Recombinant microorganism for producing L-valine, construction method and application thereof

Abstract

Related are a recombinant microorganism for producing L-valine, a construction method and an application thereof. Through transferring an amino acid dehydrogenase gene and/or activating activity of a transhydrogenase and/or a NAD kinase, reducing power of NADPH in cell is increased, the titer and yield of L-valine generated by Escherichia coli are improved, and the production of L-valine by one-step anaerobic fermentation is achieved.

Claims

1. A construction method of a recombinant microorganism for producing L-valine, comprising: transferring an amino acid dehydrogenase gene into a microorganism, and/or activating activity of a transhydrogenase in the microorganism, and/or activating activity of a NAD kinase in the microorganism, so that enhancing the activity of the transhydrogenase and/or the NAD kinase in the microorganism.

2. The construction method according to claim 1, wherein the method further comprises one or more of the following modifications (1)-(7) to the recombinant microorganism according to claim 1: (1) knocking out a gene mgsA; (2) knocking out a gene IdhA; (3) knocking out genes pta and/or ackA; (4) knocking out genes tdcD and/or tdcE; (5) knocking out a gene adhE; (6) knocking out genes frd and/or pflB; and (7) enhancing activity of AHAS and/or ilvD; preferably, the above items (7), (1), and (3)-(6) are selected for modification; preferably, the above items (1)-(7) are selected for modification; preferably, the item (6) is achieved by substituting the pflB gene of the microorganism itself with the ilvD gene; preferably, the item (6) is achieved by substituting the frd gene of the microorganism itself with the leuDH gene; and preferably, the item (1) is achieved by substituting the mgsA gene of the microorganism itself with the ilvC gene.

3. The construction method according to claim 1, wherein the microorganism is Escherichia coli; and more preferably, the microorganism is Escherichia coli ATCC 8739.

4. The construction method according to claim 1, wherein at least one regulatory element is used to activate or enhance activity of an encoding gene of the enzyme; preferably, the regulatory element is selected from an M1-46 artificial regulatory element, an M1-93 artificial regulatory element or an M1-37 artificial regulatory element; preferably, the M1-93 artificial regulatory element regulates encoding genes pntAB, ilvD, leuDH, ilvBN and ilvGM; the M1-37 artificial regulatory element regulates an encoding gene yfjB; and the M1-46 artificial regulatory element regulates an encoding gene ilvC.

5. The construction method according to claim 1, wherein one or more copies of the enzyme encoding gene and the regulatory element are integrated into a genome of the microorganism, or a plasmid containing the enzyme encoding gene is transferred into the microorganism; preferably, transfer, mutation, knockout, activation or regulation of the enzyme gene is completed by a method of integrating into the genome of the microorganism; preferably, the transfer, mutation, knockout, activation or regulation of the enzyme gene is completed by a homologous recombination method; and preferably, the transfer, mutation, knockout, activation or regulation of the enzyme gene is completed by a two-step homologous recombination method.

6. A recombinant microorganism obtained by the construction method according to claim 1.

7. The construction method according to claim 1, wherein the construction method further comprises acquiring a recombinant microorganism for highly producing L-valine through metabolic evolution on the basis of the recombinant microorganism obtained by the construction method according to claim 1.

8. A recombinant microorganism, wherein a preservation number thereof is CGMCC 19456.

9. (canceled)

10. A method for producing L-valine, wherein the method comprises: (1) fermenting the recombinant microorganism according to claim 6; and (2) separating and harvesting L-valine; preferably, the fermentation is carried out under anaerobic conditions.

11. The construction method according to claim 1, wherein the construction method further comprises transferring an acetohydroxy acid reductoisomerase encoding gene into the microorganism so as to enhance activity of an acetohydroxy acid reductoisomerase; the acetohydroxy acid reductoisomerase encoding gene is preferably an ilvC gene.

12. The construction method according to claim 1, wherein the amino acid dehydrogenase gene is NADH-dependent.

13. The construction method according to claim 1, wherein the amino acid dehydrogenase gene is a leucine dehydrogenase gene.

14. The construction method according to claim 1, wherein the amino acid dehydrogenase gene is leuDH, the transhydrogenase is PntAB, and the NAD kinase is YfjB.

15. The construction method according to claim 2, wherein the AHAS is ilvBN, or ilvGM, or ilvIH; optionally, the activity of the ilvIH is enhanced by releasing feedback inhibition of valine to the ilvH, preferably, the ilvH gene is enhanced by mutation.

16. The construction method according to claim 2, wherein the item (7) is selected for modification.

17. The construction method according to claim 2, wherein the items (7) and (2) are selected for modification.

18. The construction method according to claim 2, wherein the items (7) and (6) are selected for modification.

19. The construction method according to claim 2, wherein the items (7), (2) and (5) are selected for modification.

20. The construction method according to claim 2, wherein the items (7), (2) and (6) are selected for modification.

21. A method for producing L-valine, wherein the method comprises: (1) fermenting the recombinant microorganism according to claim 8; and (2) separating and harvesting L-valine; preferably, the fermentation is carried out under anaerobic conditions.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0093] Drawings of the description for constituting a part of the present application are used to provide further understanding of the disclosure. Exemplary embodiments of the disclosure and descriptions thereof are used to explain the disclosure, and do not constitute improper limitation to the disclosure. In the drawings:

[0094] FIG. 1: L-valine synthesis pathway.

[0095] FIG. 2: Determination of a standard substance of L-valine by high performance liquid chromatography.

[0096] FIG. 3: Determination of fermentation solution components of strain Sval030 by high performance liquid chromatography.

[0097] FIG. 4: Construction of strain Sval031 by metabolic evolution.

[0098] FIG. 5: Determination of a standard substance of L-valine by high performance liquid chromatography.

[0099] FIG. 6: Determination of fermentation solution components of strain Sval031 by high performance liquid chromatography.

DETAILED DESCRIPTION OF THE EMBODIMENTS

[0100] The disclosure is further described by the following embodiments, but any embodiments or combinations thereof should not be interpreted as limiting a scope or an embodiment of the disclosure. The scope of the disclosure is defined by appended claims. In combination with the description and common knowledge in the field, those of ordinary skill in the art may clearly understand the scope defined by the claims. Without departing from the spirit and scope of the disclosure, those skilled in the art may make any modifications or changes to technical schemes of the disclosure, and such modifications and changes are also included in the scope of the disclosure.

[0101] Experimental methods used in the following embodiments are conventional methods unless otherwise specified. Materials, reagents and the like used in the following embodiments may be obtained from commercial sources unless otherwise specified.

[0102] Strains and plasmids constructed in this research are shown in Table 1, and primers used are shown in Table 2.

TABLE-US-00001 TABLE 1 Strains and plasmids used in the disclosure Related characteristics Sources Strain ATCC 8739 Wild type Laboratory preservation M1-93 ATCC 8739, FRT-Km-FRT::M1-93::lacZ Lu, et al., Appl Microbiol Biotechnol, 2012, 93: 2455-2462 M1-46 ATCC 8739, FRT-Km-FRT::M1-46::lacZ Lu, et al., Appl Microbiol Biotechnol, 2012, 93: 2455-2462 M1-37 ATCC 8739, FRT-Km-FRT::M1-37::lacZ Lu, et al., Appl Microbiol Biotechnol, 2012, 93: 2455-2462 Sval001 ATCC 8739, mgsA::cat-sacB Constructed by the disclosure Sval002 Sval001, ΔmgsA Constructed by the disclosure Sval003 Sval002, ldhA::cat-sacB Constructed by the disclosure Sval004 Sval003, ΔldhA Constructed by the disclosure Sval005 Sval004, ackA-pta::cat-sacB Constructed by the disclosure Sval006 Sval005, Δ ackA-pta Constructed by the disclosure Sval007 Sval006, tdcDE::cat-sacB Constructed by the disclosure Sval008 Sval007, ΔtdcDE Constructed by the disclosure Sval009 Sval008, adhE::cat-sacB Constructed by the disclosure Sval010 Sval009, ΔadhE Constructed by the disclosure Sval011 Sval010, mgsA::cat-sacB Constructed by the disclosure Sval012 Sval011, mgsA::ilvC Constructed by the disclosure Sval013 Sval012, mgsA::cat-sacB::ilvC Constructed by the disclosure Sval014 Sval013, mgsA::M1-46-ilvC Constructed by the disclosure Sval015 Sval014, pflB::cat-sacB Constructed by the disclosure Sval016 Sval015, pflB::ilvD Constructed by the disclosure Sval017 Sval016, pflB::cat-sacB::ilvD Constructed by the disclosure Sval018 Sval017, pflB::RBS4-ilvD Constructed by the disclosure Sval019 Sval018, cat-sacB::ilvB Constructed by the disclosure Sval020 Sval019, M1-93::ilvB Constructed by the disclosure Sval021 Sval020, cat-sacB::ilvG Constructed by the disclosure Sval022 Sval021, M1-93::ilvG Constructed by the disclosure Sval023 Sval022, ilvH::cat-sacB Constructed by the disclosure Sval024 Sval023, ilvH::ilvH* Constructed by the disclosure Sval025 Sval024, frd::cat-sacB Constructed by the disclosure Sval026 Sval025, frd::M1-93-leuDH Constructed by the disclosure Sval027 Sval026, cat-sacB::pntAB Constructed by the disclosure Sval028 Sval027, M1-93-pntAB Constructed by the disclosure Sval029 Sval028, cat-sacB::yfjB Constructed by the disclosure Sval030 Sval029, M1-37-yfjB Constructed by the disclosure Sval031 metabolic evolution of Sval030 Constructed by the for 70 generations, CGMCC 19456 disclosure Plasmid pUC57-M1-93-leuDH Artificial regulatory element M1-93 Nanjing Genscript and chemically synthesized gene leuDH Biotechnology Co., Ltd. are linked to a pUC57 vector together

TABLE-US-00002 TABLE 2 Primers used in the disclosure Primer Sequence name Sequence number mgsA-cs-up gtaggaaagttaactacggatgtacattatggaactgacgactcgcacttTG 1 TGACGGAAGATCACTTCGCAG mgsA-cs-down gcgtttgccacctgtgcaatattacttcagacggtccgcgagataacgctTT 2 ATTTGTTAACTGTTAATTGTCCT XZ-mgsA-up cagctcatcaaccaggtcaa 3 XZ-mgsA-down aaaagccgtcacgttattgg 4 mgsA-del-down gcgtttgccacctgtgcaatattacttcagacggtccgcgagataacgctaag 5 tgcgagtcgtcagttcc mgsA-ilvC-up gtaggaaagttaactacggatgtacattatggaactgacgactcgcacttAT 6 GGCTAACTACTTCAATACac mgsA-ilvC-down gcgtttgccacctgtgcaatattacttcagacggtccgcgagataacgctTT 7 AACCCGCAACAGCAATACGtttc mgsA-Pcs-up gtaggaaagttaactacggatgtacattatggaactgacgactcgcacttTG 8 TGACGGAAGATCACTTCGCAG mgsA-Pcs-down agctgtgccagctgctggcgcagattcagtGTATTGAAGTAGTTAG 9 CCATTTATTTGTTAACTGTTAATTGTCCT mgsA-P46-up gtaggaaagttaactacggatgtacattatggaactgacgactcgcacttTT 10 ATCTCTGGCGGTGTTGAC ilvC-P46-down agctgtgccagctgctggcgcagattcagtGTATTGAAGTAGTTAG 11 CCATAGCTGTTTCCTGGTTTAAACCG ilvC-YZ347-down cgcactacatcagagtgctg 12 IdhA-cs-up ttcaacatcactggagaaagtcttatgaaactcgccgtttatagcacaaaTG 13 TGACGGAAGATCACTTCGCAG IdhA-cs-down agcggcaagattaaaccagttcgttcgggcaggtttcgcctttttccagaTTA 14 TTTGTTAACTGTTAATTGTCCT XZ-IdhA-up GATAACGGAGATCGGGAATG 15 XZ- CTTTGGCTGTCAGTTCACCA 16 IdhA-down IdhA-del-down agcggcaagattaaaccagttcgttcgggcaggtttcgcctttttccagatttgt 17 gctataaacggcgagt ackA-cs-up aggtacttccatgtcgagtaagttagtactggttctgaactgcggtagttTGT 18 GACGGAAGATCACTTCGCAG pta-cs-down ggtcggcagaacgctgtaccgctttgtaggtggtgttaccggtgttcagaTT 19 ATTTGTTAACTGTTAATTGTCCT XZ-ackA-up cgggacaacgttcaaaacat 20 XZ-pta-down attgcccatcttcttgttgg 21 ackA-del-down ggtcggcagaacgctgtaccgctttgtaggtggtgttaccggtgttcagaaac 22 taccgcagttcagaacca tdcDE-cs-up ccgtgattggtctgctgaccatcctgaacatcgtatacaaactgttttaaTGT 23 GACGGAAGATCACTTCGCAG tdcDE-cs-down cgcctggggcacgttgcgtttcgataatctttttcatacatcctccggcgTTAT 24 TTGTTAACTGTTAATTGTCCT XZ-tdcDE-up TGATGAGCTACCTGGTATGGC 25 XZ-tdcDE-down CGCCGACAGAGTAATAGGTTTTAC 26 tdcDE-del-down cgcctggggcacgttgcgtttcgataatctttttcatacatcctccggcgttaaa 27 acagtttgtatacgatgttcag adhE-cs-up ATAACTCTAATGTTTAAACTCTTTTAGTAAATCACAGT 28 GAGTGTGAGCGCTGTGACGGAAGATCACTTCGCA adhE-cs-down CCGTTTATGTTGCCAGACAGCGCTACTGATTAAGCG 29 GATTTTTTCGCTTTTTATTTGTTAACTGTTAATTGTCC T adhE-del-down CCGTTTATGTTGCCAGACAGCGCTACTGATTAAGCG 30 GATTTTTTTCGCTTTGCGCTCACACTCAGTGTGATTTA C XZ-adhE-up CATGCTAATGTAGCCACCAAA 31 XZ-adhE-down TTGCACCACCATCCAGATAA 32 pflB-CS-up aaacgaccaccattaatggttgtcgaagtacgcagtaaataaaaaatccaT 33 GTGACGGAAGATCACTTCGCAG pflB-CS-down CGGTCCGAACGGCGCGCCAGCACGACGACCGTCT 34 GGGGTGTTACCCGTTTTTATTTGTTAACTGTTAATTGT CCT pflB-ilvD-up aaacgaccaccattaatggttgtcgaagtacgcagtaaataaaaaatccaa 35 tgcctaagtaccgttccgc pflB-ilvD-down CGGTCCGAACGGCGCGCCAGCACGACGACCGTCT 36 GGGGTGTTACCCGTTTttaaccccccagtttcgatttatc XZ-pflB-up600 CTGCGGAGCCGATCTCTTTAC 37 XZ-pflB-down CGAGTAATAACGTCCTGCTGCT 38 pflB-Pcs-up aaacgaccaccattaatggttgtcgaagtacgcagtaaataaaaaatccaT 39 GTGACGGAAGATCACTTCGCA pflB-Pcs-down CCCGCCATATTACGACCATGAGTGGTGGTGGCGGAA 40 CGGTACTTAGGCATTTATTTGTTAACTGTTAATTGTCC T pflB-Pro-up AAACGACCACCATTAATGGTTGTCGAAGTACGCAGT 41 AAATAAAAAATCCATTATCTCTGGCGGTGTTGAC ilvD-Pro-down cccgccatattacgaccatgagtggtggtggcggaacggtacttaggcatT 42 GCTGACCTCCTGGTTTAAACGTACATG ilvD-YZ496- caaccagatcgagcttgatg 43 down XZ-frd-up TGCAGAAAACCATCGACAAG 44 XZ-frd-down CACCAATCAGCGTGACAACT 45 frd-cs-up GAAGGCGAATGGCTGAGATGAAAAACCTGAAAATTG 46 AGGTGGTGCGCTATTGTGACGGAAGATCACTTCGCA frd-cs-down TCTCAGGCTCCTTACCAGTACAGGGCAACAAACAGG 47 ATTACGATGGTGGCTTATTTGTTAACTGTTAATTGTCC T frd-M93-up GAAGGCGAATGGCTGAGATGAAAAACCTGAAAATTG 48 AGGTGGTGCGCTATTTATCTCTGGCGGTGTTGAC frd-leuDH-down TCTCAGGCTCCTTACCAGTACAGGGCAACAAACAGG 49 ATTACGATGGTGGCTTAACGGCCGTTCAAAATATTTT TTTC ilvB ctgacgaaacctcgctccggcggggttttttgttatctgcaattcagtacTGT 50 pro-catup GACGGAAGATCACTTCGCA ilvB tctgcgccggtaaagcgcttacgcgtcgatgttgtgcccgaacttgccatTTA 51 pro-catdown TTTGTTAACTGTTAATTGTCCT ilvB pro-up ctgacgaaacctcgctccggcggggttttttgttatctgcaattcagtacTTAT 52 CTCTGGCGGTGTTGAC ilvB tctgcgccggtaaagcgcttacgcgtcgatgttgtgcccgaacttgccatAG 53 pro-down CTGTTTCCTGGTTTAAAC ilvB gttctgcgcggaacacgtatac 54 pro-YZup ilvB ccgctacaggccatacagac 55 pro-YZdown ilvG tgaactaagaggaagggaacaacattcagaccgaaattgaatttttttcaT 56 pro-catup GTGACGGAAGATCACTTCGCA ilvG ttcacaccctgtgcccgcaacgcatgtaccacccactgtgcgccattcatTT 57 pro-catdown ATTTGTTAACTGTTAATTGTCCT ilvG pro-up tgaactaagaggaagggaacaacattcagaccgaaattgaatttttttcaTT 58 ATCTCTGGCGGTGTTGAC ilvG ttcacaccctgtgcccgcaacgcatgtaccacccactgtgcgccattcatAG 59 pro-down CTGTTTCCTGGTTTAAACG ilvG gcataagatatcgctgctgtag 60 pro-YZup ilvG gccagttttgccagtagcac 61 p-YZdown ilvH*-cat-up agaacctgattatgCGCCGGATATTATCAGTCTTACTCGAA 62 AATGAATCATGTGACGGAAGATCACTTCGCA ilvH*-cat-down TTCATCGCCCACGGTCTGGATGGTCATACGCGATAA 63 TGTCGGATCGTCGGTTATTTGTTAACTGTTAATTGTC CT ilvH*-mut-up agaacctgattatgCGCCGGATATTATCAGTCTTACTCGAA 64 AATGAATCAGaCGCGTTATtCCGCGTGATTGGC ilvH*-mut-down CACACCAGAGCGAGCAACCTC 65 ilvH*-mutYZ-up atgagctggaaagcaaacttagc 66 pntAB-cs-up acaattatcagtctttatccggcgttctaaggtgtttatcccactatcacTGTG 67 ACGGAAGATCACTTCGCA pntAB-cs-down gcaacacgggtttcattggttaaccgttctcttggtatgccaattcgcatTTAT 68 TTGTTAACTGTTAATTGTCCT pntAB-P-up acaattatcagtctttatccggcgttctaaggtgtttatcccactatcacTTAT 69 CTCTGGCGGTGTTGAC pntAB-M93- gcaacacgggtttcattggttaaccgttctcttggtatgccaattcgcatAGC 70 down TGTTTCCTGGTTTAAACG pntAB-YZ-uP tcatatcacattccttaagc 71 pntAB-YZ-down atactttgaacttgttcttt 72 yfjb-cs-up cattcatctcgctaacttcgcttattatggggatcagtttcagggtttcaTGTG 73 ACGGAAGATCACTTCGCA yfjb-cs-down gggtgccgtgggtgtcccacaatgccaatacacttgaaatgattattcatTTA 74 TTTGTTAACTGTTAATTGTCCT yfjb-P-up cattcatctcgctaacttcgcttattatggggatcagtttcagggtttcaTTATC 75 TCTGGCGGTGTTGAC yfjb-M37-down gggtgccgtgggtgtcccacaatgccaatacacttgaaatgattattcatAG 76 CTGTTTCCTGGTTTAAAC yfjb-YZ-up ttcagtacgtcgacgcaggt 77 yfjb-YZ-down gtaatcgcatccagagaggg 78

EXAMPLE 1

Knockout of Methylglyoxal Synthase Encoding Gene mgsA in ATCC 8739 Strain

[0103] Started from Escherichia coli ATCC 8739, a two-step homologous recombination method is used to knock out the methylglyoxal synthase encoding gene mgsA, and specific steps are as follows.

[0104] In a first step, a pXZ-CS plasmid DNA is used as a template, 2719 bp of a DNA fragment I is amplified by using primers mgsA-cs-up/mgsA-cs-down, and used for the first step of homologous recombination.

[0105] An amplification system is: Phusion 5× buffer (NewEngland Biolabs) 10 μl, dNTP (10 mM for each dNTP) 1 μl, DNA template 20 ng, primers (10 μM) 2 μl each, Phusion High-Fidelity DNA polymerase (2.5 U/μl) 0.5 μl, distilled water 33.5 μl, and a total volume is 50 μl.

[0106] Amplification conditions are 98° C. pre-denaturation for 2 minutes (1 cycle); 98° C. denaturation for 10 seconds, 56° C. annealing for 10 seconds, 72° C. extension for 2 minutes (30 cycles); and 72° C. extension for 10 minutes (1 cycle).

[0107] The above DNA fragment I is used for the first homologous recombination: firstly, a pKD46 plasmid (purchased from the Coil Genetic Stock Center (CGSC) of Yale University, CGSC#7739) is transformed into Escherichia coli ATCC 8739 by an electrotransformation method, and then the DNA fragment I is electrotransformed to the Escherichia coli ATCC 8739 with the pKD46.

[0108] Electrotransformation conditions are as follows: firstly, electrotransformation competent cells of the Escherichia coli ATCC 8739 with the pKD46 plasmid are prepared; 50 μl of the competent cells are placed on ice, and 50 ng of the DNA fragment I is added. The mixture was placed on ice for 2 minutes, and transferred into a 0.2 cm MicroPulser Electroporation Cuvette (Bio-Rad). The electroporation was carried with the MicroPulser (Bio-Rad) electroporation apparatus and the electric voltage was 2.5 kV. After electric shock, 1 ml of LB medium was quickly added into the electroporation cuvette, and transferred into a test tube after pipetting five times. The culture was incubated at 30° C. with shaking at 75 rpm for 2 hours. 200 μl of culture was spread onto a LB plate containing ampicillin (a final concentration is 100 μg/ml) and chloramphenicol (a final concentration is 34 μg/ml). After being cultured overnight at 30° C., colonies were verified with primer set XZ-mgsA-up/XZ-mgsA-down, and a correct colony amplification product is a 3646 bp fragment. A correct single colony was selected, and named as Sval001.

[0109] In a second step, a genomic DNA of wild-type Escherichia coli ATCC 8739 is used as template, and 566 bp of a DNA fragment II is amplified with primer set XZ-mgsA-up/mgsA-del-down. DNA fragment II is used for the second homologous recombination. Amplification conditions and system are the same as those described in the first step. The DNA fragment II is electrotransformed into the strain Sval001.

[0110] Electrotransformation conditions are as follows: firstly, electrotransformation competent cells of the Sval001 with the pKD46 plasmid (Dower et al., 1988, Nucleic Acids Res 16:6127-6145) were prepared; 50 μl of the competent cells were placed on ice, and 50 ng of a DNA fragment II is added. The mixture was placed on ice for 2 minutes, and transferred into a 0.2 MicroPulser Electroporation Cuvette (Bio-Rad). The electroporation was carried with the MicroPulser (Bio-Rad) electroporation apparatus and the electric voltage was 2.5 kV. After electric shock, 1 ml of LB medium was quickly added into the electroporation cuvette, and transferred into a test tube after pipetting five times. The culture was incubated at 30° C. with shaking at 75 rpm for 4 hours. The culture was then transferred into LB medium containing 10% sucrose but without a sodium chloride (50 ml of a medium is loaded in 250 ml of a flask), and after being cultured for 24 hours, it is streak-cultured on an LB solid medium containing 6% sucrose without a sodium chloride. The correct clone was verified by colony PCR amplification with primer set XZ-mgsA-up/XZ-mgsA-down, and a correct colony amplification product was 1027 bp. A correct single colony is then selected, and named as Sval002 (Table 1).

EXAMPLE 2

Knockout of Lactate Dehydrogenase Encoding Gene IdhA

[0111] Started from Sval002, and a lactate dehydrogenase encoding gene IdhA is knocked out by a two-step homologous recombination method. Specific steps are as follows.

[0112] In a first step, a pXZ-CS plasmid DNA is used as a template, 2719 bp of a DNA fragment I is amplified by using primers IdhA-cs-up/IdhA-cs-down, and used for the first step of the homologous recombination. Amplification system and amplification conditions are the same as those described in Example 1. The DNA fragment I is electrotransformed to the Sval002.

[0113] The DNA fragment I is used for the first homologous recombination: firstly, a pKD46 plasmid is transformed into Escherichia coli Sval002 by an electrotransformation method, and then the DNA fragment I is electrotransformed into the Escherichia coli Sval002 with the pKD46.

[0114] Electrotransformation conditions and steps are the same as the first step method for the mgsA gene knockout described in example 1. 200 μl of culture solution is spreaded onto a LB plate containing ampicillin (a final concentration is 100 μg/ml) and chloramphenicol (a final concentration is 34 μg/ml). After being cultured overnight at 30° C., colonies were PCR verified with primer set XZ-IdhA-up/XZ-IdhA-down, and a correct PCR product should be 3448 bp. A correct single colony is picked, and named as Sval003.

[0115] In a second step, a DNA of wild-type Escherichia coli ATCC 8739 is used as a template, and 476 bp of a DNA fragment II is amplified with primers XZ-IdhA-up/IdhA-del-down. The DNA fragment II is used for the second homologous recombination. The DNA fragment II is electrotransformed into the strain Sval003.

[0116] Electrotransformation conditions and steps are the same as the second step method for the mgsA gene knockout described in example 1. Colonies were verified by PCR using primers XZ-IdhA-up/XZ-IdhA-down and sequenced, and a correct colony amplification product is 829 bp. A correct single colony is picked, and named as Sval004 (Table 1).

EXAMPLE 3

Knockout of Phosphoacetyl Transferase Encoding Gene pta and Acetate Kinase Encoding Gene ackA

[0117] Started from Sval004, a two-step homologous recombination method is used to knock out a phosphoacetyl transferase encoding gene pta and an acetate kinase encoding gene ackA. Specific steps are as follows.

[0118] In a first step, a pXZ-CS plasmid DNA is used as a template, 2719 bp of a DNA fragment I is amplified by using primers ackA-cs-up/pta-cs-down and used for the first step of the homologous recombination. Amplification system and amplification conditions are the same as those described in example 1. The DNA fragment I is electrotransformed to the Sval004.

[0119] The DNA fragment I is used for the first homologous recombination: firstly, a pKD46 plasmid is transformed into Escherichia coli Sval004 by an electrotransformation method, and then the DNA fragment I is electrotransformed into the Escherichia coli Sval004 with the pKD46.

[0120] Electrotransformation conditions and steps are the same as the first step method for the mgsA gene knockout described in example 1. 200 μl of bacterial solution is spreaded onto an LB plate containing ampicillin (a final concentration is 100 μg/ml) and chloramphenicol (a final concentration is 34 μg/ml). After being cultured overnight at 30° C., colonies were PCR verified using primers XZ-ackA-up/XZ-pta-down, and a correct PCR product should be 3351 bp. A correct single colony is picked, and named as Sval005.

[0121] In a second step, a DNA of wild-type Escherichia coli ATCC 8739 is used as a template, and 371 bp of a DNA fragment II is amplified with primers XZ-ackA-up/ackA-del-down. The DNA fragment II is used for the second homologous recombination. The DNA fragment II is electrotransformed into the strain Sval005.

[0122] Electrotransformation conditions and steps are the same as the second step method for the mgsA gene knockout described in example 1. Colony PCR is used to verify clones using primers XZ-ackA-up/XZ-pta-down, and a correct colony amplification product is 732 bp. A correct single colony is picked, and named as Sval006 (Table 1).

EXAMPLE 4

Knockout of Propionate Kinase Encoding Gene tdcD and Formate Acetyltransferase Encoding Gene tdcE

[0123] Started from Sval006, a two-step homologous recombination method is used to knock out the propionate kinase encoding gene tdcD and the formate acetyltransferase encoding gene tdcE. Specific steps are as follows.

[0124] In a first step, a pXZ-CS plasmid DNA is used as a template, 2719 bp of a DNA fragment I is amplified by using primers tdcDE-cs-up/tdcDE-cs-down, and used for the first step of the homologous recombination. Amplification system and amplification conditions are the same as those described in example 1. The DNA fragment I is electrotransformed to the Sval006.

[0125] The DNA fragment I is used for the first homologous recombination: firstly, a pKD46 plasmid is transformed into Escherichia coli Sval006 by an electrotransformation method, and then the DNA fragment I is electrotransformed into the Escherichia coli Sval006 with the pKD46.

[0126] Electrotransformation conditions and steps are the same as the first step method for the mgsA gene knockout described in example 1. 200 μl of culture solution is spreaded onto a LB plate containing ampicillin (a final concentration is 100 μg/ml) and chloramphenicol (a final concentration is 34 μg/ml). After being cultured overnight at 30° C., colonies were PCR verified using primers XZ-tdcDE-up/XZ-tdcDE-down and a correct PCR product should be 4380 bp. A correct single colony is picked, and named as Sval007.

[0127] In a second step, a DNA of wild-type Escherichia coli ATCC 8739 is used as a template, and 895 bp of a DNA fragment II is amplified with primers XZ-tdcDE-up/tdcDE-del-down. The DNA fragment II is used for the second homologous recombination. The DNA fragment II is electrotransformed into strain Sval007.

[0128] Electrotransformation conditions and steps are the same as the second step method for the mgsA gene knockout described in example 1. Colonies were PCR verified using primers XZ-tdcDE-up/XZ-tdcDE-down, and a correct colony amplification product is 1761 bp. A correct single colony is picked, and named as Sval008 (Table 1).

EXAMPLE 5

Knockout of Alcohol Dehydrogenase Gene adhE

[0129] Started from Sval008, a two-step homologous recombination method is used to knock out the alcohol dehydrogenase gene adhE. Specific steps are as follows.

[0130] In a first step, a pXZ-CS plasmid DNA is used as a template, 2719 bp of a DNA fragment I is amplified by using primers adhE-cs-up/adhE-cs-down, and used for the first step of the homologous recombination. Amplification system and amplification conditions are the same as those described in Example 1.

[0131] The DNA fragment I is used for the first homologous recombination: firstly, a pKD46 plasmid is transformed into Escherichia coli Sval008 by an electrotransformation method, and then the DNA fragment I is electrotransformed into the Escherichia coli Sval008 with the pKD46.

[0132] Electrotransformation conditions and steps are the same as the first step method for the mgsA gene knockout described in example 1. 200 μl of bacterial solution is spreaded onto a LB plate containing ampicillin (a final concentration is 100 μg/ml) and chloramphenicol (a final concentration is 34 μg/ml). After being cultured overnight at 30° C., colonies were PCR verified using primers XZ-adhE-up/XZ-adhE-down, and a correct PCR product should be 3167 bp. A correct single colony is picked, and named as Sval009.

[0133] In a second step, a DNA of wild-type Escherichia coli ATCC 8739 is used as a template, and 271 bp of a DNA fragment II is amplified with primers XZ-adhE-up/XZ-adhE-down. The DNA fragment II is used for the second homologous recombination. The DNA fragment II is electrotransformed into the strain Sval009.

[0134] Electrotransformation conditions and steps are the same as the second step method for the mgsA gene knockout described in Example 1. Colonies were PCR verified using primers XZ-adhE-up/XZ-adhE-down, and a correct colony amplification product is 548 bp. A correct single colony is picked, and named as Sval010 (Table 1).

EXAMPLE 6

Integration of Acetohydroxy Acid Reductoisomerase Encoding Gene ilvC in Methylglyoxal Synthase Encoding Gene mgsA Site

[0135] Started from Sval010, an acetohydroxy acid reductoisomerase encoding gene ilvC from Escherichia coli is integrated into the methylglyoxal synthase encoding gene mgsA site through a two-step homologous recombination method. Specific steps are as follows.

[0136] In a first step, a cat-sacB fragment is integrated into the mgsA site of strain Sval010. PCR, integration, and verification of the cat-sacB fragment are exactly the same as the first step of the mgsA gene knockout in example 1, and an obtained clone is named as Sval011.

[0137] In a second step, a DNA of wild-type Escherichia coli ATCC 8739 is used as a template, 1576 bp of a DNA fragment II is amplified by using primers mgsA-ilvC-up/mgsA-ilvC-down. The DNA fragment II is used for the second homologous recombination. The DNA fragment II is electrotransformed into the strain Sval011.

[0138] Electrotransformation conditions and steps are the same as the second step method for the mgsA gene knockout described in example 1. Colonies were PCR verified using primers XZ-mgsA-up/XZ-mgsA-down and sequenced, and a correct colony amplification product is 2503 bp. A correct single colony is picked, and named as Sval012 (Table 1).

EXAMPLE 7

Regulation of Acetohydroxy Acid Reductoisomerase Encoding Gene ilvC

[0139] Started from Sval012, and an artificial regulatory element is used to regulate expression of the acetohydroxy acid reductoisomerase encoding gene ilvC integrated in methylglyoxal synthase encoding gene mgsA site. Specific steps are as follows.

[0140] In a first step, a pXZ-CS plasmid DNA is used as a template, 2719 bp of a DNA fragment I is amplified by using primers mgsA-Pcs-up/mgsA-Pcs-down, and used for the first step of the homologous recombination. Amplification system and amplification conditions are the same as those described in example 1. The DNA fragment I is electrotransformed into the Sval012.

[0141] The DNA fragment I is used for the first homologous recombination: firstly, a pKD46 plasmid (purchased from the Coil Genetic Stock Center (CGSC) of Yale University, CGSC#7739) is transformed into Escherichia coli Sval012 by an electrotransformation method, and then the DNA fragment I is electrotransformed into the Escherichia coli Sval012 with the pKD46.

[0142] Electrotransformation conditions and steps are the same as the first step method for the mgsA gene knockout described in Example 1. 200 μl of bacterial solution is spreaded onto a LB plate containing ampicillin (a final concentration is 100 μg/ml) and chloramphenicol (a final concentration is 34 μg/ml). After being cultured overnight at 30° C., colonies were selected for PCR verification, primers XZ-mgsA-up/ilvC-YZ347-down are used for the verification, and a correct PCR product should be 3482 bp. A correct single colony is picked, and named as Sval013.

[0143] In a second step, a genomic DNA of M1-46 (Lu, et al., Appl Microbiol Biotechnol, 2012, 93:2455-2462) is used as a template, and 188 bp of a DNA fragment II is amplified by using primers mgsA-P46-up/ilvC-P46-down. The DNA fragment II is used for the second homologous recombination. The DNA fragment II is electrotransformed into the strain Sval013.

[0144] Electrotransformation conditions and steps are the same as the second step method for the mgsA gene knockout described in Example 1. Colonies were PCR verified using primers XZ-mgsA-up/ilvC-YZ347-down and sequenced, and a correct colony amplification product is 951 bp. A correct single colony is picked, and named as Sval014 (Table 1).

EXAMPLE 8

Integration of Dihydroxy Acid Dehydratase Encoding Gene ilvD

[0145] Started from Sval014, a dihydroxy acid dehydratase encoding gene ilvD from Escherichia coli is integrated into the pyruvate formate lyase encoding gene pflB site and replaces the pflB gene through a two-step homologous recombination method, namely the pflB gene is knocked out while the ilvD is integrated. Specific steps are as follows.

[0146] In a first step, a pXZ-CS plasmid DNA is used as a template, 2719 bp of a DNA fragment I is amplified by using primers pflB-CS-up/pflB-CS-down, and used for the first step of the homologous recombination. Amplification system and amplification conditions are the same as those described in example 1. The DNA fragment I is electrotransformed into the Sval014.

[0147] The DNA fragment I is used for the first homologous recombination: firstly, a pKD46 plasmid is transformed into Escherichia coli Sval014 by an electrotransformation method, and then the DNA fragment I is electrotransformed into the Escherichia coli Sval014 with the pKD46.

[0148] Electrotransformation conditions and steps are the same as the first step method for the mgsA gene knockout described in Example 1. 200 μl of bacterial solution is spreaded onto an LB plate containing ampicillin (a final concentration is 100 μg/ml) and chloramphenicol (a final concentration is 34 μg/ml). After being cultured overnight at 30° C., colonies were PCR verified using primers XZ-pflB-up600/XZ-pflB-down, and a correct PCR product should be 3675 bp. A correct single colony is picked, and named as Sval015.

[0149] In a second step, a genomic DNA of Escherichia coli MG1655 (from ATCC, No. 700926) is used as a template, and 1951 bp of a DNA fragment II is amplified by using primers pflB-ilvD-up/pflB-ilvD-down. The DNA fragment II is used for the second homologous recombination. The DNA fragment II is electrotransformed into the strain Sval015.

[0150] Electrotransformation conditions and steps are the same as the second step method for the mgsA gene knockout described in Example 1. Colonies were PCR verified using primers XZ-pflB-up600/XZ-pflB-down and sequenced, and a correct colony amplification product is 2907 bp. A correct single colony is picked, and named as Sval016 (Table 1).

EXAMPLE 9

Regulation of Dihydroxy Acid Dehydratase Encoding Gene ilvD

[0151] Started from Sval016, and an artificial regulatory element is used to regulate expression of the dihydroxy acid dehydratase encoding gene ilvD integrated in the pyruvate formate lyase encoding gene pflB site. Specific steps are as follows.

[0152] In a first step, a pXZ-CS plasmid DNA is used as a template, 2719 bp of a DNA fragment I is amplified by using primers pflB-Pcs-up/pflB-Pcs-down, and used for the first step of the homologous recombination. Amplification system and amplification conditions are the same as those described in Example 1. The DNA fragment I is electrotransformed into the Sval016.

[0153] The DNA fragment I is used for the first homologous recombination: firstly, a pKD46 plasmid is transformed into Escherichia coli Sval016 by an electrotransformation method, and then the DNA fragment I is electrotransformed into the Escherichia coli Sval016 with the pKD46.

[0154] Electrotransformation conditions and steps are the same as the first step method for the mgsA gene knockout described in Example 1. 200 μl of bacterial solution is spreaded onto an LB plate containing ampicillin (a final concentration is 100 μg/ml) and chloramphenicol (a final concentration is 34 μg/ml). After being cultured overnight at 30° C., colonies were PCR verified using primers XZ-pflB-up600/ilvD-YZ496-down, and a correct PCR product should be 3756 bp. A correct single colony is picked, and named as Sval017.

[0155] In a second step, a genomic DNA of M1-93 (Lu, et al., Appl Microbiol Biotechnol, 2012, 93:2455-2462) is used as a template, and 189 bp of a DNA fragment II is amplified by using primers pflB-Pro-up/ilvD-Pro-down. The DNA fragment II is used for the second homologous recombination. The DNA fragment II is electrotransformed into the strain Sval017.

[0156] Electrotransformation conditions and steps are the same as the second step method for the mgsA gene knockout described in Example 1. Colonies were PCR verified using primers XZ-pflB-up600/ilvD-YZ496-down and sequenced, and a correct colony amplification product is 1226 bp. A correct single colony is picked, and named as Sval018 (Table 1).

EXAMPLE 10

Regulation of Acetolactate Synthase Gene ilvBN

[0157] An artificial regulatory element M1-93 is used to regulate expression of an acetolactate synthase gene ilvBN through a two-step homologous recombination method. Specific steps are as follows.

[0158] In a first step, a pXZ-CS plasmid DNA is used as a template, 2719 bp of a DNA fragment I is amplified by using primers ilvB pro-catup/ilvB pro-catdown, and used for the first step of the homologous recombination. Amplification system and amplification conditions are the same as those described in Example 1.

[0159] The DNA fragment I is used for the first homologous recombination: firstly, a pKD46 plasmid is transformed into Escherichia coli Sval018 by an electrotransformation method, and then the DNA fragment I is electrotransformed into the Escherichia coli Sval018 with the pKD46.

[0160] Electrotransformation conditions and steps are the same as the first step method for the mgsA gene knockout described in Example 1. 200 μl of bacterial solution is spreaded onto an LB plate containing ampicillin (a final concentration is 100 μg/ml) and chloramphenicol (a final concentration is 34 μg/ml). After being cultured overnight at 30° C., colonies were PCR verified using primers ilvB pro-YZup/ilvB pro-YZdown, and a correct PCR product should be 2996 bp. A correct single colony is picked, and named as Sval019.

[0161] In a second step, a genomic DNA of M1-93 is used as a template, and 188 bp of a DNA fragment II is amplified by using primers ilvB pro-up/ilvB pro-down. The DNA fragment II is used for the second homologous recombination. The DNA fragment II is electrotransformed into the strain Sval019.

[0162] Electrotransformation conditions and steps are the same as the second step method for the mgsA gene knockout described in Example 1. Colonies were PCR verified using primers ilvB pro-YZup/ilvB pro-YZdown and sequenced, and a correct colony amplification product is 465 bp. A correct single colony is picked, and named as Sval020.

EXAMPLE 11

Regulation of Acetolactate Synthase Gene ilvGM

[0163] An artificial regulatory element M1-93 is used to regulate expression of the acetolactate synthase gene ilvGM through a two-step homologous recombination method. Specific steps are as follows.

[0164] In a first step, a pXZ-CS plasmid DNA is used as a template, 2719 bp of a DNA fragment I is amplified by using primers ilvG pro-catup/ilvG pro-catdown, and used for the first step of the homologous recombination. Amplification system and amplification conditions are the same as those described in Example 1.

[0165] The DNA fragment I is used for the first homologous recombination: firstly, a pKD46 plasmid is transformed into Escherichia coli Sval020 by an electrotransformation method, and then the DNA fragment I is electrotransformed into the Escherichia coli Sval020 with the pKD46.

[0166] Electrotransformation conditions and steps are the same as the first step method for the mgsA gene knockout described in Example 1. 200 μl of bacterial solution is spreaded onto an LB plate containing ampicillin (a final concentration is 100 μg/ml) and chloramphenicol (a final concentration is 34 μg/ml). After being cultured overnight at 30° C., colonies were PCR verified using primers ilvG pro-YZup/ilvG p-YZdown, and a correct PCR product should be 2993 bp. A correct single colony is picked, and named as Sval0121.

[0167] In a second step, a genomic DNA of M1-93 is used as a template, and 188 bp of a DNA fragment II is amplified by using primers ilvG pro-up/ilvG pro-down. The DNA fragment II is used for the second homologous recombination. The DNA fragment II is electrotransformed into the strain Sval021.

[0168] Electrotransformation conditions and steps are the same as the second step method for the mgsA gene knockout described in Example 1. colonies were PCR verified using primers ilvG pro-YZup/ilvG p-YZdown and sequenced, and a correct colony amplification product is 462 bp. A correct single colony is picked, and named as Sval022.

EXAMPLE 12

Mutation of Acetolactate Synthase Gene ilvH

[0169] A mutation is transferred into the ilvH gene so as to release feedback inhibition of L-valine through a two-step homologous recombination method. Specific steps are as follows.

[0170] In a first step, a pXZ-CS plasmid DNA is used as a template, 2719 bp of a DNA fragment I is amplified by using primers ilvH*-cat-up/ilvH*-cat-down, and used for the first step of the homologous recombination. Amplification system and amplification conditions are the same as those described in Example 1.

[0171] The DNA fragment I is used for the first homologous recombination: firstly, a pKD46 plasmid is transformed into Escherichia coli Sval022 by an electrotransformation method, and then the DNA fragment I is electrotransformed into the Escherichia coli Sval022 with the pKD46.

[0172] Electrotransformation conditions and steps are the same as the first step method for the mgsA gene knockout described in Example 1. 200 μl of bacterial solution is spreaded onto an LB plate containing ampicillin (a final concentration is 100 μg/ml) and chloramphenicol (a final concentration is 34 μg/ml). After being cultured overnight at 30° C., colonies were PCR verified using primers ilvH*-mutYZ-up/ilvH*-mut-down, and a correct PCR product should be 3165 bp. A correct single colony is picked, and named as Sval023.

[0173] In a second step, a DNA of wild-type Escherichia coli ATCC 8739 is used as a template, and 467 bp of a DNA fragment II is amplified by using primers ilvH*-mut-up/ilvH*-mut-down. The DNA fragment II is used for the second homologous recombination. The DNA fragment II is electrotransformed into the strain Sval023.

[0174] Electrotransformation conditions and steps are the same as the second step method for the mgsA gene knockout described in Example 1. colonies were PCR verified using primers ilvH*-mutYZ-up/ilvH*-mut-down and sequenced, and a correct colony amplification product is 619 bp. A correct single colony is picked, and named as Sval024.

EXAMPLE 13

Fermentation and Production of L-Valine Using Recombinant Strain Sval024

[0175] A seed culture medium is formed by the following components (a solvent is water):

[0176] Glucose 20 g/L, corn syrup dry powder 10 g/L, KH.sub.2PO.sub.4 8.8 g/L, (NH.sub.4).sub.2SO.sub.4 2.5 g/L, and MgSO.sub.4.7H.sub.2O 2 g/L.

[0177] The fermentation culture medium is most the same as the seed culture medium, and a difference is only that the glucose concentration is 50 g/L.

[0178] Anaerobic fermentation of Sval024 includes the following steps:

[0179] (1) Seed culture: a fresh clone on an LB plate is inoculated into a test tube containing 4 ml of the seed culture medium, and shake-cultured overnight at 37° C. and 250 rpm. Then, a culture is transferred to 250 ml of a triangular flask containing 30 ml of the seed culture medium according to an inoculum size of 2% (V/V), and seed culture solution is obtained by shake culture at 37° C. and 250 rpm for 12 hours, and used for fermentation medium inoculation.

[0180] (2) Fermentation culture: a volume of the fermentation culture medium in 500 ml of an fermenter is 250 ml, and the seed culture solution is inoculated into the fermentation culture medium according to an inoculum size of final concentration OD550=0.1, and fermented at 37° C. and 150 rpm for 6 days, to obtain fermentation solution. The neutralizer is 5M ammonia, the pH was controlled at 7.0. No air was sparged during the fermentation.

[0181] Analytical method: an Agilent (Agilent-1260) high performance liquid chromatograph is used to determine components in the fermentation solution after fermentation for 6 days. The concentrations of glucose and organic acid in the fermentation solution are determined by using an Aminex HPX-87H organic acid analytical column of Biorad Company. A Sielc amino acid analysis column primesep 100 250×4.6 mm is used for amino acid determination.

[0182] It is discovered from results that: strain Sval024 could produce 1.3 g/L of L-valine (an L-valine peak corresponding to a position in FIG. 2 appears) with a yield of 0.31 mol/mol after after 4 days fermentation under anaerobic conditions.

EXAMPLE 14

Cloning and Integration of Leucine Dehydrogenase Encoding Gene leuDH

[0183] Referring to the reported (Ohshima, T. et. al, Properties of crystalline leucine dehydrogenase from Bacillus sphaericus. The Journal of biological chemistry 253, 5719-5725 (1978)) sequence of a leuDH from Lysinibacillus sphaericus IFO 3525, a leuDH gene was codon optimized and chemically synthesized (an optimized sequence is as shown in a sequence number 79).

[0184] During the synthesis, an M1-93 artificial regulatory element is added before the leuDH gene to initiate expression of the leuDH gene, and inserted into a pUC57 vector to construct a plasmid pUC57-M1-93-leuDH (gene synthesis and vector construction are completed by Nanjing Genscript Biotechnology Co., Ltd.). The M1-93 artificial regulatory element and the leuDH gene are integrated into the fumarate reductase encoding gene frd site in strain Sval024 through a two-step homologous recombination method and substitute the frd gene, namely the frd gene is knocked out while the leuDH is integrated. Specific steps are as follows.

[0185] In a first step, a pXZ-CS plasmid DNA is used as a template, 2719 bp of a DNA fragment I is amplified by using primers frd-cs-up/frd-cs-down, and used for the first step of the homologous recombination. Amplification system and amplification conditions are the same as those described in Example 1.

[0186] The DNA fragment I is used for the first homologous recombination: firstly, a pKD46 plasmid is transformed into Escherichia coli Sval024 by an electrotransformation method, and then the DNA fragment I is electrotransformed into the Escherichia coli Sval024 with the pKD46.

[0187] Electrotransformation conditions and steps are the same as the first step method for the mgsA gene knockout described in Example 1. 200 μl of bacterial solution is spreaded onto an LB plate containing ampicillin (a final concentration is 100 μg/ml) and chloramphenicol (a final concentration is 34 μg/ml). After being cultured overnight at 30° C., colonies were PCR verified using primers XZ-frd-up/XZ-frd-down, and a correct PCR product should be 3493 bp. A correct single colony is picked, and named as Sval025.

[0188] In a second step, a pUC57-M1-93-leuDH plasmid DNA is used as a template, and 1283 bp of a DNA fragment II is amplified by using primers frd-M93-up/frd-leuDH-down. The DNA fragment II is used for the second homologous recombination. The DNA fragment II is electrotransformed into the strain Sval025.

[0189] Electrotransformation conditions and steps are the same as the second step method for the mgsA gene knockout described in Example 1. Colonies were PCR verified using XZ-frd-up/XZ-frd-down and sequenced, and a correct colony amplification product is 2057 bp. A correct single colony is picked, and named as Sval026.

EXAMPLE 15

Fermentation and Production of L-Valine Using Recombinant Strain Sval026

[0190] Components and preparation of seed culture medium and fermentation culture medium are the same as those described in Example 13.

[0191] The fermentation is performed in 500 mL of a fermentation vessel, and a fermentation process and an analysis process are the same as the fermentation process and the analysis process of the Sval024 described in Example 13.

[0192] It is discovered from results that: the strain Sval026 could produce 1.8 g/L of L-valine (an L-valine peak corresponding to a position in FIG. 2 appears) 0.56 mol/mol after 4 days fermentation under anaerobic conditions.

EXAMPLE 16

Regulation of Transhydrogenase Encoding Gene pntAB Using Artificial Regulatory Element

[0193] Started from a strain Sval026, and an artificial regulatory element is used to regulate expression of a pntAB gene so as to activate activity of the transhydrogenase PntAB. Specific steps are as follows.

[0194] In a first step, a pXZ-CS plasmid DNA is used as a template, 2719 bp of a DNA fragment I is amplified by using primers pntAB-cs-up/pntAB-cs-down, and used for the first step of the homologous recombination. Amplification system and amplification conditions are the same as those described in Example 1.

[0195] The DNA fragment I is used for the first homologous recombination: firstly, a pKD46 plasmid is transformed into Escherichia coli Sval026 by an electrotransformation method, and then the DNA fragment I is electrotransformed into the Escherichia coli Sval026 with the pKD46.

[0196] Electrotransformation conditions and steps are the same as the first step method for the mgsA gene knockout described in Example 1. 200 μl of bacterial culture is spreaded onto an LB plate containing ampicillin (a final concentration is 100 μg/ml) and chloramphenicol (a final concentration is 34 μg/ml). After being cultured overnight at 30° C., colonies were PCR verified using primers pntAB-YZ-up/pntAB-YZ-down, and a correct PCR product should be 3459 bp. A correct single colony is picked, and named as Sval027.

[0197] In a second step, a genomic DNA of M1-93 is used as a template, and 188 bp of a DNA fragment II is amplified by using primers pntAB-P-up/pntAB-M93-down. The DNA fragment II is used for the second homologous recombination. The DNA fragment II is electrotransformed into the strain Sval027.

[0198] Electrotransformation conditions and steps are the same as the second step method for the mgsA gene knockout described in Example 1. Colonies were PCR verified using primers pntAB-YZ-up/pntAB-YZ-down, and a correct colony amplification product is 928 bp. A correct single colony is picked, and named as Sval028 (Table 1).

EXAMPLE 17

Regulation of NAD Kinase Encoding Gene yfjB Using Artificial Regulatory Element

[0199] Started from a strain Sval028, and an artificial regulatory element is used to regulate expression of a NAD kinase gene yfjB so as to activate activity of the NAD kinase YfjB, so that the transhydrogenase and the NAD kinase may achieve a cofactor supply balance together. Specific steps are as follows.

[0200] In a first step, a pXZ-CS plasmid DNA is used as a template, 2719 bp of a DNA fragment I is amplified by using primers yfjb-cs-up/yfjb-cs-down, and used for the first step of the homologous recombination. Amplification system and amplification conditions are the same as those described in Example 1.

[0201] The DNA fragment I is used for the first homologous recombination: firstly, a pKD46 plasmid is transformed into Escherichia coli Sval028 by an electrotransformation method, and then the DNA fragment I is electrotransformed into the Escherichia coli Sval028 with the pKD46.

[0202] Electrotransformation conditions and steps are the same as the first step method for the mgsA gene knockout described in Example 1. 200 μl of bacterial culture is spread onto an LB plate containing ampicillin (a final concentration is 100 μg/ml) and chloramphenicol (a final concentration is 34 μg/ml). After being cultured overnight at 30° C., colonies were PCR verified using primers yfjb-YZ-up/yfjb-YZ-down, and a correct PCR product should be 3542 bp. A correct single colony is picked, and named as Sval029.

[0203] In a second step, a genomic DNA of M1-37 (Lu, et al., Appl Microbiol Biotechnol, 2012, 93:2455-2462) is used as a template, and 188 bp of a DNA fragment II is amplified by using primers yfjb-P-up/yfjb-M37-down. The DNA fragment II is used for the second homologous recombination. The DNA fragment II is electrotransformed into the strain Sval029.

[0204] Electrotransformation conditions and steps are the same as the second step method for the mgsA gene knockout described in Example 1. Colonies were PCR verified using primers yfjb-YZ-up/yfjb-YZ-down, and a correct colony amplification product is 1011 bp. A correct single colony is picked, and named as Sval030 (Table 1).

EXAMPLE 18

Production of L-Valine Using Recombinant Strain Sval030

[0205] Components and preparation of seed culture medium and fermentation culture medium are the same as those described in Example 13.

[0206] The fermentation is performed in 500 mL fermentation vessel, a fermentation process and an analysis process are the same as the fermentation process and the analysis process of the Sval024 described in Example 13.

[0207] It is discovered from results that: Strain Sval030could produce 2.2 g/L of L-valine (an L-valine peak corresponding to a position in FIG. 2 appears) with a yield of 0.83 mol/mol after fermentation for 4 days under anaerobic conditions, FIG. 2 is a spectrum of the L-valine standard substance, and FIG. 3 is a spectrum of Sval030 fermentation solution.

EXAMPLE 19

Construction of Recombinant Strain Sval031

[0208] Started from Sval030, cell growth and L-valine production capacity are synchronously improved through metabolic evolution.

[0209] Metabolic evolution was carried out in 500 mL fermentation vessel with 250 mL fermentation culture medium. The fermentative pH was controlled at 7.0 by using 5 Mammonia as neutralizer. Components and preparation method of fermentation culture medium used for the metabolic evolution are the same as those of the fermentation culture medium described in Example 16. Every 24 hours, fermentation solution is transferred into a new fermentation vessel and the initial OD550 is 0.1. After 70 generations of the evolution, a strain Sval031 is obtained (FIG. 4). The strain Sval031 is preserved in the China General Microbiological Culture Collection Center (CGMCC) with a preservation number CGMCC 19456.

EXAMPLE 20

Fermentation of Strain Sval031 to Produce L-Valine in 500 mL Fermentation Vessel

[0210] Components and preparation of a seed culture medium are the same as those described in Example 13.

[0211] The fermentation is performed in 500 mL fermentation vessel, and a fermentation culture medium is 250 ml. The fermentation culture medium is basically the same as the seed culture medium. A difference is that a glucose concentration is 100 g/L, and a neutralizer used is 5M ammonia, so that the fermentative pH is controlled in 7.0.

[0212] It is discovered from results that: after fermented in 500 mL fermentation vessel for 48 hours, strain Sval031 produced 53 g/L L-valine with a yield of 0.92 mol/mol, and impurities such as a heteroacid are not generated.

EXAMPLE 21

Production of L-Valine by Fermentation of Recombinant Strain Sval031 in 5 L Fermentation Vessel

[0213] Components, preparation and analytical method of a seed culture medium are the same as those described in Example 13. A fermentation culture medium is basically the same as the seed culture medium, and a difference is that a glucose concentration is 140 g/L.

[0214] The fermentation is performed in 5 L of a fermentation vessel (Shanghai Baoxing, BIOTECH-5BG) under anaerobic conditions, including the following steps:

[0215] (1) Seed culture: the seed culture medium in 500 ml of a triangular flask is 150 ml, and it is sterilized at 115° C. for 15 min. After cooling, recombinant Escherichia coli Sval031 are inoculated into the seed culture medium according to an inoculum size of 1% (V/V), and cultured at 37° C. and 100 rpm for 12 hours to obtain seed solution for inoculation of the fermentation culture medium.

[0216] (2) Fermentation culture: a volume of the fermentation culture medium in 5 L is 3 L, and it is sterilized at 115° C. for 25 min. The seed solution is inoculated into the fermentation culture medium according to an inoculum size of final concentration OD550=0.2, and cultured under anaerobic conditions at 37° C. for 48 days, and a stirring speed is 200 rpm, fermentation solution is obtained. The fermentation solution is all of substances in the fermentation vessel. No air was sparged during the fermentation.

[0217] It is discovered from results that: after fermented in 5 L of the fermentation vessel for 48 hours, strain Sval031 produced 82 g/L L-valine with a yield of 0.93 mol/mol, and impurities such as a heteroacid are not generated. FIG. 5 is a spectrum of the L-valine standard.