Bunyaviruses with segmented glycoprotein precursor genes and methods for generating these viruses

Abstract

The invention relates to a bunyavirus, in which separated (NSm)Gn and Gc coding regions are functionally present on two different genome segments, preferably a bunyavirus that comprises a total of at least 4 genome segments. The invention further relates to methods for producing said bunyavirus, and to a composition comprising said bunyavirus and a suitable excipient.

Claims

1. A bunyavirus of the genus Phlebovirus, in which separated Gn and Gc coding regions, or separated NSmGn and Gc coding regions, are functionally present on two separate genome segments.

2. The bunyavirus of claim 1, comprising a total of 4 genome segments.

3. The bunyavirus according to claim 1, comprising a bunyavirus L genome segment; a bunyavirus S genome segment or part of a S genome segment comprising at least the N gene and the 3 and 5 UTRs; and a bunyavirus M genome segment from which the Gn or Gc coding region, or the NSmGn or Gc coding region, has been functionally inactivated, whereby the Gn or Gc coding region, or the NSmGn or Gc coding region, that is functionally inactivated on the M genome segment is functionally present on a second M genome segment.

4. The bunyavirus according to claim 1, wherein a bunyavirus L genome segment and/or a S genome segment comprises a foreign gene.

5. A bunyavirus according to claim 1, wherein the Gn and/or the Gc coding region, or the NSmGn and/or Gc coding region, is from a bunyavirus that differs from the bunyavirus from which the L and S genome segments were obtained.

6. A bunyavirus according to claim 1, further comprising a nucleocapsid (N) coding region from a bunyavirus that differs from the bunyavirus from which the genome segments and Gn and/or Gc coding region, or the NSmGn and/or Gc coding region, were obtained.

7. A bunyavirus according to claim 1, wherein an NSs coding region on a S genome segment is functionally inactivated.

8. A method for producing a bunyavirus, the method comprising A) providing a eukaryotic cell with growth medium; and B) infecting the eukaryotic cell with the bunyavirus according to claim 1.

9. A composition comprising a bunyavirus according to claim 1, and a suitable excipient.

10. The composition according to claim 9, which is an immunogenic composition.

11. The bunyavirus according to claim 1, for use as a medicament.

12. A vaccine comprising the bunyavirus according to claim 1.

13. A method for generating a bunyavirus of the genus Phlebovirus, the method comprising: A) providing a cell with a bunyavirus of the genus Phlebovirus comprising at least one genome segment functionally encoding a RdRp gene and an N gene, and B) providing the cell with at least two genome segments selected from L, M, and S genome segments in which separated Gn and Gc coding regions, or separated NSmGn and Gc coding regions, are functionally present on two separate genome segments.

14. The method according to claim 13, whereby the cell is provided with a genomic segment by providing the cell with a vector that comprises cDNA of said genomic segment which is flanked by a T7 promoter and cDNA of a ribozyme, further comprising providing the cell with a T7 polymerase.

15. The bunyavirus of claim 1, comprising a total of 3 genome segments.

16. The method according to claim 13, wherein the separated Gn and Gc coding regions are present on two separate minigenome segments, or on a genome segment and a minigenome segment.

17. The composition according to claim 9, for use as a medicament.

18. A vaccine comprising the composition according to claim 9.

Description

FIGURE LEGENDS

(1) FIG. 1. Membrane topology and proteolytic processing of the RVFV glycoprotein precursor. Shown are the translation products starting from the in-frame AUG codons 1,2 and of the open reading frame. The Y symbols indicate the predicted N-linked glycosylation sites. The red Y symbol is known not to be utilized. The 14-kDa, 78-kDa, Gn and Gc proteins are indicated, as well as the predicted transmembrane spanning regions.

(2) FIG. 2. Schematic representations of relevant plasmid sequences of A) pCAGGSNSmGn, B) pCAGGS-Gn, C) pCAGGS-Gc, D) pUC57-S-NSmGn, E) pUC57-S-Gc, F) pUC57-S-de1NSs, G) pUC57-M-NSmGn, H) pUC57-M-Gc, I) pUC57-S-CCHFV-N, J) pUC57-S-NSmGn (non-optimized NSmGn sequence), and K) pUC57-S-Gc (non-optimized Gc sequence). Cartoons were produced using SnapGene software (from GSL Biotech; available at snapgene.com). Sequences in bold indicate start and stop codons whereas underlined sequences represent restriction enzyme sites. Shaded sequences represent untranslated regions. The RVFV sequences in pUC57 plasmids are flanked by a T7 promoter and a ribozyme sequence.

(3) FIG. 3. Replicon particle production by BHK-Rep2 cells. BHK-Rep2 cells stably maintaining the L and S-eGFP genome segments of RVFV were transfected with either pCAGGS-M, co-transfected with pCAGGS-Gn and pCAGGS-Gc, or co-transfected with pCAGGS-NSmGn and pCAGGS-Gc. One day post transfection supernatants were titrated on BHK-21 cells and titers of replicon particle progeny were determined.

(4) FIG. 4. Visualization of RVFV containing two S genome segments. BHK-21 cells were infected with RVFV-SSL and after 2 days Gn and Gc expression was visualized using IPMA.

(5) FIG. 5. Visualization of RVFV containing four genome segments. BSR T7/5 cells were infected with RVFV-SMML-NSs, RVFV-SMML-delNSs or RVFV-SMML-eGFP and after 2 days Gn and Gc expression was visualized using IPMA.

(6) FIG. 6. Growth curves of RVFV-eGFP and RVFV-SMML-eGFP. BSR T7/5 and C6/36 cells were infected with the listed viruses with an moi of 0.001. Supernatants were collected at the indicated time points and titrated on BSR T7/5 cells.

(7) FIG. 7. RVFV-SMML-eGFP-based virus neutralization test. Sera from experimentally infected sheep were analysed for RVFV neutralizing antibodies using a conventional VNT test and a RVFV-SMML-eGFP-based VNT.

(8) FIG. 8. Creation of RVFV replicon particles using a segmented glycoprotein precursor gene. A) Schematic presentation of M-segment encoded proteins and protein processing. The localization of the segmentation site is indicated with an arrow. B) Schematic presentation of the NSR read-out system. BHK-Rep2 cells, stably maintaining replicating RVFV L and SeGFP genome segments were transfected with pCAGGS expression plasmids encoding Gn, (NSm)Gn, Gc or NSmGnGc. C) One day post transfection the titer of NSR progeny was determined in the supernatant. Bars represent means+standard error (SE) of three independent experiments.

(9) FIG. 9. Rescue of RVFV-LMS-split and RVFV-LSS. A) Schematic presentation of the wild-type RVFV genome and the RVFV-LMS-split and RVFV-LSS variants. B) IFA (Gn antigen) of BSR cells infected with RVFV, RVFV-LMS-split or RVFV-LSS 48 h post infection. C) Northern blot analysis of RVFV, RVFV-LMS-split and RVFV-LSS RNA isolated of supernatants of infected cells. Used probes are indicated on the right. D) Growth curve of indicated viruses on BSR cells.

(10) FIG. 10. Rescue of RVFV-4S A) Schematic presentation of the wildtype RVFV genome and of 4 segment variants. B) IFA (Gn antigen) of BSR cells infected with all the variants 48 h post infection. C) Northern blot analysis of RNA isolated from supernatants of RVFV-4S infected cells. Used probes are indicated at the right. D) Growth curve of indicated viruses on BSR cells.

(11) FIG. 11. Localization of Gn and Gc in cells infected with RVFV-4S. BSR cells were infected at MOI 0.1 with RVFV.sub.eGFP or RVFV-LMMS.sub.eGFP. 16 h post infection cells were fixated and Gn and Gc antigen was detected.

(12) FIG. 12. Growth of RVFV variants in insect cells. C6/36 cells and BSR cells were infected with the RVFV variants as indicated at an MOI of 0.01. Supernatants were collected at 4 days post infection and titrated on BSR cells. Bars represent means+SE of three independent experiments.

(13) FIG. 13. Virulence of RVFV-4S. A) Survival curve of mice inoculated with a high or a low dose of RVFV-LMMS.sub.NSs via intraperitoneal route. As a control, mice were challenged with a low dose of authentic RVFV. Virus dissemination in the liver (B) and brain (C) of mice euthanized at different time points was determined by qRT-PCR.

(14) FIG. 14. Vaccination-challenge experiment. A) Survival curve of mice inoculated with culture medium (mock), NSR.sub.Gn, RVFV-LMMS.sub.eGFP or RVFV-LMMS.sub.delNSs. Three weeks post vaccination mice were challenged with a lethal dose of wild-type RVFV. B) RVFV neutralization titers present in sera the day before challenge. Virus dissemination into the liver (C) and brain (D) was determined by qRT-PCR.

(15) FIG. 15. Rectal temperatures of vaccinated (A) and mock-vaccinated (B) lambs before and after challenge with RVFV on day post vaccination (DPV) 21. Rectal body temperatures ( C.) were determined daily. Fever was defined as a body temperature above 40.5 C. (interrupted line). Rectal body temperatures of vaccinated lambs are depicted as averages (n=7) with SD. Rectal body temperatures of mock-vaccinated lambs determined after DPV 23, 24 and 27 are depicted as averages of 6, 5 and 4 measurements, respectively, since a lamb from this group died on each of these days.

(16) FIG. 16. Monitoring of viremia in vaccinated (A) and mock-vaccinated (B) lambs by qRT-PCR. Viral RNA was detected by qRT-PCR in plasma samples obtained at different days post challenge with RVFV.

(17) FIG. 17. Results from virus neutralization tests performed with sera obtained from vaccinated- or mock-vaccinated lambs at different time points after vaccination and challenge infection. Errors bars represent standard deviations. The detection limit of the assay is a VNT titer of 10. The arrow indicates the day of challenge.

EXAMPLES

Example 1

(18) Materials and Methods

(19) Cells and Growth Conditions.

(20) All mammalian cell lines were routinely grown at 37 C. with 5% CO2. BHK cells were grown in Glasgow Minimum Essential Medium (GMEM; Invitrogen, Bleiswijk, The Netherlands) supplemented with 4% tryptose phosphate broth (TPH; Invitrogen), 1% non-essential amino acids (NEAA; Invitrogen), 5-10% fetal bovine serum (FBS; Bodinco, Alkmaar, The Netherlands) and 1% penicillin-streptomycin (Invitrogen). BSR-T7/5 cells, kindly provided by Prof. Dr. K. Conzelmann (Max von Pettenkofer-Institut, Munchen, Germany) and BHK-Rep2 cells (BHK-21 cells constitutively replicating L and S genome segments of RVFV isolate 35/74) were grown in the same medium as used for BHK cells, supplemented with 1 mg/ml geneticin. Cell culture in the BSL-3 laboratory was performed in closed containers and therefore required the use of CO2-independent medium (CIM; Invitrogen). For these experiments, the culture medium was replaced with CIM supplemented with 5% FBS and 1% penicillin-streptomycin. Aedes albopictus (C6/36) mosquito cells [9] were grown in L15 medium (Invitrogen) supplemented with 10% FBS, 1% NEAA, 2% TPH and 1% pencillin-streptomycin at 28 C. without CO2. QM5 cells were grown in QT35 medium (Invitrogen) supplemented with 5% FBS and 1% penicillin-streptomycin.

(21) Viruses

(22) RVFV strain 35/74 was isolated from the liver of a sheep that died during a RVFV outbreak in the Free State province of South Africa in 1974 (Barnard 1979. J S Mr Vet Assoc 50: 155) and was kindly provided by the Agricultural Research Council-Onderstepoort Veterinary Institute (Pretoria, South Africa). The virus was passaged four times in suckling mice by intra-cerebral injection and three times on BHK-21 cells. The virus was routinely grown on BHK-21 cells. Sequences of the L, M, and S genome segments can be found in GenBank under accession numbers JF784386, JF784387, and JF784388 respectively.

(23) A fowlpox virus that expresses T7 polymerase, named fpEFLT7pol [11], from hereafter referred to as FP-T7, was kindly provided by the Institute for Animal Health (IAH, Compton, UK; Britton et al., J Gen Virol. 1996; 77:963-967.). The virus was grown and titrated on QM5 cells.

(24) Titration

(25) Virus titers were determined by serial dilution on cells of interest in 96 wells plates (10.000-40.000 cells/well). Two to five days post infection cytopathologic effect (CPE) was scored or virus growth was visualized using immunoperoxidase monolayer assay (IPMA, see below). Titers were determined as TCID50 as described (Krber., 1931. Arch Exp Path Pharmak 162: 480-483; and Spearman, 19908. Br J Psychol 2: 227-242).

(26) Plasmids

(27) Expression Plasmids

(28) pGAGGS expression plasmids, containing a CMV immediate enhancer/chicken -actin (CAG) promoter (Niwa et al, 1991, Gene 108: 193-199) were used for transient expression of genes of interest (GOI). pCAGGS-M (Kortekaas et al., 2011. J Virol 85: 12622-12630) contains the ORF of the M-segment of RVFV isolate 35/74, starting at the first methionine codon. pCAGGS-NSmGn contains the NSmGn coding region of the M segment of RVFV strain 35/74 without the signal sequence of Gc (FIG. 2A). pCAGGS-Gn contains the Gn coding region of the M-segment of RVFV isolate 35/74 without the signal sequence of Gc (FIG. 2B). pCAGGS-Gc contains the Gc coding region of the M-segment of RVFV isolate 35/74 including its N-terminal signal sequence (FIG. 2C). Plasmids were designed to contain sequences optimized for expression in mammalian cells and Kozak consensus sequences were included to optimize expression.

(29) Transcription Plasmids

(30) RVFV transcription plasmids, pUC57-S, pUC57-M and pUC57-L (Kortekaas et al., 2011. J Virol 85: 12622-12630) encode the complete S, M or L segment of RVFV isolate 35/74, respectively, including the 3 and 5 UTRs. Transcription of the genome segments is controlled by a minimal T7 promoter. Transcription results in antigenomic-sense RNA genome segments. Plasmid pUC57-S-eGFP plasmid (Kortekaas et al., 2011. J Virol 85: 12622-12630) encodes an S segment RNA in which the NSs gene is replaced in its entirety by the gene encoding enhanced green fluorescent protein (eGFP). pUC57-S-NSmGn and pUC57-S-Gc encode the N protein in antigenomic orientation and the NSmGn protein and Gc protein, respectively, in genomic-sense orientation (FIGS. 2D and 2E). NSmGn and Gc-coding sequences were codon optimized for optimal expression in mammalian cells. The non-optimized pUC57-S-NSmGn and pUC57-S-Gc sequences are depicted in FIGS. 2J and 2K, respectively. The pUC57-S-delNSs plasmid encodes an S segment from which the NSs gene is deleted in its entirety (FIG. 2F). The pUC57-M-NSmGn and pUC57-M-Gc plasmids contain the authentic (non-codon optimized) sequences of NSmGn, respectively Gc, in antigenomic-sense orientation (FIGS. 2G and 2H). Kozak consensus sequences were included for optimal expression.

(31) Immunoperoxidase monolayer assay (IPMA) and immunofluorescence assay (IFA). Monolayers of infected cells were fixed in 4% paraformaldehyde in PBS for 30 minutes and subsequently permeabilized with 100% cold methanol. After blocking the cells with 5% horse serum in PBS for 30 min, cells were incubated with primary antibody in blocking solution. Either a Gn-specific monoclonal antibody (mAb, provided by Dr. Connie Schmaljohn, USAMRIID, Keegan et al., 1986. J Virol 58: 263-270), a Gc rabbit polyclonal antibody (De Boer et al., 2012. J Virol 86: 13642-13652), or an N-specific mAb (F1D11; Kindly provided by Dr. Alejandro Brun, CISA-INIA, Spain; Martin-Folgar et al., MAbs. 2010; 2(3):275-284) was used. As secondary antibodies, HRP-conjugated rabbit anti-mouse IgG, goat anti-rabbit IgG (DAKO, Heverlee, Belgium) or a rabbit anti-mouse Texas Red conjugated antibody (DAKO) was used. All antibody incubations were performed for >1 hour at 37 C. and between antibody incubations cells were washed three times with PBS supplemented with 0.05% Tween 80. Antibody binding was visualized using an EVOS fluorescence microscope (Fisher Scientific) and a 3-amino-9-ethylcarbazole (AEC)-based substrate (DAKO).

(32) Virus Rescue

(33) BSR-T7/5 or BHK-21 cells were seeded on day 0 in 6-well plates (100.000-600.000 cells/well) in GMEM supplemented with 5% FBS. On day 1, cells were infected for one to two hours with FP-T7 (moi0.1) in Optimem (Invitrogen) containing 0.2% FBS and were subsequently transfected with 3 g plasmid DNA (600-1000 ng/plasmid) using jetPEI transfection reagents according the manufactures description (Polyplus, Illkirch, France). Four hours post transfection, medium was replaced by complete CIM or GMEM medium. Three to five days post transfection, supernatants were collected and incubated with freshly seeded BSR-T7/5 or BHK-21 cells. Productive infection was visualized with the EVOS fluorescence microscope by detection of GFP expression or by staining RVFV-specific proteins by IPMA or IFA.

(34) Virus Neutralization Test (VNT)

(35) VNTs were performed with the 4S SLMM-eGFP virus expressing eGFP from the S segment. Sera were obtained from lambs that had previously been experimentally infected with the 35/74 isolate. To confirm the presence of RVFV-specific antibodies, the sera were analyzed with a recombinant N (recN) RVFV enzyme-linked immunosorbent assay (ELISA) (BDSL, Irvine, Ayrshire, Scotland, United Kingdom) prior to analysis by VNT. Serum dilutions were prepared in 96-well plates in 50 l complete GMEM supplemented with 5% FBS. Culture medium containing 200 infectious particles in a 50 l volume was added to the serum dilutions and the mixture was incubated for 1.5 h at room temperature. Next, 50 l of CIM growth medium containing 40 000 BHK-21 cells was added to each well. Plates were incubated at 37 C. for 36 to 48 h. Neutralization titers were calculated by the Spearman-Krber method.

(36) Results

(37) The Glycoprotein Precursor (GPC) is not Essential for Bunyavirus Assembly

(38) The requirement for the (NSm)Gn and Gc glycoproteins of RVFV to be expressed from a polyprotein precursor was evaluated. The ORF encoding the GPC was divided into two non-overlapping ORFs encoding NSmGn and Gc, respectively. Specifically, the GPC gene was segmented at the tyrosine (Y)-675 codon, which is predicted to be the first amino acid of the signal sequence of Gc (Suzich et al., 1990. J Virol 64: 1549-1555; Gerrard and Nichol, 2007. Virology 357(2): 124-133).

(39) To evaluate whether the (NSm)Gn and Gc proteins, expressed from dedicated expression plasmids, are able to package RVFV genome segments into infectious replicon particles, we co-transfected BHK-Rep2 cells (Kortekaas et al., 2011. J Virol 85: 12622-12630) with pCAGGS expression vectors encoding either Gn or NSmGn (pCAGGS-Gn or pCAGGS-NSmGn) and a pCAGGS plasmid encoding Gc (pCAGGS-Gc) and evaluated if replicon particles were produced. As a positive control, BHK-Rep2 cells were transfected with a pCAGGS plasmid encoding the complete GPC (pCAGGS-M) which is known to result in the production of replicon particles (Kortekaas et al., 2011. J Virol 85: 12622-12630). The results show that Gn and Gc, when expressed from two different expression plasmids, are able to package RVFV genome segments into infectious replicon particles (FIG. 3). These experiments resulted in average infectious particle titers of 10E4 TCID50/ml. The presence of the NSm coding region increased the yield of infectious particles to 10E6 TCID50/ml (FIG. 2). Although replicon particle yields when produced with pCAGGS-NSmGn and pCAGGS-Gc were approximately 10 times lower compared to the yields resulting from transfection with pCAGGS-M, the results clearly show that segmentation of the GPC ORF into two dedicated ORFs encoding the (NSm)Gn and Gc glycoproteins, respectively, does not abrogate particle assembly or glycoprotein function. From this, it is concluded that co-translational cleavage of the GPC is not essential for the generation of infectious replicon particles.

(40) Rescue of a RVFV that Expresses NSmGn from the S-Segment

(41) After demonstrating that RVFV L- and S genome segments can efficiently be packaged into infectious replicon particles using the pCAGGS-NSmGn and pCAGGS-Gc expression plasmids, we next investigated if virus can be generated expressing the NSmGn gene and Gc gene from separate genome segments. To this end, a transcription plasmid was created that encodes the Gc gene flanked by the M segment untranslated regions (UTRs, pUC57-M-Gc) and a transcription plasmid was created that encodes an S segment in which the NSs gene is substituted for the NSmGn gene (pUC57-S-NSmGn). BHK cells were infected with FP-T7 and transfected with transcription plasmids pUC57-L, pUC57-M-Gc and pUC57-S-NSmGn. Three days post transfection supernatants were collected and used to inoculated fresh BHK-21 cells. Three days later, CPE was observed, indicating the presence of virus. Titration of the virus showed a yield of 10E6 TCID50/ml. The results of this experiment demonstrate that co-translational cleavage of the GPC is not essential for RVFV particle assembly and glycoprotein function.

(42) The virus based on expression of codon optimized NSmGn from the S-segment is referred to as RVFV-LMS-split-opt

(43) Rescue of RVFV Containing Two S-Type Genome Segments

(44) Our finding that the GPC is not essential for RVFV provides opportunities to study RVFV genome packaging. We investigated whether RVFV is able to package more than one genome segment of the same type. A plasmid was created that encodes an S segment in which the NSs gene is replaced with the Gc gene (yielding pUC57-S-Gc). FP-T7-infected BHK-21 cells were transfected with pUC57-L, pUC57-S-NSmGn and pUC57-S-Gc. Three days post transfection supernatants were analyzed for the presence of infectious virus by incubation with BHK-21 cells. Three days post incubation CPE was observed and rescue of virus was visualized with IPMA (FIG. 4). Titration of the virus revealed a yield of 10E6 TCID50/ml. The relatively efficient growth of a RVFV containing two S segments suggests that the virus can easily maintain two S-type genome segments.

(45) The two S-segmented virus based on expression of codon optimized NSmGn and Gc from separate S-segments is referred to as RVFV-LSS-opt.

(46) Rescue of Four Segmented RVFV

(47) To further explore RVFV genome packaging, we evaluated if a virus can be rescued that contains 4 genome segments: one L, one S and two additional segments encoding the structural glycoproteins. We selected the M segment for expression of NSmGn and Gc. To this end, two transcription plasmids were created, pUC57-M-NSmGn and pUC57-M-Gc. BSR T7/5 cells were infected with FP-T7 and transfected with transcription plasmids pUC57-L, pUC57-M-NSmGn, pUC57-M-Gc and either pUC57-S, pUC57-S-eGFP or pUC57-S-delNSs. The pUC57-S-eGFP was used to facilitate detection of virus by fluorescence microscopy. The pUC57-delNSs was created by deleting the complete NSs gene from the pUC57-S plasmid. Three days post transfection, supernatants were collected and used to infect BHK cells. First experiments focused on the rescue of eGFP expressing virus, which was monitored using an EVOS fluorescence microscope. The increase in number of fluorescent cells demonstrated that virus was rescued and passage of the supernatant resulted in a virus titer of 10E7 TCID50/ml. Using similar methods, viruses either lacking or containing the NSs gene were rescued, which both yielded titers of 10E7 TCID50/ml. All three viruses were visualized using IPMA (FIG. 5). The successful rescue of a RVFV using four genome segments, named RVFV-SMML (also referred to as RVFV-LMMS), indicates that RVFV is able to maintain more than three genome segments in the virus population. The successful production of virus using this method can be explained by packaging of all four genome segments into a single virus particle or, alternatively, by co-infection of a single cell with two or more particles.

(48) An interesting feature of the RVFV-SMML-eGFP virus is that the virus is not able to spread among insect cells in contrast to RVFV-eGFP (RVFV-eGFP contains the wildtype M genome segment, the wildtype L genome segment and a S genome segment in which the NSs gene is replaced for the gene encoding eGFP) (FIG. 6). RVFV-SMML-eGFP can thus be considered a non-spreading virus in C6/36 cells. In addition, the RVFV-SMML-eGFP virus grows slower in BSR-T7 cells compared to wild type RVFV-eGFP (FIG. 6). We propose that the RVFV-SMML viruses hold great promise as a vaccine that optimally combines the safety of inactivated vaccines with the efficacy of live vaccines. Compared to the previously developed replicon particles, RVFV-SMML viruses offer the advantage of easy production on a variety of mammalian cell types known to be suitable for RVFV production, as no cell line is required that expresses (NSm)Gn and Gc. To obtain optimal safety, the NSs gene in the S segment of RVFV-SMML viruses is either deleted in its entirety or replaced by the eGFP gene. Finally, it is interesting to note that the NSs gene can also be replaced by a gene of interest from another pathogen, offering possibilities to develop multivalent vaccines or vector vaccines.

(49) Use of the RVFV-SMML-eGFP Virus in a Virus Neutralization Test (VNT)

(50) The expression of eGFP by the RVFV-SMML-eGFP virus allows its use in VNTs. To evaluate whether a VNT based on the RVFV-SMML-eGFP virus is of similar specificity and sensitivity as the conventional VNT using the authentic, virulent RVFV virus or the VNT using replicon particles (Kortekaas et al., 2011. J Virol 85: 12622-12630) a panel of sera obtained from sheep experimentally infected with RVFV was tested. Two days post infection with RVFV-SMML-eGFP, reporter gene expression was used as a readout, while CPE was used as a readout in the conventional VNT. The results show that both tests have similar sensitivity (FIG. 7). After further validation, the RVFV-SMML-eGFP-based VNT could be used as an alternative for the conventional VNT. The major advantage of this novel VNT is that the test can be performed outside biosafety containment facilities. A second advantage is that the results of a RVFV-SMML-eGFP VNT are available after 48 hrs, whereas the conventional VNT, which depends on CPE, takes 5-7 days to completion.

Example 2

(51) Materials and Methods

(52) Cells and Viruses

(53) BHK, BHK-Rep2 (Kortekaas et al., 2011. J Virol 85: 12622-12630), BSR-T7/5 (Buchholz et al., 1999. J Virol 73: 251-259) and C6/36 cells were maintained as described previously (Kortekaas et al., 2011. J Virol 85: 12622-12630). All RVFV variants described in this study contain the RVFV strain 35/74 genetic backbone (Kortekaas et al., 2011. J Virol 85: 12622-12630; Barnard 1979. J South African Vet Assoc 50: 155-157). Viral titers were determined as TCID50/ml using the Spearman-Krber method.

(54) Plasmids

(55) All plasmids are described in Table 1. To transiently express genes of interest, pCAGGS plasmids were used. RVFV genome segments were transcribed from minimal T7 promoters on pUC57 plasmids. All plasmids were constructed using standard cloning techniques and gene synthesis (GenScript, New Jersey, USA). Plasmids containing half of the glycoprotein precursor (GPC) gene, either (NSm)Gn or Gc, were segmented at the tyrosine (Y)-675 codon of NSmGnGc (FIG. 8A), without any nucleotide overlap. (Y)-675 is predicted to be the first amino acid of the signal sequence of Gc (Gerrard and Nichol, 2007. Virology 357: 124-133; Suzich et al., 1990. J Virol 64: 1549-1555).

(56) Production of RVFV Replicon Particles

(57) BHK-Rep2 cells were seeded in 6 wells plates and after overnight incubation transfected with a total of 3 g pCAGGS expression plasmid using JetPEI reagents (Polyplus-transfection SA, Illkirch, France) according the manufacturers' instructions. At 1 day post transfection supernatants were harvested and titrated on BHK cells.

(58) TABLE-US-00001 TABLE 1 Plasmids used in this study Plasmid Type Encodes UTRs Product (nt) Reference pCAGGS-M expression NSmGnGc [*] pCAGGS-NSmGn expression NSmGn this study pCAGGS-Gn expression Gn this study pCAGGS-Gc expression Gc this study puC57-S transcription N.sup.(+) + NSs.sup.() S-type 1691 [*] puC57-S-delNSs transcription N.sup.(+) S-type 922 this study pUC57-S-eGFP transcription N.sup.(+) + eGFP.sup.() S-type 1621 [*] puC57-S-NSmGn transcription N.sup.(+) + NSmGn.sup.() S-type 2934 this study pUC57-S-Gc transcription N.sup.(+) + Gc.sup.() S-type 2484 this study pUC57-M transcription NSmGnGc.sup.(+) M-type 3885 [*] pUC57-M-NSmGn transcription NSmGn.sup.(+) M-type 2319 this study pUC57-M-Gc transcription Gc.sup.(+) M-type 1869 this study puC57-M-N transcription N.sup.(+) M-type 1032 this study pUC57-L transcription polymerase.sup.(+) L-type 6404 [*] (NSm)Gn and Gc are segmented at the tyrosine (Y)-675 codon of NSmGnGc .sup.(+)genomic sence orientation; .sup.()anti-genomic sence orientation All plasmids contain sequences with RVFV strain 35/74 background (Accesssion numbers: JF784388.1, JF784387.1 and JF784386.1) [*] Kortekaas et al., 2011. J Virol 85: 12622-12630
Rescue Experiments

(59) BSR-T7/5 cells were seeded in 6 wells plates (500.000 cells/well) and after overnight incubation, infected for 2 h with a recombinant Fowlpox virus expressing T7 polymerase (FP-T7) (Britton et al., (1996). J Gen Virol 77: 963-967). As an alternative, BSR-T7/5 cells were infected for 2 h with a wildtype Fowlpox virus for rescue of four segmented RVFV. Subsequently, medium was refreshed and cells were transfected with a total of 3 g pUC57 transcription plasmids per well using JetPEI transfection reagents according to the instructions from the manufacturer. Three to five days post transfection, supernatants were collected and used to infect freshly seeded BSR-T7/5 cells. Viral rescue was visualized using immunofluorescence assays (IFA).

(60) Immunofluorescence

(61) Immunofluorescence assays (IFA) were performed as previously described with some modifications (Oreshkova et al., 2013. PloS one 8(10):e77461). Briefly, infected cell monolayers were fixed with 4% (w/v) paraformaldehyde (15 min) and permeabilized with cold methanol (5 min). Blocking (30 min) and antibody incubations (1 h at 37 C.) were subsequently performed in PBS supplemented with 5% horse serum. To detect Gn expression, monoclonal antibody 4-39-cc was used (Keegan and Collett, 1986. J Virol 58: 263-270) in combination with a Texas Red-conjugated secondary antibody (Abcam, Cambridge, UK). To detect Gc expression, a polyclonal antibody (rabbit) was used (de Boer et al., 2012. J Virol 86: 13642-13652), in combination with an alexa fluor 350-conjugated secondary antibody (Life Technologies, Bleiswijk, The Netherlands). Between antibody incubations cells were washed 3 times with washing buffer (PBS, 0.05% v/v Tween-20). Antibody binding was visualized using an AMG EVOS-FL fluorescence microscope.

(62) Northern Blotting

(63) Northern blotting was performed using the DIG Northern starter kit (Roche, Woerden, The Netherlands) in combination with the Northern-Max-Gly kit (Ambion, Austin, Tex.) as previously described (Kortekaas et al., 2011. J Virol 85: 12622-12630). Primers used for the generation of the RNA probes are listed in Table 2. Viral RNA was isolated using Trizol LS (Sigma-Aldrich, Missouri, United States) in combination with the Direct-zol RNA Miniprep kit (Zymo research, California, United States) according the manufactures instructions.

(64) TABLE-US-00002 PrimersusedforNorthernblotprobes Primer Sequence Application JR597 TAATACGACTCACTATAGGGTCAGTGTTTCCTACTTGAAGGAGGCTT (SEQIDNO:30) Polymeraseforward JR598 AAGTCCACACAGGCCCCTTACATT (SEQIDNO:31) Polymerasereverse JR599 TAATACGACTCACTATAGGGGGTCTGCGAAGTGGGGGTTCAAG (SEQIDNO:32) Gnforward(1) JR600 GACAACCAATCCGTGAGGCTCA (SEQIDNO:33) Gnreverse(1) JR601 TAATACGACTCACTATAGGGCGGACAACCAATCCGTGAGGCTCAC (SEQIDNO:34) Gnforward(2) JR602 CGAAGTGGGGGTTCAAGCACTCAAA (SEQIDNO:35) Gnreverse(2) JR603 TAATACGACTCACTATAGGGGTCTCAAGTGAGCTATCGTGCAGGG (SEQIDNO:36) Gcforward(1) JR604 ATTGCATACCCTTTGCCTGGGCT (SEQIDNO:37) Gcreverse(1) JR605 TAATACGACTCACTATAGGGAGACACGGCTGCTCCCACAAAGTC (SEQIDNO:38) Gcforward(2) JR606 CAGTCAGTCAGAAAAGAGGCCCTTAG (SEQIDNO:39) Gcreverse(2) JR607 TAATACGACTCACTATAGGGTCAAGCAGTGGACCGCAATGAGATTG (SEQIDNO:40) Nforward JR608 ATTCACTGCTGCATTCATTGGCTGC (SEQIDNO:41) Nreverse JR609 TAATACGACTCACTATAGGGATTCTATCTCAACATCTGGGATTGGAGGA (SEQIDNO:42) NSsforward JR610 CACCTCCACCAGCAAAGCCTTTTCA (SEQIDNO:43) NSsreverse _T7 polymerase recognition sequence (1) Resulting probe recognizes genomic-sense RNA (in wild-type RVFV virus) (2) Resulting probe recognizes antigenomic-sense RNA (in wild-type RVFV virus)
Animal Experiments
Viral Dissemination RVFV-LMMS.sub.NSs

(65) Nine-week-old female BALB/cAnCrl mice (Charles River Laboratories) were divided in two groups of 16 mice and one group of 10 mice, kept in type III filter top cages under BSL-3 conditions, and allowed to acclimatize for 6 days. At day 0 the two groups of 16 mice were inoculated via intraperitoneal route (1 ml) with either a low (10.sup.E3 TCID.sub.50) or high (5.10.sup.E5 TCID.sub.50) dose of RVFV-LMMS.sub.NSs. As a positive control, the group of 10 mice was infected with a low (10.sup.E3 TCID.sub.50) dose of authentic RVFV strain 35/74. Mice were observed daily and at day 1, 4, 8 and 11 post infection 4 mice were euthanized form the groups infected with RVFV-LMMS.sub.NSs. Viral dissemination in the liver and brain was evaluated by qRT-PCR as described (Kortekaas et al., 2012. Vaccine 30: 3423-3429).

(66) Vaccination-Challenge Experiment

(67) Six-week-old female BALB/cAnCrl mice (Charles River Laboratories) were divided in 4 groups of 10 mice, kept in type III filter top cages under BSL-3 conditions, and allowed to acclimatize for 6 days. At day 0, mice were vaccinated intramuscularly (thigh muscle) with either medium (Mock), NSR-Gn (Oreshkova et al., (2013). PloS one 8(10):e77461), 10.sup.E6 TCID.sub.50), RVFV-LMMS.sub.eGFP 10.sup.E6 TCID.sub.50 or RVFV-LMMS.sub.delNSs in 50 l. Mice were observed daily and three weeks post vaccination mice were challenged intraperitoneally with 10.sup.E3 TCID.sup.50 of RVFV strain 35/74 in 1 ml medium. One day prior challenge, RVFV specific neutralization titers in sera were determined as described (Kortekaas et al., 2011. J Virol 85: 12622-12630) using the 4S virus as antigen. Viral dissemination in the liver and brain was evaluated by qRT-PCR as described (Kortekaas et al., 2012. Vaccine 30: 3423-3429).

(68) Results

(69) Splitting of the RVFV GPC Gene does not Abrogate the Functionality of Gn and Gc

(70) Bunyavirus M segments encode GPCs which are proteolytically cleaved into proteins that function in receptor binding and fusion. To evaluate whether proteolytic processing of the RVFV GPC is a prerequisite for the functionality of Gn and Gc, we constructed expression plasmids encoding either (NSm)Gn or Gc and evaluated their ability to facilitate production of RVFV replicon particles (also referred to as non-spreading RVFV (NSR) (Kortekaas et al., 2011. J Virol 85: 12622-12630). The GPC was split at the tyrosine (Y)-675 codon, because this codon is predicted to be the first amino acid of the signal sequence of Gc (Gerrard and Nichol, 2007. Virology 357: 124-133; Suzich et al., 1990. J Virol 64: 1549-1555) (FIG. 8A). BHK cells, stably maintaining replicating L and S.sub.eGFP genome segments

(71) (BHK-Rep2) cells were co-transfected with pCAGGS-(NSm)Gn and pCAGGS-Gc (FIG. 8B). One day post transfection the level of progeny replicon particles was determined in the supernatant. As a positive control, BHK-Rep2 cells were transfected with pCAGGS-M, which encodes wild-type NSmGnGc (Kortekaas et al., 2011. J Virol 85: 12622-12630). Co-transfection of pCAGGS-Gn and pCAGGS-Gc resulted in average NSR particles of 10.sup.E4 TCID.sub.50/ml, whereas co-transfection of pCAGGS-NSmGn and pCAGGS-Gc resulted in average NSR particle production of 10.sup.E6 TCID.sub.50/ml, nearly reaching the production level of 10.sup.E7 TCID.sub.50/ml, generally obtained after transfection of BHK-Rep2 cells with pCAGGS-M (FIG. 8C). These results show that splitting of the GPC gene does not abrogate Gn and Gc functionality.

(72) Rescue of RVFV with a Segmented GPC Gene

(73) After demonstrating that RVFV L and S genome segments can efficiently be packaged into infectious replicon particles using the NSmGn and Gc expression plasmids, we investigated whether a virus expressing NSmGn and Gc from separate genome segments is viable. Transcription plasmids pUC57-L, pUC57-M-Gc and pUC57-S-NSmGn were used for the rescue of virus with NSmGn expressed form the NSs location of the S-segment and transcription plasmids pUC57-L, pUC57-M-NSmGn and pUC57-S-Gc were used for the rescue of virus with Gc expressed from the NSs location. Virus based on the expression of Gc from the S-segment and NSmGn from the M segment could be rescued, as evidenced by IFA and Northern blot (FIG. 9A-C). The virus, from hereafter referred to as RVFV-LMS-split, was able to grow up to 10.sup.E6 TCID.sub.50/ml in BSR cells (FIG. 9D). The successful rescue of the LMS-split virus indicates that Gn and Gc are fully functional when expressed from separate genome segments.

(74) RVFV is Able to Maintain Two S-Type Genome Segments

(75) The finding that Gn and Gc do not require processing as a GPC protein to produce progeny virus provided new opportunities to study the dynamics of RVFV genome packaging. In a first experiment, we investigated whether RVFV is able to package two S-type genome segments in the absence of an M-type genome segment. Rescue experiments were performed with transcription plasmids pUC57-L, pUC57-S-Gc and pUC57-S-NSmGn. In this situation, both NSmGn and Gc will be expressed from the NSs gene location of an S segment. In several attempts, the presence of infectious double S-segment virus, as evidenced by Northern blot and IFA, could be confirmed (FIG. 9A-C). The virus, from hereon referred to as RVFV-LSS, is able to grow up to titers of 10.sup.E5 TCID.sub.50/ml in BSR cells (FIG. 9D), which is about 10 times lower than observed with RVFV-LMS-split. The ability to rescue RVFV-LSS indicates that RVFV is able to package more than one S-segment into a single virion.

(76) To further investigate RVFV genome packaging, we evaluated whether viruses could be constructed that comprise four instead of three genome segments (RVFV-4S); one L, one S and two M-type segments. Rescue experiments were performed with transcription plasmids pUC57-L, pUC57-S-eGFP, pUC57-M-NSmGn and pUC57-M-Gc. In this situation, the virus contains an authentic L segment, an S segment that encodes N and eGFP and two M-type segments that encode either NSmGn or Gc. In several attempts, as evidenced by Northern blot and IFA (FIG. 10A-C), the rescue of infectious four-segment RVFV was successful. The RVFV-4S eGFP variant, from hereon referred to as RVFV-LMMS.sub.eGFP is able to grow up to 10.sup.E7 TCID.sub.50/ml in BSR cells (FIG. 10D).

(77) In addition to RVFV-LMMS.sub.eGFP, we tried to rescue RVFV-4S viruses with S-segments expressing the N protein and NSs or solely N. Rescue experiments were performed as described for RVFV-LMMS.sub.eGFP, but instead of pUC57-S-eGFP, pUC57-S(encoding N and NSs) and pUC57-S-delNSs were used. Both viruses, hereon after referred to as RVFV-LMMS.sub.NSs and RVFV-LMMS.sub.delNSs were viable and able to grow in BSR cells up to 10.sup.E6 and 10.sup.E7 TCID.sub.50/ml, respectively (FIG. 10A-D).

(78) RVFV is Able to Maintain 4 Genome Segments of which 3 are of the M-Type

(79) The results so far strongly suggest that RVFV genome packaging is relatively flexible. To further study this flexibility, we tried to rescue a four segment virus with three instead of two M-type genome segments. In this situation NSmGn, Gc and also N are all encoded by genome segments with M-type UTRs. Rescue experiments were performed with transcription plasmids pUC57-L, pUC57-M-NSmGn, pUC57-M-Gc and pUC57-M-N. In several attempts, successful rescue of RVFV-LMMM could be confirmed by IFA and Northern blot analysis (FIG. 10A-D) and the virus was able to grow up to 10.sup.E6 TCID.sub.50/ml in BSR cells. The ability to rescue RVFV-LMMM virus emphasizes that RVFV genome packaging, at least in mammalian cells, is highly flexible.

(80) Evidence for the Packaging of 4 Genome Segments into a Single Virion

(81) To produce progeny virions, RVFV-4S should deliver all 4 genome segments into a single host cell. Theoretically, this can be achieved by infection with a single virion containing all four segments or, alternatively, by co-infection of complementing replicon particles, lacking at least one of the genome segments. To evaluate which of the two mechanisms is used by the RVFV-4S virus, we infected BSR cells with RVFV-LMMS.sub.eGFP and evaluated GFP, Gn and Gc expression 16 h post infection using IFA. RVFV.sub.eGFP was used as a reference. As expected, the fast majority (>99%) of RVFV.sub.eGFP virions contain at least one L, one M and one S segment as evidenced by the high percentage of infected cells that expressed eGFP, Gn and Gc (FIG. 11). Infrequently, cells were observed that expressed eGFP in the absence of Gn and Gc. Most likely these cells were infected by two segmented replicons lacking the M-segment.

(82) Comparable to RVFV.sub.eGFP, almost all (>99%) eGFP-expressing cells showed expression of both Gn and Gc after infection with RVFV-LMMS.sub.eGFP. Once again, only a limited number of eGFP positive cells were observed that did not express Gn and Gc (FIG. 10). As expected, there were also some eGFP-positive cells that expressed Gn in the absence of Gc, or Gc in the absence of Gn, indicative for the presence of replicon particles lacking at least one of the four genome segments. These results, together with the observation that RVFV-4S is able to spread at low MOI (data not shown), indicate that RVFV-4S primarily produces progeny by infection with 4 segment virions rather than by infection with complementing replicon particles.

(83) Growth of RVFV with Segmented Glycoprotein Precursor Genes in Insect Cell Culture

(84) In the experiments described thus far, viruses with segmented glycoprotein precursor genes were grown in mammalian cells. Since RVFV is a mosquito-borne pathogen and able to grow efficiently in insect cells, we compared the growth of wildtype and mutant viruses in Aedes albopictus C6/36 insect cell culture. As a positive control, viruses were grown in BSR cells. As expected, authentic RVFV and RVFV.sub.eGFP were able to grow efficiently in the C6/36 cells. In sharp contrast, none of the viruses with a segmented glycoprotein precursor gene were able to spread efficiently in C6/36 cell culture (FIG. 12). This result suggests that RVFV GPC processing and/or genome packaging is less flexible in mosquito cells.

(85) RVFV-4S Comprising all RVFV Genes is Innocuous in Mice

(86) Since the growth of viruses with segmented glycoprotein precursor genes is somewhat impaired in mammalian cells and strongly impaired in insect cells, we hypothesized that these viruses might have reduced virulence. To study the effect of GPC gene segmentation on virulence we evaluated whether a four-segmented containing all RVFV genes, including the major virulence factor NSs (RVFV-LMMS.sub.NSs), is able to cause disease in a mouse model. Mice were infected with either a low (10.sup.E3 TCID.sub.50) or a high (5.10.sup.E5 TCID.sub.50) dose of RVFV-LMMS.sub.NSs and, after different time points, mice were sacrificed for the evaluation of virus dissemination to the organs. As a positive control, one group of mice was infected with a low dose of authentic RVFV. All mice infected with authentic RVFV died within four days post infection, whereas none of the mice infected with RVFV-LMMS.sub.NSs died or showed clinical symptoms, not even when inoculated with the 500-fold higher dose (FIG. 13A). Evaluation of virus dissemination to the livers and brains confirmed that RVFV-LMMS.sub.NSs was unable to spread systemically (FIG. 13B-C). Altogether, these results indicate that RVFV-4S is innocuous in mice.

(87) RVFV-4S Induces a Protective Immune Response in Mice

(88) Since RVFV-4S grows well in cell culture and is innocuous in mice, we considered this virus to be a highly promising vaccine candidate. To investigate whether RVFV-4S is able to induce a protective immune response in mice, we performed a vaccination-challenge experiment. Mice were intramuscularly vaccinated with 10.sup.E6 TCID.sub.50 of RVFV-LMMS.sub.eGFP or RVFV-LMMS.sub.delNSs. As a positive control mice were vaccinated with 10.sup.E6 TCID50 NSR-Gn (Oreshkova et al., (2013) PloS one 8(10):e77461). At three weeks post vaccination mice were challenged with a lethal dose of authentic RVFV. Within 4 days post challenge all mock-vaccinated control mice succumbed to the infection (FIG. 14A). In contrast, mice vaccinated with RVFV-LMMS.sub.eGFP or RVFV-LMMS.sub.delNSs remained healthy during the entire experiment. Analysis of sera and organs of vaccinated animals demonstrated the presence of a neutralizing antibody response (FIG. 14B) and the absence of systemic spread of challenge virus (FIG. 14C-D). Collectively, these results demonstrate that RVFV-4S can be used as a vaccine that optimally combines the safety of an inactivated vaccine with the efficacy of a live vaccine.

Example 3

(89) Materials and Methods

(90) Preparation Vaccine and Challenge Virus

(91) RVFV-LMMS.sub.delNSs was used as vaccine virus and was rescued and produced on BSR cells as described in Example 2. The virus was diluted in BSR growth medium consisting of CO2 independent medium (CIM, Invitrogen) supplemented with 5% fetal bovine serum and 1% penicillin-streptomycin, hereafter referred to as complete CIM medium. The recombinant RVFV strain 35/74 (RVFV rec35/74) was used as challenge virus (Kortekaas et al., 2011. J Virol 85: 12622-12630). Titers were determined as 50% tissue culture infective dose (TCID.sub.50) using the Spearman-Krber algorithm

(92) Vaccination and Challenge of Lambs

(93) Conventional 9-11 week-old lambs were divided into five groups of seven animals. After one week of acclimatization, lambs of groups 1-4 were vaccinated via either the subcutaneous or intramuscular (right thigh) route with a medium dose (MD, 10.sup.5.1 TCID.sub.50) or high-dose (HD, 10.sup.6.1 TCID.sub.50) of RVFV-LMMS.sub.delNSs. Lambs of group 5 were mock-vaccinated. Three weeks post vaccination, all lambs were challenged via the intravenous route (jugular vein) with 10.sup.5 TCID.sub.50 of RVFV rec35/74. Vaccine and challenge viruses were administered in 1 ml complete CIM medium. Prior to challenge, animals were sedated by intramuscular administration of medetomidine (40 g/kg medetomidine hydrochloride, Sedator, Eurovet, The Netherlands). Rectal temperatures were determined daily and serum blood samples were obtained weekly. EDTA blood samples were also obtained weekly. During the first 6 and 11 days post vaccination and challenge, respectively, additional EDTA blood samples were taken daily. At the end of the experiment (three weeks post challenge), or when humane endpoints were reached, animals were euthanized by exsanguination, after being anesthetized with 50 mg/kg sodium pentobarbital (Euthasol, ASTfarma BV, The Netherlands) applied via the intravenous route. Plasma samples were analyzed for the presence of RVFV RNA with quantitative real-time PCR (qRT-PCR) as described previously (Kortekaas et al., 2012. Vaccine 30: 3423-3429). Virus neutralization titers were determined using a RVFV-LMMSeGFP-based virus neutralization test (VNT) as described in Example 1.

(94) Results

(95) Vaccination with RVFV-4S Protects Lambs from Viremia, Fever and Mortality

(96) To evaluate the potential of RVFV-4S as a vaccine for sheep, we performed a vaccination-challenge experiment with lambs. These lambs were offspring from Texel-Swifter ewes and a Suffolk ram. Thirty-five lambs were divided into five groups of seven animals at day-7. At day 0, lambs of groups 1 and 2 were vaccinated subcutaneously with 10.sup.5.1 TCID.sub.50 or 10.sup.6.1 TCID.sub.50 RVFV-LMMS.sub.delNSs. Lambs of group 3 and 4 were vaccinated intramuscularly with 10.sup.5.1 TCID50 or 10.sup.6.1 TCID50 RVFV-LMMS.sub.delNSs. Lambs of group 5 were mock vaccinated and served as a challenge control group. No vaccine virus was detected in plasma samples by qRT-PCR before challenge, indicating that RVFV-LMMS.sub.delNSs is unable to induce viremia and strongly suggesting RVFV-LMMS.sub.delNSs is unable to spread efficiently in vivo. After challenge, mock-vaccinated lambs developed fever (>40.5 C.), starting within 2 days post challenge and lasting on average for four days (FIG. 15B). In the first week post challenge these animals also displayed a high viremia, as evidenced by qRT-PCR (up to 10.sup.10 RNA copies/ml plasma) (FIG. 16B). Two lambs in this control group succumbed to the RVFV infection 3 days after challenge infection and one lamb died 7 days after challenge infection. No fever was observed in any of the vaccinated lambs and no viral RNA or infectious virus could be detected in the plasma samples of the HD and MD intramuscularly and the HD subcutaneously vaccinated lambs (FIGS. 15A and 16A). Only two sheep vaccinated with the medium-dose and via the subcutaneous route displayed very low levels of systemic viral RNA at 4-7 days post challenge. Altogether these results indicate that sterile protection against RVFV challenge in sheep can be achieved by a single (preferably intramuscular) administration of 10.sup.5 TCID.sub.50 RVFV-4S particles.

(97) Intramuscularly Vaccinated Lambs Display Higher Neutralizing Antibody Responses Compared to Subcutaneously Vaccines Lambs

(98) Using a previously developed highly sensitive VNT test (Example 1) sera were evaluated for the presence of RVFV-specific neutralizing antibodies. As expected, neutralizing antibodies were not detected in any of the sera collected on the day of vaccination or in sera of mock-vaccinated animals collected before challenge (FIG. 17). In contrast, high levels of neutralizing antibodies were detected in sera obtained one, two and three weeks post RVFV-4S vaccination (FIG. 17A). Remarkably, average titers of MD subcutaneously vaccinated animals were significantly lower at one and two weeks post vaccination compared to the MD intramuscular vaccinated group. In addition, only the MD subcutaneously vaccinated animals displayed a significant increase in VNT titer after challenge. Collectively, these results demonstrate that RVFV-4S is able to induce a substantial and effective systemic neutralizing immune response in sheep, especially when applied via the intramuscular route.