the initiation codon in E. coli system. The reverse primers were 389-E2s R (SEQ ID NO: 27) and A-E2s R (SEQ ID NO: 28), respectively. The amplification was performed to obtain the N-terminal fragments of the fusion proteins. For the second PCR reaction, the full-length gene of CRM197 was used as template. The forward primer were 389-E2s F (SEQ ID NO: 29) and A-E2s F (SEQ ID NO:30), respectively. The reverse primer was DrP59 R, at the 5 terminal of which the restriction endonuclease EcoRI site GAA TTC was introduced. The amplification was performed to obtain the C-terminal fragments of the fusion proteins. The first and second PCR reactions were performed in a PCR thermocycler (Biometra T3) under the following conditions.
(77) TABLE-US-00005 94 C. denaturation 10 min 1 cycle 94 C. denaturation 50 sec 20 cycle 58 C. annealing 50 sec 72 C. elongation 50 sec 72 C. elongation 10 min 1 cycle
(78) For the third PCR reaction, the amplification products of the first and second PCR reactions were used as templates (for example, the two fragments obtained by using 389-E2sF and 389-E2sR as primers were used as template for amplification of 389-E2s), and CRM197F and DrP59R were used as primers. The amplification was performed in a PCR thermocycler (Biometra T3) under the following conditions.
(79) TABLE-US-00006 94 C. denaturation 10 min 1 cycle 94 C. denaturation 50 sec 20 cycle 58 C. annealing 50 sec 72 C. elongation 50 sec 72 C. elongation 10 min 1 cycle
(80) The amplification products were DNA fragments of about 1600 bp and 1000 bp in length, respectively. The amplification products obtained above were linked into commercially available pMD 18-T vector (produced by TAKARA Co.), respectively. As identified by NdeI/EcoRI enzyme cleavage, the positive clones pMD 18-T-389-E2s and pMD 18-T-A-E2s were obtained.
(81) As confirmed by M13(+) primer, correct nucleotide sequences of SEQ ID NO:15 and SEQ ID NO:17 (which encoded the amino acid sequences of SEQ ID NO:16 and SEQ ID NO:18, respectively) were inserted into the obtained pMD 18-T-389-E2s and pMD 18-T-A-E2s, respectively.
(82) The plasmids pMD 18-T-389-E2s and pMD 18-T-A-E2s were digested by NdeI/EcoRI enzyme. The fragments obtained by enzyme cleavage were then linked into the prokaryotic expression vector pTO-T7 digested by NdeI/EcoRI enzyme (Luo Wenxin et al., Chinese Journal of Biotechnology, 2000, 16:53-57). As identified by NdeI/EcoRI enzyme cleavage, the positive plasmids pTO-T7-389-E2s and pTO-T7-A-E2s, into which 389-E2s and A-E2s were inserted, respectively, were obtained.
(83) The sequences of the primers used in the Example were shown in Table 1.
(84) TABLE-US-00007 TABLE1 Primersequences SEQ ID NO: PrimerName Primersequence(5-3) 19 CRM197F CATATGGGCGCTGATGATGTTGTTGATTCTTCT 20 CRM197R GAATTCCCCACTACCTTTCAGCTTTTG 21 CRM197-linker GGATCCACCGCCACCGCTGCCACCGCCACCGCTG R CCACCGCCACCGCTTTTGAT 22 389-linkerR GGATCCACCGCCACCGCTGCCACCGCCACCGCTG CCACCGCCACCAAATGGTTGC 23 A-linkerR GGATCCACCGCCACCGCTGCCACCGCCACCGCTG CCACCGCCACCACGATTTCCTGCAC 24 E2F GGATCCCAGCTGTTCTACTCTCGTC 25 E2sF GGATCCTCCCCAGCCCCATCGCGC 26 Drp59R GAATTCCTAGCGCGGAGGGGGGGCT 27 389-E2sR GATGGGGCTGGGGAAAATGGTTG 28 A-E2sR GATGGGGCTGGGGAACGATTTCCTGCAC 29 389-E2sF CGCAACCATTTTCCCCAGCCC 30 A-E2sF GAAATCGTTCCCCAGCCCCAT
(85) 1 L of plasmids pTO-T7-CRM197-L-E2, pTO-T7-CRM197-L-E2s, pTO-T7-389-L-E2, pTO-T7-389-L-E2s, pTO-T7-389-E2s, pTO-T7-A-L-E2, pTO-T7-A-L-E2s and pTO-T7-A-E2s (0.15 mg/ml) were separately used to transform 40 L competent E. coli ER2566 (purchased from Invitrogen) prepared by the Calcium chloride method, and then the bacteria were plated on solid LB medium (the components of the LB medium: 10 g/L peptone, 5 g/L yeast powder, and 10 g/L NaCl, the same below) containing kanamycin (at a final concentration of 100 mg/ml, the same below). The plates were statically incubated at 37 C. for about 10-12 h until individual colonies could be observed clearly. Individual colonies from the plates were transferred to a tube containing 4 ml liquid LB medium containing kanamycin. The cultures were incubated in a shaking incubator at 180 rpm for 10 h at 37 C., and then 1 ml bacterial solutions was taken and stored at 70 C.
Example 3. The Expression and Purification of the Fusion Proteins Constructed in Example 2
(86) Expression of Fusion Proteins and Purification of Inclusion Bodies
(87) 5 L bacterial solution, taken from an ultra low temperature freezer at 70 C., was seeded to 5 mL liquid LB medium containing kanamycin, and then was cultured at 37 C., 180 rpm under shaking until OD600 reached about 0.5. The resultant solution was transferred to 500 ml LB medium containing kanamycin, and then was cultured at 37 C., 180 rpm under shaking for 4-5 h. When OD600 reached about 1.5, IPTG was added to a final concentration of 0.4 mM, and the bacteria were induced under shaking at 37 C. for 4 h.
(88) After induction, centrifugation was performed at 8000 g for 5 min to collect the bacteria, and then the bacteria were re-suspended in a lysis solution at a ratio of 1 g bacteria to 10 mL lysis solution (20 mM Tris buffer pH7.2, 300 mM NaCl), in ice-bath. The bacteria were treated with a sonicator (Sonics VCX750 Type Sonicator) (conditions: operating time 15 min, pulse 2s, intermission 4s, output power 55%). The bacterial lysate was centrifuged at 12000 rpm, 4 C. for 5 min (the same below), the supernatant was discarded and the precipitate (i.e. inclusion body) was kept; 2% Triton-100 of the same volume was used for washing, the result mixture was under vibration for 30 min, centrifuged, and the supernatant was discarded. The precipitate was re-suspended in Buffer 1 (20 mM Tris-HCl pH8.0, 100 mM NaCl, 5 mM EDTA), under vibration for 30 min, centrifuged, and the supernatant was discarded. The precipitate was then re-suspended in 2M urea, under vibration at 37 C. for 30 min, centrifuged, the supernatant and the precipitate were obtained. The supernatant was kept; and the precipitate was re-suspended in 4M urea in the same volume, under vibration at 37 C. for 30 min, and centrifuged at 12000 rpm, 4 C. for 15 min to obtain the supernatant and precipitate. The supernatant (i.e. the 4M urea-dissolved supernatant) was kept; and the precipitate was further in re-suspended in 8M urea in the same volume, under vibration at 37 C. for 30 min, and centrifuged, and the supernatant (i.e. the 8M urea-dissolved supernatant) was kept.
(89) The SDS-PAGE analytic results of the obtained fractions (Coomassie brilliant blue staining was used for visualization, the same below, see the methods in The Molecular Cloning Experiment Guide, 2.sup.nd edition) was showed in
(90) Purification of the Fusion Protein A-L-E2 by Anion Exchange Chromatography
(91) Sample: a solution of A-L-E2 protein with a purity of about 80% as obtained above.
(92) Equipment: AKTA Explorer 100 preparative liquid chromatography system produced by GE Healthcare (i.e. the original Amersham Pharmacia Co.)
(93) Chromatographic media: Q SEPHAROSE Fast Flow (GE Healthcare Co.)
(94) Column Volume: 15 mm20 cm
(95) Buffer: 20 mM phosphate buffer pH 7.7+4M urea
(96) 20 mM phosphate buffer pH 7.7+4M urea+1M NaCl
(97) Flow Rate: 6 mL/min
(98) Detector Wavelength: 280 nm
(99) Elution protocol: eluting the protein of interest with 150 mM NaCl, eluting the undesired protein with 300 mM NaCl, and collecting the fraction eluted with 150 mM NaCl.
(100) Purification of the Fusion Protein A-L-E2 by Hydrophobic Interaction Chromatography
(101) Equipment: AKTA Explorer 100 preparative liquid chromatography system produced by GE Healthcare (i.e. the original Amersham Pharmacia Co.)
(102) Chromatographic media: Phenyl SEPHAROSE Fast Flow (GE Healthcare Co.) Column Volume: 15 mm20 cm
(103) Buffer: 20 mM phosphate buffer pH 7.7+4M urea+0.5 M (NH.sub.4).sub.2SO.sub.4
(104) 20 mM phosphate buffer pH 7.7+4M
(105) Flow Rate: 5 mL/min
(106) Detector Wavelength: 280 nm
(107) Sample: the fraction eluted with 150 mM NaCl as obtained in the previous step was dialyzed to a buffer (20 mM phosphate buffer pH 7.7+4M urea+0.5 M (NH.sub.4).sub.2SO.sub.4), and then was used as sample.
(108) Elution protocol: eluting the undesired protein with 0.3M (NH.sub.4).sub.2SO.sub.4, eluting the protein of interest with 0.1M and 0M (NH.sub.4).sub.2SO.sub.4, and collecting the fraction eluted with 0.1M and 0M (NH.sub.4).sub.2SO.sub.4.
(109) The fraction eluted with 0.1M and 0M (NH.sub.4).sub.2SO.sub.4 was dialyzed and renatured into PBS, and then 10 l was taken for SDS-PAGE analysis, and electrophoresis bands were visualized by Coomassie brilliant blue staining. The results showed that after the above purification steps, the fusion protein A-L-E2 had a purity of above 90% (See
Example 4. Analysis of Properties of the Fusion Proteins Constructed in Example 2 Determination of the Reactivity of the Fusion Proteins with Antibodies by Western Blotting
(110) The reactivity of the fusion proteins with HEV neutralizing monoclonal antibody 8C11 (see, Zhang et al., Vaccine. 23(22): 2881-2892 (2005)) and anti-CRM197 polyclonal antiserum (which was prepared by immunizing mice with CRM197 through methods well known in the art, and the reactivity of the serum was confirmed by commercially available CRM197) were determined by Western blotting. The dialyzed and renatured samples were transferred to nitrocellulose membrane for blotting after SDS-PAGE separation; 5% skimmed milk was used to block the membrane for 2 h, monoclonal antibody 8C11 diluted at a certain ratio was then added (monoclonal antibody was diluted at 1:500, and polyclonal antiserum was diluted at 1:1000), and the reaction was carried out for 1 h. The membrane was washed with TNT (50 mmol/L Tris.Cl (pH 7.5), 150 mmol/L NaCl, 0.05% Tween 20) for three times, 10 min for each time. Goat Anti-mouse alkaline phosphatase (KPL product) was then added, the reaction was carried out for 1 h, and the membrane was then washed with TNT for three times, 10 min for each time. NBT and BCIP (PROTOS product) were used for visualization. The results, as determined by Western blotting using the fusion proteins and HEV neutralizing monoclonal antibody 8C11, were shown in
(111) Determination of the Reactivity of the Fusion Proteins with Various HEV Specific Antibodies by ELISA
(112) The reactivity of the fusion proteins and the control proteins E2 and HEV-239 with various HEV specific antibodies (Gu Ying et al., Chinese Journal of Virology, 19(3): 217-223(2003)) was determined by indirect ELISA. The dialyzed and renatured samples were diluted in 1PBS (1 g/ml), and then were added to 96-well microplate (Beijing Wantai Co.) at 100 l/well and incubated at 37 C. for 2 h. The coating solution was discarded, the plate was washed with PBST (PBS+0.05% Tween-20) once, and then the blocking solution (2% gelatin, 5% Casein, 1% PROCLIN 300, in PBS) was added at 200 l/well and incubated at 37 C. for 2 h. The blocking solution was discarded when the detection was performed, and the HEV monoclonal antibodies diluted at a certain ratio (when E2s and its fusion protein were detected, they were diluted at 1:10000; when E2 and its fusion protein were detected, they were diluted at 1:100000; when the reactivity of A-L-E2, 239 and E2 proteins was compared, the monoclonal antibodies were subjected to 10-fold serial dilution wherein 1 mg/ml was used as the initial concentration, and the polyclonal antibody at its initial concentration was subjected to dilution in the same manner) was added at 100 l/well. The mixture was incubated at 37 C. for 1-2 h. The plate was then washed with PBST for five times, and HRP-labeled Goat anti Mouse (KPL product) (1:5000) was then added at 100 l/well and was incubated at 37 C. for 30 min; the plate was then washed with PBST for five times, HRP substrate (Beijing Wantai Co.) was then added at 100 l/well and was incubated at 37 C. for 15 min. 2M sulphuric acid was added at 50 l/well to stop the reaction, and Microplate reader (Sunrise Type, product from Tecan Co.) was then used to read OD450/620 value. The results of the ELISA using the fusion proteins with the monoclonal antibodies were shown in
(113) Analysis of the Reactivity of the Fusion Protein A-L-E2 Purified by Chromatography
(114) The reactivity of the fusion protein A-L-E2, purified by two-step chromatography, was analyzed by indirect ELISA (see the concrete process in the previous step). The ELISA result was shown in
(115) Analysis of Sedimentation Velocity (SV) of the Fusion Protein A-L-E2
(116) The apparatus used in the experiment was US Beckman XL-A analytic supercentrifuge, which was equipped with an optical detection system and An-50Ti and An-60Ti rotators. The Sedimentation Velocity (SV) method (c(s) algorithm, see P. Schuck et al., Biophys J 78: 1606-1619(2000)) was used to analyze the sedimentation coefficient of the fusion protein A-L-E2. The analytic result was shown in
Example 5. Analysis of Immunogenicity of the Fusion Proteins Constructed in Example 2
(117) Antibody Titers Induced by the Fusion Proteins
(118) The mice used in the experiment were female, 6-week old BALB/C mice. By using aluminum adjuvant, mice were immunized by intraperitoneal injection of the fusions proteins which were prepared by the methods in the Example 3 and renatured to PBS and the control proteins HEV-239, E2 and E2s, respectively. The injection volume was 1 ml, and two dose groups (a 5 g-dose group or a 0.5m-dose group) were used. The primary immunization was performed at week 0, and booster immunization was performed at week 2 and 4.
(119) HEV-239 was used to coat a plate, and the antibody titers in serum as induced by the fusion proteins and the control proteins, were measured by similar indirect ELISA assay as described above. The detection results of the serum antibody titers within 3 months after immunization were shown in
(120) Investigation on Median Effective Dose (ED50) of the Fusion Protein A-L-E2
(121) In the experiment, immunogenicity of fusion proteins was investigated by determining median effective dose (ED50). The experimental animals used were 3-4 week old female BALB/c mice. A-L-E2 was mixed with aluminum adjuvant, and the initial dose was 1 g/mouse, and was subjected to serial dilution at 1:3, resulting in 8 dose groups in total. In addition, HEV-239 (HEV recombinant vaccine) was used as control, and the initial dose was 1.6 g/mouse, and was subjected to serial dilution at 1:4, resulting in 4 dose groups in total. 6 mice were used in each group. The immunization was carried out by single intraperitoneal injection.
(122) Peripheral venous blood was taken after 4 weeks following immunization, serum was separated, and serological conversion rate was determined by ELISA assay as described above. When the ELISA value of 100-fold diluted serum was higher than the cutoff value (i.e. three times of the average negative value), the serum was regarded as positive. The median effective dose (ED50) was calculated by Reed-Muench method. The serological conversion rate of the fusion protein A-L-E2 was shown in Table 2, and the serological conversion rate of HEV-239 vaccine was shown in Table 3.
(123) TABLE-US-00008 TABLE 2 ED50 of A-L-E2 for inducing seroconversion of HEV antibody in mice Number of mice Number of with Serological Dose (g) mice seroconversion conversion rate ED50 (g) 1.0000 6 6 100% 0.0064 0.3333 6 6 100% 0.1111 6 6 100% 0.0370 6 6 100% 0.0123 6 6 100% 0.0041 6 1 16.7% 0.0013 6 0 0% 0.0005 6 0 0%
(124) TABLE-US-00009 TABLE 3 ED50 of HEV-239 vaccine for inducing seroconversion of HEV antibody in mice Number of mice Number of with Serological Dose (g) mice seroconversion conversion rate ED50(g) 1.6 6 6 100% 0.071 0.4 6 5 83.3% 0.1 6 4 66.7% 0.025 6 0 0%
(125) The results showed that ED50 of HEV-239 was 11 times of that of A-L-E2, indicating that CRM197 of the invention or a fragment thereof significantly enhanced immunogenicity of the antigen protein fused therewith, and could be used as intramolecular adjuvant. Meanwhile, since immunogenicity of the fusion protein A-L-E2 was significantly higher than that of HEV-239 vaccine in the form of virus like particle, the fusion protein might be used for the preparation of a new vaccine which is more effective for Hepatitis E.
Example 6. Design and Clone of Fusion Proteins Comprising CRM197 or a Fragment Thereof and an Influenza Virus M2e Protein
(126) In the Example, vectors expressing the fusion proteins were constructed exemplarily. The clone design of the exemplary fusion proteins constructed is shown in
(127) Clone of Fusion Proteins
(128) M2e Fused to the C-Terminus of CRM197 or a Fragment Thereof
(129) The amplification product (i.e. the full-length gene of CRM197) obtained in the Example 1 was used as template. The forward primer was CRM197F1 (SEQ ID NO: 45), at the 5 terminal of which the restriction endonuclease NdeI site CAT ATG was introduced, wherein ATG was the initiation codon in E. coli system. The reverse primers were CRM197-linker R1 (SEQ ID NO: 46), 389-linker R1 (SEQ ID NO: 47) and A-linker R1 (SEQ ID NO: 48), respectively, at the 5 terminal of which the restriction endonuclease BamHI site GGA TCC was introduced. The PCR reaction was performed in a PCR thermocycler (Biometra T3) under the following conditions. The sequences of the primers used were shown in Table 4.
(130) TABLE-US-00010 95 C. denaturation 10 min 1 cycle 95 C. denaturation 1.5 min 20 cycle 58 C. annealing 1.5 min 72 C. elongation 1.7 min 72 C. elongation 10 min 1 cycle
(131) The amplification products were DNA fragments of about 1600 bp, 1200 bp and 600 bp in length, respectively.
(132) In addition, the plasmid PHW2000 (stored in our lab, comprising the full-length gene of M2) was used as a template. The forward primer was M2eF1 (SEQ ID NO: 49), at the 5 terminal of which the restriction endonuclease BamHI GGA TCC was introduced. The reverse primer was M2eR (SEQ ID NO: 50), at the 5 terminal of which the restriction endonuclease EcoRI site GAA TTC was introduced. The PCR reaction was performed in a PCR thermocycler (Biometra T3) under the following conditions. The sequences of the primers used were shown in Table 4.
(133) TABLE-US-00011 95 C. denaturation 10 min 1 cycle 95 C. denaturation 50 sec 20 cycle 58 C. annealing 50 sec 72 C. elongation 30 sec 72 C. elongation 10 min 1 cycle
(134) The amplification products were DNA fragments of about 70 bp in length, respectively.
(135) The amplification products as obtained above were linked into commercially available pMD 18-T vector (produced by TAKARA Co.), respectively, and designated as pMD 18-T-CRM197-L1, pMD 18-T-389-L1 and pMD 18-T-A-L1 as well as pMD 18-T-M2e. As identified by NdeI/BamHI and BamHI/EcoRI enzyme cleavage, respectively, the positive clones pMD 18-T-CRM197-L1, pMD 18-T-389-L1, pMD 18-T-A-L1 and pMD 18-T-M2e were obtained.
(136) As confirmed by M13(+) primer, correct nucleotide sequences of interest were inserted into the obtained plasmids pMD 18-T-CRM197-L1, pMD 18-T-389-L1, pMD 18-T-A-L1 and pMD 18-T-M2e.
(137) The plasmids pMD 18-T-CRM197-L1, pMD 18-T-389-L1 and pMD 18-T-A-L1 were digested by NdeI/BamHI enzyme. The fragments obtained by enzyme cleavage were linked into the prokaryotic expression vector pTO-T7 digested by NdeI/BamHI enzyme (Luo Wenxin et al., Chinese Journal of Biotechnology, 2000, 16:53-57), and were transformed into E. coli ER2566 (purchased from Invitrogen Co.); after extraction of plasmids, as identified by NdeI/BamHI enzyme cleavage, the positive plasmids pTO-T7-CRM197-L1, pTO-T7-389-L1 and pTO-T7-A-L1, into which the fragments CRM197-L1, 389-L1 and A-L1 were inserted, respectively, were obtained.
(138) pTO-T7-CRM197-L1, pTO-T7-389-L1, pTO-T7-A-L1 and pMD 18-T-M2e were digested by BamHI/EcoRI enzyme. The obtained M2e fragment was linked into the vectors pTO-T7-CRM197-L1, pTO-T7-389-L1 and pTO-T7-A-L1 digested by BamHI/EcoRI enzyme, respectively. As identified by NdeI/EcoRI enzyme cleavage, the positive expression vectors pTO-T7-CRM197-L-M2e, pTO-T7-389-L-M2e, and pTO-T7-A-L-M2e, into which CRM197-L-M2e (SEQ ID NO:33, 34), 389-L-M2e (SEQ ID NO:35, 36), or A-L-M2e (SEQ ID NO:37, 38) was inserted respectively, were obtained.
(139) M2e Fused to the N-Terminus of CRM197 or a Fragment Thereof.
(140) The plasmid PHW2000 (stored in our lab, containing the full-length gene of M2) was used as template. The forward primer was M2eF2 (SEQ ID NO: 51), at the 5 terminal of which the restriction endonuclease NdeI CAT ATG was introduced, wherein ATG was the initiation codon in E. coli system. The reverse primer was M2e-Linker R (SEQ ID NO: 52), at the 5 terminal of which the restriction endonuclease BamHI GGA TCC was introduced. The PCR reaction was performed in a PCR thermocycler (Biometra T3) under the following conditions.
(141) TABLE-US-00012 95 C. denaturation 10 min 1 cycle 95 C. denaturation 50 sec 20 cycle 58 C. annealing 50 sec 72 C. elongation 30 sec 72 C. elongation 10 min 1 cycle
(142) The amplification products were DNA fragments of about 100 bp in length.
(143) In addition, the amplification product (i.e. the full-length gene of CRM197) obtained in the Example 1 was used as template. The forward primer was CRM197F2 (SEQ ID NO: 53), at the 5 terminal of which the restriction endonuclease BamHI GGA TCC was introduced. The reverse primers were CRM197 R2 (SEQ ID NO: 54), 389 R (SEQ ID NO: 55), and A R (SEQ ID NO: 56), at the 5 terminal of which the restriction endonuclease EcoRI site GAA TTC was introduced. The PCR reaction was performed in a PCR thermocycler (Biometra T3) under the following conditions. The sequences of the primers used were shown in Table 4.
(144) TABLE-US-00013 95 C. denaturation 10 min 1 cycle 95 C. denaturation 1.5 min 20 cycle 58 C. annealing 1.5 min 72 C. elongation 1.7 min 72 C. elongation 10 min 1 cycle
(145) The amplification products were DNA fragments of about 1600 bp, 1200 bp and 600 bp in length, respectively.
(146) The amplification products as obtained above were linked into commercially available pMD 18-T vector (produced by TAKARA Co.), respectively, and designated as pMD 18-T-M2e-L as well as pMD 18-T-CRM197, pMD 18-T-389 and pMD 18-T-A, respectively. As identified by NdeI/BamHI and BamHI/EcoRI enzyme cleavage, respectively, the positive clones pMD 18-T-CRM197, pMD 18-T-389, pMD 18-T-A, and pMD 18-T-M2e-L were obtained.
(147) As confirmed by M13(+) primer, correct nucleotide sequences of interest were inserted into the obtained plasmids pMD 18-T-CRM197, pMD 18-T-389, pMD 18-T-A, and pMD 18-T-M2e-L, respectively.
(148) The plasmid pMD 18-T-M2e-L was digested by NdeI/BamHI enzyme. The fragments obtained by enzyme cleavage were then linked into the prokaryotic expression vector pTO-T7 digested by NdeI/BamHI enzyme (Luo Wenxin et al., Chinese Journal of Biotechnology, 2000, 16:53-57), and was transformed into E. coli ER2566 (purchased from Invitrogen Co.); after extraction of plasmids, as identified by NdeI/BamHI enzyme cleavage, the positive plasmid pTO-T7-M2e-L, into which the fragment M2e-L was inserted, was obtained.
(149) pTO-T7-M2e-L, pMD 18-T-CRM197, pMD 18-T-389 and pMD 18-T-A were digested by BamHI/EcoRI enzyme. The obtained fragments CRM197, 389 and A were linked into the vector pTO-T7-M2e-L digested by BamHI/EcoRI enzyme, respectively. As identified by NdeI/EcoRI enzyme cleavage, the positive expression vectors pTO-T7-M2e-L-CRM197, pTO-T7-M2e-L-389, and pTO-T7-M2e-L-A, into which M2e-L-CRM197 (SEQ ID NO:39, 40), M2e-L-389 (SEQ ID NO:41, 42), and M2e-L-A (SEQ ID NO:43, 44) were inserted respectively, were obtained.
(150) The sequences of the primers used in the Example are listed in Table 4.
(151) TABLE-US-00014 TABLE4 Primersequences SEQ ID NO: Primernames Primersequences(5-3) 45 CRM197F1 CATATGGGCGCTGATGATGTTGTTGATTCTTCTA AATCTTTTGTGATGGAA 46 CRM197-linker GGATCCGCTGCCACCGCCACCGCTGCCACCGCC R1 ACCGCTTTTGAT 47 389-linkerR1 GGATCCGCTGCCACCGCCACCGCTGCCACCGCC ACCAAATGGTTG 48 A-linkerR1 GGATCCGCTGCCACCGCCACCGCTGCCACCGCC ACCACGATTTCC 49 M2eF1 GGATCCATGAGTCTTCTAACCGAGGTCGAAACG CCT 50 M2eR GAATTCTTAATCACTTGAACCGTTGCATCTGCAC CCCCA 51 M2eF2 CATATGATGAGTCTTCTAACCGAGGTCGAAACG CCT 52 M2e-LinkerR GGATCCGCTGCCACCGCCACCGCTGCCACCGCC ACCATCACTTGA 53 CRM197F2 GGATCCGGCGCTGATGATGTTGTTGATTCTTCTA AATCTTTTGTGATGGAA 54 CRM197R2 GAATTCTAAGCTTTTGATTTCAAAAAATAGCGAT AGCTTAGA 55 389R GAATTCTAAAAATGGTTGCGTTTTATGCCCCGGA GAATACGC 56 AR GAATTCTAAACGATTTCCTGCACAGGCTTGAGCC ATATACTC
(152) 1 L of plasmids pTO-T7-CRM197-L-M2e, pTO-T7-389-L-M2e, pTO-T7-A-L-M2e, pTO-T7-M2e-L-CRM197, pTO-T7-M2e-L-389 and pTO-T7-M2e-L-A (0.15 mg/ml) were separately used to transform 40 l. L competent E. coli ER2566 (purchased from Invitrogen) prepared by the Calcium chloride method, and then the bacteria were plated on solid LB medium (the components of the LB medium: 10 g/L peptone, 5 g/L yeast powder, and 10 g/L NaCl, the same below) containing kanamycin (at a final concentration of 100 mg/ml, the same below). The plates were statically incubated at 37 C. for about 10-12 h until individual colonies could be observed clearly. Individual colonies from the plates were transferred to a tube containing 4 ml liquid LB medium containing kanamycin. The cultures were incubated in a shaking incubator at 180 rpm for 10 h at 37 C., and then 1 ml bacterial solution was taken and stored at 70 C.
Example 7. The Expression, Isolation and Renaturation of the Fusion Proteins Constructed in Example 6
(153) 5 L bacterial solution, taken from an ultra low temperature freezer at 70 C., was seeded to 5 mL liquid LB medium containing kanamycin, and then was cultured at 37 C., 180 rpm under shaking until OD600 reached about 0.5. The resultant solution was transferred to 500 ml LB medium containing kanamycin, and then was cultured at 37 C., 180 rpm under shaking for 4-5 h. When OD600 reached about 1.5, IPTG was added to a final concentration of 0.4 mM, and the bacteria were induced under shaking at 37 C. for 4 h.
(154) After induction, centrifugation was performed at 8000 g for 5 min to collect the bacteria, and then the bacteria was re-suspended in a lysis solution at a ratio of 1 g bacteria to 10 mL lysis solution (20 mM Tris buffer pH7.2, 300 mM NaCl), in ice-bath. The bacteria was treated with a sonicator (Sonics VCX750 Type Sonicator) (conditions: operating time 15 min, pulse 2s, intermission 4s, output power 55%). The bacterial lysate was centrifuged at 12000 rpm, 4 C. for 5 min (the same below), and the supernatant and the precipitate (i.e. inclusion body) after disrupting the bacteria by ultrasonication were collected, respectively. 2% Triton-100 of the same volume was used for washing the precipitate, the result mixture was under vibration for 30 min, centrifuged, and the supernatant was discarded. The precipitate was re-suspended in Buffer I (20 mM Tris-HCl pH8.0, 100 mM NaCl, 5 mM EDTA), under vibration for 30 min, centrifuged, and the supernatant was discarded. The precipitate was then re-suspended in 2M urea, under vibration at 37 C. for 30 min, centrifuged, and the supernatant and the precipitate were obtained. The supernatant was kept; and the precipitate was re-suspended in 4M urea in the same volume, under vibration at 37 C. for 30 min, and centrifuged at 12000 rpm, 4 C. for 15 min to obtain the supernatant and precipitate. The supernatant (i.e. the 4M urea-dissolved supernatant) was kept; and the precipitate was further in re-suspended in 8M urea in the same volume, under vibration at 37 C. for 30 min, and centrifuged, and the supernatant (i.e. the 8M urea-dissolved supernatant) was kept.
(155) The fractions obtained were analyzed by SDS-PAGE (Coomassie brilliant blue staining was used for visualization, the same below, see the methods in The Molecular Cloning Experiment Guide, 2.sup.nd edition). The results showed that the fusion proteins were expressed in inclusion bodies (see
Example 8. Analysis of Properties of the Fusion Proteins Constructed in Example 6
(156) Determination of the Reactivity of the Fusion Proteins with Antibodies by Western Blotting
(157) The reactivity of the fusion proteins with influenza virus M2e monoclonal antibody 5D1 and CRM197 monoclonal antibody 1E6 (prepared in the laboratory) were determined by Western blotting. The dialyzed and renatured samples were transferred to nitrocellulose membrane for blotting after SDS-PAGE separation; 5% skimmed milk was used to block the membrane for 2 h, and then the monoclonal antibody 5D1 diluted at 1:500 was added. The reaction was carried out for 1 h. The membrane was then washed with TNT (50 mmol/L Tris.Cl (pH 7.5), 150 mmol/L NaCl, 0.05% Tween 20) for three times, 10 min for each time. Goat Anti-mouse alkaline phosphatase (KPL product) was then added. The reaction was carried out for 1 h, and the membrane was then washed with TNT for three times, 10 min for each time. NBT and BCIP (PROTOS product) were used for visualization. The results, as determined by Western blotting using the fusion proteins and influenza virus M2e monoclonal antibody 5D1 (
(158) Determination of the Reactivity of the Fusion Proteins with Various M2e Specific Monoclonal Antibodies and CRM197 Specific Antibody by ELISA
(159) The reactivity of the fusion proteins and the control protein GST-M2e with various M2e specific antibodies and CRM197 specific monoclonal antibody 1E6 (the antibodies used in the experiment were known in the prior art, or commercially available or prepared in the laboratory) was determined by indirect ELISA. For example, O19 antibody is a protective antibody against influenza known in the prior art (see, Fu et al., Virology, 2009, 385:218-226). The dialyzed and renatured samples were diluted in 1PBS (1 g/ml), and then were added to 96-well microplate (Beijing Wantai Co.) at 100 l/well and incubated at 37 C. for 2 h. The coating solution was discarded, the plate was washed with PBST (PBS+0.05% TWEEN 20) once, and then the blocking solution (2% gelatin, 5% Casein, 1% PROCLIN 300, in PBS) was added at 180 l/well and incubated at 37 C. for 2 h. The blocking solution was discarded when the detection was performed, and the anti-M2e antibody or CRM197 antibody diluted at a certain ratio (0.002 mg/ml was used as the initial concentration for 2-fold gradient dilution) was added at 100 l/well. The mixture was incubated at 37 C. for 1 h. The plate was washed with PBST for five times, HRP-labeled Goat anti Mouse (KPL product) (1:5000) was then added at 100 l/well and was incubated at 37 C. for 30 min. The plate was washed with PBST for five times, HRP substrate (Beijing Wantai Co.) was then added at 100 l/well and was incubated at 37 C. for 15 min. 2M sulphuric acid was added at 50 l/well to stop the reaction, and Microplate reader (Sunrise Type, product from Tecan Co.) was then used to read OD450/620 value. The results of the ELISA using the fusion proteins with the antibodies were shown in
(160) Analysis of Sedimentation Velocity (SV) of the Fusion Proteins
(161) The apparatus used in the experiment was US Beckman XL-A analytic supercentrifuge, which was equipped with an optical detection system and An-50Ti and An-60Ti rotators. The Sedimentation Velocity (SV) method (c(s) algorithm, see P. Schuck et al., Biophys J 78: 1606-1619(2000)) was used to analyze the sedimentation coefficient of the fusion proteins. The analytic results were shown in
Example 9. Analysis of Immunogenicity of the Fusion Proteins Constructed in Example 6
(162) The mice used in the experiment were female, 6-week old BALB/C mice. By using aluminum adjuvant, mice were immunized by intraperitoneal injection of the fusions proteins as constructed in Example 6 and renatured to PBS and the control protein GST-M2e, respectively. The injection volume was 1 ml, and two dose groups (a 5 g-dose group or a 0.5 g-dose group) were used. The primary immunization was performed at week 0, and booster immunization was performed at week 2 and 4.
(163) GST-M2e was used to coat a plate, and the antibody titers in serum as induced by the fusion proteins and control protein, were measured by similar indirect ELISA assay as described above. The detection results of the serum antibody titers within 4 months after immunization were shown in
(164) Although the specific embodiments of the invention have been described in details, those skilled in the art would understand that, according to the teachings disclosed in the specification, various modifications and changes can be made without departing from the sprit or scope of the invention as generally described, and that such modifications and changes are within the scope of the present invention. The scope of the present invention is given by the appended claims and any equivalents thereof.