Chalcone synthase dihyrdoflavonol 4-reductase and leucoanthocyanidine reductase from clover, medic ryegrass or fescue

Abstract

The present invention relates to nucleic acid fragments encoding amino acid sequences for flavonoid biosynthetic enzymes in plants, and the use thereof for the modification of, for example, flavonoid biosynthesis in plants, and more specifically the modification of the content of condensed tannins. In particularly preferred embodiments, the invention relates to the combinatorial expression of chalcone synthase (CHS) and/or dihydroflavonol 4-reductase (BAN) and/or leucoanthocyanidine reductase (LAR) in plants to modify, for example, flavonoid biosynthesis or more specifically the content of condensed tannins.

Claims

1. A purified or isolated nucleic acid comprising (a) a sequence encoding a leucoanthocyanidine reductase (LAR) comprising a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 11, 13, and 15, or (b) a variant of the sequence of paragraph (a), wherein the variant has at least 80% nucleic acid identity to any one of SEQ ID NOs: 11, 13 or 15, and encodes a polypeptide comprising the entirety of SEQ ID NOs: 12, 14, or 16, respectively.

2. The purified or isolated nucleic acid of claim 1, wherein the nucleic acid is a variant and the variant has at least 95% nucleic acid identity to any one of SEQ ID NOs: 11, 13 or 15.

3. The purified or isolated nucleic acid of claim 1, comprising a sequence selected from the group consisting of SEQ ID NOs: 11, 13 and 15 as the sequence encoding the LAR.

4. The purified or isolated nucleic acid of claim 1, further comprising a promoter sequence effective to direct expression of the nucleic acid sequence of (a), or (b) in a plant cell.

5. A plant cell, plant, plant seed or other plant part, comprising a nucleic acid construct, said construct comprising a nucleic acid sequence selected from the group consisting of: (a) a sequence encoding a leucoanthocyanidine reductase (LAR) comprising a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 11, 13, and 15, and (b) a variant of the sequence of paragraph (a), wherein the variant has at least 80% nucleic acid identity to any one of SEQ ID NOs: 11, 13 or 15, and encodes a polypeptide comprising the entirety of SEQ ID NOs: 12, 14, or 16, respectively; and a promoter sequence heterologous to the nucleic acid sequence effective to direct expression of the nucleic acid sequence in the plant cell, plant, plant seed or other plant part.

6. A method for modifying one or more processes selected from the group consisting of condensed tannin biosynthesis; protein binding; metal chelation; anti oxidation; UV-light absorption; and plant defense to a biotic stress in a plant, said method comprising introducing into said plant an effective amount of a purified or isolated nucleic acid sequence comprising a sequence selected from the group consisting of: (a) a sequence encoding a leucoanthocyanidine reductase (LAR) comprising a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 11, 13, and 15, and (b) a variant of the sequence of paragraph (a), wherein the variant has at least 80% nucleic acid identity to any one of SEQ ID NOs: 11, 13 or 15, and encodes a polypeptide comprising the entirety of SEQ ID NO: 12, 14, or 16, respectively; and expressing the nucleic acid sequence in the plant, whereby at least one of the processes is modified.

7. A method of modifying forage quality of a plant by disrupting protein foam and/or conferring protection from rumen pasture bloat, said method comprising introducing into said plant an effective amount of a purified or isolated nucleic acid sequence comprising a sequence selected from the group consisting of: (a) a sequence encoding a leucoanthocyanidine reductase (LAR) comprising a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 11, 13, and 15, and (b) a variant of the sequence of paragraph (a), wherein the variant has at least 80% nucleic acid identity to any one of SEQ ID NOs: 11, 13 or 15, and encodes a polypeptide having LAR activity, and having at least 95% amino acid identity to SEQ ID NO: 12, 14, or 16, respectively; and expressing the nucleic acid sequence in the plant, whereby the forage quality of the plant is modified.

Description

(1) In the Figures

(2) FIG. 1 shows the plasmid map in pGEM-T Easy of TrCHSa3.

(3) FIG. 2 shows the nucleotide sequence of TrCHSa3 (Sequence ID No. 1).

(4) FIG. 3 shows the deduced amino acid sequence of TrCHSa3 (Sequence ID No. 2).

(5) FIG. 4 shows plasmid maps of sense and antisense constructs of TrCHSa3 in the binary vector pPZP221:35 S.sup.2.

(6) FIG. 5 shows the plasmid map in pGEM-T Easy of TrCHSc.

(7) FIG. 6 shows the nucleotide sequence of TrCHSc (Sequence ID No. 3).

(8) FIG. 7 shows the deduced amino acid sequence of TrCHSc (Sequence ID No. 4).

(9) FIG. 8 shows plasmid maps of sense and antisense constructs of TrCHSc in the binary vector pPZP221:35 S.sup.2.

(10) FIG. 9 shows the plasmid map in pGEM-T Easy of TrCHSf.

(11) FIG. 10 shows the nucleotide sequence of TrCHSf (Sequence ID No. 5).

(12) FIG. 11 shows the deduced amino acid sequence of TrCHSf (Sequence ID No. 6).

(13) FIG. 12 shows plasmid maps of sense and antisense constructs of TrCHSf in the binary vector pPZP221:35 S.sup.2.

(14) FIG. 13 shows the plasmid map in pGEM-T Easy of TrCHSh.

(15) FIG. 14 shows the nucleotide sequence of TrCHSh (Sequence ID No. 7).

(16) FIG. 15 shows the deduced amino acid sequence of TrCHSh (Sequence ID No. 8).

(17) FIG. 16 shows plasmid maps of sense and antisense constructs of TrCHSh in the binary vector pPZP221:35 S.sup.2.

(18) FIG. 17 shows the plasmid map in pGEM-T Easy of TrBANa.

(19) FIG. 18 shows the nucleotide sequence of TrBANa (Sequence ID No. 9).

(20) FIG. 19 shows the deduced amino acid sequence of TrBANa (Sequence ID No. 10).

(21) FIG. 20 shows plasmid maps of sense and antisense constructs TrBANa in the binary vector pPZP221:35 S.sup.2.

(22) FIG. 21 shows the plasmid map in pGEM-T Easy of TrLARa.

(23) FIG. 22 shows the nucleotide sequence of TrLARa (Sequence ID No. 11).

(24) FIG. 23 shows the deduced amino acid sequence of TrLARa (Sequence ID No. 12).

(25) FIG. 24 shows plasmid maps of sense and antisense constructs of TrLARa in the binary vector pPZP221:35 S.sup.2.

(26) FIG. 25 shows the plasmid map in pGEM-T Easy of TrLARb.

(27) FIG. 26 shows the nucleotide sequence of TrLARb (Sequence ID No. 13).

(28) FIG. 27 shows the deduced amino acid sequence of TrLARb (Sequence ID No. 14).

(29) FIG. 28 shows plasmid maps of sense and antisense constructs of TrLARb in the binary vector pPZP221:35 S.sup.2.

(30) FIG. 29 shows the plasmid map in pGEM-T Easy of TrLARc.

(31) FIG. 30 shows the nucleotide sequence of TrLARc (Sequence ID No. 15).

(32) FIG. 31 shows the deduced amino acid sequence of TrLARc (Sequence ID No. 16).

(33) FIG. 32 shows plasmid maps of sense and antisense constructs of TrLARc in the binary vector pPZP221:35 S.sup.2.

(34) FIG. 33 shows the plasmid map of the binary vector pPZP221:ASSU::TrBAN:35S.sup.2::TrCHS.

(35) FIG. 34 shows the plasmid maps of the modular vector system comprising a binary base vector and 7 auxiliary vectors.

(36) FIG. 35 shows an example of the modular binary transformation vector system comprising plasmid maps of the binary transformation vector backbone and 4 expression cassettes in auxiliary vectors (A) and the plasmid map of the T-DNA region of the final binary transformation vector.

(37) FIG. 36 shows A, white clover cotyledons; B, C, D, selection of plantlets transformed with a binary transformation vector constructed as described in Examples 4 and 5; E, putative transgenic white clover on root-inducing medium; F, G, white clover plants transgenic for genes involved in condensed tannin biosynthesis.

(38) FIG. 37 shows the molecular analysis of white clover plants transgenic for the TrBAN gene with Q-PCR amplification plot, agarose gel of PCR product and Southern hybridisation blot.

(39) FIG. 38 shows the molecular analysis of white clover plants transgenic for the TrCHSf gene with Q-PCR amplification plot and agarose gel of PCR product.

(40) FIG. 39 shows the molecular analysis of white clover plants transgenic for the TrLARb gene with Q-PCR amplification plot, agarose gel of PCR product and Southern hybridisation blot.

EXAMPLE 1

Preparation of cDNA Libraries, Isolation and Sequencing of cDNAs Coding for CHS, CHS-like, BAN, BAN-like, LAR and LAR-Like Proteins from White Clover Trifolium repens

(41) cDNA libraries representing mRNAs from various organs and tissues of white clover (Trifolium repens) were prepared. The characteristics of the white clover libraries are described below (Table 1).

(42) TABLE-US-00001 TABLE 1 cDNA libraries from white clover (Trifolium repens) Library Organ/Tissue 01wc Whole seedling, light grown 02wc Nodulated root 3, 5, 10, 14, 21 & 28 day old seedling 03wc Nodules pinched off roots of 42 day old rhizobium inoculated plants 04wc Cut leaf and stem collected after 0, 1, 4, 6 & 14 h after cutting 05wc Inflorescences: <50% open, not fully open and fully open 06wc Dark grown etiolated 07wc Inflorescence-very early stages, stem elongation, <15 petals, 15-20 petals 08wc seed frozen at 80 C., imbibed in dark overnight at 10 C. 09wc Drought stressed plants 10wc AMV infected leaf 11wc WCMV infected leaf 12wc Phosphorus starved plants 13wc Vegetative stolon tip 14wc stolon root initials 15wc Senescing stolon 16wc Senescing leaf

(43) The cDNA libraries may be prepared by any of many methods available. For example, total RNA may be isolated using the Trizol method (Gibco-BRL, USA) or the RNeasy Plant Mini kit (Qiagen, Germany), following the manufacturers' instructions. cDNAs may be generated using the SMART PCR cDNA synthesis kit (Clontech, USA), cDNAs may be amplified by long distance polymerase chain reaction using the Advantage 2 PCR Enzyme system (Clontech, USA), cDNAs may be cleaned using the GeneClean spin column (Bio 101, USA), tailed and size fractionated, according to the protocol provided by Clontech. The cDNAs may be introduced into the pGEM-T Easy Vector system 1 (Promega, USA) according to the protocol provided by Promega. The cDNAs in the pGEM-T Easy plasmid vector are transfected into Escherichia coli Epicurean coli XL10-Gold ultra competent cells (Stratagene, USA) according to the protocol provided by Stratagene.

(44) Alternatively, the cDNAs may be introduced into plasmid vectors for first preparing the cDNA libraries in Uni-ZAP XR vectors according to the manufacturer's protocol (Stratagene Cloning Systems, La Jolla, Calif., USA). The Uni-ZAP XR libraries are converted into plasmid libraries according to the protocol provided by Stratagene. Upon conversion, cDNA inserts will be contained in the plasmid vector pBlueScript. In addition, the cDNAs may be introduced directly into precut pBlueScript II SK(+) vectors (Stratagene) using T4 DNA ligase (New England Biolabs), followed by transfection into E. coli DH10B cells according to the manufacturer's protocol (GIBCO BRL Products).

(45) Once the cDNA inserts are in plasmid vectors, plasmid DNAs are prepared from randomly picked bacterial colonies containing recombinant plasmids, or the insert cDNA sequences are amplified via polymerase chain reaction using primers specific for vector sequences flanking the inserted cDNA sequences. Plasmid DNA preparation may be performed robotically using the Qiagen QiaPrep Turbo kit (Qiagen, Germany) according to the protocol provided by Qiagen. Amplified insert DNAs are sequenced in dye-terminator sequencing reactions to generate partial cDNA sequences (expressed sequence tags or ESTs). The resulting ESTs are analysed using an Applied Biosystems ABI 3700 sequence analyser.

EXAMPLE 2

DNA Sequence Analyses

(46) The cDNA clones encoding CHS, CHS-like, BAN, BAN-like, LAR and LAR-like proteins were identified by conducting BLAST (Basic Local Alignment Search Tool; Altschul et al. (1993), J. Mol. Biol. 215:403-410) searches. The cDNA sequences obtained were analysed for similarity to all publicly available DNA sequences contained in the eBioinformatics nucleotide database using the BLASTN algorithm provided by the National Center for Biotechnology Information (NCBI). The DNA sequences were translated in all reading frames and compared for similarity to all publicly available protein sequences contained in the SWISS-PROT protein sequence database using BLASTx algorithm (v 2.0.1) (Gish and States (1993), Nature Genetics 3:266-272) provided by the NCBI.

(47) The cDNA sequences obtained and identified were then used to identify additional identical and/or overlapping cDNA sequences generated using the BLASTN algorithm. The identical and/or overlapping sequences were subjected to a multiple alignment using the CLUSTALw algorithm, and to generate a consensus contig sequence derived from this multiple sequence alignment. The consensus contig sequence was then used as a query for a search against the SWISS-PROT protein sequence database using the BLASTx algorithm to confirm the initial identification.

EXAMPLE 3

Identification and Full-Length Sequencing of cDNAs Encoding White Clover CHS, BAN and LAR Proteins

(48) To fully characterise for the purposes of the generation of probes for hybridisation experiments and the generation of transformation vectors, a set of cDNAs encoding white clover CHS, BAN and LAR proteins was identified and fully sequenced.

(49) Full-length cDNAs were identified from our EST sequence database using relevant published sequences (NCBI databank) as queries for BLAST searches. Full-length cDNAs were identified by alignment of the query and hit sequences using Sequencher (Gene Codes Corp., Ann Arbor, Mich. 48108, USA). The original plasmid was then used to transform chemically competent XL-1 cells (prepared in-house, CaCl.sub.2 protocol). After colony PCR (using HotStarTaq, Qiagen) a minimum of three PCR-positive colonies per transformation were picked for initial sequencing with M13F and M13R primers. The resulting sequences were aligned with the original EST sequence using Sequencher to confirm identity and one of the three clones was picked for full-length sequencing, usually the one with the best initial sequencing result.

(50) Sequencing of TrBAN could be completed with M13F and M13R primers. Sequencing of TrCHSa3, TrCHSc, TrCHSf, TrCHSh, TrLARa, TrLARb and TrLARc was completed by primer walking, i.e. oligonucleotide primers were designed to the initial sequence and used for further sequencing. The sequences of the oligonucleotide primers are shown in Table 2.

(51) Contigs were then assembled in Sequencher. The contigs include the sequences of the SMART primers used to generate the initial cDNA library as well as pGEM-T Easy vector sequence up to the EcoRI cut site both at the 5 and 3 end.

(52) Plasmid maps and the full cDNA sequences of TrCHSa3, TrCHSc, TrCHSf, TrCHSh, TrBANa, TrLARa, TrLARb and TrLARc proteins were obtained (FIGS. 1, 2, 5, 6, 9, 10, 13, 14, 17, 18, 21, 22, 25, 26, 29 and 30).

(53) TABLE-US-00002 TABLE2 Listofprimersusedforsequencingofthefull-lengthcDNAsofTrCHSa3, TrCHSc,TrCHSf,TrCHSh,TrLARa,TrLARbandTrLARc genename cloneID sequencingprimer primersequence(5 > 3) TrCHSa3 05wc1RsB06 05wc1RsB06.f1 AGGAGGCTGCAGTCAAGG 05wc1RsB06.f2 TGCCTGAAATTGAGAAACC 05wc1RsB06.f3 AAAGCTAGCCTTGAAGCC TrCHSc 07wc1TsE12 07wc1TsE12.f1 TCGGACATAACTCATGTGG 07wc1TsE12.f2 TTGGGTTGGAGAATAAGG 07wc1TsE12.r1 TGGACATTTATTGGTTGC 07wc1TsE12.r2 TATCATGTCTGGAAATGC TrCHSf 07wc1UsD07 07wc1UsD07.f1 AGATTGCATCAAAGAATGG 07wc1UsD07.r1 GGTCCAAAAGCCAATCC TrCHSh 13wc2lsG04 13wc2lsG04.f1 TAAGACGAGACATAGTGG 13wc2lsG04.r1 TATTCACTAAGCACATGC TrLARa 05wc1CsA02 05wc1CsA02.f1 TCATTTCTGCAATAGGAGG 05wc1CsA02.r1 ATCCACCTCAGGTGAACC TrLARb 05wc3EsA03 05wc3EsA03.f1 AATAGGAGGCTCTGATGG 05wc3EsA03r1 ATCCACCTCAGGTGAACC TrLARc 07wc1VsF06 07wc1VsF06.f1 AGGCTCTGATGGCTTGC 07wc1VsF06.r1 ATCCACCTCAGGTGAACC

EXAMPLE 4

Development of Binary Transformation Vectors Containing Chimeric Genes with cDNA Sequences from White Clover TrCHSa3, TrCHSc, TrCHSf, TrCHSh, TrBANa, TrLARa, TrLARb and TrLARc

(54) To alter the expression of the proteins involved in flavonoid biosynthesis, and more specifically condensed tannin biosynthesis to improve herbage quality and bloat-safety, a set of sense and antisense binary transformation vectors was produced.

(55) cDNA fragments were generated by high fidelity PCR with a proofreading DNA polymerase using the original pGEM-T Easy plasmid cDNA as a template. The primers used (Table 3) contained recognition sites for appropriate restriction enzymes, for example EcoRI and XbaI, for directional and non-directional cloning into the target vector. After PCR amplification and restriction digest with the appropriate restriction enzyme (usually XbaI), the cDNA fragments were cloned into the corresponding site in a modified pPZP binary vector (Hajdukiewicz et al., 1994). The pPZP221 vector was modified to contain the 35S.sup.2 cassette from pKYLX71:35 S.sup.2 (Schardl et al., 1987) as follows: pKYLX71:35 S.sup.2 was cut with ClaI. The 5 overhang was filled in using Klenow and the blunt end was A-tailed with Taq polymerase. After cutting with EcoRI, the 2 kb fragment with an EcoRI-compatible and a 3-A tail was gel-purified. pPZP221 was cut with HindIII and the resulting 5 overhang filled in and T-tailed with Taq polymerase. The remainder of the original pPZP221 multi-cloning site was removed by digestion with EcoRI, and the expression cassette cloned into the EcoRI site and the 3 T overhang restoring the HindIII site. This binary vector contains between the left and right border the plant selectable marker gene aacC1 under the control of the 35S promoter and 35S terminator and the pKYLX71:35 S.sup.2-derived expression cassette with a CaMV 35S promoter with a duplicated enhancer region and an rbcS terminator.

(56) Alternatively, the primers for the amplification of cDNA fragments contained attB sequences for use with recombinases utilising the GATEWAY system (Invitrogen). The resulting PCR fragments were used in a recombination reaction with pDONR vector (Invitrogen) to generate entry vectors. A GATEWAY cloning cassette (Invitrogen) was introduced into the multicloning site of the pPZP221:35 S.sup.2 vector following the manufacturer's protocol. In a further recombination reaction, the cDNAs encoding the open reading frame sequences were transferred from the entry vector to the GATEWAY-enabled pPZP221:35 S.sup.2 vector.

(57) The orientation of the constructs (sense or antisense) was checked by restriction enzyme digest and sequencing which also confirmed the correctness of the sequence. Transformation vectors containing chimeric genes using full-length open reading frame cDNAs encoding white clover TrCHSa3, TrCHSc, TrCHSf, TrCHSh, TrBANa, TrLARa, TrLARb and TrLARc proteins in sense and antisense orientation under the control of the CaMV 35S.sup.2 promoter were generated (FIGS. 4, 8, 12, 16, 20, 24, 28 and 32).

(58) TABLE-US-00003 TABLE3 ListofprimersusedtoPCR-amplify theopenreadingframes gene name primer primersequence(5 > 3) TrCHSa3 05wc1RsB06f GAATTCTAGAAGATATGGTGAGTGTA GCTG 05wc1RsB06r GAATTCTAGAATCACACATCTTATAT AGCC TrCHSa3 05wc1RsB06fG GGGGACAAGTTTGTACAAAAAAGCAG GCTTCTAGAAGATATGGTGAGTGTAG CTG 05wc1RsB06rG GGGGACCACTTTGTACAAGAAAGCTG GGTTCTAGAATCACACATCTTATATA GCC TrCHSc 07wc1TsE12f GAATTCTAGAAGAAGAAATATGGGAG ACGAAGG 07wc1TsE12r GAATTCTAGAAAGACTTCATGCACAC AAGTTCC TrCHSf 07wc1UsD07f GAATTCTAGATGATTCATTGTTTGTT TCCATAAC 07wc1UsD07r GAATTCTAGAACATATTCATCTTCCT ATCAC TrCHSh 13wc21sG04f GAATTCTAGATCCAAATTCTCGTACC TCACC 13wc21sG04r GAATTCTAGATAGTTCACATCTCTCG GCAGG TrBANa 05wc2XsG02f GGATCCTCTAGAGCACTAGTGTGTAT AAGTTTCTTGG 05wc2XsG02r GGATCCTCTAGACCCCCTTAGTCTTA AAATACTCG TrLARa 05wc1CsA02fG GGGGACAAGTTTGTACAAAAAAGCAG GCTCTAGAAAGCAAAGCAATGGCACC 05wc1CsA02rG GGGGACCACTTTGTACAAGAAAGCTG GGTCTAGATCCACCTCAGGTGAACC TrLARb 05wc3EsA03fG GGGGACAAGTTTGTACAAAAAAGCAG GCTCTAGAAAGCAATGGCACCAGCAG C 05wc3EsA03rG GGGGACCACTTTGTACAAGAAAGCTG GGTCTAGATCCACCTCAGGTGAACC TrLARc 07wc1VsF06fG GGGGACAAGTTTGTACAAAAAAGCAG GCTCTAGATAAAGCAATGGCACCAGC 07wc1VsF06rG GGGGACCACTTTGTACAAGAAAGCTG GGTCTAGATCCACCTCAGGTGAACC

(59) The pPZP221:35 S.sup.2 binary vector was further modified to contain two expression cassettes within one T-DNA. The expression cassette from the binary vector pWM5 consisting of the ASSU promoter and the tob terminator was PCR-amplified with a proofreading DNA polymerase using oligonucleotide primers with the following sequences:

(60) TABLE-US-00004 forwardprimer 5-CCACCATGTTTGAAATTTATTATGTGTTTT TTTCCG-3; reverseprimer 5-TAATCCCGGGTAAGGGCAGCCCATACAAAT GAAGC-3.

(61) The PCR product was cut with BstXI and SmaI and cloned directionally into the equally cut pPZP221:35 S.sup.2 vector. Additionally, a GATEWAY cloning cassette (Invitrogen) was introduced into the multicloning site in the 35S.sup.2:rbcS expression cassette following the manufacturer's protocol. TrBANa was cloned into the ASSU:tob expression cassette, TrCHSa3 was amplified with the GATEWAY-compatible primers (see Table 3) and cloned into the 35S.sup.2:rbcS expression cassette. A transformation vector containing chimeric genes using full-length open reading frame cDNAs encoding white clover TrBANa protein in sense orientation under the control of the ASSU promoter and TrCHSc3 protein in sense orientation under the control of the CaMV 35S.sup.2 promoter within the same T-DNA was generated (FIG. 33).

EXAMPLE 5

Development of Binary Transformation Vectors Containing Chimeric Genes with a Combination of 2 or More cDNA Sequences from White Clover TrCHSa3, TrCHSc, TrCHSf, TrCHSh, TrBANa, TrLARa, and TrLARc

(62) To alter the expression of the proteins involved in flavonoid biosynthesis, and more specifically condensed tannin biosynthesis to improve herbage quality and bloat-safety, a modular binary transformation vector system was used (FIG. 34). The modular binary vector system enables simultaneous integration of up to seven transgenes the expression of which is controlled by individual promoter and terminator sequences into the plant genome (Goderis et al., 2002).

(63) The modular binary vector system consists of a pPZP200-derived vector (Hajdukiewicz et al., 1994) backbone containing within the T-DNA a number of unique restriction sites recognised by homing endonucleases. The same restriction sites are present in pUC18-based auxiliary vectors flanking standard multicloning sites. Expression cassettes comprising a selectable marker gene sequence or a cDNA sequence to be introduced into the plant under the control of regulatory sequences like promoter and terminator can be constructed in the auxiliary vectors and then transferred to the binary vector backbone utilising the homing endonuclease restriction sites. Up to seven expression cassettes can thus be integrated into a single binary transformation vector. The system is highly flexible and allows for any combination of cDNA sequence to be introduced into the plant with any regulatory sequence.

(64) For example, a selectable marker cassette comprising the nos promoter and nos terminator regulatory sequences controlling the expression of the nptII gene was PCR-amplified using a proofreading DNA polymerase from the binary vector pKYLX71:35 S.sup.2 and directionally cloned into the AgeI and NotI sites of the auxiliary vector pAUX3166. Equally, other selectable marker cassettes can be introduced into any of the auxiliary vectors.

(65) In another example, the expression cassette from the binary vector pWM5 consisting of the ASSU promoter and the tob terminator was PCR-amplified with a proofreading DNA polymerase and directionally cloned into the AgeI and NotI sites of the auxiliary vector pAUX3169. Equally, other expression cassettes can be introduced into any of the auxiliary vectors.

(66) In yet another example, the expression cassette from the direct gene transfer vector pDH51 was cut using EcoRI and cloned directly into the EcoRI site of the auxiliary vector pAUX3132.

(67) TABLE-US-00005 TABLE4 ListofprimersusedtoPCR-amplifyplant selectablemarkercassettesandtheregulatory elementsusedtocontroltheexpressionof TrCHSa3,TrCHSc,TrCHSf,TrCHSh,TrBANa, TrLARa,TrLARbandTrLARcgenes expression cassette primer primersequence(5 > 3) nos::nptll-nos forward ATAATAACCGGTTGATCATGAGC GGAGAATTAAGGG reverse ATAATAGCGGCCGCTAGTAACAT AGATGACACCGCG 35S::aacC1-35S forward AATAGCGGCCGCGATTTAGTACT GGATTTTGG reverse AATAACCGGTACCCACGAAGGAG CATCGTGG 35S.sup.2::rbcS forward ATAATAACCGGTGCCCGGGGATC TCCTTTGCC reverse ATAATAGCGGCCGCATGCATGTT GTCAATCAATTGG assu::tob forward TAATACCGGTAAATTTATTATGR GTTTTTTTCCG reverse TAATGCGGCCGCTAAGGGCAGCC CATACAAATGAAGC

(68) The expression cassettes were further modified by introducing a GATEWAY cloning cassette (Invitrogen) into the multicloning site of the respective pAUX vector following the manufacturer's protocol. In a recombination reaction, the cDNAs encoding the open reading frame sequences were transferred from the entry vector obtained as described in Example 4 to the GATEWAY-enabled pAUX vector. Any combination of the regulatory elements with cDNA sequences of TrCHSa3, TrCHSc, TrCHSf, TrCHSh, TrBANa, TrLARa, TrLARb and TrLARc can be obtained. One typical example is given in FIG. 35 with expression cassettes for the nptII plant selectable marker, TrBANa, TrLARa and TrCHSa3.

(69) Complete expression cassettes comprising any combination of regulatory elements and cDNA sequences to be introduced into the plant were then cut from the auxiliary vectors using the respective homing endonuclease and cloned into the respective restriction site on the binary vector backbone. After verification of the construct by nucleotide sequencing, the binary transformation vector comprising a number of expression cassettes was used to generate transgenic white clover plants.

EXAMPLE 6

Production by Agrobacterium-Mediated Transformation and Analysis of Transgenic White Clover Plants Carrying Chimeric White Clover TrCHSa3, TrCHSc, TrCHSf, TrCHSh, TrBANa, TrLARa, TrLARb and TrLARc Genes Involved in Flavonoid Biosynthesis

(70) A set of binary transformation vectors carrying chimeric white clover genes involved in flavonoid biosynthesis, and more specifically condensed tannin biosynthesis to improve herbage quality and bloat-safety, were produced as detailed in Examples 4 and 5.

(71) Agrobacterium-mediated gene transfer experiments were performed using these transformation vectors.

(72) The production of transgenic white clover plants carrying the white clover TrCHSa3, TrCHSc, TrCHSf, TrCHSh, TrBANa, TrLARa, TrLARb and TrLARc cDNAs, either singly or in combination, is described here in detail.

(73) Preparation of Agrobacterium

(74) Agrobacterium tumefaciens strain AGL-1 transformed with one of the binary vector constructs detailed in Example 6 were streaked on LB medium containing 50 g/ml rifampicin and 50 g/ml kanamycin and grown at 27 C. for 48 hours. A single colony was used to inoculate 5 ml of LB medium containing 50 g/ml rifampicin and 50 g/ml kanamycin and grown over night at 27 C. and 250 rpm on an orbital shaker. The overnight culture was used as an inoculum for 500 ml of LB medium containing 50 g/ml kanamycin only. Incubation was over night at 27 C. and 250 rpm on an orbital shaker in a 2 I Erlenmeyer flask.

(75) Preparation of White Clover Seeds

(76) 1 spoon of seeds (ca. 500) was placed into a 280 m mesh size sieve and washed for 5 min under running tap water, taking care not to wash seeds out of sieve. In a laminar flow hood, seeds were transferred with the spoon into an autoclaved 100 ml plastic culture vessel. A magnetic stirrer (wiped with 70% EtOH) and ca. 30 ml 70% EtOH were added, and the seeds were stirred for 5 min. The EtOH was discarded and replaced by 50 ml 1.5% sodium hypochlorite. The seeds were stirred for an additional 45-60 min on a magnetic stirrer. The sodium hypochlorite was then discarded and the seeds rinsed 3 to 4 times with autoclaved ddH.sub.2O. Finally 30 ml of ddH.sub.2O were added, and seeds incubated over night at 10-15 C. in an incubator.

(77) Agrobacterium-Mediated Transformation of White Clover

(78) The seed coat and endosperm layer of the white clover seeds prepared as above were removed with a pair of 18 G or 21 G needles. The cotyledons were cut from the hypocotyl leaving a ca. 1.5 mm piece of the cotyledon stalk. The cotyledons were transferred to a petridish containing ddH.sub.2O. After finishing the isolation of clover cotyledons, ddH.sub.2O in the petridish was replaced with Agrobacterium suspension (diluted to an OD.sub.600=0.2-0.4). The petridish was sealed with its lid and incubated for 40 min at room temperature.

(79) After the incubation period, each cotyledon was transferred to paper towel using the small dissection needle, dried and plated onto regeneration medium RM73. The plates were incubated at 25 C. with a 16 h light/8 h dark photoperiod. On day 4, the explants were transferred to fresh regeneration medium. Cotyledons transformed with Agrobacterium were transferred to RM73 containing cefotaxime (antibacterial agent) and gentamycin. The dishes were sealed with Parafilm and incubated at 25 C. under a 16/8 h photoperiod. Explants were subcultured every three weeks for a total of nine weeks onto fresh RM 73 containing cefotaxime and gentamycin. Shoots with a green base were then transferred to root-inducing medium RIM. Roots developed after 1-3 weeks, and plantlets were transferred to soil when the roots were well established.

(80) This process is shown in detail in FIG. 36.

(81) Preparation of Genomic DNA for Real-Time PCR and Analysis for the Presence of Transgenes

(82) 3-4 leaves of white clover plants regenerated on selective medium were harvested and freeze-dried. The tissue was homogenised on a Retsch MM300 mixer mill, then centrifuged for 10 min at 1700g to collect cell debris. Genomic DNA was isolated from the supernatant using Wizard Magnetic 96 DNA Plant System kits (Promega) on a Biomek FX (Beckman Coulter). 5 l of the sample (50 l) were then analysed on an agarose gel to check the yield and the quality of the genomic DNA.

(83) Genomic DNA was analysed for the presence of the transgene by real-time PCR using SYBR Green chemistry. PCR primer pairs (Table 4) were designed using MacVector (Accelrys) or PrimerExpress (ABI). The forward primer was located within the 35S.sup.2 promoter region and the reverse primer within the transgene to amplify products of approximately 150-250 bp as recommended. The positioning of the forward primer within the 35S.sup.2 promoter region guaranteed that endogenous genes in white clover were not detected.

(84) TABLE-US-00006 TABLE5 ListofprimersusedforReal-timePCRanalysisofwhite cloverplantstransformedwithchimericwhiteclover genesinvolvedincondensedtanninbiosynthesis construct primer1(forward),5 > 3 primer2(reverse),5 > 3 pPZP221TrCHSa3 CATTTCATTTGGAGAGGACACGC AACACGGTTTGGTGGATTTGC pPZP221TrCHSc TTGGAGAGGACACGCTGAAATC ACAAGTTGGTGAGGGAATGCC pPZP221TrCHSf CATTTCATTTGGAGAGGACACGC TCGTTGCCTTTCCCTGAGTAGG pPZP221TrCHSh TCATTTGGAGAGGACACGCTG CGGTCACCATTTTTTTGTTGGAGG pPZP221TrBANa TTGGAGAGGACACGCTGAAATC CAACAAAACCAGTGCCACC pPZP221TrLARa ATGACGCACAATCCCACTATCC AGCCTTAGAAGAGAGAAGAGGTCC pPZP221TrLARb ATGACGCACAATCCCACTATCC AGCCTTAGAAGAGAGAAGAGGTCC pPZP221TrLARc ATGACGCACAATCCCACTATCC AGCCTTAGAAGAGAGAAGAGGTCC

(85) 5 l of each genomic DNA sample was run in a 50 l PCR reaction including SYBR Green on an ABI 7700 (Applied Biosystems) together with samples containing DNA isolated from wild type white clover plants (negative control), samples containing buffer instead of DNA (buffer control) and samples containing the plasmid used for transformation (positive plasmid control). Cycling conditions used were 2 min. at 50 C., 10 min. at 95 C. and then 40 cycles of 15 sec. at 95 C., 1 min. at 60 C.

(86) Preparation of Genomic DNA and Analysis of DNA for Presence and Copy Number of Transgene by Southern Hybridisation Blotting

(87) Genomic DNA for Southern hybridisation blotting was obtained from leaf material of white clover plants following the CTAB method. Southern hybridisation blotting experiments were performed following standard protocols as described in Sambrook et al. (1989). In brief, genomic DNA samples were digested with appropriate restriction enzymes and the resulting fragments separated on an agarose gel. After transfer to a membrane, a cDNA fragment representing a transgene or selectable marker gene was used to probe the size-fractionated DNA fragments. Hybridisation was performed with either radioactively labelled probes or using the non-radioactive DIG labelling and hybridisation protocol (Boehringer) following the manufacturer's instructions.

(88) Plants were obtained after transformation with all chimeric constructs and selection on medium containing gentamycin. Details of plant analysis are given in Table 5 and FIGS. 37, 38 and 39.

(89) TABLE-US-00007 TABLE 5 Transformation of white clover with binary transformation vectors comprising cDNAs of white clover genes involved in condensed tannin biosyntheses, selection and molecular analysis of regenerated plants. cotyledons selection copy number construct transformed into RIM soil QPCR-positive Southern range pPZP221-35S2::TrCHSa3 2358 135 32 23 n/d pPZP221-35S2::TrCHSc 3460 89 41 27 n/d pPZP221-35S2::TrCHSf 3931 113 44 27 n/d pPZP221-35S2::TrCHSh 3743 79 37 30 n/d pPZP221-35S2::TrBANa 2315 144 50 38 7 1 to 4 pPZP221-35S2::TrLARa 2487 88 45 38 n/d pPZP221-35S2::TrLARb 3591 133 47 47 5 1 to 3 pPZP221-35S2::TrLARc 2835 96 32 29 n/d

REFERENCES

(90) Altschul, S. F., Gish, W., Miller, W., Myers, E. W., Lipman, D. J. (1990) Basic local alignment search tool. J. Mol. Biol. 215, 403-410. Frohman, M. A., Dush, M. K., Martin, G. R. (1988) Rapid production of full-length cDNAs from rare transcripts: amplification using a single gene-specific oligonucleotide primer. Proc. Natl. Acad. Sci. USA 85, 8998. Gish, W., States, D. J. (1993) Identification of protein coding regions by database similarity search. Nature Genetics 3, 266-272. Goderis, I., De Bolle, M. F. C., Francois, I., Wouters, P. F. J., Broekaert, W. F., and Cammue, B. P. A. (2002) A set of modular plant transformation vectors allowing flexible insertion of up to six expression units. Plant Molecular Biology 50, 17-27. Hajdukiewicz P, Svab Z, Maliga P. (1994) The small, versatile pPZP family of Agrobacterium binary vectors for plant transformation. Plant Mol Biol. 25, 989-94. Loh, E. Y., Elliott, J. F., Cwirla, S., Lanier, L. L., Davis, M. M. (1989). Polymerase chain reaction with single-sided specificity: Analysis of T-cell receptor delta chain. Science 243, 217-220. Ohara, O., Dorit, R. L., Gilbert, W. (1989). One-sided polymerase chain reaction: The amplification of cDNA. Proc. Natl. Acad Sci USA 86, 5673-5677 Sambrook, J., Fritsch, E. F., Maniatis, T. (1989). Molecular Cloning. A Laboratory Manual. Cold Spring Harbour Laboratory Press Schardl, C. L., Byrd, A. D., Benzion, G., Altschuler, M. A., Hildebrand, D. F., Hunt, A. G. (1987) Design and construction of a versatile system for the expression of foreign genes in plants. Gene 61, 1-11

(91) Finally, it is to be understood that various alterations, modifications and/or additions may be made without departing from the spirit of the present invention as outlined herein.