Multifunctional oral vaccine based on chromosome recombineering

09750793 ยท 2017-09-05

Assignee

Inventors

Cpc classification

International classification

Abstract

A recombineered Salmonella typhi Ty21a, compositions and vaccines comprising such a Ty21a, and a method for recombineering comprising inserting a large antigenic region into a bacterial chromosome for the purpose of making multivalent vaccines to protect against one or more disease agents are described herein.

Claims

1. A Salmonella Typhi Ty21a comprising a Shigella sonnei form 1 O-antigen biosynthetic gene region inserted into the Salmonella Typhi Ty21a chromosome, wherein: a) heterologous Shigella sonnei form 1 O-antigen is stably expressed together with or without homologous Salmonella Typhi O-antigen; b) immune protection is elicited against virulent Shigella sonnei challenge; and c) immune protection is elicited against virulent Salmonella Typhi challenge when heterologous Shigella sonnei form 1 O-antigen is stably expressed together with homologous Salmonella Typhi O-antigen; and d) the region comprises a DNA sequence, wherein the DNA sequence comprises: 1) the DNA sequence as set out in SEQ ID NO:2, or 2) a DNA sequence that shares at least about 90% sequence identity with the DNA sequence set out in SEQ ID NO:2.

2. The Salmonella Typhi Ty21a of claim 1, further comprising an O-antigen biosynthetic gene region from a bacterial strain selected from the group consisting of: Shigella species, Escherichia coli serotypes, Salmonella enterica serovars, Vibrio cholerae serotypes, Enterobacter species, Yersinia species, Plesiomonas species, and Pseudomonas species.

3. A Salmonella Typhi Ty21a comprising a Shigella dysenteriae 1 O-antigen biosynthetic gene region inserted into the Salmonella Typhi Ty21a chromosome, wherein: a) heterologous Shigella dysenteriae serotype 1 O-antigen is stably expressed together with or without homologous Salmonella Typhi O-antigen; b) immune protection is elicited against virulent Shigella dysenteriae challenge; and c) immune protection is elicited against virulent Salmonella Typhi challenge when heterologous Shigella dysenteriae serotype 1 O-antigen is stably expressed together with homologous Salmonella Typhi O-antigen; and d) the region comprises a DNA sequence, wherein the DNA sequence comprises: 1) the DNA sequence as set out in SEQ ID NO:33, or 2) a DNA sequence that shares at least about 90% sequence identity with the DNA sequence set out in SEQ ID NO:33.

4. The Salmonella Typhi Ty21a of claim 3, further comprising an O-antigen biosynthetic gene region from a bacterial strain selected from the group consisting of: Shigella species, Escherichia coli serotypes, Salmonella enterica serovars, Vibrio cholerae serotypes, Enterobacter species, Yersinia species, Plesiomonas species, and Pseudomonas species.

5. A plasmid construct having i) a DNA sequence as set out in SEQ ID NO: 1 or ii) a DNA sequence that shares at least about 90% sequence identity with the DNA sequence set out in SEQ ID NO:1.

6. The plasmid construct of claim 5, further comprising a Shigella sonnei O-antigen biosynthetic gene region or a Shigella dysenteriae 1 O-antigen biosynthetic gene region.

7. A method of recombineering a large antigenic gene region into a bacterial chromosome, comprising: i) cloning the region into a vector containing: ia) a genetically selectable marker flanked 5 and 3 by an FRT site, respectively; ib) a multiple cloning site downstream of the 3 FRT site; and ic) two sites of chromosome homology, one of the two located upstream of the 5 FRT site, and one of the two located downstream of the multiple cloning site; ii) integrating the region into the bacterial chromosome using X, red recombination; iii) selecting for the genetically selectable marker; and iv) removing the selectable marker, thus recombineering the large antigenic gene region into the chromosome.

8. The method of claim 7, wherein the large antigenic gene region is about 5 to about 20 kb long.

9. The method of claim 7, wherein the vector is selected from the group consisting of a plasmid, phage, phasmid, and cosmid construct.

10. The method of claim 9, wherein the plasmid construct has i) a DNA sequence as set out in SEQ ID NO: 1 or ii) a DNA sequence that shares at least about 90% sequence identity with the DNA sequence set out in SEQ ID NO:1.

11. The method of claim 7, wherein the bacterial chromosome is from Salmonella Typhi Ty21a.

12. The method of claim 7, wherein the genetically selectable marker is an antibiotic resistance marker.

13. The method of claim 12, wherein the antibiotic resistance marker is kanamycin.

14. The method of claim 7, wherein the large antigenic gene region is selected from the group consisting of a Shigella sonnei O-antigen biosynthetic gene region, a Shigella dysenteriae 1 O-antigen biosynthetic gene region, a Shigella flexneri 2a 0-antigen biosynthetic gene region, and a Shigella flexneri 3a O-antigen biosynthetic gene region.

15. The method of claim 7, wherein the large antigenic gene region is engineered between the two sites of chromosome homology, each site comprising between about 500 to about 1000 bp regions of bacterial chromosome homology before step ii.

16. The method of claim 13, wherein the kanamycin resistance gene is removed via recombination induced following transformation of chromosomal integrants of step ii with pCP20.

17. A vaccine comprising a pharmaceutically acceptable solid carrier and Salmonella Typhi Ty21a comprising a Shigella flexneri 2a O-antigen biosynthetic gene region inserted into the Salmonella Typhi Ty21a chromosome, wherein: a) heterologous Shigella flexneri 2a O-antigen is stably expressed together with or without homologous Salmonella Typhi O-antigen; b) immune protection is elicited against virulent Shigella flexneri 2a challenge; and c) immune protection is elicited against virulent Salmonella Typhi challenge when heterologous Shigella flexneri 2a O-antigen is stably expressed together with homologous Salmonella Typhi O-antigen.

18. A vaccine comprising a pharmaceutically acceptable solid carrier and Salmonella Typhi Ty21a comprising a Shigella flexneri 3a O-antigen biosynthetic gene region inserted into the Salmonella Typhi Ty21a chromosome, wherein: a) heterologous Shigella flexneri 3a O-antigen is stably expressed together with or without homologous Salmonella Typhi O-antigen; b) immune protection is elicited against virulent Shigella flexneri 3a challenge; and c) immune protection is elicited against virulent Salmonella Typhi challenge when heterologous Shigella flexneri 3a O-antigen is stably expressed together with homologous Salmonella Typhi O-antigen.

19. A vaccine comprising the Salmonella Typhi Ty21a of claim 1 in combination with a physiologically acceptable carrier.

20. A method of treating at least one bacterial infection comprising administering a prophylactically or therapeutically effective amount of the Salmonella Typhi Ty21a of claim 1 to a subject, thus treating the at least one bacterial infection.

21. The Salmonella Typhi Ty21a of claim 1, wherein the Shigella sonnei form 1 O-antigen biosynthetic gene region is partially or wholly chemically synthesized.

22. The plasmid construct of claim 5, wherein the DNA sequence is partially or wholly chemically synthesized.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) The following Detailed Description, given by way of Examples, but not intended to limit the invention to specific embodiments described, may be understood in conjunction with the accompanying figures, in which:

(2) FIG. 1 provides a schematic representation of the cloning and chromosomal integration of S. sonnei form I LPS biosynthetic genes. Panel A shows the ORFs involved in form 1 O-antigen biosynthesis and adjacent IS elements from the cloned insert of pXK65, reported previously (Xu, et al. (2002) Infect and immunity 70:4414-4423). In Panel B, the latter part of wzz (orf3), containing the promoter of the O-antigen operon, through wzy(orf7) was PCR-amplified as fragment A and cloned into HindIII and BamHI sites of pMD-TV (SEQ ID NO:1). Next, the genes wbgV (orf9) through apqZ (orf14) were PCR-amplified as fragment B and cloned into the BamHI and XhoI sites adjacent to fragment A. In Panel C, the resulting plasmid pMD-TV-Ss-1, was used as a template to PCR-amplify tviD through vexA using forward (F) and reverse (R) primers. In Panel D, the PCR product was integrated into the tviD-tviE-vexA region of the Ty21a chromosome by red-mediated recombination. Finally, in Panel E, the Kan.sup.r cassette was removed following temporary introduction of the temperature-sensitive plasmid pCP20 by expression of FLP recombinase, generating the final antibiotic-sensitive, chromosomal integrant Ty21a-Ss (strain MD77).

(3) FIG. 2 shows the results of analyses of SDS-PAGE-separated polysaccharide isolated from various Shigella sonnei, E. coli, and Ty21a isolates by, in Panel A, silver staining and in Panel B, Western immunoblotting with form 1-specific antibody.

(4) FIG. 3 shows bar graphs depicting mouse serum IgG responses, measured by ELISA, to S. sonnei LPS (FIG. 3A) and Ty21a LPS (FIG. 3B) after intraperitoneal immunization of mice with PBS, Ty21a, or vaccine strain Ty21a-Ss simultaneously expressing both Ty21a LPS and S. sonnei LPS. ELISA plates were coated with S. sonnei LPS or Ty21a LPS and blocked with 1% BSA. Serial dilutions of serum collected from vaccinated mice were added to the microtiter wells, washed, and LPS-bound IgG antibodies were detected using anti-mouse IgG-HPR. End point titers for the three groups of mice that received PBS, Ty21a, or Ty21a-Ss are shown following 1, 2, or 3 vaccine doses. Each symbol represents a single mouse, and bars represent the meanSEM of each group of 10 mice.

(5) FIG. 4 shows a schematic diagram depicting S. dysenteriae biosynthetic genes integrated into Vi capsule operon of Ty21a vaccine strain.

(6) FIG. 5 provides a schematic representation of the cloning and chromosomal integration of S. dysenteriae O-antigen genes. The figure shows how the lpp promoter was inserted to replace the native promoter.

(7) FIG. 6 shows S. dysenteriae O-antigen expression as determined via Western blotting.

(8) FIG. 7 shows mouse immunogenicity determined by ELISA. FIG. 7A quantifies the IgG elicited against S. dysenteriae LPS. FIG. 7B quantifies the IgG elicited against S. Typhi 9,12 LPS.

(9) FIG. 8 shows a plot of data for immunized mice challenged IP with S. dysenteriae 1 at a dose of approximately 10LD.sub.50.

(10) FIG. 9 shows the chemical composition of the different serotypes of Shigella flexneri (modified from Allison, et al. 2000 Trends in Microbiol 8:17-23).

(11) FIG. 10 shows Silver stain (FIG. 10A) and Western blot (FIGS. 10B and 10C) with anti-2a (FIG. 10B) and anti-3a (FIG. 10C) antibodies.

(12) FIG. 11 is a schematic representation of S. flexneri basic O-antigen backbone, serotype Y, and the genes involved in the biosynthesis of this O-antigen backbone are located in the rfb operon (10 kb) were cloned into pMD-TV plasmid.

(13) FIG. 12 shows a Western blot with anti-S. flexneri 3a antibody.

(14) FIG. 13 shows a Western blot with anti-S. flexneri 2a antibody.

(15) FIG. 14 provides schematic representations of Ty21a-Y (MD114), Ty21a-2a (MD194), Ty21a-2al (MD212), and Ty21a-3a (MD196).

DETAILED DESCRIPTION

(16) In an effort to elucidate a method to insert the large >10 kb S. sonnei LPS gene region into the chromosome that would allow for removal of a selectable marker and would result in 100% genetic stability, an existing recombination method was optimized to mediate the insertion of a >11 kb region encoding the S. sonnei LPS genes into the Ty21a genome in a region that does affect normal cell metabolism. This chromosomal insert was shown to be 100% genetically stable. Further testing demonstrated that the resulting strain Ty21a-Ss simultaneously expresses both homologous Ty21a and heterologous S. sonnei O-antigens. Moreover, Ty21a-Ss elicited a strong dual anti-LPS serum immune response and 100% protection in mice against a virulent S. sonnei challenge. This new vaccine candidate, absolutely stable for vaccine manufacture, should provide combined protection against enteric fevers due to Salmonella serovar Typhi (and some Paratyphi infections) and against shigellosis due to S. sonnei.

Definitions

(17) The terms O-Ps (O polysaccharide) biosynthesis and O-antigen biosynthetic genes are used interchangeably herein. The O-antigen is a polysaccharide that can be expressed as a core-linked lipopolysaccharide (LPS) or as a group 4 capsule where the O-antigen is expressed at the cell surface but linked to a lipid other than lipid A-core oligosaccharide.

(18) The terms vector and vehicle are used interchangeably in reference to nucleic acid molecules that transfer DNA segment(s) from one cell to another. The term expression vector as used herein refers to a recombinant DNA molecule containing a desired coding sequence and appropriate nucleic acid sequences necessary for the expression (i.e., transcription and/or translation) of an operably linked coding sequence in a particular host organism. Expression vectors are exemplified by, but not limited to, plasmids, plasmid constructs, plasmids, phagemids, shuttle vectors, cosmids, viral vectors, the chromosome, mitochondrial DNA, plastid DNA, and nucleic acid fragments, that may be used for expression of a desired sequence in a cell, such as a human cell, avian cell, a fungal cell, a protozoan cell, and/or insect cell. Nucleic acid sequences used for expression in prokaryotes include a promoter, optionally an operator sequence, a ribosome-binding site and possibly other sequences. Eukaryotic cells are known to utilize promoters, enhancers, and termination and polyadenylation signals. Flippase Recognition Target (FRT) sites and multiple cloning sites (MCS), also called polylinkers, are also utilized. A MCS is a short DNA segment containing many (up to about 20) restriction sites that are typically unique, occurring only once within a given plasmid.

(19) The term transformation as used herein, refers to any mechanism by which a DNA molecule (i.e., plasmid or PCR amplicon) may be incorporated into a host cell. A successful transformation results in the capability of the host cell to express any operative genes carried by the plasmid or incorporated into the chromosome. Transformations may result in genetically stable or transient gene expression. One example of a transient transformation comprises a plasmid vector within a cell, wherein the plasmid is not integrated into the host cell chromosome and is segregated from cells during cell division. Alternatively, a stable transformation comprises a plasmid within a cell, wherein the plasmid is integrated within the host cell genome or exists stably in the cytoplasm after many cell divisions.

(20) The terms subject, patient, and individual, as used herein, interchangeably refer to a multicellular animal (including mammals (e.g., humans, non-Human primates, murines, ovines, bovines, ruminants, lagomorphs, porcines, caprines, equines, canines, felines, ayes, etc.), avians (e.g., chicken), amphibians (e.g. Xenopus), reptiles, and insects (e.g. Drosophila). Animal includes guinea pig, hamster, ferret, chinchilla, mouse and cotton rat.

(21) As is well known in this art, amino acid or nucleic acid sequences may be compared using any of a variety of algorithms, including those available in commercial computer programs such as BLASTN for nucleotide sequences and BLASTP, gapped BLAST, and PSI-BLAST for amino acid sequences. Exemplary such programs are described in Altschul et al. (1990) J. Mol. Biol., 215:403-410; Altschul, et al., Methods in Enzymology; Altschul et al. (1997) Nucleic Acids Res., 25:3389-3402; Baxevanis, et al., Bioinformatics: A Practical Guide to the Analysis of Genes and Proteins, Wiley, 1998; and Misener, et al., (eds.), Bioinformatics Methods and Protocols (Methods in Molecular Biology, Vol. 132), Humana Press, 1999; all of which are incorporated herein by reference. In addition to identifying homologous sequences, the programs mentioned above typically provide an indication of the degree of homology.

(22) The phrases homology or substantial homology, as used herein, refers to a comparison between amino acid sequences. As will be appreciated by those of ordinary skill in the art, two sequences are generally considered to be substantially homologous if they contain homologous residues in corresponding positions. Homologous residues may be identical residues. Alternatively, homologous residues may be non-identical residues with appropriately similar structural and/or functional characteristics. For example, as is well known by those of ordinary skill in the art, certain amino acids are typically classified as hydrophobic or hydrophilic amino acids, and/or as having polar or non-polar side chains. Substitution of one amino acid for another of the same type may often be considered a homologous substitution.

(23) In some embodiments, two sequences are considered to be substantially homologous if at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more of their corresponding residues are homologous over a relevant stretch of residues. In some embodiments, the relevant stretch is a complete sequence. In some embodiments, the relevant stretch is at least 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500 or more residues.

(24) The phrases identity or substantial identity, as used herein, refer to a comparison between amino acid or nucleic acid sequences. As will be appreciated by those of ordinary skill in the art, two sequences are generally considered to be substantially identical if they contain identical residues in corresponding positions. Indeed, identity refers to the overall relatedness between polymeric molecules, e.g., between nucleic acid molecules (e.g., DNA molecules and/or RNA molecules) and/or between polypeptide molecules. Calculation of the percent identity of two nucleic acid sequences can, for example, be performed by aligning the two sequences for optimal comparison purposes (e.g., gaps can be introduced in stretches of one or both of a first and a second nucleic acid sequence for optimal alignment and non-identical sequences can be disregarded for comparison purposes). In certain embodiments, the length of a sequence aligned for comparison purposes is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or substantially 100% of the length of the reference sequence. The nucleotides at corresponding nucleotide positions are then compared. When a position in the first sequence is occupied by the same nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which needs to be introduced for optimal alignment of the two sequences. The comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm.

(25) In some embodiments, two sequences are considered to be substantially identical if at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more of their corresponding residues are identical over a relevant stretch of residues. In some embodiments, the relevant stretch is a complete sequence. In some embodiments, the relevant stretch is at least 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500 or more residues.

(26) Reference herein to any numerical range (for example, a dosage range) expressly includes each numerical value (including fractional numbers and whole numbers) encompassed by that range. For example, but without limitation, reference herein to a range of 210.sup.9 to 510.sup.10 CFU (colony-forming units) includes all whole numbers of and fractional numbers between the two. In a further illustration, reference herein to a range of less than x (wherein x is a specific number) includes whole numbers x1, x2, x3, x4, x5, x6, etc., and fractional numbers x0.1, x0.2, x0.3, x0.4, x0.5, x0.6, etc. In yet another illustration, reference herein to a range of from x to y (wherein x is a specific number, and y is a specific number) includes each whole number of x, x+1, x+2 . . . to y2, y1, y, as well as each fractional number, such as x+0.1, x+0.2, x+0.3 . . . to y0.2, y0.1. In another example, the term at least 95% includes each numerical value (including fractional numbers and whole numbers) from 95% to 100%, including, for example, 95%, 96%, 97%, 98%, 99% and 100%.

(27) The terms antigen, immunogen, antigenic, immunogenic, antigenically active, immunologic, and immunologically active, as used herein, refer to any substance that is capable of inducing a specific immune response (including eliciting a soluble antibody response) and/or cell-mediated immune response (including eliciting a cytotoxic T-lymphocyte (CTL) response).

(28) An individual referred to as suffering from a disease, disorder, and/or condition (e.g., influenza or typhoid fever infection) herein has been diagnosed with and/or displays one or more symptoms of a disease, disorder, and/or condition.

(29) As used herein, the term at risk for disease (such as bacterial infection), refers to a subject (e.g., a human) that is predisposed to contracting the disease and/or expressing one or more symptoms of the disease. Such subjects include those at risk for failing to elicit an immunogenic response to a vaccine against the disease. This predisposition may be genetic (e.g., a particular genetic tendency to expressing one or more symptoms of the disease, such as heritable disorders, the presence of bacterial species blocking antibodies, the presence of reduced levels of bactericidal antibodies, etc.), or due to other factors (e.g., immune suppressive conditions, environmental conditions, exposures to detrimental compounds, including immunogens, present in the environment, etc.). The term subject at risk includes subjects suffering from disease, i.e., a subject that is experiencing the disease. It is not intended that the present invention be limited to any particular signs or symptoms. Thus, it is intended that the present invention encompasses subjects that are experiencing any range of disease, from sub-clinical infection to full-blown disease, wherein the subject exhibits at least one of the indicia (e.g., signs and symptoms) associated with the disease.

(30) The terms treat, treatment, or treating, as used herein, refer to any method used to partially or completely alleviate, ameliorate, relieve, inhibit, prevent, delay onset of, reduce severity of and/or reduce incidence of one or more symptoms or features of a disease, disorder, and/or condition (e.g., bacterial infection). Treatment may be administered to a subject who does not exhibit signs of a disease, disorder, and/or condition. In some embodiments, treatment may be administered to a subject who exhibits only early signs of the disease, disorder, and/or condition for the purpose of decreasing the risk of developing pathology associated with the disease, disorder, and/or condition.

(31) As used herein, the terms immunogenically effective amount, immunologically effective amount, and antigenically effective amount refer to that amount of a molecule that elicits and/or increases production of an immune response (including production of specific antibodies and/or induction of a TCL response) in a host upon vaccination. It is preferred, though not required, that the immunologically-effective (i.e., immunogenically effective) amount is a protective amount. The terms protective and therapeutic amount of a composition or vaccine refer to an amount of the composition or vaccine that prevents, delays, reduces, palliates, ameliorates, stabilizes, and/or reverses disease (for example, bacterial infection) and/or one or more symptoms of disease.

(32) As used herein, the term vaccination refers to the administration of a composition or vaccine intended to generate an immune response, for example, to a disease-causing agent. For the purposes of the present invention, vaccination can be administered before, during, and/or after exposure to a disease-causing agent, and, in certain embodiments, before, during, and/or shortly after exposure to the agent. In some embodiments, vaccination includes multiple administrations, appropriately spaced in time, of a vaccinating composition (vaccine).

(33) The terms comprises, comprising, are intended to have the broad meaning ascribed to them in US Patent Law and can mean includes, including and the like.

(34) The invention can be understood more fully by reference to the following detailed description and illustrative examples, which are intended to exemplify non-limiting embodiments of the invention.

Additional Embodiments of the Invention

(35) In one embodiment, the invention comprises a prokaryotic microorganism. In another embodiment, the prokaryotic microorganism is a bacterial species. Preferably, the prokaryotic microorganism is an attenuated strain of Salmonella. However, other prokaryotic microorganisms, such as attenuated strains of Escherichia coli, Shigella, Yersinia, Lactobacillus, Mycobacteria, Listeria or Vibrio are likewise contemplated for the invention. Examples of suitable strains of microorganisms include, but are not limited to, Salmonella typhimurium, Salmonella Typhi, Salmonella dublin, Salmonella enteritidis, Escherichia coli, Shigella flexneri, Shigella sonnei, Vibrio cholerae (Yamamoto, et al. (2009) Gene 438:57-64), Pseudomonas aeruginosa (Lesic, et al. (2008) BMC Mol Biol 9:20), Yersinia pestis (Sun, et al. (2008) Applied and Env Microbiol 74:4241-4245), and Mycobacterium bovis (BCG). Of note, lambda red does not work in mycobacteria, but another phage (for example, Che9c gp61) has been used for recombineering in mycobacteria (van Kessel, et al. (2008) Methods mol biol 435:203-215).

(36) In one preferred embodiment the prokaryotic microorganism is Salmonella typhi Ty21a. VIVOTIF Typhoid Vaccine Live Oral Ty21a is a live attenuated vaccine intended for oral administration. The vaccine contains the attenuated strain Salmonella Typhi Ty21a. (Germanier et al. (1975) J. Infect. Dis., 131:553-558). It is manufactured by Bema Biotech Ltd. Berne, Switzerland. Salmonella Typhi Ty21a is also described in U.S. Pat. No. 3,856,935.

(37) The attenuated strain of the prokaryotic microorganism undergoes recombineering, such that a large antigenic region is integrated into the chromosome of the microorganism. In one embodiment, the large antigenic region is a Shigella sonnei O-antigen biosynthetic gene region, and the prokaryotic organism is a Salmonella Typhi Ty21a.

(38) In a further aspect, the present invention provides a composition comprising one or more of above attenuated prokaryotic microorganisms, optionally in combination with a pharmaceutically or physiologically acceptable carrier. Preferably, the composition is a vaccine, especially a vaccine for mucosal immunization, e.g., for administration via the oral, rectal, nasal, vaginal or genital routes. Advantageously, for prophylactic vaccination, the composition comprises one or more strains of Salmonella expressing a plurality of different O-Ps genes or of different protein antigens (e.g. anthrax protective antigen or malaria parasite surface proteins).

(39) In a further aspect, the present invention provides an attenuated strain of a prokaryotic microorganism described above for use as a medicament, especially as a vaccine.

(40) In a further aspect, the present invention provides the use of an attenuated strain of a prokaryotic microorganism comprising an O-antigen biosynthetic gene region inserted into a chromosome of the prokaryotic microorganism, wherein the O antigens are produced in the microorganism, in the preparation of a medicament for the prophylactic or therapeutic treatment of one or several different types of bacterial infection (e.g. typhoid fever and dysentery).

(41) Generally, the microorganisms expressing O-Ps according to the present invention are provided in an isolated and/or purified form, i.e., substantially pure. This may include being in a composition where it represents at least about 90% active ingredient, more preferably at least about 95%, more preferably at least about 98%. Such a composition may, however, include inert carrier materials or other pharmaceutically and physiologically acceptable excipients. A composition according to the present invention may include in addition to the microorganisms expressing O-Ps as disclosed, one or more other active ingredients for therapeutic or prophylactic use (e.g. other antigens) and an adjuvant.

(42) The compositions of the present invention are preferably given to an individual in a prophylactically effective amount or a therapeutically effective amount (as the case may be, although prophylaxis may be considered therapy), this being sufficient to show benefit to the individual. The actual amount administered, and rate and time-course of administration, will depend on the nature and severity of who/what is being treated. Prescription of treatment, e.g., final decisions on acceptable dosage etc., will be dictated by Vaccine Regulatory Authorities, after review of safety and efficacy data following human immunizations.

(43) A composition may be administered alone or in combination with other treatments, either simultaneously or sequentially dependent upon the condition to be treated.

(44) Pharmaceutical compositions according to the present invention, and for use in accordance with the present invention, may include, in addition to active ingredient, a pharmaceutically or physiologically acceptable excipient, carrier, buffer, stabilizer or other materials well known to those skilled in the art. Such materials should be non-toxic and should not interfere with the efficacy of the active ingredient. The precise nature of the carrier or other material will depend on the route of administration.

(45) Examples of techniques and protocols mentioned above can be found in Remington's Pharmaceutical Sciences, 16th edition, Osol, A. (Ed.), 1980.

(46) The invention further relates to the identification and sequencing of 9 ORFs in the rfb locus (GENBANK accession number: AY585348; SEQ ID NO:3) and an ORF in the rfp locus (GENBANK accession number: AY763519; SEQ ID NO:4) for S. dysenteriae 1 LPS. These genes may be present in whole or in part in the vaccine strains described herein.

(47) Accordingly, the present invention relates to vaccine strains further characterized by the presence of heterologous genes or a set of heterologous genes coding for O-Ps.

(48) In a preferred embodiment of the vaccine strains, the heterologous gene(s) is (are) stably integrated into the chromosome of said strain at a defined integration site which is to be nonessential for growth, for inducing a protective immune response by the carrier strain.

(49) In one embodiment, the heterologous genes of the invention include all 9 ORFs from the rfb locus and the ORF from rfp. In another embodiment, the ninth ORF from rfb is not present, because it is not essential for O-Ps biosynthesis. The ORFs may, in one embodiment, be separated by an insertion sequence element. The latter is the case for S. sonnei only.

(50) The ORFs may be under the control of the cognate promoter or other non-cognate promoters. The essential O-antigen biosynthetic genes may be physically together in one operon or separated on the chromosome and present on separate DNA regions under the control of different promoters. The genes may vary in gene order when placed next to one another, as long as they are biologically functional.

(51) Alternatively, the above vaccine strains contain the rfbB, rfbC, and rfbA and/or any additional gene(s) necessary for the synthesis of complete core-linked O-antigen LPS which are integrated in tandem into a single chromosomal site or located at separate chromosomal sites.

(52) Such vaccine strains allow expression of heterologous O-Ps, which is covalently coupled to a heterologous LPS core region, which, preferably, exhibits a degree of polymerization similar to that of native LPS produced by the enteric pathogen. Such vaccine strains can, if desired, be modified in such a way that they are deficient in the synthesis of homologous LPS core.

(53) The invention also relates to a live vaccine comprising the above vaccine strain and optionally a pharmaceutically or physiologically acceptable carrier and/or a buffer for neutralizing gastric acidity and/or a system for delivering said vaccine in a viable state to the intestinal tract.

(54) Said vaccine comprises an immunoprotective or immunotherapeutic and non-toxic amount of said vaccine strain. Suitable dosage amounts can be determined by the person skilled in the art and are typically 10.sup.7 to 10.sup.10 bacteria.

(55) Pharmaceutically and physiologically acceptable carriers, suitable neutralizing buffers, and suitable delivering systems can be selected by the person skilled in the art.

(56) In a preferred embodiment said live vaccine is used for immunization against gram-negative enteric pathogens.

(57) The mode of administration of the vaccines of the present invention may be any suitable route which delivers an immunoprotective or immunotherapeutic amount of the vaccine to the subject. However, the vaccine is preferably administered orally or intranasally.

(58) The invention also relates to the use of the above vaccine strains for the preparation of a live vaccine for immunization against gram-negative enteric pathogens. For such use the vaccine strains are combined with the carriers, buffers and/or delivery systems described above.

(59) The invention also provides polypeptides and corresponding polynucleotides required for synthesis of core linked O-specific polysaccharide. The invention includes both naturally occurring and unnaturally occurring polynucleotides and polypeptide products thereof. Naturally occurring O-antigen biosynthesis products include distinct gene and polypeptide species as well as corresponding species homologs expressed in organisms other than Shigella or Salmonella strains. Non-naturally occurring O-antigen biosynthesis products include variants of the naturally occurring products such as analogs and O-antigen biosynthesis products, which include covalent modifications. The sequences of the O-antigen biosynthesis polynucleotides include SEQ ID NOs:3-4 (DNA including Shigella dysenteriae serotype 1 polypeptides), which are disclosed in U.S. Pat. No. 8,071,113.

(60) Purified and isolated Shigella sonnei polynucleotides (e.g., DNA sequences and RNA transcripts, both sense and complementary antisense strands) encode the bacterial O-antigen biosynthesis gene products. Certain DNA sequences, including genomic and cDNA sequences as well as wholly or partially chemically synthesized DNA sequences, are described in U.S. Pat. No. 8,071,113. Genomic DNA comprises the protein coding region for a polypeptide of the invention and includes variants that may be found in other bacterial strains of the same species. Synthesized, as used herein and is understood in the art, refers to purely chemical, as opposed to enzymatic, methods for producing polynucleotides. Wholly synthesized DNA sequences are therefore produced entirely by chemical means, and partially synthesized DNAs embrace those wherein only portions of the resulting DNA were produced by chemical means. Preferred DNA sequences encoding Shigella sonnei O-antigen biosynthesis gene products are set out in SEQ ID NO:2, and species homologs thereof. Preferred DNA sequences encoding Shigella dysenteriae O-antigen biosynthesis gene products are set out in SEQ ID NOs:3 and 4, and species homologs thereof.

(61) Autonomously replicating recombinant expression constructions such as plasmid and viral DNA vectors incorporating O-antigen biosynthesis gene sequences are also provided. Expression constructs wherein O-antigen biosynthesis polypeptide-encoding polynucleotides are operatively linked to an endogenous or exogenous expression control DNA sequence and a transcription terminator are also provided. The O antigen biosynthesis genes may be cloned by PCR, using Shigella sonnei genomic DNA as the template. For ease of inserting the gene into expression vectors, PCR primers are chosen so that the PCR-amplified gene(s) has a restriction enzyme site at the 5 end preceding the initiation codon ATG, and a restriction enzyme site at the 3 end after the termination codon TAG, TGA or TAA. If desirable, the codons in the gene(s) are changed, without changing the amino acids, according to E. coli codon preference described by Grosjean et al. (1982) Gene, 18:199-209; and Konigsberg et al. (1983) Proc. Natl. Acad. Sci. USA, 80:687-691. Optimization of codon usage may lead to an increase in the expression of the gene product when produced in E. coli. If a protein gene product is to be produced extracellularly, either in the periplasm of E. coli or other bacteria, or into the cell culture medium, the gene is cloned into an expression vector and linked to a signal sequence.

(62) According to another aspect of the invention, host cells are provided, including prokaryotic and eukaryotic cells, either stably or transiently transformed, transfected, or electroporated with polynucleotide sequences of the invention in a manner which permits expression of O antigen biosynthesis polypeptides of the invention. Potential expression systems of the invention include bacterial, yeast, fungal, viral, parasitic, invertebrate, and mammalian cells systems. Host cells of the invention are a valuable source of immunogen for development of anti-bodies specifically immunoreactive with the O antigen. Host cells of the invention are conspicuously useful in methods for large scale production of O antigen biosynthesis polypeptides wherein the cells are grown in a suitable culture medium and the desired polypeptide products are isolated from the cells or from the medium in which the cells are grown by, for example, immunoaffinity purification or any of the multitude of purification techniques well known and routinely practiced in the art. Any suitable host cell may be used for expression of the gene product, such as E. coli, other bacteria, including P. multocida, Bacillus and S. aureus, yeast, including Pichia pastoris and Saccharomyces cerevisiae, insect cells, or mammalian cells, including CHO cells, utilizing suitable vectors known in the art. Proteins may be produced directly or fused to a peptide or polypeptide, and either intracellularly or extracellularly by secretion into the periplasmic space of a bacterial cell or into the cell culture medium. Secretion of a protein requires a signal peptide (also known as pre-sequence); a number of signal sequences from prokaryotes and eukaryotes are known to function for the secretion of recombinant proteins. During the protein secretion process, the signal peptide is removed by signal peptidase to yield the mature protein.

(63) To simplify the protein purification process, a purification tag may be added either at the 5 or 3 end of the gene coding sequence. Commonly used purification tags include a stretch of six histidine residues (U.S. Pat. Nos. 5,284,933 and 5,310,663), a streptavidin affinity tag described by Schmidt et al. (1993) Protein Eng., 6:109-122, a FLAG peptide (Hopp et al. (1988) Biotechnology, 6:1205-1210), glutathione 5-transferase (Smith et al. (1988) Gene, 67:31-40), and thioredoxin (LaVallie et at. (1993) Bio/Technology, 11:187-193). To remove these peptide or polypeptides, a proteolytic cleavage recognition site may be inserted at the fusion junction. Commonly used proteases are factor Xa, thrombin, and enterokinase.

(64) In one embodiment, the invention employs purified and isolated Shigella sonnei O-antigen biosynthesis polypeptides as described above. Presently preferred are polypeptides comprising the amino acid sequences encoded by any one of the polynucleotides set out in SEQ ID NO:2, and species homologs thereof. In certain embodiments, the invention utilizes O antigen biosynthesis polypeptides encoded by a DNA selected from the group consisting of:

(65) a) the DNA sequence set out in any one of SEQ ID NO:2 and species homologs thereof;

(66) b) DNA molecules encoding Shigella sonnei O-antigen biosynthetic polypeptides encoded by any one of SEQ ID NO:2, and species homologs thereof; and

(67) c) a DNA molecule encoding a O-antigen biosynthesis gene product that hybridizes under moderately stringent conditions to the DNA of (a) or (b). Moderately stringent hybridization conditions are well-known to the ordinarily skilled artisan.

(68) The invention also embraces polypeptides that have at least about 99%, at least about 95%, at least about 90%, at least about 85%, at least about 80%, at least about 75%, at least about 70%, at least about 65%, at least about 60%, at least about 55%, and at least about 50% identity and/or homology to the preferred polypeptides of the invention. Percent amino acid sequence identity with respect to the preferred polypeptides of the invention is defined herein as the percentage of amino acid residues in the candidate sequence that are identical with the residues in the O antigen biosynthesis gene product sequence after aligning both sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. Percent sequence homology with respect to the preferred polypeptides of the invention is defined herein as the percentage of amino acid residues in the candidate sequence that are identical with the residues in one of the O antigen biosynthesis polypeptide sequences after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and also considering any conservative substitutions as part of the sequence identity. Conservative substitutions can be defined as set out below in Tables A and B.

(69) TABLE-US-00001 TABLE A Conservative Substitutions I SIDE CHAIN CHARACTERISTIC AMINO ACID Aliphatic Non-polar G, A, P I, L, V Polar-uncharged C, S, T, M N, Q Polar-charged D, E K, R Aromatic H, F, W, Y Other N, Q, D, E

(70) Polypeptides of the invention may be isolated from natural bacterial cell sources or may be chemically synthesized, but are preferably produced by recombinant procedures involving host cells of the invention. O antigen biosynthesis gene products of the invention may be full length polypeptides, biologically active fragments, or variants thereof which retain specific biological or immunological activity. The biological activity is, in one embodiment, the biosynthesis of the antigen, for example, the Shigella sonnei O-antigen. The immunological activity is, in one embodiment, the protective immunological activity of the antigenic gene product, for example, the O-antigen product. Variants may comprise O antigen biosynthesis polypeptide analogs wherein one or more of the specified (i.e., naturally encoded) amino acids is deleted or replaced or wherein one or more non-specified amino acids are added: (1) without loss of one or more of the biological activities or immunological characteristics (activity) specific for the O antigen biosynthesis gene product; or (2) with specific disablement of a particular biological activity of the O antigen biosynthesis gene product. Deletion variants contemplated also include fragments lacking portions of the polypeptide not essential for biological activity, and insertion variants include fusion polypeptides in which the wild-type polypeptide or fragment thereof have been fused to another polypeptide.

(71) Variant O antigen biosynthesis polypeptides include those wherein conservative substitutions have been introduced by modification of polynucleotides encoding polypeptides of the invention. Conservative substitutions are recognized in the art to classify amino acids according to their related physical properties and can be defined as set out in Table A (from WO 1997/009433, page 10). Alternatively, conservative amino acids can be grouped as defined in Lehninger, (Biochemistry, Second Edition (1975) W.H. Freeman & Co., pp. 71-77) as set out in Table B.

(72) TABLE-US-00002 TABLE B Conservative Substitutions II SIDE CHAIN CHARACTERISTIC AMINO ACID Non-polar (hydrophobic) A. Aliphatic: A, L, I, V, P B. Aromatic: F, W C. Sulfur-containing: M D. Borderline: G Uncharged-polar A. Hydroxyl: S, T, Y B. Amides: N, Q C. Sulfhydryl: C D. Borderline: G Positively Charged (Basic): K, R, H Negatively Charged (Acidic): D, E

(73) Variant O antigen biosynthesis products of the invention include mature O antigen biosynthesis gene products, i.e., wherein leader or signal sequences are removed, having additional amino terminal residues. O antigen biosynthesis gene products having an additional methionine residue at position 1 are contemplated, as are O antigen biosynthesis products having additional methionine and lysine residues at positions 2 and 1. Variants of these types are particularly useful for recombinant protein production in bacterial cell types. Variants of the invention also include gene products wherein amino terminal sequences derived from other proteins have been introduced, as well as variants comprising amino terminal sequences that are not found in naturally occurring proteins.

(74) The invention also embraces variant polypeptides having additional amino acid residues which result from use of specific expression systems. For example, use of commercially available vectors that express a desired polypeptide as fusion protein with glutathione-S-transferase (GST) provide the desired polypeptide having an additional glycine residue at position 1 following cleavage of the GST component from the desired polypeptide. Variants which result from expression using other vector systems are also contemplated.

(75) Also comprehended by the present invention are antibodies (e.g., monoclonal and polyclonal antibodies, single chain antibodies, chimeric antibodies, humanized, human, and CDR-grafted antibodies, including compounds which include CDR sequences which specifically recognize a polypeptide of the invention) and other binding proteins specific for O antigen biosynthesis gene products or fragments thereof. The term specific for indicates that the variable regions of the antibodies of the invention recognize and bind O antigen exclusively (i.e., are oftentimes able to distinguish a single O antigen from related O antigens, but may also interact with other proteins (for example, S. aureus protein A or other antibodies in ELISA techniques) through interactions with sequences outside the variable region of the antibodies, and in particular, in the constant region of the molecule. Screening assays to determine binding specificity of an antibody of the invention are well known and routinely practiced in the art. For a comprehensive discussion of such assays, see Harlow et al. (Eds.); Antibodies A Laboratory Manual (1988) Cold Spring Harbor Laboratory; Cold Spring Harbor, N.Y., chapter 6. Antibodies that recognize and bind fragments of the O antigen of the invention are also contemplated, provided that the antibodies are first and foremost specific for, as defined above, an O antigen of the invention from which the fragment was derived.

(76) Treatment/Therapy

(77) In certain embodiments, the present invention provides compositions (including vaccines) and methods to treat (e.g., alleviate, ameliorate, relieve, delay onset of, inhibit progression of, reduce severity of, and/or reduce incidence of one or more symptoms or features of) and/or prevent bacterial infection.

(78) In some embodiments, methods of vaccination and/or treatment (such as those described in the sections below) involve stratification of a patient population based on prior exposure to bacterial strains. Such methods involve steps of determining whether a patient has been previously exposed to one or more of the bacterial strains. In some embodiments, if it is determined that a patient has been previously been exposed to one or more of the bacterial strains, that patient may receive less concentrated, less potent, and/or less frequent doses of the inventive vaccine or composition. If it is determined that a patient has not been previously been exposed to one or more of the bacterial strains, that patient may receive more concentrated, more potent, and/or more frequent doses of the inventive vaccine or composition.

(79) In one embodiment, the recombineered bacterial strain or vaccine or composition of the invention treats more than one bacterial infection, i.e., infection with more than one bacterial species. It can, in such an embodiment, be deemed a multifunctional vaccine (or strain or compositioneither of the latter two are contemplated in the continued description, below). A multifunctional vaccine according to the invention may also be useful for treating and/or preventing simultaneously a number of different disorders in a subject. Accordingly, the present invention further provides, in an additional embodiment, a method for treating and/or preventing more than one disorder in a subject, by administering to the subject a multifunctional vaccine according to the invention.

(80) Exemplary disorders which potentially may be treated and/or prevented by a multifunctional vaccine according to the invention include, without limitation, multiple bacterial species infections, burns, infections, neoplasia, or radiation injuries. Neoplasia refers to the uncontrolled and progressive multiplication of tumour cells, under conditions that would not elicit, or would cause cessation of, multiplication of normal cells. Neoplasia results in a neoplasm, which is defined herein to mean any new and abnormal growth, particularly a new growth of tissue, in which the growth of cells is uncontrolled and progressive. Thus, neoplasia includes cancer, which herein refers to a proliferation of tumour cells having the unique trait of loss of normal controls, resulting in unregulated growth, lack of differentiation, local tissue invasion, and/or metastasis.

(81) Administration

(82) Compositions and vaccines (the terms used interchangeably herein) may be administered using any amount and any route of administration effective for treatment and/or vaccination. The exact amount required will vary from subject to subject, depending on the species, age, and general condition of the subject, the severity of the infection, the particular composition, its mode of administration, its mode of activity, and the like. Compositions are typically formulated in dosage unit form for ease of administration and uniformity of dosage. It will be understood, however, that the total daily usage of the compositions of the present invention will be decided by the attending physician within the scope of sound medical judgment. The specific therapeutically effective dose level for any particular subject or organism will depend upon a variety of factors including the disorder being treated and/or vaccinated and the severity of the disorder; the activity of the specific vaccine composition employed; the half-life of the composition after administration; the age, body weight, general health, sex, and diet of the subject; the time of administration, route of administration, and rate of excretion of the specific compound employed; the duration of the treatment; drugs used in combination or coincidental with the specific compound employed; and like factors, well known in the medical arts.

(83) Compositions (and vaccines) according to the invention may be administered by any route. In some embodiments, pharmaceutical compositions of the present invention are administered by a variety of routes, including oral (PO), intravenous (IV), intramuscular (IM), intra-arterial, intramedullary, intrathecal, subcutaneous (SQ), intraventricular, transdermal, interdermal, intradermal, rectal (PR), vaginal, intraperitoneal (IP), intragastric (IG), topical or transcutaneous (e.g., by powders, ointments, creams, gels, lotions, and/or drops), mucosal, intranasal, buccal, enteral, vitreal, sublingual; by intratracheal instillation, bronchial instillation, and/or inhalation; as an oral spray, nasal spray, and/or aerosol, and/or through a portal vein catheter.

(84) In general, the most appropriate route of administration will depend upon a variety of factors including the nature of the agent being administered (e.g., its stability upon administration), the condition of the subject (e.g., whether the subject is able to tolerate a particular mode of administration), etc. In specific embodiments, compositions may be administered intranasally. In specific embodiments, compositions may be administered by intratracheal instillation. In specific embodiments, compositions may be administered by bronchial instillation. In specific embodiments, compositions may be administered by inhalation. In specific embodiments, compositions may be administered as a nasal spray. In specific embodiments, compositions may be administered mucosally. In specific embodiments, compositions may be administered orally. In specific embodiments, compositions may be administered by intravenous injection. In specific embodiments, compositions may be administered by intramuscular injection. In specific embodiments, compositions may be administered by subcutaneous injection. The oral or nasal spray or aerosol route (e.g., by inhalation) is most commonly used to deliver therapeutic agents directly to the lungs and respiratory system. However, the invention encompasses the delivery of a pharmaceutical composition by any appropriate route taking into consideration likely advances in the sciences of drug delivery.

(85) For oral administration, the composition (including vaccine) may be presented as capsules, tablets, dissolvable membranes, powders, granules, or as a suspension. The composition may have conventional additives, such as lactose, mannitol, corn starch, or potato starch. The composition also may be presented with binders, such as crystalline cellulose, cellulose derivatives, acacia, corn starch, or gelatins. Additionally, the composition may be presented with disintegrators, such as corn starch, potato starch, or sodium carboxymethylcellulose. The composition may be further presented with dibasic calcium phosphate anhydrous or sodium starch glycolate. Finally, the composition may be presented with lubricants, such as talc or magnesium stearate.

(86) For parenteral administration, the composition may be combined with a sterile aqueous solution, which is preferably isotonic with the blood of the subject. Such a formulation may be prepared by dissolving a solid active ingredient in water containing physiologically-compatible substances, such as sodium chloride, glycine, and the like, and having a buffered pH compatible with physiological conditions, so as to produce an aqueous solution, then rendering said solution sterile. The formulation may be presented in unit or multi-dose containers, such as sealed ampoules or vials. The formulation also may be delivered by any mode of injection, including any of those described herein.

(87) Compositions for rectal or vaginal administration are typically suppositories which can be prepared by mixing compositions with suitable non-irritating excipients such as cocoa butter, polyethylene glycol or a suppository wax which are solid at ambient temperature but liquid at body temperature and therefore melt in the rectum or vaginal cavity and release the active ingredient.

(88) Solid dosage forms for oral administration include capsules, tablets, pills, powders, dissolvable membranes, and granules. In such solid dosage forms, the active ingredient is mixed with at least one inert, pharmaceutically acceptable excipient such as sodium citrate or dicalcium phosphate and/or fillers or extenders (e.g., starches, lactose, sucrose, glucose, mannitol, and silicic acid), binders (e.g., carboxymethylcellulose, alginates, gelatin, polyvinylpyrrolidinone, sucrose, and acacia), humectants (e.g., glycerol), disintegrating agents (e.g., agar, calcium carbonate, potato starch, tapioca starch, alginic acid, certain silicates, and sodium carbonate), solution retarding agents (e.g., paraffin), absorption accelerators (e.g., quaternary ammonium compounds), wetting agents (e.g., cetyl alcohol and glycerol monostearate), absorbents (e.g., kaolin and bentonite clay), and lubricants (e.g., talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate), taste/olfactory components, and mixtures thereof. In the case of capsules, tablets and pills, the dosage form may comprise buffering agents.

(89) Dosage forms for topical and/or transdermal administration of a composition in accordance with this invention may include ointments, pastes, creams, lotions, gels, powders, solutions, sprays, inhalants and/or patches. Generally, the active ingredient is admixed under sterile conditions with a pharmaceutically acceptable excipient and/or any needed preservatives and/or buffers as may be required. Additionally, the present invention contemplates the use of transdermal patches, which often have the added advantage of providing controlled delivery of a compound to the body. Such dosage forms may be prepared, for example, by dissolving and/or dispensing the compound in the proper medium. Alternatively or additionally, the rate may be controlled by either providing a rate controlling membrane and/or by dispersing the compound in a polymer matrix and/or gel.

(90) For transdermal administration, the composition (including vaccine) according to the invention may be combined with skin penetration enhancers, such as propylene glycol, polyethylene glycol, isopropanol, ethanol, oleic acid, N-methylpyrrolidone, and the like, which increase the permeability of the skin to the composition, and permit the composition to penetrate through the skin and into the bloodstream. The composition of enhancer and vaccine also may be further combined with a polymeric substance, such as ethylcellulose, hydroxypropyl cellulose, ethylene/vinylacetate, polyvinyl pyrrolidone, and the like, to provide the composition in gel form, which may be dissolved in solvent, such as methylene chloride, evaporated to the desired viscosity, and then applied to backing material to provide a patch. The composition may be administered transdermally, at or near the site on the subject where the infection, neoplasm, or other disorder may be localized. Alternatively, the composition may be administered transdermally at a site other than the affected area, in order to achieve systemic administration.

(91) For intranasal administration (e.g., nasal sprays) and/or pulmonary administration (administration by inhalation), a composition (including vaccine) according to the invention, including aerosol formulations, may be prepared in accordance with procedures well known to persons of skill in the art. Aerosol formulations may comprise either solid particles or solutions (aqueous or non-aqueous). Nebulizers (e.g., jet nebulizers, ultrasonic nebulizers, etc.) and atomizers may be used to produce aerosols from solutions (e.g., using a solvent such as ethanol); metered-dose inhalers and dry-powder inhalers may be used to generate small-particle aerosols. The desired aerosol particle size can be obtained by employing any one of a number of methods known in the art, including, without limitation, jet-milling, spray drying, and critical-point condensation.

(92) Compositions for intranasal administration may be solid formulations (e.g., a coarse powder) and may contain excipients (e.g., lactose). Solid formulations may be administered from a container of powder held up to the nose, using rapid inhalation through the nasal passages. Compositions for intranasal administration may also comprise aqueous or oily solutions of nasal spray or nasal drops. For use with a sprayer, the formulation may comprise an aqueous solution and additional agents, including, for example, an excipient, a buffer, an isotonicity agent, a preservative, or a surfactant. A nasal spray may be produced, for example, by forcing a suspension or solution of the composition through a nozzle under pressure.

(93) Formulations of a composition (including vaccine) according to the invention for pulmonary administration may be presented in a form suitable for delivery by an inhalation device, and may have a particle size effective for reaching the lower airways of the lungs or sinuses. For absorption through mucosal surfaces, including the pulmonary mucosa, the formulation may comprise an emulsion that includes, for example, a bioactive peptide, a plurality of submicron particles, a mucoadhesive macromolecule, and/or an aqueous continuous phase. Absorption through mucosal surfaces may be achieved through mucoadhesion of the emulsion particles.

(94) Compositions (including vaccines) according to the invention for use with a metered-dose inhaler device may include a finely-divided powder containing the composition as a suspension in a non-aqueous medium. For example, the composition may be suspended in a propellant with the aid of a surfactant (e.g., sorbitan trioleate, soya lecithin, or oleic acid). Metered-dose inhalers typically use a propellant gas (e.g., a chlorofluorocarbon, a hydrochlorofluorocarbon, a hydrofluorocarbon, or a hydrocarbon) stored in a container (e.g., a canister) as a mixture (e.g., as a liquefied, compressed gas). Inhalers require actuation during inspiration. For example, actuation of a metering valve may release the mixture as an aerosol. Dry-powder inhalers use breath-actuation of a mixed powder.

(95) A composition (including vaccine) according to the invention also may be released or delivered from an osmotic mini-pump or other timed-release device. The release rate from an elementary osmotic mini-pump may be modulated with a microporous, fast-response gel disposed in the release orifice. An osmotic mini-pump would be useful for controlling release, or targeting delivery, of the composition.

(96) A composition (including vaccine) according to the invention may be administered or introduced to a subject by known techniques used for the introduction of drugs, including, for example, injection and transfusion. Where a disorder is localized to a particular portion of the body of the subject, it may be desirable to introduce the composition directly to that area by injection or by some other means (e.g., by introducing the composition into the blood or another body fluid).

(97) A composition (including vaccine) according to the invention may be administered to a subject who has a disorder, either alone or in combination with one or more drugs used to treat that disorder. For example, where the subject has neoplasia, the composition may be administered to a subject in combination with at least one antineoplastic drug. Examples of antineoplastic drugs with which the composition may be combined include, without limitation, carboplatin, cyclophosphamide, doxorubicin, etoposide, and vincristine. Additionally, when administered to a subject who suffers from neoplasia, the composition may be combined with other neoplastic therapies, including, without limitation, surgical therapies, radiotherapies, gene therapies, and immunotherapies.

(98) Vaccine

(99) A vaccine is a composition that induces an immune response in the recipient or host of the vaccine. The vaccine can induce protection against infection upon subsequent challenge with a bacterial species (or other microorganism). Protection refers to resistance (e.g., partial resistance) to persistent infection of a host animal with at least one bacterial species (or other microorganism). Neutralizing antibodies generated in the vaccinated host can provide this protection. In other situations, CTL responses can provide this protection. In some situations, both neutralizing antibodies and cell-mediated immune (e.g., CTL) responses provide this protection.

(100) Vaccines are useful in preventing or reducing infection or disease by inducing immune responses, to an antigen or antigens, in an individual. For example, vaccines can be used prophylactically in naive individuals, or therapeutically in individuals already infected with at least one bacterial species (or other microorganism).

(101) Protective responses can be evaluated by a variety of methods. For example, either the generation of neutralizing antibodies against bacterial (or other microorganism) proteins, and/or the generation of a cell-mediated immune response against such proteins can indicate a protective response. Protective responses also include those responses that result in lower number of bacteria colonized in a vaccinated host animal exposed to a given inoculum (of bacteria or other microorganism) as compared to a host animal exposed to the same inoculum, but that has not been administered the vaccine.

(102) Vaccines according to the invention may, in one embodiment, contain an adjuvant. The term adjuvant, as used herein, refers to any compound which, when injected together with an antigen, non-specifically enhances the immune response to that antigen. Exemplary adjuvants include Complete Freund's Adjuvant, Incomplete Freund's Adjuvant, Gerbu adjuvant (GMDP; C.C. Biotech Corp.), RIBI fowl adjuvant (MPL; RIBI Immunochemical Research, Inc.), potassium alum, aluminum phosphate, aluminum hydroxide, QS21 (Cambridge Biotech), TITERMAX adjuvant (CytRx Corporation), and QUIL A adjuvant. Other compounds that may have adjuvant properties include binders such as carboxymethylcellulose, ethyl cellulose, microcrystalline cellulose, or gelatin; excipients such as starch, lactose or dextrins, disintegrating agents such as alginic acid, sodium alginate, PRIMOGEL, corn starch and the like; lubricants such as magnesium stearate or STEROTEX; glidants such as colloidal silicon dioxide; sweetening agents such as sucrose or saccharin, a flavoring agent such as peppermint, methyl salicylate or orange flavoring, and a coloring agent.

(103) Furthermore, a useful compendium of many adjuvants is prepared by the National Institutes of Health and can be found on the internet (www.niaid.nih.gov/daids/vaccine/pdf/compendium.pdf). Hundreds of different adjuvants are known in the art and could be employed in the practice of the present invention. Exemplary adjuvants that can be utilized in accordance with the invention include, but are not limited to, cytokines, aluminum salts (e.g., aluminum hydroxide, aluminum phosphate, etc.), gel-type adjuvants (e.g., calcium phosphate, etc.); microbial adjuvants (e.g., immunomodulatory DNA sequences that include CpG motifs; endotoxins such as monophosphoryl lipid A); exotoxins such as cholera toxin, E. coli heat labile toxin, and pertussis toxin; muramyl dipeptide, etc.); oil-emulsion and emulsifier-based adjuvants (e.g., Freund's Adjuvant, MF59 [Novartis], SAF, etc.); particulate adjuvants (e.g., liposomes, biodegradable microspheres, etc.); synthetic adjuvants (e.g., nonionic block copolymers, muramyl peptide analogues, polyphosphazene, synthetic polynucleotides, etc.); and/or combinations thereof. Other exemplary adjuvants include some polymers (e.g., polyphosphazenes), Q57, saponins (e.g., QS21), squalene, tetrachlorodecaoxide, CPG 7909, poly[di(carboxylatophenoxy)phosphazene] (PCCP), interferon-gamma, block copolymer P1205 (CRL1005), interleukin-2 (IL-2), polymethyl methacrylate (PMMA), etc. In one embodiment of the instant invention, the carrier bacterium (e.g. S. Typhi Ty21a) itself serves as an adjuvant for expressed foreign antigens such as Shigella O antigens or anthrax protective antigen.

(104) Vaccines according to the invention may, in another embodiment, be formulated using a diluent. Exemplary diluents include water, physiological saline solution, human serum albumin, oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents, antibacterial agents such as benzyl alcohol, antioxidants such as ascorbic acid or sodium bisulphite, chelating agents such as ethylene diamine-tetra-acetic acid, buffers such as acetates, citrates or phosphates and agents for adjusting the osmolarity, such as sodium chloride or dextrose. Exemplary carriers include liquid carriers (such as water, saline, culture medium, saline, aqueous dextrose, and glycols) and solid carriers (such as carbohydrates exemplified by starch, glucose, lactose, sucrose, and dextrans, anti-oxidants exemplified by ascorbic acid and glutathione, and hydrolyzed proteins.

(105) Vaccines according to the invention may, in still another embodiment, contain an excipient. The term excipient refers herein to any inert substance (e.g., gum arabic, syrup, lanolin, starch, etc.) that forms a vehicle for delivery of an antigen. The term excipient includes substances that, in the presence of sufficient liquid, impart to a composition the adhesive quality needed for the preparation of pills or tablets.

(106) As mentioned above, in some embodiments, interfering agents and/or binding agents in accordance with the invention may be utilized for prophylactic applications. In some embodiments, prophylactic applications involve systems and methods for preventing, inhibiting progression of, and/or delaying the onset of bacterial infection. In some embodiments, interfering agents may be utilized for passive immunization (i.e., immunization wherein antibodies are administered to a subject). In some embodiments, vaccines for passive immunization may comprise antibody interfering agents, such as those described herein. In some embodiments, passive immunization occurs when antibodies are transferred from mother to fetus during pregnancy. In some embodiments, antibodies are administered directly to an individual (e.g., by injection, orally, etc.). Of note, it is possible to immunize a person and use their antibodies for passive protection in another individual. For example, Ty21a is contraindicated for use in pregnant women (i.e., they are immunocompromised, and the attenuated Salmonella could potentially cause illness). However, it may be appropriate to passively transfer protective antibodies to a pregnant mother, instead of leaving them susceptible to deadly diseases.

(107) The invention provides, in one embodiment, vaccines for active immunization (i.e., immunization wherein microbes, proteins, peptides, epitopes, mimotopes, etc. are administered to a subject). In some embodiments, the vaccines may comprise one or more interfering agents and/or binding agents, as described herein.

(108) In one embodiment, a composition is provided including interfering agents and/or binding agents, as described for vaccines, above. For example, in some embodiments, interfering agent and/or binding agent polypeptides, nucleic acids encoding such polypeptides, characteristic or biologically active fragments of such polypeptides or nucleic acids, antibodies that bind to and/or compete with such polypeptides or fragments, small molecules that interact with or compete with such polypeptides or with glycans that bind to them, etc. are included in compositions. In some embodiments, interfering agents and/or binding agents that are not polypeptides, e.g., that are small molecules, umbrella topology glycans and mimics thereof, carbohydrates, aptamers, polymers, nucleic acids, etc., are included in the compositions. One could, in specific embodiments, envision bacterially delivered therapies for cancer or other maladies, in which the therapeutic nucleic acids or proteins are encoded in the chromosome of the carrier bacterial vaccine/therapeutic strain.

(109) The invention encompasses treatment and/or prophylaxis of bacterial (or other microorganism) infections by administration of compositions according to the invention. In some embodiments, such compositions are administered to a subject suffering from or susceptible to a bacterial infection. In some embodiments, a subject is considered to be suffering from a bacterial infection if the subject is displaying one or more symptoms commonly associated with the bacterial infection. In some embodiments, the subject is known or believed to have been exposed to the at least one bacterial species (or other microorganism). In some embodiments, a subject is considered to be susceptible to a bacterial infection if the subject is known or believed to have been exposed to the bacterial species. In some embodiments, a subject is known or believed to have been exposed to the bacterial species if the subject has been in contact with other individuals known or suspected to have been infected with the same, and/or if the subject is or has been present in a location in which the bacterial infection is known or thought to be prevalent. Compositions provided herein may be administered prior to or after development of one or more symptoms of bacterial (or other microorganism) infection.

(110) In general, a composition will include a therapeutic agent (the recombineered Salmonella Typhi Ty21a, for example), in addition to one or more inactive, agents such as a sterile, biocompatible pharmaceutical carrier including, but not limited to, sterile water, saline, buffered saline, or dextrose solution. Alternatively or additionally, a composition may comprise a pharmaceutically acceptable excipient, which, as used herein, includes any and all solvents, dispersion media, diluents, or other liquid vehicles, dispersion or suspension aids, disintegrating agents, surface active agents, isotonic agents, thickening or emulsifying agents, preservatives, buffering agents, solid binders, granulating agents, lubricants, coloring agents, sweetening agents, flavoring agents, perfuming agents, and the like, as suited to the particular dosage form desired. Remington's The Science and Practice of Pharmacy, 21st Ed., A. R. Gennaro, (Lippincott, Williams & Wilkins, Baltimore, Md., 2006; incorporated herein by reference) discloses various excipients used in formulating pharmaceutical compositions and known techniques for the preparation thereof. Except insofar as any conventional excipient medium is incompatible with a substance or its derivatives, such as by producing any undesirable biological effect or otherwise interacting in a deleterious manner with any other component of the pharmaceutical composition, its use is contemplated to be within the scope of this invention.

(111) Combinations

(112) Compositions and vaccines according to the invention can be administered to a subject either alone or in combination with one or more other therapeutic agents including, but not limited to, vaccines and/or antibodies. By in combination with, it is not intended to imply that the agents must be administered at the same time or formulated for delivery together, although these methods of delivery are within the scope of the invention. Compositions and vaccines according to the invention can be administered concurrently with, prior to, or subsequent to, one or more other desired therapeutics or medical procedures. It will be appreciated that therapeutically active agents utilized in combination may be administered together in a single composition or administered separately in different compositions. In general, each agent will be administered at a dose and/or on a time schedule determined for that agent.

(113) In general, each agent (in this context, one of the agents is a composition or vaccine according to the invention) will be administered at a dose and on a time schedule determined for that agent. Additionally, the invention encompasses the delivery of the compositions in combination with agents that may improve their bioavailability, reduce or modify their metabolism, inhibit their excretion, or modify their distribution within the body. Although the compositions (including vaccines) according to the invention can be used for treatment and/or vaccination of any subject, they are preferably used in the treatment and/or vaccination of humans.

(114) The particular combination of therapies (e.g., therapeutics or procedures) to employ in a combination regimen will take into account compatibility of the desired therapeutics and/or procedures and the desired therapeutic effect to be achieved. It will be appreciated that the therapies employed may achieve a desired effect for the same purpose (for example, an agent useful for treating, preventing, and/or delaying the onset of a bacterial (or other microorganism) infection may be administered concurrently with another agent useful for treating, preventing, and/or delaying the onset of the bacterial infection), or they may achieve different effects (e.g., prevention of severe illness or control of adverse effects).

(115) In general, it is expected that agents utilized in combination with be utilized at levels that do not exceed the levels at which they are utilized individually. In some embodiments, the levels utilized in combination will be lower than those utilized individually.

(116) Dosages

(117) The dosage of a vaccine (or other composition) according to the invention can be determined by, for example, first identifying doses effective to elicit a prophylactic and/or therapeutic immune response. This may be accomplished by measuring the serum titer of bacterium-specific immunoglobulins and/or by measuring the inhibitory ratio of antibodies in serum samples, urine samples, and/or mucosal secretions. The dosages can be determined from animal studies, including animals that are not natural hosts to the bacterial species in question. For example, the animals can be dosed with a vaccine candidate, e.g., a vaccine according to the invention, to partially characterize the immune response induced and/or to determine if any neutralizing antibodies have been produced. In addition, routine human clinical studies can be performed to determine the effective dose for humans.

(118) Effective doses may be extrapolated from dose-response curves derived from in vitro and/or in vivo animal models. Ty21a is given every other day for three or four doses (depending on country of use), and the dose may be between about 210.sup.9 and >10.sup.10 colony forming units (cfu) per dose. In one embodiment, dose spacing of every one to two months works better in some immunization schedules (e.g. in infants), and in another embodiment, doses as high as 10.sup.11 cfu may work better in developing countries (i.e., trigger better protection that persists longer).

(119) An immunologically effective amount, based upon human studies, would, in one embodiment, be sufficient to stimulate an acceptable level of protective immunity in a population. For some vaccines (in certain embodiments), this immunologically effective level would provide an 80% efficacy against a specific diarrheal disease. For other vaccines (in other embodiments), an immunologically effective amount would be one that protects against severe disease but may not protect against all symptoms of a disease.

(120) In one embodiment, a vaccine (or other composition) according to the invention may also be administered to a subject at risk of developing a disorder, in an amount effective to prevent the disorder in the subject. As used herein, the phrase effective to prevent the disorder includes effective to hinder or prevent the development or manifestation of clinical impairment or symptoms resulting from the disorder, or to reduce in intensity, severity, and/or frequency, and/or delay of onset of one or more symptoms of the disorder.

(121) Kits

(122) Kits comprising the recombineered Salmonella Typhi Ty21a or a vaccine or a composition according to the invention are provided in an additional embodiment. Kits can include one or more other elements including, but not limited to, instructions for use; other reagents, e.g., a diluent, devices or other materials for preparing the vaccine or composition for administration; pharmaceutically acceptable carriers; and devices or other materials for administration to a subject. Instructions for use can include instructions for therapeutic application (e.g., DNA vaccination and protein boosting) including suggested dosages and/or modes of administration, e.g., in a human subject, as described herein.

(123) In another embodiment, a kit according to the invention can further contain at least one additional reagent, such as a diagnostic or therapeutic agent, e.g., a diagnostic agent to monitor an immune response to the compositions or vaccines according to the invention in the subject, or an additional therapeutic agent as described herein (see, e.g., the section herein describing combination therapies).

EXAMPLES

(124) The following examples are provided for illustrative purposes only and are not intended to limit the scope of the invention.

Example 1. Cloning the Minimal Essential S. sonnei O-Antigen Biosynthetic Genes

(125) A large 30 kb region encoding S. sonnei form I O-antigen biosynthesis and flanking sequences were previously characterized (initially by deletion analysis) to determine minimal necessary sequences for O-antigen expression. Together with DNA sequence analyses of this region, these deletion data indicated that a contiguous 12.3 kb region containing a putative promoter and 10 orfs (orf 4 to 13 in FIG. 1) was required for O-antigen biosynthesis in S. sonnei. These deletion studies also suggested that wzz (ofr3), typically involved in regulating O-antigen chain length, is not essential for form 1 expression in Ty21a, but the latter part of wzz apparently contains the putative form 1 O-antigen biosynthetic operon promoter (Xu, et al. (2002) Infect and Immun 70:4414-4423.

(126) Construction of pMD-TV Plasmid

(127) Standard molecular biology techniques were used for cloning. The restriction endonucleases and ligase were purchased from New England Biolabs (NEB) or FERMENTAS, and PHUSION polymerase (Fisher) was used for all PCRs. The Kan.sup.r cassette flanked by FRT sites was PCR-amplified from pKD4 with primers containing NheI and NsiI restriction sites, and plasmid pGB-2 was also PCR amplified with primers containing NheI and NsiI restriction sites, engineered to delete the open reading frame (orf) that confers Spc resistance. The two PCR products were digested with NheI and NsiI and ligated to construct the Kan.sup.r, Spc.sup.S plasmid pMD35-36. The vexA gene (1000 bp) and part of the tviD gene (500 bp) were PCR-amplified from Ty21a genomic DNA. The amplified tviD sequence was cloned upstream of the Kan.sup.r cassette flanked by FRT sites, and the vexA amplicon was cloned downstream of the multiple cloning site (MCS), as shown in FIG. 1. Restriction endonuclease sites were further added or removed, as needed, by the method described in the PHUSION site-directed mutagenesis kit (NEB), to construct pMD-TV. Sequences of the primers used to construct pMD-TV are provided in Table C, below.

(128) TABLE-US-00003 TABLEC PrimersusedtoconstructpMD-TV Primername Sequence.sup.a prMD31.pGB.2.F.Nsi TCATATATGCATTAATGTCTAACAATTCGTTCAAGCC (SEQ.IDNO:5) prMD32.pGB2.R.NheI CTACACGCTAGCACGCTACTTGCATTACAGCTTACG (SEQ.IDNO:6) prMD33.KD.F.NheI TAGCGTGCTAGCGTGTAGGCTGGAGCTGCTTCG(SEQ.ID NO:7) prMD34.KD.R.NsiI ACATTAATGCATATATGAATATCCTCCTTAGTTCCTATT CCG(SEQ.IDNO:8) prMD35.pGB.MCS.F.p TCGAGGGGCGCGCCGGTACCGAATTCCCGACAGTAAGA CGG(SEQ.IDNO:9) prMD36.pGB.MCS.R.p GCCCGGGGATCCGCGGCCGCGTCGACCTGCAGCCAAGC TT(SEQ.IDNO:10) prMD58.tviD.F GATCGGCTAGCCCGTTCCTCATTGATTTGATTGC(SEQ. IDNO:11) prMD59.tviD.R GATCGCCCGGGTTACGACTTCCCTGATGTATTTTTTTGT AATG(SEQ.IDNO:12) prMD60.vexA.F GATCGCTCGAGTAATTAATGGGCATCATTTTTCAGCTAT TTC(SEQ.IDNO:13) prMD83.vexA.R.xhoI.1000 GATCGCTCGAGTTAGAAAGAATTAGTGCCGCGGG(SEQ. IDNO:14) prMD75.mcs.F.p CGGTCTCGAGGGGCGCGCCGGTACCGAATTCTAATTAA TGGGCATCATTTTTCAGCTATTTC(SEQ.IDNO:15) prMD76.mcs.R.p GTGGATCCAAGCTTGCGGCCGCCCGTCGACAGTAAAGC CCTCGCTAGATTTTAATGCG(SEQ.IDNO:16) prMD77.sites.remove.F.p CCGACAGTAAGACGGGTAAGCC(SEQ.IDNO:17) prMD78.sites.remove.R.p TTAGAAAGAATTAGTGCCGCGGG(SEQ.IDNO:18) .sup.aRestriction sites are underlined.

(129) Part of wzz (orf 3) through orf 7 was PCR-amplified (labeled fragment A in FIG. 1) and cloned into pMD-TV.

(130) Cloning S. sonnei O-Antigen Genes into pMD-TV

(131) S. sonnei O-antigen genes were PCR-amplified from pXK65 (Xu et al. (2002) Infect. Immun., 70:4414-4423). Primers prMD43.ss.F.HindIII, gatcaaagcttgatcaaatagctcatat tcagcg (SEQ ID NO:19), and prMD44.ss.BamHI.R, gatcaggatcctgctcagtccggttggtg (SEQ ID NO:20), were used to amplify part of the wzz gene (orf3) through wzy (orf7), shown as fragment A in FIG. 1. The resulting PCR product and pMD-TV were digested with HindIII and BamHI, PCR purified (QIAGEN) and ligated using T4 ligase. Primers prMD41.ss.F.BamHI, gtagcggatccaagcgcagctatttaggatgag (SEQ ID NO:21), and prMD42.ss.R.XhoI, gatcgctcgagttaatttacggggtgattaccagac (SEQ ID NO:22), were used to amplify genes wbgV (orf9) through apqZ (orf 14), shown as fragment B in FIG. 1. The resulting PCR product and plasmid pMD-TV containing genes wzz to wzy (orf3 to orf7) were digested with BamHI and XhoI, PCR-purified, and ligated as before to construct pMD-TV-Ss-1. Thus, orfs 9 to 14 (labeled fragment B in FIG. 1) were PCR-amplified, eliminating the non-essential IS630 element (orf8), and this amplicon was attached to cloned fragment A in pMD-TV to generate pMD-TV-Ss-1.

(132) The plasmid was observed to express S. sonnei form I O-antigen in either E. coli or Ty21a, as determined by slide agglutination with form I-specific antisera. Also, LPS purified from E. coli or Ty21a carrying pMD-TV-Ss-1 reacted with specific form I antibody in Western immunoblotting studies (FIG. 2), demonstrating that IS630 (orf8) is not essential for form I O-antigen biosynthesis.

Example 2. Integration into the Ty21a Chromosome of Linear Shigella DNA

(133) Datsenko and Wanner (Datsenko et al. (2000) Proc. Natl. Acad. Sci. USA, 97:6640-6645) previously described a method based on the highly efficient phage red recombination system that enables one to create specific targeted gene mutations via recombinational replacement of an E. coli chromosomal sequence with a small selectable antibiotic resistance gene that is generated by PCR using primers containing 36 to 50 bp extensions that are homologous to the gene targeted for mutation. The red system includes , , and exo genes, whose products are called Beta, Gam, and Exo, respectively (Murphy (1998) J. Bacteriol., 180:2063-2071). Gam inhibits the host RecB,C,D exonuclease and the SbcC,D nuclease activities, so that exogenously added linear DNA is not degraded. The Exo protein is a dsDNA-dependent exonuclease that binds to the terminus of each strand while degrading the other strand in a 5 to 3 direction. Beta binds to the resulting ssDNA overhangs, ultimately pairing them with a complementary chromosomal DNA target (Sawitzke et al. (2007) Methods Enzymol., 421:171-199). The low copy plasmid pKD20 encodes these three red proteins under the control of the arabinose-inducible P.sub.araB promoter, has an optimized ribosome-binding site for efficient translation of the , , and exo genes, and has a temperature-sensitive replicon to allow for its easy elimination (Datsenko et al. (2000) Proc. Natl. Acad. Sci. USA, 97:6640-6645). The red system has been widely utilized for specific gene inactivation in E. coli, Salmonella and Shigella species, and for introducing small biological tags (Uzzau et al. (2001) Proc. Natl. Acad. Sci. USA, 98:15264-15269) or single genes into these chromosomes (Yu et al. (2011) Appl. Microbiol. Biotechnol., 91:177-188).

(134) In this study, the lengths of the homologous extensions needed for detectable lambda-Red mediated recombination of large blocks of foreign DNA (15,000*bp) into a targeted site in the desired chromosome were increased in a stepwise fashion from 50 to 150 bp and then to 500-1000 bp. In order to integrate the large form 1 O-antigen operon into the chromosome of vaccine strain Ty21a, a new plasmid, pMD-TV, was constructed.

(135) As depicted in FIG. 1, the optimal chromosome insertion vector pMD-TV consists of a replicon plus a multiple cloning site (MCS) and an adjacent selectable Kan.sup.r cassette, which can be removed, when desired, via special recombination between flanking FRT sites. In addition, the MCS plus removable Kan.sup.r cassette are flanked by two large regions (500-1000 bp) of targeted homology with the Ty21a chromosome. The homologous regions chosen are tviD (500 bp) and vexA (1000 bp) located within the non-expressed Vi capsule locus of Ty21a. The minimal essential S. sonnei O-antigen gene region was cloned into the MCS of pMD-TV to construct pMD-TV-Ss-1, the PCR template for subsequent chromosome recombineering. The resulting PCR amplicon, containing the S. sonnei O-antigen genes, is 15,532 bp.

(136) Bacterial Strains, Plasmids, and Growth Conditions

(137) The bacterial strains and plasmids utilized herein are described in Table D, below. E. coli strains were grown at 37 C. in Luria-Bertani (LB) broth or on LB agar from DIFCO. Shigella strains were grown in tryptic soy broth (TSB) or tryptic soy agar (TSA) from DIFCO. Salmonella strain Ty21a was grown in TSB or TSA supplemented with 0.01% galactose and 0.01% glucose. Plasmid-containing strains were selected in growth medium containing ampicillin (Amp; 100 g/ml), spectinomycin (Spc; 100 g/ml), chloramphenicol (Cm; 35 g/ml), or kanamycin (Kan; 30 g/ml). All constructed plasmids were sequenced, and the sequences were assembled and analyzed by using the VECTOR NTI suite 9.0 software (Invitrogen).

(138) TABLE-US-00004 TABLE D Bacterial strains and plasmids Reference Strain or plasmid Genotype or description or source Strains E. coli DH5 supE44 hsdR17 recA1 endA1 New England gyrA96 thi-1 relA1 Biolabs S. enterica serovar galE ilvD viaB (Vi-) H.sub.2S- (Germanier Typhi Ty21a and Fuer, 1975) S. flexneri 2a 2457 Lab stock S. flexneri 3a J99 Lab stock Ty21a-Ss (MD77) S. sonnei O-antigen genes integrated This study into tviD-VexA on the chromosome, Kan.sup.s, Amp.sup.s, Cm.sup.s Ty21a-Ss-Kan S. sonnei O-antigen genes integrated This study (MD67) into tviD-VexA on the chromosome, Kan.sup.r, Amp.sup.s, Cm.sup.s Ty21a-Sd (MD149) S. dysenteriae O-antigen genes This study, integrated into tviD-VexA on the FIG. 4 chromosome, expressed from lpp promoter, Kan.sup.s, Amp.sup.s, Cm.sup.s Ty21a-Sd1 S. dysenteriae O-antigen genes This study (MD174) integrated into tviD-VexA on the FIG. 5 chromosome, expressed from lpp promoter, Kan.sup.s, Amp.sup.s, Cm.sup.s Ty21a-Y (MD114) S. flexneri rfb operon integrated into This study tviD-vexA on the chromosome, FIG. 14 expressed from native promoter, Kan.sup.s, Amp.sup.s, Cm.sup.s Ty21a-2a (MD194) S. flexneri 2a O-antigen genes This study integrated into tviD-vexA on the FIG. 14 chromosome, expressed from native promoter, Kan.sup.s, Amp.sup.s, Cm.sup.s Ty21a-3a (MD196) S. flexneri 3a O-antigen genes This study integrated into tviD-vexA on the FIG. 14 chromosome, expressed from native promoter, Kan.sup.s, Amp.sup.s, Cm.sup.s Ty21a-2a1 (MD212) S. flexneri 2a O-antigen genes This study integrated into tviD-vexA on the FIG.3 14 chromosome, expressed from lpp promoter, Kan.sup.s, Amp.sup.s, Cm.sup.s S. dysenteriae type 1 Virulent strain (Mendizabal- 1617 Morris et al., 1971; Neill et al., 1988) 1617stxA Deletion of most of stxA of strain (Xu et al., 1617 2007) S. sonnei 53GI Form I (phase I), virulent isolate (Kopecko et al., 1980) Plasmids pGB-2 pSC101 derivative, low-copy (Churchward plasmid; Sm.sup.r, Spc.sup.r et al., 1984) pKX65 S. sonnei genes cloned into pGB-2 (Xu et al., 2002) pXK65 pGB-2 containing the cloned Rfb (Xu et al., region of S. sonnei 2002 pKD4 Kan.sup.r flanked by FRT sites, Amp.sup.r, (Datsenko oriR6Kgamma and Wanner, 2000) pKD46 Gam-beta-exo proteins under the (Datsenko control of arabinose promoter, ts- and Wanner, rep.sup.a, Amp.sup.r 2000) pCP20 yeast Flp recombinase gene FLP, (Cherepanov Cm.sup.r, Amp.sup.r, ts-rep.sup.a and Wackernagel, 1995) pMD35-36 pSC101 derivative, low-copy This study plasmid, Kan.sup.r flanked by FRT pMD-TV pSC101 derivative, low-copy This study plasmid, Kan.sup.r flanked by FRT, containing homologous regions for Ty21a tviD and vexA genes pMD-TV-Ss-1 S. sonnei O-antigen genes cloned This study (SEQ ID NO: 24) into pMD-TV pMD-TV-Sd-4 S. dysenteriae 1 O-antigen genes This study cloned into pMD-TV pMD-TV-lpp lpp promoter cloned into pMD-TV This study .sup.ats-rep; temperature sensitive replication
Chromosomal Integration of O-Antigen Genes

(139) The S. sonnei O-antigen biosynthetic genes described above, engineered between 500-1000 bp regions of Ty21a chromosome homology to enhance recombination efficiency, were integrated into the Ty21a chromosome using red recombination (Datsenko et al. (2000) Proc. Natl. Acad. Sci. USA, 97:6640-6645). Ty21a was transformed with pKD46 and grown at 30 C. in TBS-Amp supplemented with 0.01% galactose and 0.01% glucose and induced with L-arabinose until OD.sub.600=0.7. The resulting cells were made electrocompetent by washing with 10 mM Hepes and 10% glycerol and concentrating 500-fold by centrifugation. As shown in FIG. 1, pMD-TV-Sswas used as a template with the tviD forward primer and vexA reverse primer for PCR amplification. This PCR-amplified region contains part of the tviD gene, a Kan.sup.r gene flanked by FTR sites, a genetically-minimized set of essential S. sonnei O-antigen biosynthetic genes, and the vexA gene.

(140) The PCR product was DpnI-digested to remove circular plasmid DNA, was purified, and 1-2 g was transformed into freshly grown electrocompetent cells of Ty21a expressing red proteins. Thus, the linear ds-DNA amplicon was used to transform competent Ty21a cells expressing the red proteins from pKD46.

(141) Transformants for the above-described amplicon were selected for Kan.sup.r; the transformed cells were recovered by growing in SOC media at 30 C. and plating on TSA-Kan plates. Of note, the above PCR products were DpnI-digested to remove any remaining circular plasmids. Despite this step, a few copies of plasmid inevitably escaped DpnI-digestion and generated Kan.sup.r transformants. These plasmid transformants can then recombine at either chromosomal region of homology, creating unstable merodiploids, making molecular characterization confusing, because PCR results reflect a mixture of possibilities. After primary selection with antibiotic, mutants were maintained on medium without an antibiotic. Isolates were colony-purified once non-selectively at 37 C. and then tested for ampicillin sensitivity to demonstrate loss of plasmid pKD46.

(142) To detect appropriate chromosomal integrants (i.e., containing 15,532 kb inserts of S. sonnei form 1 genes inserted between tviD and vexA), DNA from individual transformants was subjected to PCR using primers prMD92 and prMD124 (FIG. 1) recognizing Ty21a sequences just upstream and downstream of the targeted integration site. Colonies were further analyzed by PCR to confirm chromosomal integration with primers prMD92, GTTGCGGTAATGGTATAACGAAATAACAGATAC (SEQ ID NO:25) and prMD124, CACGCAATATTTCAATGATGGCAAC (SEQ ID NO:26), as shown in FIG. 1. Furthermore, expression of the form 1 O-antigen was confirmed by slide-agglutination and Western immunoblot with form 1-specific antisera. (DIFCO-BBL). The wild-type Ty21a sequence, in the integration region tviD-tviE-vexA, detected by using primers prMD92 and prMD124, generated a 4 kb band. Undesired integration of the whole plasmid into the Ty21a chromosome at tviD and/or vexA could also be detected by PCR.

(143) Next, the desired Kan.sup.r chromosomal integrants of linear S. sonnei DNA were transformed with temperature-sensitive plasmid pCP20, which expresses the FLP recombinase, to eliminate the FRT-flanked Kan.sup.r cassette. In brief, chromosomal integrants expressing Kan.sup.r were transformed with pCP20 (Cherepanov et al. (1995) Gene, 158:9-14), and Cm.sup.r transformants were selected at 30 C., after which a few isolates were colony-purified non-selectively at 37 C. and then tested for loss of all antibiotic resistances.

(144) Antibiotic-sensitive chromosomal integrants were further analyzed by PCR to demonstrate deletion of the Kan cassette. Furthermore, the final PCR products generated from primers prMD92 and prMD124, were sequenced entirely. When the chromosomally integrated Ty21a-Ss sequence was compared to the GENBANK S. sonnei O-antigen gene cluster AF294823 (SEQ ID NO:23), only a single change (E.sub.273K) was detected in wbgZ (orf13 in FIG. 1), which had no apparent effect on O-antigen expression, as determined by slide agglutination and western blotting of resulting LPS.

Example 3. Two-Year Ear Studies to Attain Stable Expression of the Approximately 12 kb Shigella sonnei O-Antigen Gene Region Via Recombinational Insertion into the Chromosome of Vaccine Vector Strain Salmonella Typhi Ty21a

(145) Expression in Low Copy Plasmid Vector

(146) S. sonnei O-antigen genes were cloned into the low copy plasmid pGB-2, and this heterologous O-antigen was stably expressed in vaccine vector Ty21a, with only a 2% loss after 60 generations. This plasmid contains a spectinomycin-resistance gene cassette for genetic selection purposes. In contrast, high copy plasmid vectors, containing this cloned Shigella region were not genetically stable (3). Although pGB-2 appeared suitably stable, the spectinomycin-resistance gene needed to be removed.

(147) Achieving Stable Expression after Removal of Antibiotic Cassette

(148) S. sonnei genes on pGB-2 were stably expressed with 98% stability for 60 generations of growth in the absence of antibiotics. For FDA regulatory purposes, however, the antibiotic resistance cassette needs to be removed prior to administration of the vaccine to humans on a large scale. Thus, attempts were made to remove the resistance gene cassette by deletion using targeted restriction endonucleases, by deletion using recombination techniques or PCR-generated deletions. Regardless of the method used or the length of the region deleted, removal of the antibiotic cassette resulted, unexpectedly, in plasmid instability. Plasmid loss over 60 generations reached 50%. The spectinomycin cassette was then replaced with a kanamycin-resistance gene cassette flanked by FRT sites. If the kanamycin-resistance could be removed via recombination between FRT sites, perhaps the resulting plasmid would be genetically stable. However, removal of kanamycin-resistance also resulted in plasmid instability.

(149) Construction of pMD35-36 for Chromosomal Integration of O-Antigen Genes

(150) In order to achieve stable expression of heterologous Shigella sonnei O-antigen genes in Ty21a in the absence of an antibiotic resistance cassette, the O-antigen genes were integrated into the Ty21a chromosome. To facilitate this task, the low copy plasmid pMD35-36 was constructed to contain a kanamycin-resistance gene cassette, flanked by FRT sites, and located adjacent to a multiple cloning site (MCS) locus. In addition, the kanamycin-resistance cassette, FRT sites, and MCS locus were synthesized by PCR from this plasmid using primers containing regions of homology to the Ty21a chromosome for recombinational insertion. The Ty21a tviD and vexA gene regions were used for homology. They are located adjacent to each other in the Vi capsule biosynthesis operon, which is nonfunctional in Ty21a.

(151) Cloning S. sonnei Genes into pMD35-36

(152) Essential genes of the S. sonnei O-antigen operon (eliminating a non-essential IS630 element) were cloned into plasmid pMD35-36 in two steps.

(153) Optimizing Lambda Red Expression in Ty21a

(154) Datsenko and Wanner (2000) (Datsenko et al. (2000) Proc. Natl. Acad. Sci. USA, 97:6640-6645) previously described a method based on the highly efficient lambda phage red recombination system that enables one to create mutations within a targeted gene via recombinational replacement of a chromosomal sequence with a selectable antibiotic resistance gene that is generated by PCR, using primers with 36 to 50 bp extensions that are homologous to the gene targeted for mutation. Lambda red proteins are expressed from plasmid pKD46, and the expression is tightly regulated through an arabinose-inducible promoter. This lambda red system has been widely utilized for specific gene inactivation in E. coli, Salmonella and Shigella species (Kotloff et al. (1999) Bull. WHO, 77:651-666), and for introducing small biological tags (Kewon (2008) Curr. Opin. Infect. Dis., 21:313-318).

(155) To facilitate chromosomal insertion, the S. sonnei O-antigen genes were cloned into plasmid pMD35-36, as described above. Initially, 50 bp regions of chromosomal homology to tviD and vexA were used. PCR amplification of this large recombinational construct resulted in a 13.5 kb fragment, which includes the S. sonnei O-antigen biosynthetic genes, the kanamycin-resistance gene cassette flanked by FRT sites, all contained within two regions of chromosomal homology, consisting of 50 bp homology to tviD and vexA. This PCR product was transformed into Ty21a cells containing pKD46. No anticipated chromosomal inserts, detected as kanamycin-resistant colonies, were obtained, even when this experiment was repeated. As an experimental control, attempts were made to insert the smaller 1.5 kb kanamycin-resistance gene cassette, without any Shigella sequences included. This also resulted in failure. This result was unexpected, as the smaller 1.5. kb Kan.sup.R insert fragment should have integrated into the chromosome.

(156) Based on a hypothesis that this lack of success might be due to insufficient lamda red recombinant protein expression in Salmonella Typhi Ty21a (the published conditions for lambda red expression (i.e., 1 mM arabinose) in Salmonella (Kewon (2008) Curr. Opin. Infect. Dis., 21:313-318) and E. coli (Kotloff et al. (1999) Bull. WHO, 77:651-666) were not successful in Ty21a), higher arabinose concentrations of 2 mM, 10 mM, or 25 mM were attempted and found to be insufficient to express lambda red proteins from pKD46 in Ty21a, as detected by chromosomal integration of the 1.5 kb kanamycin-resistance cassette. This result was very unexpected.

(157) Finally, a 100-fold increase in the recommended 1 mM concentration of arabinose was tried, and it was found that 100 mM was needed to generate sufficient lambda red expression in Ty21a to facilitate chromosomal insertion of the small 1.5 kb kanamycin-resistance gene cassette, using 50 bp regions of chromosomal homology. However, the large 13.5 kb PCR product containing the S. sonnei O-antigen biosynthetic genes was not integrated into the chromosome.

(158) Homology Extensions Increased to 150 Bases

(159) In order to facilitate chromosomal integration of the larger insert, the chromosomal homology extensions on the PCR primers were increased from 50 to 150 bases each. Although these increased regions of homology facilitated chromosomal insertion of the 1.5 kb kanamycin-resistance cassette at an enhanced frequency, the large 13.5 kb PCR product failed to integrate into the chromosome after several attempts. This result was also unexpected, since general recombination usually proceeds with 50-100 bp of homology, and lambda Red-mediated recombination is usually more efficient than bacterial general recombination.

(160) Construction of Chromosomal Insertion Plasmid pMD-TV

(161) The use of large 500-1000 bp regions of homology required cloning these regions into the chromosomal insertion plasmid. First, Ty21a genomic DNA was prepared. Next, the vexA gene (1000 bp) and part of the tviD gene (500 bp) were PCR-amplified from Ty21a genomic DNA. These two PCR amplicons were cloned into pMD35-36 in separate steps. In addition, the MCS locus was further changed to contain new and different restriction sites. This resulted in the construction of a new chromosomal insertion vector, pMD-TV, containing 500-1000 bp arms of chromosomal homology. These longer arms were engineered to increase the area of homology with the Ty21a chromosome and thus increase the chances for integration of large DNA regions (i.e., greater than 5 kb).

(162) Cloning S. sonnei Genes into pMD-TV

(163) Essential genes of the S. sonnei O-antigen biosynthetic operon were cloned in two steps into the plasmid pMD-TV, eliminating a nonessential IS630 element.

(164) Optimizing Competent Cells

(165) After the S. sonnei genes were cloned into the new pMD-TV plasmid, a 15.5 kb PCR product, which contains the kanamycin-resistance cassette, the S. sonnei O-antigen genes, and the arms of Ty21a homology, was transformed into Ty21a expressing the lambda red proteins. Unexpectedly, no transformants were achieved, even after exhaustive plating and a repeat experiment. In order to address the question of whether the transformation efficiency of the large linear DNA fragment was too low, fresh competent Ty21a cells were further optimized by increasing the number of final washes from two to three, increasing the number of cells in each transformation reaction, and also increasing the amount of linear DNA added per reaction to about 1-2 g. These changes allowed for the successful chromosomal integration into Ty21a of the large 13.5 kb fragment encoding the heterologous S. sonnei O-antigen. (Datsenko et al. (2000) Proc. Natl. Acad. Sci. USA, 97:6640-6645; Uzzau et al. (2001) Proc. Natl. Acad. Sci. USA, 98:15264-15269; Xu et al. (2002) Infect. Immun., 70:4414-4423).

Example 4. O-Antigen Expression Determined by Silver Staining and Immunoblotting. LPS Analysis by Silver-Stain and Western Immunoblotting was Employed to Examine LPS Expression in Parent and Recombinant Strains Expressing Heterologous O-Antigen

(166) O-Antigen Expression Analyses

(167) Slide agglutination reactions were performed with rabbit polyclonal antisera against S. sonnei (phase I) or against Salmonella Typhi O-specific 9 factor (DIFCO). For immunoblotting, Salmonella, Shigella and E. coli strains with or without various recombinant plasmids were grown overnight with aeration at 37 C. in media containing appropriate antibiotics. LPS was purified using an LPS extraction kit (Bocca Scientific) according to the manufacturer's instructions. Purified LPS was separated by Tris-glycine PAGE. Standard Western blotting procedures were carried out with the above antibodies for identification of specific LPS types. Silver-staining analysis was performed using the SILVERXPRESS Silver Staining Kit (Invitrogen) according to the manufacturer's instructions. As revealed by silver-staining of isolated polysaccharide separated by SDS-PAGE (FIG. 2, Panel A), E. coli DH5, a rough mutant (lane 1), was observed to express S. sonnei O-antigen as both an LPS ladder and a slower-migrating Group 4 capsule (lane 2). Ty21a (lane 3) was found to produce a typical 9,12 LPS short ladder pattern, which is altered both by the addition of an extended form 1 LPS ladder pattern and slower-moving form 1 O-antigen capsule expression (lanes 4, 5, 6, 7). Wild-type S. sonnei was observed to express a form 1 LPS ladder pattern, the majority topping out at a chain length of 20 O-repeats, by silver stain analysis (FIG. 2, Panel A, lane 8).

(168) Western immunoblotting (FIG. 2, Panel B) showed specific antibody reaction with form 1 polysaccharide in all strains expressing S. sonnei O-antigen, regardless of whether the form 1 genes were carried by plasmids (i.e., pXK65, pMD-TV-Ss-1) or integrated into the Ty21a chromosome [i.e., Ty21a-Ss (or MD77) Ty21a-Ss-Kan (or MD67)]. Although a form 1 LPS ladder pattern was easily visible in E. coli (FIG. 2, Panel B, lane 2) and wild-type S. sonnei (lane 8), the majority of form 1 O-antigen in all expressing isolates appeared to be the slower migrating group 4 capsule expression. As noted below, Form 1 O-antigen was highly immunogenic regardless of expression as LPS or in capsular form (FIG. 3).

Example 5. Stability of Heterologous Form 1 O-Antigen Expression in Ty21a

(169) Stability of recombinant clones of Ty21a-Ss expressing S. sonnei O-antigen were tested by immunoblotting of colonies plated from an overnight culture (24 hours), and it was diluted 1:100 and grown for an additional24 hours. Colonies, transferred to a nitrocellulose membrane, were analyzed by standard Western blotting procedures using the LPS-specific antibodies specified above.

(170) The new recombineered vaccine strain Ty21a-Ss, which is antibiotic-sensitive and contains chromosomally integrated form 1 biosynthetic genes, was grown at high dilution in TSB plus 0.01% galactose and 0.01% glucose without antibiotics for 24 hours, which represents 25 generations of growth. This culture was diluted 1:100 and grown for an additional 24 hours, which represents 50 generations. The resulting cells were plated on TSA containing 0.01% galactose and 0.01% glucose, grown overnight at 37 C., and colony immunoblots were performed to examine form 1 expression, as described above. All of 500 colonies tested retained S. sonnei form I O-antigen expression, demonstrating 100% stability of the chromosomally integrated genes.

Example 6. Antibodies to Both S. Typhi and S. sonnei LPSs are Elicited in Mice Following Immunization with Ty21a-Ss

(171) Mice were immunized (3 doses IP spaced 2 weeks apart) with the recombineered vaccine strain Ty21a-Ss, the parent strain Ty21a or control PBS. Eight-week-old female Balb/c mice were immunized with vaccine candidate strains (Ty21a-Ss) or negative controls, Ty21a alone, and PBS. Ty21a-Ss and Ty21a controls were grown overnight in TSB supplemented with 0.01% galactose and 0.01% glucose, washed, and suspended in sterile PBS to a concentration of 0.8-1.610.sup.8 CFU per ml. They were tested one week after each dose for the presence of antibodies against S. sonnei or Ty21a LPS by ELISA, as described below. As shown in FIG. 3, immunization with Ty21a-Ss resulted in increased anti-LPS antibody titers after each dose, but peaked after 2 doses at very high titers of 400,000 for anti-form 1 serum IgG, and after 3 doses at similarly high titers for anti-Salmonella Typhi LPS antibodies. These results further confirm the stable expression of both heterologous S. sonnei O-antigen and homologous Ty21a LPS in Ty21a-Ss. Moreover, the parent strain Ty21a elicited serum IgG antibodies that reacted only with Ty21a LPS, and were at essentially the same titer as that elicited by the recombinant Ty21a-Ss.

Example 7. Protection from Virulent S. sonnei Challenge Conferred by Ty21a-Ss

(172) Mice are typically used to demonstrate immune stimulation by a Salmonella Typhi vaccine strain and to measure specific protection against parenteral challenge with virulent Shigella. Balb/C mice were immunized with Ty21a-Ss, Ty21a alone, or saline by the IP route with three doses of vaccine spaced two weeks apart. Mice were inoculated intraperitoneally with a 0.25-ml dose containing 2-410.sup.7 CFU per mouse of either vaccine, control Ty21a cells, or 0.25 ml sterile saline, for three total doses spaced two weeks apart. Mice were tail-bled one week after every injection. Two weeks following the last dose, mice were challenged i.p. with S. sonnei 53G at a dose of approximately 100LD50. Immunized and control mice were challenged intraperitoneally, 2 weeks after final immunization, with 510.sup.6 CFU/ml of freshly grown, mid-log-phase S. sonnei strain 53GI in 0.25 ml (210.sup.6 CFU per mouse) of 5% hog gastric mucin (Sigma) dissolved in sterile saline (i.e., approximately 100 times the 50% lethal infectious dose [LD.sub.50]). Survival was monitored for 72 h.

(173) TABLE-US-00005 TABFE E Mouse protection against virulent S. sonnei challenge Groups of 10 mice immunized with: Survivors/total Ty21a-Ss (strain MD 77) 10/10 Ty21a 0/10 Saline 0/10
Detection of Anti-LPS Antibodies by ELISA

(174) S. sonnei 53G Phase 1 was grown overnight at 37 C. with aeration in TBS while S. Typhi Ty21a-Ss was grown in TSB supplemented with 0.01% galactose and 0.01% glucose. LPS was purified using a LPS extraction kit (Bocca Scientific) according to the manufacturer's instructions. Microtiter plates were coated with S. sonnei (phase I) or Salmonella Typhi Ty21a purified LPS in 0.1 M Na.sub.2CO.sub.3/NaHCO.sub.3 pH 9.5. Coated microtiter plates were blocked with blocking buffer containing 1% BSA (Sigma) in TBST (TBS with 0.5% tween-20) for two hours. Serial dilutions of serum were added to each plate and incubated at 4 C. overnight. After washing six times with TBST, bound antibodies were detected with HRP-conjugated goat anti-mouse IgG (SOUTHERNBIOTECH). Endpoint titers were defined as the reciprocal of the antibody dilution for the last well in a column with a positive OD for each sample after subtracting the background. Background values were determined with pre-immunization sera, where the OD values of the pre-immunization sera were averaged and then doubled. This value was subtracted from the OD of all the wells containing titrations of every mouse serum sample. Each data point represents the average endpoint titer of two independent ELISAs performed for every mouse serum sample. The individual sample titers and the meanSEM for each group of ten mice are shown in FIG. 3.

(175) Sequences are available under GENBANK accession numbers JX436480 for pMD-TV (SEQ ID NO:1) and JX436479 for Ty21a-Ss tviD-vexA region (SEQ ID NO:2). This stringent challenge resulted in 100% mortality in Ty21a alone- or saline-immunized mice. However, mice immunized with the recombineered vaccine strain Ty21a-Ss were 100% protected against the S. sonnei challenge.

(176) Thus, disclosed herein are attempts to stabilize the expression of heterologous S. sonnei LPS antigens in oral vaccine vector Ty21a to create a candidate that will protect against both typhoid fever and shigellosis due to S. sonnei. Previous studies had shown that a cloned large block of Shigella LPS biosynthetic genes (i.e., 10-15 kb) was much more stable in the low copy plasmid pGB-2 than in high copy plasmid vectors (Xu et al. (2007) Vaccine, 25:6167-6175; Xu et al. (2002) Infect. Immun., 70:4414-4423). When attempting to remove the antibiotic resistance selective marker in pGB-2, which removal would be required for human vaccine use, unexpected and unexplained genetic instability was encountered. For example, Kan.sup.r (kanamycin resistance) pGB-2 carrying the S. sonnei form 1 O-antigen biosynthetic genes was 95-98% genetically stable when grown for 60 generations in the absence of antibiotic selective pressure. However, removal of the antibiotic resistance gene function by insertion or small deletion resulted in a plasmid with 60% genetic stability (unpublished data).

(177) A recent study by Yu, et al. (2011) inserted small 2 kb gene regions into the Salmonella chromosome. Thus, the red recombination system was modified to allow the introduction of large blocks of foreign DNA, more than 15 kb, into the chromosome of Salmonella Typhi, termed genomic super-recombineering. This task required expanding the size of the necessary homologous recombination regions from 50 bp as originally proposed (Datsenko et al. (2000) Proc. Natl. Acad. Sci. USA, 97:6640-6645) to 500-1000 bp in order to increase the efficiency of recombination. These expanded regions of homology were engineered into plasmid vector pMD-TV, which was specifically created to insert large regions of DNA into a susceptible chromosome at a chosen, targeted integration site (i.e., in this case, the tviE gene region of the non-functional Vi gene locus of Ty21a was chosen). Furthermore, the expression of the red recombination proteins in Ty21a and the concentration of PCR-amplified DNA needed for efficient chromosomal insertion of this large amplicon had to be optimized. Utilizing this optimized genomic super-recombineering technique, the S. sonnei O-antigen genes were inserted into the Ty21a Vi gene locus. Heterologous S. sonnei O-antigen expression in this Ty21a-Ss chromosomal integrant is 100% genetically stable. Additionally, this method allows for the use of antibiotic selection during strain construction and removal of a FRT-bracketed antibiotic resistance gene after all genetic manipulations are completed. Of especial importance, this new vaccine candidate strain elicits robust serum IgG antibody responses against both heterologous S. sonnei form I LPS and homologous Salmonella Typhi LPS in mice and protects mice 100% against a lethal challenge dose of virulent S. sonnei.

(178) This chromosomal super-recombineering method has allowed for the development of a much improved vaccine candidate that is 100% genetically stable. This technique can be applied to many different bacterial genera and can be used to insert different foreign antigens at multiple targeted chromosomal sites, after which the associated antibiotic resistance gene, used for efficient selection, can be removed. The cloning of the S. dysenteriae serotype 1 O-antigen essential biosynthetic genes on plasmid pGB-2 has been previously described (Xu et al. (2007) Vaccine, 25:6167-6175). The pGB-2 cloning of the S. flexneri 2a and 3a LPS regions has been undertaken to construct additional multivalent typhoid-shigellosis vaccine components. It is, thus, contemplated to make similar super-recombineered chromosomal insertions of, for example, minimal-sized LPS genes of S. flexneri 2a, S. flexneri 3a, and S. flexneri 6, each into a separate Ty21a strain. The final multivalent vaccine will consist of 5 different strains comprising a multifunctional vaccine for protection against enteric fevers (aimed at typhoid, but with moderate cross-protection against paratyphoid fevers) and the predominant causes of shigellosis, projected to protect against 85% of shigellosis worldwide (Noriega et al. (1999) Infect. Immun., 67:782-788). In an additional embodiment, other antigens are incorporated into Ty21a (or another suitable vector strain) for vaccine purposes (e.g. anthrax protective antigen, plague F1 and V antigens, viral antigens to protect against viral diseases, malaria antigens) or genetic constructs expressing anti-tumor proteins or siRNAs directed at inhibiting tumor growth and metastasis for anti-cancer therapeutic purposes.

(179) Recent collaborative studies (Ohtake et al. (2011) Vaccine, 29:2761-2771) have led to the development of a formulation and foam-drying method that results in a temperature-stable, dried Ty21a vaccine that obviates the need for refrigeration during distribution/immunization and will extend the shelf life to 5 years or greater at 4 C., enhancing the potential value of this multifunctional enteric vaccine for use in travellers, the military, and in developing world populations.

Example 8. Cloning and Chromosomal Insertion of a Second LPS Locusof Shigella dysenteriae O-Antigen Biosynthetic Genes

(180) Cloning S. dysenteriae O-Antigen Genes into pMD-TV

(181) S. dysenteriae O-antigen genes were PCR-amplified from S. dysenteriae serotype 1 strain 1617 genomic DNA (Xu, et al. (2007) Vaccine 25:6167-6175). Primers prMD127.dy.F.HindIII gatcgaagcttggcattttttgtcatttttggatgc (SEQ ID NO:27) and prMD128.dy.R.wbbP.BamHI gatcgggatccatcgatatggctgggtaaggtcatg (SEQ ID NO:28) were used first to amplify the wbbP gene. The resulting PCR product and pMD-TV were digested with HindIII and BamHI, PCR-purified, and ligated. Next, primers prMD129.F.BamHI gatcgggatcctaatgaaaatctga ccgaatgtaacgg (SEQ ID NO:29) and prMD130.R.EcoRI gatcggaattctcacattaatgctaccaaaaagagtcgc (SEQ ID NO:30) were used to amplify the larger S. dysenteriae 1 rfb gene cluster. The resulting PCR product and plasmid pMD-TV-wbbP were digested with BamHI and EcoRI, PCR-purified, and ligated to construct pMD-TV-Sd-4.

(182) Integrating S. dysenteriae O-Antigen Genes into the Ty21a Chromosome

(183) The S. dysenteriae O-antigen biosynthetic genes that were cloned into plasmid pMD-TV to construct pMD-TV-Sd-4 were used as a template for PCR with the tviD forward primer and vexA reverse primer. The PCR-amplified region was 13,574 bp and contains part of the tviD gene, Kan.sup.r gene cassette flanked by FRT sites, S. dysenteriae O-antigen biosynthetic genes and the vexA gene. The PCR amplicon was transformed into Ty21a competent cells expressing red proteins from pKD46 and selected for Kan resistance as described (Dharmasena et al.). PCR with primers upstream and downstream of the site of integration, prMD92 and prMD124, resulted in a 14.5 Kb Kan.sup.r insert band. After removing the Kan.sup.r cassette as previously described (Dharmasena et al.), antibiotic-sensitive chromosomal integrants were further analyzed by PCR for deletion of the Kan.sup.r cassette, and the PCR product (MD 149/Ty21a-Sd13 Kb band) obtained from primers prMD92 and prMD124 was sequenced. The previously sequenced S. dysenteriae wpp gene (GENBANK accession no. AY763519; SEQ ID NO:4) and that of the S. dysenteriae strain 1617 strain were identical except for two bases, where CA is changed to AC at position 619-620 in the strain 1617 wpp gene. No mutations were detected in the chromosomally inserted wpp in Ty21a-Sd strain. When the Ty21a-Sd chromosomal insert Rfb sequence was compared to the GENBANK accession no. AY585348 (SEQ ID NO:3) for the S. dysenteriae 1617 strain Rfb O-antigen gene cluster, only a single A to G transition (N130D) was detected in the gene rmlD (FIG. 4), which did not affect O-antigen expression as determined by slide agglutination and ELISA expression studies.

(184) Replacing the Wpp Native Promoter with lpp

(185) The low copy plasmid pMD-TV is a pSC 101 derivative existing as 5 copies per cell. Thus, the plasmid pMD-TV-Sd-4 in Ty21a has 5 copies of S. dysenteriae O-antigen genes per cell, while Ty21a-Sd (MD149) [i.e., the strain with S. dysenteriae O-antigen genes integrated into the Ty21a chromosome] has only one copy of the S. dysenteriae O-antigen biosynthetic genes per cell. Note, from previous studies (Dharmasena, et al.), that the S. sonnei LPS:S. Typhi Ty21a LPS ratio, as assessed by ELISA, was approximately 1 in strains expressing the S. sonnei O-antigen genes from the Ty21a chromosome (Ty21a-Ss) compared to the same genes expressed from the pGB-2 plasmid (pMD-TV-Ss) in Ty21a. However, the S. dysenteriae LPS: S. Typhi Ty21a LPS ratio was considerably less than 1 in the strain expressing S. dysenteriae O-antigen genes from the chromosome (Ty21a-Sd, MD 149) than from the plasmid (pMD-TV-Sd-4 in Ty21a), as determined by ELISA. Thus, attempts were made to increase the S. dysenteriae LPS expression by replacing the native wpp promoter with the Escherichia coli lpp promoter, which is a highly transcribed constitutively active promoter.

(186) pMD-TV-lpp was used as a template for PCR with the tviD forward primer and the lpp promoter reverse primer containing a 150 bp wpp homology extension (prMD151.lpp.R

(187) TABLE-US-00006 aggaatggcgcctgctttttttattatttccttggatgaatcattatagt cagtagcaaaagcatagactgaaatccctttcttggttagtgtttttatt aaatccaatctaaacaaaatcatagcatttgctgtgttccctattattga gatcttcatatgcctctcctttcattattaataccctctagagttc; SEQIDNO:31).
The PCR-amplified region (which was 13,574 bp) contains part of the tviD gene, Kan.sup.r cassette flanked by FTR sites, a 200 bp lpp promoter and the first 150 bp of the S. dysenteriae 1 wpp gene. The PCR products were transformed into Ty21a-Sd (MD149) competent cells expressing red proteins from pKD46 and selected initially for Kan.sup.r resistance. Subsequently, the Kan.sup.r cassette was removed and the remaining chromosomal insert was sequenced as described (Dharmasena, et al. 2013 Intl J Med Microbiol 303:105-113) to construct Ty21a-Sdl (MD174). Expression data suggest that Ty21a-Sdl (MD174) expresses a more desirable S. dysenteriae LPS: S. Typhi Ty21a LPS ratio of approximately 1, than Ty21a-Sd (MD 149) containing the native promoter, as determined by ELISA. Indeed, Western blot with anti-S. dysenteriae antibody shows that replacing wpp native promoter with lpp (Ty21a-sdl, MD174) results in higher S. dysenteriae LPS expression than that of Ty21a-sd (MD149) and the LPS levels are comparable to plasmid expression (FIG. 6). Also O-antigen expression of both these strains were 100% stable over 75 generations of growth in vitro determined by colony immunoblotting.
Genetic Stability of Heterologous S. dysenteriae 1 O-Antigen Expression in Ty21a

(188) The newly recombineered vaccine strains Ty21a-Sd (MD149), SEQ ID NO:32, and Ty21-Sdl (MD174), SEQ ID NO:33, which are antibiotic-sensitive and contain chromosomally integrated Sd1 O-antigen biosynthetic genes, were grown at high dilution in Tryptic Soy broth (TSB) plus 0.01% galactose and 0.01% glucose without antibiotics for 24 hours. This represents 25 generations of growth. The resulting cells were plated on TSA containing 0.01% galactose and 0.01% glucose, grown overnight at 37 C., and colony immunoblots were performed to examine S. dysenteriae O-antigen expression with rabbit polyclonal antisera against S. dysenteriae 1 (Difco). All of 200 colonies tested retained S. dysenteriae serotype 1 O-antigen expression, demonstrating 100% stability of the chromosomally integrated genes

(189) Mouse Immunogenicity

(190) Eight week-old female AJ mice, 10 in each group, were immunized with two vaccine candidate strains (Ty21a-sd and Ty21a-sdl) or negative controls Ty21a alone and PBS. Ty21a-sd, Ty21a-sdl, and Ty21a controls were grown overnight in TSB supplemented with 0.01% galactose and 0.01% glucose, washed, and suspended in sterile PBS to a concentration of 4-810.sup.7 CFU per ml. Mice were inoculated intraperitoneally with a 0.5-ml dose containing 2-410.sup.7 CFU per mouse of either vaccine, control Ty21a cells, or 0.5 ml sterile saline, for three total doses spaced two weeks apart. Mice were tail-bled one week after the last injection. Immunization with both vaccine strains (Ty21a-sd and Ty21a-sdl) resulted in a moderate antibody titer of around 15,000 against S. dysenteriae compared to 400,000 for S. sonnei. Moreover, the parent strain Ty21a elicited serum IgG antibodies that cross reacted with S. dysenteriae LPS at a low level (500) (FIG. 7). Although Ty21a-sd elicited high antibody titer against S. Typhi LPS (100,000), which was essentially the same titer as that elicited by the parent strain Ty21a, the S. Typhi LPS antibody titer elicited by Ty21a-sdl was 4 fold less. This is possibly due to higher S. dysenteriae LPS expression in Ty21a-sdl compared to Ty21a-sd. However, these results confirm the stable expression of both heterologous S. dysenteriae O-antigen and homologous Ty21a LPS in Ty21a-sd and Ty21a-sdl.

(191) Mouse Protection from Virulent S. dysenteriae Challenge

(192) Immunized and control mice were challenged intraperitoneally, 2 weeks after final immunization, with 1.510.sup.6 CFU/ml of freshly grown, mid-log-phase virulent S. dysenteriae 1 strain 1617stxA in 0.5 ml (7.510.sup.5 CFU per mouse) of 5% hog gastric mucin (Sigma) dissolved in sterile saline (i.e., approximately 10 times the 50% lethal infectious dose [LD50]). Survival was monitored for 72 h (FIG. 8). Although this challenge resulted in 100% mortality in saline-immunized mice, only 50% mortality resulted in Ty21a-alone immunized mice. This may be due to low level of S. dysenteriae LPS cross-reacting antibodies elicited by Ty21a, as determined by ELISA, providing some protection. Also, a low level of protection conferred by Ty21 has been observed before (Noriega, et al. 1999 Infection and immunity 67:782-788). The mice immunized with the recombineered vaccine strain Ty21a-Sd and Ty21a-Sdl were 100% and 70%, respectively, protected against the S. dysenteriae challenge.

Example 9. Chromosomal Integration of Shigella flexneri 2a and 3a O-Antigen Genes

(193) There are 14 S. flexneri serotypes on the basis of antigenic determinants on the O-antigen. In all of the S. flexneri serotypes, with the exception of serotype 6, all share a common polysaccharide backbone comprising repeating units of the tetrasaccharide N-acetylglucosamine-rhamnose-rhamnose-rhamnose (FIG. 9). The basic O-antigen backbone is called the serotype Y. The genes involved in the biosynthesis of the O-antigen backbone are located in the rfb operon (10 kb) flanked by gnd and galF genes. Modification of the O-antigen backbone by the addition of glucosyl and/or O-acetyl groups to different sugars in the tetrasaccharide gives rise to different serotypes. The genes involved in the O-antigen modification are encoded on temperate bacteriophages (Allison, et al. 2000 Trends in Microbiol 8:17-23). Two genes encoded on lysogenic bacteriophage SfII were found to be essential for 2a serotype conversion. These genes are bgt, which encodes a putative bactoprenol glucosyl transferase, and gtrII, encoding the putative type II antigen determining glucosyl transferase (Mavris, et al. 1997 Mol Microbiol 26:939-950).

(194) S. flexneri 3b O-antigen contains an O-acetyl modification, and S. flexneri 3a O-antigen contains a glucosyl modification in addition to the O-acetyl modification. The gene, oac, encoded on lysogenic bacteriophage Sf6, was found to be essential for the 3b serotype conversion from the Y serotype (Clark, et al. 1991 Gene 107:43-52). The glucosylation gene cluster (gtrA, gtrB, and gtrX) encoded by bacteriophage Sfx is involved in O-antigen modification of serotype Y to X and serotype 3b to 3a. The first gene of the glucosylation gene cluster gtrA encodes a small highly hydrophobic protein involved in the translocation of lipid-linked glucose across the cytoplasmic membrane. The gene gtrB encodes an enzyme catalyzing the transfer of the glucose residue from UDP-glucose to a lipid carrier, and gtrX encodes a bacteriophage-specific glucosyltransferase for the final step of attaching the glucosyl molecules onto the correct sugar residue of the O-antigen repeating unit (Guan, et al. 1999 Mol Microbiol 26:939-950).

(195) Cloning S. flexneri 2a and 3a O-Antigen Genes into pMD-TV

(196) Since cloning 10 kb rfb operon was challenging, 6 kb of the rfb operon was cloned into low copy plasmid pMD-TV (Dharmasena, et al. 2013 Intl J Med Microbiol 303:105-113), using KpnI and XhoI, followed by remaining 4 kB of the rfb operon using XhoI and BamHI. The S. flexneri 4 kb and 6 kb O-antigen gene regions were PCR amplified from S. flexneri 2a 2457 genomic DNA using prMD3-2a.rfb.F-prMD16.R and prMD18.rfb.5021.F prMD4-2a.rfb.R primer pairs (Table F, below), respectively.

(197) TABLE-US-00007 TABLEF PRMD3- GATCGGGATCCTAATGAAAATCTGACCGGATGTAACG 2A.RFB.F GTTG(SEQ.IDNO:34) PRMD16.504 GATCACTCGAGCGAGAAATCCTAGCG 2.R (SEQ.IDNO:35) PRMD18.RF CCCCTCGCTAGGATTTCTCGCTCGAG B.F (SEQ.IDNO:36) PRMD4- GATCGGGTACCTTGTTTTCTGAGCGAATATATATAAG 2A.RFB.R (SEQ.IDNO:37) PRMD1- GATCGGCGGCCGCGACCCAAAATGGACTATGACAGAA 2AGTR-F AGATCTGATATTTTTCCTCGCAAAAATGAAAATATCT CTTGTCGTTC(SEQ.IDNO:38) PRMD2- GATCGGGATCCTAAATATTAAATGGAAGCC 2AGTR-R (SEQ.IDNO:39) PRMD47.3A. ATAAGAATGCGGCCGCACTGGCTGGACCCAAAATGG OAC.NOTI (SEQ.IDNO:40) PRMD30.3A. GATCAGGATCCTCAATCCAGGGATAATTTAGGCGAAC BAMHI.R (SEQ.IDNO:41) PRMD120.SF GATCAGGATCCATCGATTGAGACTTGGATGATAGACT X.BAMHI.F TCATG(SEQ.IDNO:42) PRMD121..S GATCAGGATCCTTATTTTTTTATTAAATCAAGAGTTA FX.BAMH.R ACCATGGAGGGAG(SEQ.IDNO:43) PRMD87.VE TTAGAAAGAATTAGTGCCGCGGGTCAAAAAGC XA.R.32BP (SEQ.IDNO:44) PRMD133.T CCGTTCCTCATTGATTTGATTGCTAAC VID.F (SEQ.IDNO:45) PRMD123.Y.R CGGCAACATAAGTAATTTGCTCACG (SEQ.IDNO:46) PRMD124.F. CACGCAATATTTCAATGATGGCAAC TVID (SEQ.IDNO:47) PRMD92.VE GTTGCGGTAATGGTATAACGAAATAACAGATAC XB.R.17800 (SEQ.IDNO:48) PRMD118.R. TATTTATTATGTGACGAACAACAGCAGAACC 2AY (SEQ.IDNO:49) PRMD152.2A AATTGACTCTGTGGCATCTTTACTTCCGTCATTTATG .LPP.R AATACAATTTCTACTTCATATGGCTTCAACTCTTGGA ATTCACGTACCGTTTTATAGAAAACAGGTATCGCTTC TTCTTCATTGAAGACAGGAACGACAAGAGATATTTTC ATATGTCCTCTCCTTTCATTATTAATACCCTCTAGAG TTC(SEQ.IDNO:50)

(198) The resulting PCR 6 kb product and pMD-TV plasmid were digested with KpnI and XhoI, PCR-purified, and ligated to construct pMD-TV.2a.6, followed by digestion of 4 Kb PCR product and pMD-TV.2a.6 with XhoI and BamHI to construct pMD-TV-Y.

(199) In order to express S. flexneri 2a O-antigen, the bacteriophage SfII-encoded bgt-gtrII were cloned into pMD-TV-Y upstream of the S. flexneri 2a rfb region. First bgt-gtrII was PCR-amplified from S. flexneri 2a 2457 genomic DNA with primers that contained NotI and BamHI (prMD1-2agtr-F and prMD2-2agtr-R, FIG. 9). The resulting PCR product and pMD-TV-Y were digested with NotI and BamHI, PCR-purified, and ligated to construct pMD-TV-2a.

(200) In order to express S. flexneri 3a O-antigen, the S. flexneri 2a rfb region, bacteriophage Sf6 encoded oac and bacteriophage SfX-encoded gtrX, gtrA and gtrB were cloned, with their cognate promoters, tandemly into the pMD-TV vector. The SF6-encoded oac was PCR-amplified from S. flexneri 3a J99 genomic DNA with primers that contained NotI and BamHI sites (prMD47.3a.OAC.NotI and prMD30.3a.BamHI.R, FIG. 9). The resulting PCR product and pMD-TV-Y were digested with NotI and BamHI, PCR-purified, and ligated to construct pMD-TV-3b. Similarly, gtrX, gtrA, and gtrB gene cluster was PCR-amplified from S. flexneri 3a J99 genomic DNA with primers that contained BamHI site (prMD120.sfx.bamHI.F and prMD121.sfx.bamH.R, FIG. 9) and cloned into the BamHI site of pMD-TV-3b to construct pMD-TV-3a. All of the constructs were confirmed by PCR and sequencing.

(201) Expression of S. flexneri 2a and 3a O-Antigen from the Plasmid

(202) Expression of S. flexneri 2a and 3a O-antigen from pMD-TV-2a and pMD-TV-3a, respectively, in E. coli and Ty21a, was confirmed by slide agglutination and by Western blotting. pMD-TV-2a in E. coli or Ty21a reacts with S. flexneri type II specific anti-sera (FIG. 10) and also agglutinated with S. flexneri 3,4 epitope specific anti-sera. Thus, pMD-TV-2a contains all of the genes required for stable S. flexneri 2a O-antigen expression (Dharmasena, et al. 2012 Am Soc Microbiol mtg, San Francisco, Calif.).

(203) pMD-TV-3a in E. coli or Ty21a reacts with S. flexneri type III specific anti-sera (FIG. 10). pMD-TV-3a strains also agglutinated with S. flexneri 6 and 7, 8 epitope specific anti-sera. Thus, pMD-TV-3a contains all of the genes required for stable S. flexneri 3a O-antigen expression.

(204) Integrating S. flexneri O-Antigen Genes into Ty21a Chromosome

(205) The S. flexneri O-antigen Y serotype backbone genes that were cloned into pMD-TV (pMD-TV-Y) were used as template for PCR with tviD forward (prMD133.tviD.F) primer and vexA reverse (prMD87.vexA.R.32 bp) primer. The PCR-amplified region that contains part of tviD gene, Kan cassette flanked by FTR sites, S. flexneri rfb genes and vexA gene was 13,653 bp. These PCR products were transformed into Ty21a competent cells expressing 2 red proteins from pKD46 and selected for Kan resistance as described in (Dharmasena, et al. 2013). PCR with primers upstream and downstream of the site of integration prMD92 and prMD124 resulted in a 14.5 Kb band. After removing the Kanr cassette as described in (Dharmasena, et al. 2013), antibiotic-sensitive chromosomal integrants were further analyzed by PCR for deletion of the Kan cassette and sequenced the PCR product (strain MD 114/Ty21a-Y13 Kb band) obtained from primers prMD92 and prMD124. The sequence of this PCR was compared to S. flexneri 2a 2457 (GenBank accession no. AE014073.1, complete genome 4,599,354 bp, reference: Wei, et al. 2003 Infect Immun 71(5):2775-2786), and only a single A insertion was detected in the intergenic region upstream of gene rfbC (FIG. 11), which did not affect the O-antigen expression determined by Western blot with anti-S. flexneri 1-6 antibody.

(206) In order to integrate S. flexneri 2a modifying enzymes bgt and gtrII upstream of rfb operon in Ty21a-Y, pMD-TV-2a was used as template for PCR with tviD forward primer (prMD133.tviD.F) and rfb operon reverse primer (prMD118.R.2aY). The PCR-amplified region that contains part of tviD gene, Kan cassette flanked by FTR sites, S. flexneri 2a modifying enzymes bgt and gtrII, and first 500 bp of the rfb operon was 5,132 bp. These PCR products were transformed into Ty21a-Y competent cells expressing 2 red proteins and selected for Kan resistance as before. PCR with primers upstream and downstream of the site of integration prMD92 and prMD124 resulted in a 17 Kb band. After removing the Kan.sup.r cassette, antibiotic-sensitive chromosomal integrants were further analyzed by PCR for deletion of the Kan cassette and sequenced the PCR product (strain MD 194/Ty21a-2a 15.5 Kb band) obtained from primers prMD92 and prMD124. The sequence of this PCR was compared to SFII coded bgt-gtrII region and rfb region of S. flexneri 2a 2457, and no additional mutations were found. Also, S. flexneri 2a expression was determined by Western blot with S. flexneri type II specific anti-sera showed only weak expression compared to the plasmid expression (FIG. 12). This may be due to multiple copies of the plasmid (5 per cell) expressing more S. flexneri 2a O-antigen compared to only one copy of S. flexneri 2a O-antigen biosynthetic genes integrated into the Ty21a chromosome in Ty21-2a strain (FIG. 12).

(207) Similarly, S. flexneri 3a modifying enzymes gtrX, gtrA, and gtrB gene cluster and oac were integrated upstream of the rfb operon in the Ty21a-Y strain as described before using pMD-TV-3a as template for PCR. The PCR product that was transformed into Ty21a-Y competent cells expressing red was 6448 bp. After integration, PCR with primers upstream and downstream of the site of integration prMD92 and prMD124 resulted in a 18.5 Kb band and after removing the Kan.sup.rcassette (strain MD 194/Ty21a-3a) resulted in a 17 Kb band. The sequence of this PCR was compared to bacteriophage Sf6-encoded oac and bacteriophage SfX-encoded gtrX, gtrA, and gtrB and S. flexneri 2a 2457, and no additional mutations were found. Also, S. flexneri 3a expression was determined by Western blot with S. flexneri type III specific anti-sera showed only weak expression compared to the plasmid expression as S. flexneri 2a (FIG. 12).

(208) Replacing Bgt Native Promoter with lpp

(209) Attempts were made to increase the S. flexneri 2a LPS expression by replacing the native bgt promoter with the lpp promoter, which is a highly transcribed constitutively active promoter. Ty21a-sdl (S. dysenteriae O-antigen biosynthesis genes expressed from lpp promoter) was used as template for PCR with tviD forward primer and lpp promoter reverse primer with 150 bp bgt homology extension (Table F). The PCR-amplified region contains part of tviD gene, Kan cassette flanked by FTR sites, 200 bp lpp promoter, and first 150 bp bgt gene. The PCR products were transformed into Ty21a-2a (MD194) competent cells expressing red proteins and selected for Kan resistance, removed the Kan cassette, and sequenced as described before to construct Ty21a-2al (MD212). Western blot with S. flexneri type II specific anti-sera shows that Ty21a-2al (MD212) expresses higher S. flexneri 2a LPS than that of Ty21a-2a (MD194), but still less than plasmid expression (Ty21a pMD-TV-2a) (FIG. 13).

(210) Additional efforts are being made to carry out animal experiments employing new constructs.

REFERENCES

(211) 1. Kotloff, K. L., Winickoff, J. P., Ivanoff, B., Clemens, J. D., Swerdlow, D. L., Sansonetti, P. J., Adak, G. K., and Levine, M. M. (1999) Bulletin of the World Health Organization 77, 651-666 2. Kweon, M. N. (2008) Current opinion in infectious diseases 21, 313-318 3. Mead, P. S., Slutsker, L., Dietz, V., McCaig, L. F., Bresee, J. S., Shapiro, C., Griffin, P. M., and Tauxe, R. V. (1999) Emerging infectious diseases 5, 607-625 4. Putthasri, W., Lertiendumrong, J., Chompook, P., Tangcharoensathien, V., and Coker, R. (2009) Emerging infectious diseases 15, 423-432 5. WHO. (2005). in Guidelines for the control of shigellosis, including epidemics due to Shigella dysenteriae type 1, World Health Organization, Geneva, Switzerland 6. Kaminski, R. W., and Oaks, E. V. (2009) Expert review of vaccines 8, 1693-1704 7. Ferreccio, C., Prado, V., Ojeda, A., Cayyazo, M., Abrego, P., Guers, L., and Levine, M. M. (1991) American journal of epidemiology 134, 614-627 8. DuPont, H. L., Hornick, R. B., Snyder, M. J., Libonati, J. P., Formal, S. B., and Gangarosa, E. J. (1972) The Journal of infectious diseases 125, 5-11 9. DuPont, H. L., Hornick, R. B., Snyder, M. J., Libonati, J. P., Formal, S. B., and Gangarosa, E. J. (1972) The Journal of infectious diseases 125, 12-16 10. Noriega, F. R., Liao, F. M., Maneval, D. R., Ren, S., Formal, S. B., and Levine, M. M. (1999) Infection and immunity 67, 782-788 11. Xu de, Q., Cisar, J. O., Osorio, M., Wai, T. T., and Kopecko, D. J. (2007) Vaccine 25, 6167-6175 12. Xu, D. Q., Cisar, J. O., Ambulos Jr, N., Jr., Burr, D. H., and Kopecko, D. J. (2002) Infection and immunity 70, 4414-4423 13. Osorio, M., Wu, Y., Singh, S., Merkel, T. J., Bhattacharyya, S., Blake, M. S., and Kopecko, D. J. (2009) Infection and immunity 77, 1475-1482 14. Kopecko, D. J., Sieber, H., Ures, J. A., Furer, A., Schlup, J., Knof, U., Collioud, A., Xu, D., Colburn, K., and Dietrich, G. (2009) International journal of medical microbiology: IJMM 299, 233-246 15. D'Amelio, R., Tagliabue, A., Nencioni, L., Di Addario, A., Villa, L., Manganaro, M., Boraschi, D., Le Moli, S., Nisini, R., and Matricardi, P. M. (1988) Infection and immunity 56, 2731-2735 16. Seid, R. C., Jr., Kopecko, D. J., Sadoff, J. C., Schneider, H., Baron, L. S., and Formal, S. B. (1984) The Journal of biological chemistry 259, 9028-9034 17. Formal, S. B., Baron, L. S., Kopecko, D. J., Washington, O., Powell, C., and Life, C. A. (1981) Infection and immunity 34, 746-750 18. Black, R. E., Levine, M. M., Clements, M. L., Losonsky, G., Herrington, D., Berman, S., and Formal, S. B. (1987) The Journal of infectious diseases 155, 1260-1265 19. Herrington, D. A., Van de Verg, L., Formal, S. B., Hale, T. L., Tall, B. D., Cryz, S. J., Tramont, E. C., and Levine, M. M. (1990) Vaccine 8, 353-357 20. Van de Verg, L., Herrington, D. A., Murphy, J. R., Wasserman, S. S., Formal, S. B., and Levine, M. M. (1990) Infection and immunity 58, 2002-2004 21. Datsenko, K. A., and Wanner, B. L. (2000) Proceedings of the National Academy of Sciences of the United States of America 97, 6640-6645 22. Cherepanov, P. P., and Wackernagel, W. (1995) Gene 158, 9-14 23. Murphy, K. C. (1998) Journal of bacteriology 180, 2063-2071 24. Sawitzke, J. A., Thomason, L. C., Costantino, N., Bubunenko, M., Datta, S., and Court, D. L. (2007) Methods in enzymology 421, 171-199 25. Uzzau, S., Figueroa-Bossi, N., Rubino, S., and Bossi, L. (2001) Proceedings of the National Academy of Sciences of the United States of America 98, 15264-15269 26. Yu, B., Yang, M., Wong, H. Y., Watt, R. M., Song, E., Zheng, B. J., Yuen, K. Y., and Huang, J. D. (2011) Applied microbiology and biotechnology 91, 177-188 27. Ohtake, S., Martin, R., Saxena, A., Pham, B., Chiueh, G., Osorio, M., Kopecko, D., Xu, D., Lechuga-Ballesteros, D., and Truong-Le, V. (2011) Vaccine 29, 2761-2771 28. Germanier, R., and Fuer, E. (1975) The Journal of infectious diseases 131, 553-558 29. Kopecko, D. J., Washington, O., and Formal, S. B. (1980) Infection and immunity 29, 207-214 30. Churchward, G., Belin, D., and Nagamine, Y. (1984) Gene 31, 165-171