Fusion protein comprising diphtheria toxin non-toxic mutant CRM197 or fragment thereof

Abstract

Provided in the present invention are a diphtheria toxin non-toxic mutant CRM197 or a fragment thereof as an adjuvant in a fusion protein and the use thereof to enhance the immunogenicity of a target protein fused therewith, for example, an HEV capsid protein, or an influenza virus M2 protein or an immunogenic fragment thereof. Also provided is a method for enhancing the immunogenicity of a target protein, comprising the fusion expression of the CRM197 or the fragment thereof with the target protein to form a fusion protein. Further provided is a fusion protein comprising the CRM197 or the fragment thereof and a target protein, the CRM197 or the fragment thereof enhancing the immunogenicity of the target protein. The present invention also provides an isolated nucleic acid encoding the fusion protein, a construct and a vector comprising said nucleic acid, and a host cell comprising the nucleic acid.

Claims

1. A method for enhancing immunogenicity of a target protein, comprising fusing the target protein to a fragment of CRM197, optionally via a linker, to obtain a fusion protein, wherein the fragment of CRM197 consists of aa 1-190 or aa 1-389 of SEQ ID NO: 2, and wherein the fragment of CRM197 enhances immunogenicity of the target protein.

2. The method of claim 1, wherein the fusion protein is obtained by fusion expression of the fragment of CRM197 with the target protein, optionally using a linker.

3. The method of claim 1, wherein the fusion protein comprises the fragment of CRM197 which is linked to the N-terminus and/or C-terminus of the target protein, optionally via a linker.

4. The method of claim 1, wherein the target protein is HEV capsid protein or an immunogenic fragment thereof.

5. The method of claim 4, wherein the immunogenic fragment of HEV capsid protein comprises or is HEV-239 (aa 368-606 of HEV capsid protein), E2 (aa 394-606 of HEV capsid protein) or E2s (aa 455-606 of HEV capsid protein).

6. The method of claim 4, wherein the fusion protein comprises (a) the fragment of CRM197, and (b) HEV capsid protein or the immunogenic fragment of HEV capsid protein; wherein (a) and (b) are linked together, optionally via a linker.

7. The method of claim 4, wherein the fusion protein has an amino acid sequence as set forth in SEQ ID NO: 8, 10, 12, 14, 16 or 18.

8. The method of claim 1, wherein the target protein is influenza virus M2 protein or an immunogenic fragment thereof.

9. The method of claim 8, wherein the immunogenic fragment of M2 protein comprises or is M2e (aa 1-24 of M2 protein).

10. The method of claim 8, wherein the fusion protein comprises (a) the fragment of CRM197, and (b) influenza virus M2 protein or the immunogenic fragment of M2 protein; wherein (a) and (b) are linked together, optionally via a linker.

11. The method of claim 8, wherein the fusion protein has an amino acid sequence as set forth in SEQ ID NO: 36, 38, 42 or 44.

12. The method of claim 1, wherein the fusion protein comprises a linker.

Description

DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 shows the clone design of the fusion proteins constructed in Example 2, wherein the linker used (Linker, also referred to L for short in the present application) is a flexible fragment consisting of 15 amino acid residues, whose sequence is GGGGSGGGGSGGGGS (SEQ ID NO:60); the CRM197 used comprised 535 amino acids, whose sequence is set forth in SEQ ID NO: 2; 389 refers to a polypeptide comprising amino acid residues from positions 1 to 389 (aa 1-389) of CRM197; A refers to a polypeptide comprising amino acid residues from positions 1 to 190 (aa 1-190) of CRM197; E2 refers to a polypeptide comprising amino acid residues from positions 394 to 606 (aa 394-606) of an HEV capsid protein; E2s refers to a polypeptide comprising amino acid residues from positions 455 to 606 (aa 455-606) of an HEV capsid protein.

(2) FIGS. 2A-2D show SDS-PAGE analytic results of expression, purification and renaturation of the fusion proteins constructed in Example 2, wherein the sample used in FIG. 2A is the precipitate (i.e. inclusion body) obtained by centrifuging the disrupted bacteria after ultrasonication, the sample used in FIG. 2B is a 4M urea dissolved supernatant, the sample used in FIG. 2C is a 8M urea dissolved supernatant, and the sample used in FIG. 2D is a protein renatured into PBS. Lane M: protein molecular weight marker; Lane 1: CRM197-L-E2; Lane 2: CRM197-L-E2s; Lane 3: 389-L-E2; Lane 4: 389-L-E2s; Lane 5: 389-E2s; Lane 6: A-L-E2; Lane 7: A-L-E2s; Lane 8: A-E2s. The results showed that all the constructed fusion proteins could be expressed in inclusion bodies, and A-L-E2 and A-L-E2s were dissolved in 4M and 8M urea, while other fusion proteins were only dissolved in 8M urea. In addition, the results also showed that after dialysis and renaturation, the fusion proteins of a purity of about 80% were obtained.

(3) FIG. 3 shows the SDS-PAGE result of the fusion protein A-L-E2 purified by chromatography, wherein Lane 1 refers to A-L-E2 which is renatured to PBS after purification by chromatography, Lane 2 refers to a A-L-E2 sample of Lane 1 boiled in boiling water for 10 mins. The results showed that after two-step chromatography, A-L-E2 could reach a purity of above 90%.

(4) FIG. 4 shows the results of Western blotting using the fusion proteins constructed in Example 2 and HEV neutralizing monoclonal antibody 8C11. Lane M: protein molecular weight marker; Lane 1: Control protein HEV-239; Lane 2: Control protein E2, Lane 3: CRM197-L-E2; Lane 4: CRM197-L-E2s; Lane 5: 389-L-E2; Lane 6: 389-L-E2s; Lane 7: 389-E2s; Lane 8: A-L-E2; Lane 9: A-L-E2s; Lane 10: A-E2s. The results showed that all the fusion proteins tested had significant reactivity with the HEV-specific neutralizing monoclonal antibody 8C11.

(5) FIGS. 5A-5B show the results of indirect ELISA using the fusion proteins constructed in Example 2 and HEV-specific monoclonal antibody. The abscissa refers to HEV-specific monoclonal antibody or CRM197 polyclonal antiserum for ELISA, and the ordinate refers to OD value determined by ELISA at the same antibody dilution. FIG. 5A shows the ELISA result of the fusion proteins comprising E2, and FIG. 5B shows the ELISA result of the fusion proteins comprising E2s. The results showed that the reactivity of E2s protein with HEV-specific monoclonal antibody was significantly enhanced, after fusion of E2s protein with CRM197 or a fragment thereof, wherein the reactivity of A-L-E2s and A-E2S was enhanced most significantly; the reactivity of E2 protein with HEV-specific monoclonal antibody was retained or enhanced, after fusion of E2 protein with CRM197 or a fragment thereof.

(6) FIG. 6 shows the results of indirect ELISA using the proteins A-L-E2, HEV-239 or E2 and HEV-specific monoclonal antibody, wherein the cutoff value is defined as three times of the average negative value. The results showed that the reactivity of A-L-E2 with HEV-specific monoclonal antibody is comparable to that of HEV-239 and E2.

(7) FIG. 7 shows the analytic result of Sedimentation Velocity (SV) of the fusion protein A-L-E2. The result showed that the fusion protein A-L-E2 was mainly present in a form of dimer, and tetramer is present in a small amount.

(8) FIGS. 8A-8B show the comparison of immunogenicity between the fusion proteins constructed in Example 2 and HEV-239. The primary immunization was performed at week 0, and booster immunization was performed at week 2 and 4, wherein the dose for both the primary immunization and the booster immunization was 5 g or 0.5 g. FIG. 8A shows the comparison result of the antibody titer of immune serum in 5 g-dose groups, and FIG. 8B shows the comparison result of the antibody titer of immune serum in 0.5 g-dose groups. The results showed that seroconversion against HEV occurred in mice serum at week 4 in 5 g- and 0.5 g-dose groups, and the antibody titer reached the highest value at week 5 or 6. In particular, in 5 g-dose group, the highest antibody titer was obtained when A-L-E2 was used, which reached 10.sup.6 at week 6; and the antibody titers induced by the fusion proteins were higher than or comparable to that of HEV-239 protein. In 0.5 g-dose groups, the antibody titers of the fusion proteins were significantly higher than that of HEV-239, and the antibody titer induced by A-L-E2 protein at week 5 reached 10.sup.6. In addition, seroconversion did not occur in immune serum when using E2 and E2s in 5 g- and 0.5 g-dose groups. As seen from the results above, the immunogenicity of the fusion proteins constructed in Example 2 were significantly higher than the antigen protein (E2 and E2s) alone, indicating that the CRM197 of the invention or a fragment thereof significantly enhanced immunogenicity of the antigen protein fused therewith, and could be used as intramolecular adjuvant.

(9) FIG. 9 shows the clone design of the fusion proteins constructed in Example 6, wherein the linker used (Linker, also referred to L for short in the present application) is a flexible fragment consisting of 10 amino acid residues, whose sequence is GGGGSGGGGS (SEQ ID NO:57); the CRM197 used comprised 535 amino acids, whose sequence is set forth in SEQ ID NO: 2; 389 refers to a polypeptide comprising amino acid residues from positions 1 to 389 (aa 1-389) of CRM197; A refers to a polypeptide comprising amino acid residues from positions 1 to 190 (aa 1-190) of CRM197; M2 refers to an influenza virus M2 protein, whose sequence is set forth in SEQ ID NO: 32; M2e refers to a polypeptide comprising amino acid residues from positions 1 to 24 (aa 1-24) of the influenza virus M2 protein.

(10) FIGS. 10A-10F show the SDS-PAGE analytic results of expression, purification and renaturation of the fusion proteins constructed in Example 6, wherein Lane M: protein molecular weight marker.

(11) FIG. 10A used the samples that were the precipitate (i.e. inclusion body) and the supernatant obtained by centrifuging the disrupted bacteria after ultrasonication:

(12) Lane 1: the inclusion body obtained from the bacteria transformed with CRM197-L-M2e;

(13) Lane 2: the supernatant obtained from the bacteria transformed with CRM197-L-M2e;

(14) Lane 3: the inclusion body obtained from the bacteria transformed with 389-L-M2e;

(15) Lane 4: the supernatant obtained from the bacteria transformed with 389-L-M2e; Lane 5: the inclusion body obtained from the bacteria transformed with A-L-M2e; Lane 6: the supernatant obtained from the bacteria transformed with A-L-M2e.

(16) FIG. 10B used the samples that were the precipitate (i.e. inclusion body) and the supernatant obtained by centrifuging the disrupted bacteria after ultrasonication:

(17) Lane 1: the inclusion body obtained from the bacteria transformed with M2e-L-A;

(18) Lane 2: the supernatant obtained from the bacteria transformed with M2e-L-A; Lane 3: the inclusion body obtained from the bacteria transformed with M2e-L-389;

(19) Lane 4: the supernatant obtained from the bacteria transformed with M2e-L-389; Lane 5: the inclusion body obtained from the bacteria transformed with M2e-L-CRM197;

(20) Lane 6: the supernatant obtained from the bacteria transformed with M2e-L-CRM197.

(21) FIG. 10C used the samples that were the fusion proteins isolated and renatured into PBS, wherein no -mercaptoethanol was used during SDS-PAGE analysis, and the protein samples were treated by boiling (for 10 min) or not:

(22) Lane 1: A-L-M2e protein, not treated by boiling;

(23) Lane 2: A-L-M2e protein, treated by boiling;

(24) Lane 3: 389-L-M2e protein, not treated by boiling;

(25) Lane 4: 389-L-M2e protein, treated by boiling;

(26) Lane 5: CRM197-L-M2e protein, not treated by boiling;

(27) Lane 6: CRM197-L-M2e protein, treated by boiling.

(28) FIG. 10D used the samples that were the fusion proteins isolated and renatured into PBS, wherein -mercaptoethanol was used during SDS-PAGE analysis, and the protein samples were treated by boiling (for 10 min) or not:

(29) Lane 1: A-L-M2e protein, not treated by boiling;

(30) Lane 2: A-L-M2e protein, treated by boiling;

(31) Lane 3: 389-L-M2e protein, not treated by boiling;

(32) Lane 4: 389-L-M2e protein, treated by boiling;

(33) Lane 5: CRM197-L-M2e protein, not treated by boiling;

(34) Lane 6: CRM197-L-M2e protein, treated by boiling.

(35) FIG. 10E used the samples that were the fusion proteins isolated and renatured into PBS, wherein no -mercaptoethanol was used during SDS-PAGE analysis, and the protein samples were treated by boiling (for 10 min) or not:

(36) Lane 1: M2e-L-A protein, not treated by boiling;

(37) Lane 2: M2e-L-A protein, treated by boiling;

(38) Lane 3: M2e-L-389 protein, not treated by boiling;

(39) Lane 4: M2e-L-389 protein, treated by boiling;

(40) Lane 5: M2e-L-CRM197 protein, not treated by boiling;

(41) Lane 6: M2e-L-CRM197 protein, treated by boiling.

(42) FIG. 10F used the samples that were the fusion proteins isolated and renatured into PBS, wherein -mercaptoethanol was used during SDS-PAGE analysis, and the protein samples were treated by boiling (for 10 min) or not:

(43) Lane 1: M2e-L-A protein, not treated by boiling;

(44) Lane 2: M2e-L-A protein, treated by boiling;

(45) Lane 3: M2e-L-389 protein, not treated by boiling;

(46) Lane 4: M2e-L-389 protein, treated by boiling;

(47) Lane 5: M2e-L-CRM197 protein, not treated by boiling;

(48) Lane 6: M2e-L-CRM197 protein, treated by boiling.

(49) The results shown in FIGS. 10A-10F indicated that all the constructed fusion proteins could be expressed in inclusion bodies, and after purification and renaturation, the fusion proteins with a purity of about 80% could be obtained.

(50) FIGS. 11A-11H show the results of Western blotting using the fusion proteins constructed in Example 6 and anti-M2e monoclonal antibody 5D1 and CRM197 monoclonal antibody 1E6. The samples represented by Lanes 1-6 in FIGS. 11A, 11B, 11C and 11D correspond to the samples represented by Lanes 1-6 in FIGS. 10C, 10D, 10E and 10F, respectively, wherein anti-M2e specific monoclonal antibody 5D1 was used. The samples represented by Lanes 1-6 in FIGS. 11E, 11F, 11G and 11H correspond to the samples represented by Lanes 1-6 in FIGS. 10C, 10D, 10E and 10F, respectively, wherein CRM197 specific monoclonal antibody 1E6 was used. The results showed that all the tested fusion proteins had significant reactivity with anti-M2e specific monoclonal antibody 5D1 and CRM197 specific monoclonal antibody 1E6.

(51) FIGS. 12A-12B show the results of indirect ELISA using the fusion proteins constructed in Example 6 and various anti-M2e specific monoclonal antibodies. The abscissa refers to anti-M2e specific monoclonal antibodies and anti-CRM197 specific monoclonal antibodies for ELISA, and the ordinate refers to OD value determined by ELISA at the same antibody dilution. FIG. 12A shows the ELISA result of the fusion protein in which M2e was fused to the C-terminus of CRM197 or a fragment thereof, and FIG. 12B shows the ELISA result of the fusion protein in which M2e was fused to the N-terminus of CRM197 or a fragment thereof. The results showed that the fusion protein comprising M2e protein and CRM197 or a fragment thereof retained or enhanced the reactivity with various anti-M2e specific monoclonal antibodies, as compared to M2e protein alone.

(52) FIGS. 13A-13F show the analytic results of Sedimentation Velocity (SV) of the fusion proteins constructed in Example 6, wherein FIG. 13A: CRM197-L-M2e; FIG. 13B: 389-L-M2e; FIG. 13C: A-L-M2e; FIG. 13D: M2e-L-CRM197; FIG. 13E: M2e-L-389; FIG. 13F: M2e-L-A. The results showed that the fusion proteins A-L-M2e and M2e-L-A were mainly present in a form of monomer and tetramer; and 389-L-M2e was mainly present in a form of dimer and polymer; M2e-L-389 was mainly present in a form of monomer and polymer; CRM197-L-M2e was mainly present in a form of dimer and polymer; and M2e-L-CRM197 was mainly present in a form of monomer and polymer.

(53) FIGS. 14A-14B show the comparison of immunogenicity between the fusion proteins constructed in Example 6 and GST-M2e. The primary immunization was performed at week 0, and booster immunization was performed at week 2 and 4, wherein the dose for both the primary immunization and the booster immunization was 5 g or 0.5 s. FIG. 14A shows the comparison result of the antibody titer of immune serum in 5 g-dose groups, and FIG. 14B shows the comparison result of the antibody titer of immune serum in 0.5 g-dose groups. The results showed that after the second booster immunization, the antibody titers induced by the fusion proteins were significantly higher than GST-M2e alone in 5 g- and 0.5 g-dose groups. As seen from the results above, the immunogenicity of the fusion proteins constructed in Example 6 were significantly higher than the antigen protein (GST-M2e) alone, indicating that the CRM197 of the invention or a fragment thereof (no matter located at N-terminus or C-terminus of the fusion protein) significantly enhanced immunogenicity of the antigen protein fused therewith, and could be used as intramolecular adjuvant.

SPECIFIC MODES FOR CARRYING OUT THE INVENTION

(54) The present invention is illustrated by reference to the following examples (which are used only for the purpose of illustrating the present invention and are not intended to limit the protection scope of the present invention).

(55) Unless indicated otherwise, the molecular biological experimental methods and immunological assays used in the present invention are carried out substantially in accordance with the methods as described in Sambrook J et al., Molecular Cloning: A Laboratory Manual (Second Edition), Cold Spring Harbor Laboratory Press, 1989, and F. M. Ausubel et al., Short Protocols in Molecular Biology, 3rd Edition, John Wiley & Sons, Inc., 1995; restriction endonucleases are used under the conditions recommended by manufacturers of the products. The reagents used in the present invention, whose manufacturers are not clearly indicated, are conventional products in the art or commercially available. Those skilled in the art understand that the examples are used for illustrating the present invention, but not intended to limit the protection scope of the present invention.

Example 1. Clone of CRM197 Gene

(56) Genomic DNA extracted from Diphtheria bacillus C7 (197) strain obtained from ATCC (NO 53281) was used as template for the PCR reaction, wherein the forward primer was CRM197F (SEQ ID NO: 19), and the reverse primer was CRM197R (SEQ ID NO: 20). The PCR reaction was performed in a PCR apparatus (Biometra T3) under the following conditions, to prepare the full-length gene encoding CRM197.

(57) TABLE-US-00002 94 C. denaturation 10 min 1 cycle 94 C. denaturation 1.5 min 20 cycles.sup. 58 C. annealing 1.5 min 72 C. elongation 1.5 min 72 C. elongation 10 min 1 cycle

(58) After PCR amplification, a product of about 1.6 kb in length, was obtained. After sequencing, the nucleotide sequence (SEQ ID NO: 1) of the amplification product (i.e. the full-length gene of CRM197) was obtained, and the amino acid sequence encoded thereby was set forth in SEQ ID NO: 2.

Example 2. Design and Clone of Fusion Proteins Comprising CRM197 or a Fragment Thereof and an HEV Capsid Protein Fragment

(59) In the Example, vectors expressing the fusion proteins were constructed exemplarily. The clone design of various exemplary fusion proteins constructed is shown in FIG. 1, wherein the fusion proteins each comprise CRM197 or a fragment thereof and an HEV capsid protein fragment, optionally using a linker.

(60) Clone of Fusion Proteins Comprising a Linker

(61) The amplification product (i.e. the full-length gene of CRM197) obtained in the Example 1 was used as template. The forward primer was CRM197F (SEQ ID NO: 19), at the 5 terminal of which the restriction endonuclease NdeI site CAT ATG was introduced, wherein ATG was the initiation codon in E. coli system. The reverse primers were CRM197-linker R (SEQ ID NO: 21), 389-linker R (SEQ ID NO: 22), and A-linker R (SEQ ID NO: 23), respectively, at the 5 terminal of which the restriction endonuclease BamHI site GGA TCC was introduced. The PCR reaction was performed in a PCR thermocycler (Biometra T3) under the following conditions. The sequences of the primers used were shown in Table 1.

(62) TABLE-US-00003 94 C. denaturation 10 min 1 cycle 94 C. denaturation 1.5 min 20 cycle 58 C. annealing 1.5 min 72 C. elongation 1.5 min 72 C. elongation 10 min 1 cycle

(63) The amplification products were DNA fragments of about 1600 bp, 1200 bp and 600 bp in length, respectively.

(64) In addition, pTO-T7-E2 (Li, et al. JBC. 2005. 28(5): 3400-3406) was used as template. The forward primers were E2F (SEQ ID NO: 24) and E2sF (SEQ ID NO: 25), respectively, at the 5 terminal of which the restriction endonuclease BamHI site GGA TCC was introduced. The reverse primer was Drp59R (SEQ ID NO: 26), at the 5 terminal of which the restriction endonuclease EcoRI site GAA TTC was introduced. The PCR reaction was performed in a PCR thermocycler (Biometra T3) under the following conditions.

(65) TABLE-US-00004 94 C. denaturation 10 min 1 cycle 94 C. denaturation 50 sec 20 cycle 58 C. annealing 50 sec 72 C. elongation 50 sec 72 C. elongation 10 min 1 cycle

(66) The amplification products were DNA fragments of about 600 bp and 450 bp in length, respectively.

(67) The amplification products as obtained above were linked into commercially available pMD 18-T vector (produced by TAKARA Co.), respectively, and designated as pMD 18-T-CRM197-L, pMD 18-T-389-L and pMD 18-T-A-L as well as pMD 18-T-E2 and pMD 18-T-E2s. As identified by NdeI/BamHI and BamHI/EcoRI enzyme cleavage, respectively, the positive clones pMD 18-T-CRM197-L, pMD 18-T-389-L, pMD 18-T-A-L, pMD 18-T-E2 and pMD 18-T-E2s were obtained.

(68) As confirmed by M13(+) primer, correct nucleotide sequences of interest were inserted into the obtained pMD 18-T-CRM197-L, pMD 18-T-389-L, pMD 18-T-A-L, pMD 18-T-E2 and pMD 18-T-E2s, respectively.

(69) The plasmids pMD 18-T-CRM197-L, pMD 18-T-389-L and pMD 18-T-A-L were digested by NdeI/BamHI enzyme. The fragments obtained by enzyme cleavage were linked into the prokaryotic expression vector pTO-T7 digested by NdeI/BamHI enzyme (Luo Wenxin et al., Chinese Journal of Biotechnology, 2000, 16:53-57), and were transformed into E. coli ER2566 (purchased from Invitrogen Co.); after extraction of plasmids, as identified by NdeI/BamHI enzyme cleavage, the positive plasmids pTO-T7-CRM197-L, pTO-T7-389-L and pTO-T7-A-L, into which CRM197-L, 389-L and A-L were inserted, respectively, were obtained.

(70) pTO-T7-CRM197-L, pTO-T7-389-L, pTO-T7-A-L, pMD 18-T-E2 and pMD 18-T-E2s were digested by BamHI/EcoRI enzyme. Each of the obtained E2 and E2s fragments was linked into the vectors pTO-T7-CRM197-L, pTO-T7-389-L and pTO-T7-A-L digested by BamHI/EcoRI enzyme, respectively. As identified by NdeI/EcoRI enzyme cleavage, the positive expression vectors pTO-T7-CRM197-L-E2, pTO-T7-CRM197-L-E2s, pTO-T7-389-L-E2, pTO-T7-389-L-E2s, pTO-T7-A-L-E2 and pTO-T7-A-L-E2s, into which CRM197-L-E2 (SEQ ID NO:3, 4), CRM197-L-E2s (SEQ ID NO:5, 6), 389-L-E2 (SEQ ID NO:7, 8), 389-L-E2s (SEQ ID NO:9, 10), A-L-E2 (SEQ ID NO:11, 12) or A-L-E2s (SEQ ID NO:13, 14) was inserted, respectively, were obtained.

(71) Clone of the Fusion Proteins 389-E2s and A-E2s without a Linker

(72) The vectors expressing 389-E2s and A-E2s were constructed by three PCR reactions. For the first PCR reaction, the full-length gene of CRM197 was used as template. The forward primer was CRM197F, at the 5 terminal of which the restriction endonuclease NdeI site CAT ATG was introduced, wherein ATG was the initiation codon in E. coli system. The reverse primers were 389-E2s R (SEQ ID NO: 27) and A-E2s R (SEQ ID NO: 28), respectively. The amplification was performed to obtain the N-terminal fragments of the fusion proteins. For the second PCR reaction, the full-length gene of CRM197 was used as template. The forward primer were 389-E2s F (SEQ ID NO: 29) and A-E2s F (SEQ ID NO:30), respectively. The reverse primer was DrP59 R, at the 5 terminal of which the restriction endonuclease EcoRI site GAA TTC was introduced. The amplification was performed to obtain the C-terminal fragments of the fusion proteins. The first and second PCR reactions were performed in a PCR thermocycler (Biometra T3) under the following conditions.

(73) TABLE-US-00005 94 C. denaturation 10 min 1 cycle 94 C. denaturation 50 sec 20 cycle 58 C. annealing 50 sec 72 C. elongation 50 sec 72 C. elongation 10 min 1 cycle

(74) For the third PCR reaction, the amplification products of the first and second PCR reactions were used as templates (for example, the two fragments obtained by using 389-E2sF and 389-E2sR as primers were used as template for amplification of 389-E2s), and CRM197F and DrP59R were used as primers. The amplification was performed in a PCR thermocycler (Biometra T3) under the following conditions.

(75) TABLE-US-00006 94 C. denaturation 10 min 1 cycle 94 C. denaturation 50 sec 20 cycle 58 C. annealing 50 sec 72 C. elongation 50 sec 72 C. elongation 10 min 1 cycle

(76) The amplification products were DNA fragments of about 1600 bp and 1000 bp in length, respectively. The amplification products obtained above were linked into commercially available pMD 18-T vector (produced by TAKARA Co.), respectively. As identified by NdeI/EcoRI enzyme cleavage, the positive clones pMD 18-T-389-E2s and pMD 18-T-A-E2s were obtained.

(77) As confirmed by M13(+) primer, correct nucleotide sequences of SEQ ID NO:15 and SEQ ID NO:17 (which encoded the amino acid sequences of SEQ ID NO:16 and SEQ ID NO:18, respectively) were inserted into the obtained pMD 18-T-389-E2s and pMD 18-T-A-E2s, respectively.

(78) The plasmids pMD 18-T-389-E2s and pMD 18-T-A-E2s were digested by NdeI/EcoRI enzyme. The fragments obtained by enzyme cleavage were then linked into the prokaryotic expression vector pTO-T7 digested by NdeI/EcoRI enzyme (Luo Wenxin et al., Chinese Journal of Biotechnology, 2000, 16:53-57). As identified by NdeI/EcoRI enzyme cleavage, the positive plasmids pTO-T7-389-E2s and pTO-T7-A-E2s, into which 389-E2s and A-E2s were inserted, respectively, were obtained.

(79) The sequences of the primers used in the Example were shown in Table 1.

(80) TABLE-US-00007 TABLE1 Primersequences SEQ ID NO: PrimerName Primersequence(5-3) 19 CRM197F CATATGGGCGCTGATGATGTTGTTGATTCTTCT 20 CRM197R GAATTCCCCACTACCTTTCAGCTTTTG 21 CRM197- GGATCCACCGCCACCGCTGCCACCGCCACCGCTG linkerR CCACCGCCACCGCTTTTGAT 22 389- GGATCCACCGCCACCGCTGCCACCGCCACCGCTG linkerR CCACCGCCACCAAATGGTTGC 23 A-linkerR GGATCCACCGCCACCGCTGCCACCGCCACCGCTG CCACCGCCACCACGATTTCCTGCAC 24 E2F GGATCCCAGCTGTTCTACTCTCGTC 25 E2sF GGATCCTCCCCAGCCCCATCGCGC 26 Drp59R GAATTCCTAGCGCGGAGGGGGGGCT 27 389-E2sR GATGGGGCTGGGGAAAATGGTTG 28 A-E2sR GATGGGGCTGGGGAACGATTTCCTGCAC 29 389-E2sF CGCAACCATTTTCCCCAGCCC 30 A-E2sF GAAATCGTTCCCCAGCCCCAT

(81) 1 L of plasmids pTO-T7-CRM197-L-E2, pTO-T7-CRM197-L-E2s, pTO-T7-389-L-E2, pTO-T7-389-L-E2s, pTO-T7-389-E2s, pTO-T7-A-L-E2, pTO-T7-A-L-E2s and pTO-T7-A-E2s (0.15 mg/ml) were separately used to transform 40 L competent E. coli ER2566 (purchased from Invitrogen) prepared by the Calcium chloride method, and then the bacteria were plated on solid LB medium (the components of the LB medium: 10 g/L peptone, 5 g/L yeast powder, and 10 g/L NaCl, the same below) containing kanamycin (at a final concentration of 100 mg/ml, the same below). The plates were statically incubated at 37 C. for about 10-12 h until individual colonies could be observed clearly. Individual colonies from the plates were transferred to a tube containing 4 ml liquid LB medium containing kanamycin. The cultures were incubated in a shaking incubator at 180 rpm for 10 h at 37 C., and then 1 ml bacterial solutions was taken and stored at 70 C.

Example 3. The Expression and Purification of the Fusion Proteins Constructed in Example 2

(82) Expression of Fusion Proteins and Purification of Inclusion Bodies

(83) 5 L bacterial solution, taken from an ultra low temperature freezer at 70 C., was seeded to 5 mL liquid LB medium containing kanamycin, and then was cultured at 37 C., 180 rpm under shaking until OD600 reached about 0.5. The resultant solution was transferred to 500 ml LB medium containing kanamycin, and then was cultured at 37 C., 180 rpm under shaking for 4-5 h. When OD600 reached about 1.5, IPTG was added to a final concentration of 0.4 mM, and the bacteria were induced under shaking at 37 C. for 4 h.

(84) After induction, centrifugation was performed at 8000 g for 5 min to collect the bacteria, and then the bacteria were re-suspended in a lysis solution at a ratio of 1 g bacteria to 10 mL lysis solution (20 mM Tris buffer pH7.2, 300 mM NaCl), in ice-bath. The bacteria were treated with a sonicator (Sonics VCX750 Type Sonicator) (conditions: operating time 15 min, pulse 2s, intermission 4s, output power 55%). The bacterial lysate was centrifuged at 12000 rpm, 4 C. for 5 min (the same below), the supernatant was discarded and the precipitate (i.e. inclusion body) was kept; 2% Triton-100 of the same volume was used for washing, the result mixture was under vibration for 30 min, centrifuged, and the supernatant was discarded. The precipitate was re-suspended in Buffer I (20 mM Tris-HCl pH8.0, 100 mM NaCl, 5 mM EDTA), under vibration for 30 min, centrifuged, and the supernatant was discarded. The precipitate was then re-suspended in 2M urea, under vibration at 37 C. for 30 min, centrifuged, the supernatant and the precipitate were obtained. The supernatant was kept; and the precipitate was re-suspended in 4M urea in the same volume, under vibration at 37 C. for 30 min, and centrifuged at 12000 rpm, 4 C. for 15 min to obtain the supernatant and precipitate. The supernatant (i.e. the 4M urea-dissolved supernatant) was kept; and the precipitate was further in re-suspended in 8M urea in the same volume, under vibration at 37 C. for 30 min, and centrifuged, and the supernatant (i.e. the 8M urea-dissolved supernatant) was kept.

(85) The SDS-PAGE analytic results of the obtained fractions (Coomassie brilliant blue staining was used for visualization, the same below, see the methods in The Molecular Cloning Experiment Guide, 2.sup.nd edition) was showed in FIG. 2. The results showed that the fusion proteins were expressed in inclusion bodies (see FIG. 2A), and CRM197-L-E2, 389-L-E2, A-L-E2, and A-E2s were mainly dissolved in 4M urea (see FIG. 2B), CRM197-L-E2s, 389-L-E2s, A-L-E2s, and 389-E2s were mainly dissolved in 8M urea (see FIG. 2C). The 4M urea-dissolved supernatants or the 8M urea-dissolved supernatants containing the fusion protein, were dialyzed to PBS, respectively, to get the fusion proteins with a purity of about 80% (see FIG. 2D).

(86) Purification of the Fusion Protein A-L-E2 by Anion Exchange Chromatography

(87) Sample: a solution of A-L-E2 protein with a purity of about 80% as obtained above.

(88) Equipment: AKTA Explorer 100 preparative liquid chromatography system produced by GE Healthcare (i.e. the original Amersham Pharmacia Co.)

(89) Chromatographic media: Q SEPHAROSE Fast Flow (GE Healthcare Co.)

(90) Column Volume: 15 mm20 cm

(91) Buffer: 20 mM phosphate buffer pH 7.7+4M urea

(92) 20 mM phosphate buffer pH 7.7+4M urea+1M NaCl

(93) Flow Rate: 6 mL/min

(94) Detector Wavelength: 280 nm

(95) Elution protocol: eluting the protein of interest with 150 mM NaCl, eluting the undesired protein with 300 mM NaCl, and collecting the fraction eluted with 150 mM NaCl.

(96) Purification of the Fusion Protein A-L-E2 by Hydrophobic Interaction Chromatography

(97) Equipment: AKTA Explorer 100 preparative liquid chromatography system produced by GE Healthcare (i.e. the original Amersham Pharmacia Co.)

(98) Chromatographic media: Phenyl SEPHAROSE Fast Flow (GE Healthcare Co.)

(99) Column Volume: 15 mm20 cm

(100) Buffer: 20 mM phosphate buffer pH 7.7+4M urea+0.5 M (NH.sub.4).sub.2SO.sub.4

(101) 20 mM phosphate buffer pH 7.7+4M

(102) Flow Rate: 5 mL/min

(103) Detector Wavelength: 280 nm

(104) Sample: the fraction eluted with 150 mM NaCl as obtained in the previous step was dialyzed to a buffer (20 mM phosphate buffer pH 7.7+4M urea+0.5 M (NH.sub.4).sub.2SO.sub.4), and then was used as sample.

(105) Elution protocol: eluting the undesired protein with 0.3M (NH.sub.4).sub.2SO.sub.4, eluting the protein of interest with 0.1M and 0M (NH.sub.4).sub.2SO.sub.4, and collecting the fraction eluted with 0.1M and 0M (NH.sub.4).sub.2SO.sub.4.

(106) The fraction eluted with 0.1M and 0M (NH.sub.4).sub.2SO.sub.4 was dialyzed and renatured into PBS, and then 10 l was taken for SDS-PAGE analysis, and electrophoresis bands were visualized by Coomassie brilliant blue staining. The results showed that after the above purification steps, the fusion protein A-L-E2 had a purity of above 90% (See FIG. 3).

Example 4. Analysis of Properties of the Fusion Proteins Constructed in Example 2

(107) Determination of the Reactivity of the Fusion Proteins with Antibodies by Western Blotting

(108) The reactivity of the fusion proteins with HEV neutralizing monoclonal antibody 8C11 (see, Zhang et al., Vaccine. 23(22): 2881-2892 (2005)) and anti-CRM197 polyclonal antiserum (which was prepared by immunizing mice with CRM197 through methods well known in the art, and the reactivity of the serum was confirmed by commercially available CRM197) were determined by Western blotting. The dialyzed and renatured samples were transferred to nitrocellulose membrane for blotting after SDS-PAGE separation; 5% skimmed milk was used to block the membrane for 2 h, monoclonal antibody 8C11 diluted at a certain ratio was then added (monoclonal antibody was diluted at 1:500, and polyclonal antiserum was diluted at 1:1000), and the reaction was carried out for 1 h. The membrane was washed with TNT (50 mmol/L Tris.Cl (pH 7.5), 150 mmol/L NaCl, 0.05% Tween 20) for three times, 10 min for each time. Goat Anti-mouse alkaline phosphatase (KPL product) was then added, the reaction was carried out for 1 h, and the membrane was then washed with TNT for three times, 10 min for each time. NBT and BCIP (PROTOS product) were used for visualization. The results, as determined by Western blotting using the fusion proteins and HEV neutralizing monoclonal antibody 8C11, were shown in FIG. 4. The results showed that all the tested fusion proteins had significant reactivity with HEV neutralizing monoclonal antibody 8C11.

(109) Determination of the Reactivity of the Fusion Proteins with Various HEV Specific Antibodies by ELISA

(110) The reactivity of the fusion proteins and the control proteins E2 and HEV-239 with various HEV specific antibodies (Gu Ying et al., Chinese Journal of Virology, 19(3): 217-223(2003)) was determined by indirect ELISA. The dialyzed and renatured samples were diluted in 1PBS (1 g/ml), and then were added to 96-well microplate (Beijing Wantai Co.) at 100 l/well and incubated at 37 C. for 2 h. The coating solution was discarded, the plate was washed with PBST (PBS+0.05% Tween-20) once, and then the blocking solution (2% gelatin, 5 Casein, 1 PROCLIN 300, in PBS) was added at 200 l/well and incubated at 37 C. for 2 h. The blocking solution was discarded when the detection was performed, and the HEV monoclonal antibodies diluted at a certain ratio (when E2s and its fusion protein were detected, they were diluted at 1:10000; when E2 and its fusion protein were detected, they were diluted at 1:100000; when the reactivity of A-L-E2, 239 and E2 proteins was compared, the monoclonal antibodies were subjected to 10-fold serial dilution wherein 1 mg/ml was used as the initial concentration, and the polyclonal antibody at its initial concentration was subjected to dilution in the same manner) was added at 100 l/well. The mixture was incubated at 37 C. for 1-2 h. The plate was then washed with PBST for five times, and HRP-labeled Goat anti Mouse (KPL product) (1:5000) was then added at 100 l/well and was incubated at 37 C. for 30 min; the plate was then washed with PB ST for five times, HRP substrate (Beijing Wantai Co.) was then added at 100 l/well and was incubated at 37 C. for 15 min. 2M sulphuric acid was added at 50 l/well to stop the reaction, and Microplate reader (Sunrise Type, product from Tecan Co.) was then used to read OD450/620 value. The results of the ELISA using the fusion proteins with the monoclonal antibodies were shown in FIG. 5. The results showed that the reactivity of E2s protein with the monoclonal antibody was significantly enhanced, after its fusion with CRM197 or a fragment thereof, wherein the reactivity of A-L-E2s and A-E2s was enhanced most significantly; the reactivity of E2 protein with HEV-specific monoclonal antibody was retained or enhanced, after its fusion with CRM197 or a fragment thereof.

(111) Analysis of the Reactivity of the Fusion Protein A-L-E2 Purified by Chromatography

(112) The reactivity of the fusion protein A-L-E2, purified by two-step chromatography, was analyzed by indirect ELISA (see the concrete process in the previous step). The ELISA result was shown in FIG. 6. The result showed that the reactivity of A-L-E2 with HEV specific monoclonal antibody was comparable to that of the control proteins HEV-239 and E2.

(113) Analysis of Sedimentation Velocity (SV) of the Fusion Protein A-L-E2

(114) The apparatus used in the experiment was US Beckman XL-A analytic supercentrifuge, which was equipped with an optical detection system and An-50Ti and An-60Ti rotators. The Sedimentation Velocity (SV) method (c(s) algorithm, see P. Schuck et al., Biophys J 78: 1606-1619(2000)) was used to analyze the sedimentation coefficient of the fusion protein A-L-E2. The analytic result was shown in FIG. 7. The result showed that the fusion protein A-L-E2 was mainly present in a form of dimer, and some dimers might be further polymerized to form a tetramer.

Example 5. Analysis of Immunogenicity of the Fusion Proteins Constructed in Example 2

(115) Antibody Titers Induced by the Fusion Proteins

(116) The mice used in the experiment were female, 6-week old BALB/C mice. By using aluminum adjuvant, mice were immunized by intraperitoneal injection of the fusions proteins which were prepared by the methods in the Example 3 and renatured to PBS and the control proteins HEV-239, E2 and E2s, respectively. The injection volume was 1 ml, and two dose groups (a 5 g-dose group or a 0.5 g-dose group) were used. The primary immunization was performed at week 0, and booster immunization was performed at week 2 and 4.

(117) HEV-239 was used to coat a plate, and the antibody titers in serum as induced by the fusion proteins and the control proteins, were measured by similar indirect ELISA assay as described above. The detection results of the serum antibody titers within 3 months after immunization were shown in FIG. 8. The results showed that seroconversion occurred in mice serum at week 4 in both 5 g- and 0.5 g-dose groups, and the antibody titers reached the highest value at week 5 or 6. In particular, in 5 g-dose group, the highest antibody titer was obtained when A-L-E2 was used, which reached 10.sup.6 at week 6; and the antibody titers induced by the fusion proteins were higher or comparable to that of HEV-239 protein. In 0.5 g-dose groups, the antibody titers of the fusion proteins were significantly higher than that of HEV-239, and the antibody titer induced by A-L-E2 protein reached 10.sup.6 at week 5. In addition, seroconversion did not occur in immune serum when using E2 and E2s, in 5 g- and 0.5 g-dose groups. As seen from the above results, the immunogenicity of the constructed fusion proteins were significantly higher than the antigen protein (E2 and E2s) alone, indicating that the CRM197 of the invention or a fragment thereof significantly enhanced immunogenicity of the antigen protein fused therewith, and could be used as intramolecular adjuvant.

(118) Investigation on Median Effective Dose (ED50) of the Fusion Protein A-L-E2

(119) In the experiment, immunogenicity of fusion proteins was investigated by determining median effective dose (ED50). The experimental animals used were 3-4 week old female BALB/c mice. A-L-E2 was mixed with aluminum adjuvant, and the initial dose was 1 g/mouse, and was subjected to serial dilution at 1:3, resulting in 8 dose groups in total. In addition, HEV-239 (HEV recombinant vaccine) was used as control, and the initial dose was 1.6 g/mouse, and was subjected to serial dilution at 1:4, resulting in 4 dose groups in total. 6 mice were used in each group. The immunization was carried out by single intraperitoneal injection.

(120) Peripheral venous blood was taken after 4 weeks following immunization, serum was separated, and serological conversion rate was determined by ELISA assay as described above. When the ELISA value of 100-fold diluted serum was higher than the cutoff value (i.e. three times of the average negative value), the serum was regarded as positive. The median effective dose (ED50) was calculated by Reed-Muench method. The serological conversion rate of the fusion protein A-L-E2 was shown in Table 2, and the serological conversion rate of HEV-239 vaccine was shown in Table 3.

(121) TABLE-US-00008 TABLE 2 ED50 of A-L-E2 for inducing seroconversion of HEV antibody in mice Number of Serological Number of mice with conversion Dose (g) mice seroconversion rate ED50(g) 1.0000 6 6 100% 0.0064 0.3333 6 6 100% 0.1111 6 6 100% 0.0370 6 6 100% 0.0123 6 6 100% 0.0041 6 1 16.7% 0.0013 6 0 0% 0.0005 6 0 0%

(122) TABLE-US-00009 TABLE 3 ED50 of HEV-239 vaccine for inducing seroconversion of HEV antibody in mice Number of Serological Number of mice with conversion Dose (g) mice seroconversion rate ED50(g) 1.6 6 6 100% 0.071 0.4 6 5 83.3% 0.1 6 4 66.7% 0.025 6 0 0%

(123) The results showed that ED50 of HEV-239 was 11 times of that of A-L-E2, indicating that CRM197 of the invention or a fragment thereof significantly enhanced immunogenicity of the antigen protein fused therewith, and could be used as intramolecular adjuvant. Meanwhile, since immunogenicity of the fusion protein A-L-E2 was significantly higher than that of HEV-239 vaccine in the form of virus like particle, the fusion protein might be used for the preparation of a new vaccine which is more effective for Hepatitis E.

Example 6. Design and Clone of Fusion Proteins Comprising CRM197 or a Fragment Thereof and an Influenza Virus M2e Protein

(124) In the Example, vectors expressing the fusion proteins were constructed exemplarily. The clone design of the exemplary fusion proteins constructed is shown in FIG. 9, wherein the fusion proteins each comprise CRM197 or a fragment thereof and an influenza virus M2e protein, optionally using a linker.

(125) Clone of Fusion Proteins

(126) M2e Fused to the C-Terminus of CRM197 or a Fragment Thereof

(127) The amplification product (i.e. the full-length gene of CRM197) obtained in the Example 1 was used as template. The forward primer was CRM197F1 (SEQ ID NO: 45), at the 5 terminal of which the restriction endonuclease NdeI site CAT ATG was introduced, wherein ATG was the initiation codon in E. coli system. The reverse primers were CRM197-linker R1 (SEQ ID NO: 46), 389-linker R1 (SEQ ID NO: 47) and A-linker R1 (SEQ ID NO: 48), respectively, at the 5 terminal of which the restriction endonuclease BamHI site GGA TCC was introduced. The PCR reaction was performed in a PCR thermocycler (Biometra T3) under the following conditions. The sequences of the primers used were shown in Table 4.

(128) TABLE-US-00010 95 C. denaturation 10 min 1 cycle 95 C. denaturation 1.5 min 20 cycle 58 C. annealing 1.5 min 72 C. elongation 1.7 min 72 C. elongation 10 min 1 cycle

(129) The amplification products were DNA fragments of about 1600 bp, 1200 bp and 600 bp in length, respectively.

(130) In addition, the plasmid PHW2000 (stored in our lab, comprising the full-length gene of M2) was used as a template. The forward primer was M2eF1 (SEQ ID NO: 49), at the 5 terminal of which the restriction endonuclease BamHI GGA TCC was introduced. The reverse primer was M2eR (SEQ ID NO: 50), at the 5 terminal of which the restriction endonuclease EcoRI site GAA TTC was introduced. The PCR reaction was performed in a PCR thermocycler (Biometra T3) under the following conditions. The sequences of the primers used were shown in Table 4.

(131) TABLE-US-00011 95 C. denaturation 10 min 1 cycle 95 C. denaturation 50 sec 20 cycle 58 C. annealing 50 sec 72 C. elongation 30 sec 72 C. elongation 10 min 1 cycle

(132) The amplification products were DNA fragments of about 70 bp in length, respectively.

(133) The amplification products as obtained above were linked into commercially available pMD 18-T vector (produced by TAKARA Co.), respectively, and designated as pMD 18-T-CRM197-L1, pMD 18-T-389-L1 and pMD 18-T-A-L1 as well as pMD 18-T-M2e. As identified by NdeI/BamHI and BamHI/EcoRI enzyme cleavage, respectively, the positive clones pMD 18-T-CRM197-L1, pMD 18-T-389-L1, pMD 18-T-A-L1 and pMD 18-T-M2e were obtained.

(134) As confirmed by M13(+) primer, correct nucleotide sequences of interest were inserted into the obtained plasmids pMD 18-T-CRM197-L1, pMD 18-T-389-L1, pMD 18-T-A-L1 and pMD 18-T-M2e.

(135) The plasmids pMD 18-T-CRM197-L1, pMD 18-T-389-L1 and pMD 18-T-A-L1 were digested by NdeI/BamHI enzyme. The fragments obtained by enzyme cleavage were linked into the prokaryotic expression vector pTO-T7 digested by NdeI/BamHI enzyme (Luo Wenxin et al., Chinese Journal of Biotechnology, 2000, 16:53-57), and were transformed into E. coli ER2566 (purchased from Invitrogen Co.); after extraction of plasmids, as identified by NdeI/BamHI enzyme cleavage, the positive plasmids pTO-T7-CRM197-L1, pTO-T7-389-L1 and pTO-T7-A-L1, into which the fragments CRM197-L1, 389-L1 and A-L1 were inserted, respectively, were obtained.

(136) pTO-T7-CRM197-L1, pTO-T7-389-L1, pTO-T7-A-L1 and pMD 18-T-M2e were digested by BamHI/EcoRI enzyme. The obtained M2e fragment was linked into the vectors pTO-T7-CRM197-L1, pTO-T7-389-L1 and pTO-T7-A-L1 digested by BamHI/EcoRI enzyme, respectively. As identified by NdeI/EcoRI enzyme cleavage, the positive expression vectors pTO-T7-CRM197-L-M2e, pTO-T7-389-L-M2e, and pTO-T7-A-L-M2e, into which CRM197-L-M2e (SEQ ID NO:33, 34), 389-L-M2e (SEQ ID NO:35, 36), or A-L-M2e (SEQ ID NO:37, 38) was inserted respectively, were obtained.

(137) M2e Fused to the N-Terminus of CRM197 or a Fragment Thereof.

(138) The plasmid PHW2000 (stored in our lab, containing the full-length gene of M2) was used as template. The forward primer was M2eF2 (SEQ ID NO: 51), at the 5 terminal of which the restriction endonuclease NdeI CAT ATG was introduced, wherein ATG was the initiation codon in E. coli system. The reverse primer was M2e-Linker R (SEQ ID NO: 52), at the 5 terminal of which the restriction endonuclease BamHI GGA TCC was introduced. The PCR reaction was performed in a PCR thermocycler (Biometra T3) under the following conditions.

(139) TABLE-US-00012 95 C. denaturation 10 min 1 cycle 95 C. denaturation 50 sec 20 cycle 58 C. annealing 50 sec 72 C. elongation 30 sec 72 C. elongation 10 min 1 cycle

(140) The amplification products were DNA fragments of about 100 bp in length.

(141) In addition, the amplification product (i.e. the full-length gene of CRM197) obtained in the Example 1 was used as template. The forward primer was CRM197F2 (SEQ ID NO: 53), at the 5 terminal of which the restriction endonuclease BamHI GGA TCC was introduced. The reverse primers were CRM197 R2 (SEQ ID NO: 54), 389 R (SEQ ID NO: 55), and A R (SEQ ID NO: 56), at the 5 terminal of which the restriction endonuclease EcoRI site GAA TTC was introduced. The PCR reaction was performed in a PCR thermocycler (Biometra T3) under the following conditions. The sequences of the primers used were shown in Table 4.

(142) TABLE-US-00013 95 C. denaturation 10 min 1 cycle 95 C. denaturation 1.5 min 20 cycle 58 C. annealing 1.5 min 72 C. elongation 1.7 min 72 C. elongation 10 min 1 cycle

(143) The amplification products were DNA fragments of about 1600 bp, 1200 bp and 600 bp in length, respectively.

(144) The amplification products as obtained above were linked into commercially available pMD 18-T vector (produced by TAKARA Co.), respectively, and designated as pMD 18-T-M2e-L as well as pMD 18-T-CRM197, pMD 18-T-389 and pMD 18-T-A, respectively. As identified by NdeI/BamHI and BamHI/EcoRI enzyme cleavage, respectively, the positive clones pMD 18-T-CRM197, pMD 18-T-389, pMD 18-T-A, and pMD 18-T-M2e-L were obtained.

(145) As confirmed by M13(+) primer, correct nucleotide sequences of interest were inserted into the obtained plasmids pMD 18-T-CRM197, pMD 18-T-389, pMD 18-T-A, and pMD 18-T-M2e-L, respectively.

(146) The plasmid pMD 18-T-M2e-L was digested by NdeI/BamHI enzyme. The fragments obtained by enzyme cleavage were then linked into the prokaryotic expression vector pTO-T7 digested by NdeI/BamHI enzyme (Luo Wenxin et al., Chinese Journal of Biotechnology, 2000, 16:53-57), and was transformed into E. coli ER2566 (purchased from Invitrogen Co.); after extraction of plasmids, as identified by NdeI/BamHI enzyme cleavage, the positive plasmid pTO-T7-M2e-L, into which the fragment M2e-L was inserted, was obtained.

(147) pTO-T7-M2e-L, pMD 18-T-CRM197, pMD 18-T-389 and pMD 18-T-A were digested by BamHI/EcoRI enzyme. The obtained fragments CRM197, 389 and A were linked into the vector pTO-T7-M2e-L digested by BamHI/EcoRI enzyme, respectively. As identified by NdeI/EcoRI enzyme cleavage, the positive expression vectors pTO-T7-M2e-L-CRM197, pTO-T7-M2e-L-389, and pTO-T7-M2e-L-A, into which M2e-L-CRM197 (SEQ ID NO:39, 40), M2e-L-389 (SEQ ID NO:41, 42), and M2e-L-A (SEQ ID NO:43, 44) were inserted respectively, were obtained.

(148) The sequences of the primers used in the Example are listed in Table 4.

(149) TABLE-US-00014 TABLE4 Primersequences SEQ ID Primer NO: names Primersequences(5-3) 45 CRM197F1 CATATGGGCGCTGATGATGTTGTTGATTCTTCTA AATCTTTTGTGATGGAA 46 CRM197- GGATCCGCTGCCACCGCCACCGCTGCCACCGCC linkerR1 ACCGCTTTTGAT 47 389-linker GGATCCGCTGCCACCGCCACCGCTGCCACCGCC R1 ACCAAATGGTTG 48 A-linker GGATCCGCTGCCACCGCCACCGCTGCCACCGCC R1 ACCACGATTTCC 49 M2eF1 GGATCCATGAGTCTTCTAACCGAGGTCGAAACG CCT 50 M2eR GAATTCTTAATCACTTGAACCGTTGCATCTGCAC CCCCA 51 M2eF2 CATATGATGAGTCTTCTAACCGAGGTCGAAACG CCT 52 M2e-Linker GGATCCGCTGCCACCGCCACCGCTGCCACCGCC R ACCATCACTTGA 53 CRM197F2 GGATCCGGCGCTGATGATGTTGTTGATTCTTCTA AATCTTTTGTGATGGAA 54 CRM197R2 GAATTCTAAGCTTTTGATTTCAAAAAATAGCGAT AGCTTAGA 55 389R GAATTCTAAAAATGGTTGCGTTTTATGCCCCGGA GAATACGC 56 AR GAATTCTAAACGATTTCCTGCACAGGCTTGAGCC ATATACTC

(150) 1 L of plasmids pTO-T7-CRM197-L-M2e, pTO-T7-389-L-M2e, pTO-T7-A-L-M2e, pTO-T7-M2e-L-CRM197, pTO-T7-M2e-L-389 and pTO-T7-M2e-L-A (0.15 mg/ml) were separately used to transform 40 L competent E. coli ER2566 (purchased from Invitrogen) prepared by the Calcium chloride method, and then the bacteria were plated on solid LB medium (the components of the LB medium: 10 g/L peptone, 5 g/L yeast powder, and 10 g/L NaCl, the same below) containing kanamycin (at a final concentration of 100 mg/ml, the same below). The plates were statically incubated at 37 C. for about 10-12 h until individual colonies could be observed clearly. Individual colonies from the plates were transferred to a tube containing 4 ml liquid LB medium containing kanamycin. The cultures were incubated in a shaking incubator at 180 rpm for 10 h at 37 C., and then 1 ml bacterial solution was taken and stored at 70 C.

Example 7. The Expression, Isolation and Renaturation of the Fusion Proteins Constructed in Example 6

(151) 5 L bacterial solution, taken from an ultra low temperature freezer at 70 C., was seeded to 5 mL liquid LB medium containing kanamycin, and then was cultured at 37 C., 180 rpm under shaking until OD600 reached about 0.5. The resultant solution was transferred to 500 ml LB medium containing kanamycin, and then was cultured at 37 C., 180 rpm under shaking for 4-5 h. When OD600 reached about 1.5, IPTG was added to a final concentration of 0.4 mM, and the bacteria were induced under shaking at 37 C. for 4 h.

(152) After induction, centrifugation was performed at 8000 g for 5 min to collect the bacteria, and then the bacteria was re-suspended in a lysis solution at a ratio of 1 g bacteria to 10 mL lysis solution (20 mM Tris buffer pH7.2, 300 mM NaCl), in ice-bath. The bacteria was treated with a sonicator (Sonics VCX750 Type Sonicator) (conditions: operating time 15 min, pulse 2s, intermission 4s, output power 55%). The bacterial lysate was centrifuged at 12000 rpm, 4 C. for 5 min (the same below), and the supernatant and the precipitate (i.e. inclusion body) after disrupting the bacteria by ultrasonication were collected, respectively. 2% Triton-100 of the same volume was used for washing the precipitate, the result mixture was under vibration for 30 min, centrifuged, and the supernatant was discarded. The precipitate was re-suspended in Buffer I (20 mM Tris-HCl pH8.0, 100 mM NaCl, 5 mM EDTA), under vibration for 30 min, centrifuged, and the supernatant was discarded. The precipitate was then re-suspended in 2M urea, under vibration at 37 C. for 30 min, centrifuged, and the supernatant and the precipitate were obtained. The supernatant was kept; and the precipitate was re-suspended in 4M urea in the same volume, under vibration at 37 C. for 30 min, and centrifuged at 12000 rpm, 4 C. for 15 min to obtain the supernatant and precipitate. The supernatant (i.e. the 4M urea-dissolved supernatant) was kept; and the precipitate was further in re-suspended in 8M urea in the same volume, under vibration at 37 C. for 30 min, and centrifuged, and the supernatant (i.e. the 8M urea-dissolved supernatant) was kept.

(153) The fractions obtained were analyzed by SDS-PAGE (Coomassie brilliant blue staining was used for visualization, the same below, see the methods in The Molecular Cloning Experiment Guide, 2.sup.nd edition). The results showed that the fusion proteins were expressed in inclusion bodies (see FIGS. 10A and 10B), CRM197-L-M2e, 389-L-M2e, M2e-L-CRM197 and M2e-L-389 were mainly dissolved in 8M urea, and A-L-M2e and M2e-L-A were mainly dissolved in 4M urea. The 4M urea-dissolved supernatants containing A-L-M2e or M2e-L-A or the 8M urea-dissolved supernatants containing CRM197-L-M2e, 389-L-M2e, M2e-L-CRM197 or M2e-L-389, were dialyzed to PBS, respectively, to get the fusion proteins with a purity of about 80% (see FIGS. 10C-10F).

Example 8. Analysis of Properties of the Fusion Proteins Constructed in Example 6

(154) Determination of the Reactivity of the Fusion Proteins with Antibodies by Western Blotting

(155) The reactivity of the fusion proteins with influenza virus M2e monoclonal antibody 5D1 and CRM197 monoclonal antibody 1E6 (prepared in the laboratory) were determined by Western blotting. The dialyzed and renatured samples were transferred to nitrocellulose membrane for blotting after SDS-PAGE separation; 5% skimmed milk was used to block the membrane for 2 h, and then the monoclonal antibody 5D1 diluted at 1:500 was added. The reaction was carried out for 1 h. The membrane was then washed with TNT (50 mmol/L Tris.Cl (pH 7.5), 150 mmol/L NaCl, 0.05% Tween 20) for three times, 10 min for each time. Goat Anti-mouse alkaline phosphatase (KPL product) was then added. The reaction was carried out for 1 h, and the membrane was then washed with TNT for three times, 10 min for each time. NBT and BCIP (PROTOS product) were used for visualization. The results, as determined by Western blotting using the fusion proteins and influenza virus M2e monoclonal antibody 5D1 (FIGS. 11A-11D) or CRM197 monoclonal antibody 1E6 (FIGS. 11E-11H), were shown in FIG. 11. The results showed that all the tested fusion proteins had significant reactivity with influenza virus M2e-specific monoclonal antibody 5D1 and CRM197 specific monoclonal antibody 1E6.

(156) Determination of the Reactivity of the Fusion Proteins with Various M2e Specific Monoclonal Antibodies and CRM197 Specific Antibody by ELISA

(157) The reactivity of the fusion proteins and the control protein GST-M2e with various M2e specific antibodies and CRM197 specific monoclonal antibody 1E6 (the antibodies used in the experiment were known in the prior art, or commercially available or prepared in the laboratory) was determined by indirect ELISA. For example, 019 antibody is a protective antibody against influenza known in the prior art (see, Fu et al., Virology, 2009, 385:218-226). The dialyzed and renatured samples were diluted in 1PBS (1 g/ml), and then were added to 96-well microplate (Beijing Wantai Co.) at 100 l/well and incubated at 37 C. for 2 h. The coating solution was discarded, the plate was washed with PBST (PBS+0.05% TWEEN 20) once, and then the blocking solution (2% gelatin, 5 Casein, 1 PROCLIN 300, in PBS) was added at 180 l/well and incubated at 37 C. for 2 h. The blocking solution was discarded when the detection was performed, and the anti-M2e antibody or CRM197 antibody diluted at a certain ratio (0.002 mg/ml was used as the initial concentration for 2-fold gradient dilution) was added at 100 l/well. The mixture was incubated at 37 C. for 1 h. The plate was washed with PBST for five times, HRP-labeled Goat anti Mouse (KPL product) (1:5000) was then added at 100 l/well and was incubated at 37 C. for 30 min. The plate was washed with PBST for five times, HRP substrate (Beijing Wantai Co.) was then added at 100 l/well and was incubated at 37 C. for 15 min. 2M sulphuric acid was added at 50 l/well to stop the reaction, and Microplate reader (Sunrise Type, product from Tecan Co.) was then used to read OD450/620 value. The results of the ELISA using the fusion proteins with the antibodies were shown in FIGS. 12A and 12B. The results showed that as compared to M2e protein alone, the reactivity of M2e protein with various anti-M2e specific monoclonal antibodies was retained or enhanced after its fusion with CRM197 or a fragment thereof.

(158) Analysis of Sedimentation Velocity (SV) of the Fusion Proteins

(159) The apparatus used in the experiment was US Beckman XL-A analytic supercentrifuge, which was equipped with an optical detection system and An-50Ti and An-60Ti rotators. The Sedimentation Velocity (SV) method (c(s) algorithm, see P. Schuck et al., Biophys J 78: 1606-1619(2000)) was used to analyze the sedimentation coefficient of the fusion proteins. The analytic results were shown in FIGS. 13A-13F. The results showed that among the fusion proteins constructed in Example 6, A-L-M2e and M2e-L-A were mainly present in a form of monomer and tetramer; and 389-L-M2e was mainly present in a form of dimer and polymer; M2e-L-389 was mainly present in a form of monomer and polymer; CRM197-L-M2e was mainly present in a form of dimer and polymer; and M2e-L-CRM197 was mainly present in a form of monomer and polymer.

Example 9. Analysis of Immunogenicity of the Fusion Proteins Constructed in Example 6

(160) The mice used in the experiment were female, 6-week old BALB/C mice. By using aluminum adjuvant, mice were immunized by intraperitoneal injection of the fusions proteins as constructed in Example 6 and renatured to PBS and the control protein GST-M2e, respectively. The injection volume was 1 ml, and two dose groups (a 5 g-dose group or a 0.5 g-dose group) were used. The primary immunization was performed at week 0, and booster immunization was performed at week 2 and 4.

(161) GST-M2e was used to coat a plate, and the antibody titers in serum as induced by the fusion proteins and control protein, were measured by similar indirect ELISA assay as described above. The detection results of the serum antibody titers within 4 months after immunization were shown in FIGS. 14A and 14B. The results showed that after the second booster immunization, immunogenicity of the constructed fusion proteins was significantly higher than the antigen protein (GST-M2e) alone, indicating that the CRM197 of the invention or a fragment thereof (no matter being located at the N-terminus or C-terminus of the fusion protein) significantly enhanced immunogenicity of the antigen protein fused therewith, and could be used as intramolecular adjuvant.

(162) Although the specific embodiments of the invention have been described in details, those skilled in the art would understand that, according to the teachings disclosed in the specification, various modifications and changes can be made without departing from the sprit or scope of the invention as generally described, and that such modifications and changes are within the scope of the present invention. The scope of the present invention is given by the appended claims and any equivalents thereof.