Universal Aptamer-based Colloidal Gold Lateral Flow Test Strip for Detecting Small-molecule Substances

Abstract

The present disclosure discloses a universal aptamer-based colloidal gold lateral flow test strip for detecting small-molecule substances and belongs to the fields of analytical chemistry, medicine, environment, food safety detection, nano-biosensing and the like. An AuNPs@poly-DNA probe is used for rapidly and sensitively capturing an aptamer, streptavidin sprayed in a test zone and streptavidin-biotin-DNAc sprayed in a control zone do not need to be changed, and another substance can be detected only by changing a nucleic acid chain part of the AuNPs@poly-DNA probe. A universal colloidal gold lateral flow test strip, which is rapid, sensitive and low in cost, has been developed. The test strip method for detecting small-molecule substances is simple, convenient and rapid, and can be used for detection at any time. Only a test solution is needed to be added into a sample port and the test strip is completely developed after 5 min, thus an experiment result can be observed and the detection efficiency can be greatly improved. Qualitative analysis can be conducted by naked eyes, and quantitative analysis can be conducted by a colloidal gold test strip quantitative analyzer.

Claims

1. A universal colloidal gold lateral flow test strip, wherein the test strip contains an aptamer, a probe polyA-DNA and streptavidin-biotin-DNAc; the probe polyA-DNA contains a fragment A, a fragment B and a fragment C; a 5′ end of the aptamer is labeled with a biotin; and the aptamer is configured to specifically bind to small-molecule substances to be tested.

2. The universal colloidal gold lateral flow test strip according to claim 1, wherein a 3′ end of the aptamer is extended by 5-10 T bases.

3. The universal colloidal gold lateral flow test strip according to claim 1, wherein the fragment A is AAAAAAAAAAAAAAATTAT.

4. The universal colloidal gold lateral flow test strip according to claim 1, wherein the fragment C is 10-15 bases complementary to the extended aptamer from the 3′ end.

5. The universal colloidal gold lateral flow test strip according to claim 1, wherein the streptavidin-biotin-DNAc is obtained by mixing streptavidin and a DNAc with a 5′ end labeled by biotin in an equal volume and conducting incubation at 3-5° C. for 0.8-1.2 hours; and the DNAc has a nucleotide sequence as set forth in SEQ ID NO: 5.

6. The universal colloidal gold lateral flow test strip according to claim 5, wherein the concentration of the streptavidin is 2.5 mg/mL, and the concentration of the DNAc is 250 μM.

7. The universal colloidal gold lateral flow test strip according to claim 1, wherein the small-molecule substances comprise kanamycin, ochratoxin A (OTA), aflatoxin, streptomycin, chloramphenicol, estradiol, bisphenol A and acetamiprid.

8. The universal colloidal gold lateral flow test strip according to claim 1, wherein the test strip comprises a sample pad, a gold label pad, a nitrocellulose membrane, an absorbent pad and a PVC adhesive plate; the sample pad, the gold label pad, the nitrocellulose (NC) membrane and the absorbent pad are pasted on the PVC plate in sequence; a test zone and a control zone are arranged on the NC membrane in sequence, and a distance between the test zone and the control zone is 4-6 mm; the streptavidin is on the test zone and the streptavidin-biotin-DNAc is on the control zone; and the gold label pad contains an AuNPs@polyA-DNA conjugate.

9. The universal colloidal gold lateral flow test strip according to claim 8, wherein the length of an overlapping portion between the sample pad and the gold label pad is 1-2 mm, and the sample pad is placed above the gold label pad; the length of an overlapping portion between the gold label pad and the NC membrane is 1-2 mm, and the gold label pad is placed above the NC membrane; and the length of an overlapping portion between the NC membrane and the absorbent pad is 1-3 mm, and the absorbent pad is placed above the NC membrane.

10. The universal colloidal gold lateral flow test strip according to claim 8, wherein the AuNPs@polyA-DNA conjugate is obtained by anchoring the probe polyA-DNA on gold nanoparticles.

11. The universal colloidal gold lateral flow test strip according to claim 10, wherein the particle size of the gold nanoparticles is 13-17 nm; and the concentration of the polyA-DNA is 80-120 μM.

12. A preparation method of the universal colloidal gold lateral flow test strip according to claim 1, wherein the method comprises the following specific steps: (1) cutting the sample pad and the gold label pad, soaking the pads with PBS and drying; (2) spraying the probe AuNPs@polyA-DNA on the gold label pad and drying; (3) spraying the streptavidin in the test zone of the NC membrane, spraying the streptavidin-biotin-DNAc in the control zone, fixing the distance between the test zone and the control zone at 5 mm, and drying at 35-39° C. for 2 hours; and (4) pasting the sample pad, the gold label pad, the NC membrane and the absorbent pad prepared in steps (1)-(3) on the PVC plate in sequence to obtain the colloidal gold lateral flow test strip for detecting kanamycin.

13. The preparation method according to claim 12, wherein the AuNPs@polyA-DNA conjugate is obtained by using the probe polyA-DNA as an anchor block and anchoring the polyA-DNA on the gold nanoparticles; and the probe polyA-DNA contains a polyA fragment, a fragment complementary to the DNAc and a fragment complementary to the aptamers of the small-molecule substances.

14. The preparation method according to claim 12, wherein the particle size of the gold nanoparticles is 13-17 nm, and the concentration of the polyA-DNA is 80-120 μM.

Description

BRIEF DESCRIPTION OF FIGURES

[0058] FIG. 1 is a schematic structural diagram and detection schematic diagram of a test strip.

[0059] FIG. 2A a transmission electron microscopy (TEM) image of AuNPs; and (b) absorption spectrum of the AuNPs.

[0060] FIG. 2B absorption spectrum of the AuNPs.

[0061] FIG. 3 shows detection graphs of kanamycin standard solutions with different concentrations using the test strip, where the concentrations from left to right are 0, 0.5, 5, 15, 25, 50, 150, 250 and 400 ng/mL respectively.

[0062] FIG. 4 is a standard curve of relative signal intensity of a T line to a C line (T/C) in the standard detection solutions at different concentrations of kanamycin, where the concentrations from left to right are 0, 1, 10, 50, 100, 250 and 500 ng/mL respectively.

[0063] FIG. 5 shows detection graphs of ochratoxin A (OTA) standard solutions with different concentrations using the test strip.

[0064] FIG. 6 is a standard curve of relative signal intensity of a T line to a C line (T/C) in the standard detection solutions at different concentrations of OTA.

[0065] FIG. 7 shows detection graphs of kanamycin at different concentrations in a honey sample using the test strip.

[0066] FIG. 8A effect of different aptamer complementary chains on the probe on color development of the T line.

[0067] FIG. 8B effect of the probe chain polyA-DNA (5+10) and polyA-DNA(10+5) on the relative signal intensity (T/C) of kanamycin.

[0068] FIG. 9 is a structure of polyA-DNA.

DETAILED DESCRIPTION

Example 1: Preparation of Aptamer-Based Test Strip For Rapidly Detecting Kanamycin

[0069] The specific steps are as follows:

1. Design of Aptamer Sequences and Probes

[0070] To ensure that an aptamer with a biotinylated 5′ end can bind to AuNPs@polyA-DNA and be captured by streptavidin (SA) in a T line zone, nucleic acid probe chains with different sequences (polyA-DNA(.sub.20), polyA-DNA(.sub.15), polyA-DNA(.sub.5+10), polyA-DNA(.sub.5+5) and polyA-DNA(.sub.10 +5)) were selected to be conjugated with AuNPs (as shown in Table 1) and the concentration of the aptamer was 0.5 μM.

[0071] Results are shown in FIG. 8A. When the nucleic acid probe chains were polyA-DNA(.sub.10+15) with the nucleic acid sequence as shown in SEQ ID NO: 2 and polyA-DNA(.sub.15+10) as shown in SEQ ID NO: 10, the relative signal intensity (T/C) was significantly enhanced compared with the nucleic acid probe chains polyA-DNA(.sub.20) and polyA-DNA(.sub.15) with no T base added at a 3′ end. Therefore, the probe chains of polyA-DNA(.sub.5+10) and polyA-DNA(.sub.10+5) were used for detecting kanamycin to test the sensitivity of the detection. When the concentration of the aptamer was 0.5 μM, the probe chains of polyA-DNA(.sub.5+10) and polyA-DNA(.sub.10+5) were used to detect the kanamycin. As shown in FIG. 8B, when kanamycin of the same concentration (150 ng/mL) was added and the nucleic acid probe chain polyA-DNA(.sub.10+5) with the nucleotide sequence as shown in SEQ ID NO: 2 was used, the change of the corresponding signal intensity of the kanamycin (ΔT/C value) was the largest. Therefore, the probe used in the following examples was polyA-DNA(.sub.10+5) with the nucleotide sequence as shown in SEQ ID NO: 2.

TABLE-US-00001 TABLE 1 Nucleic acid sequences of universal aptamer-based lateral flow strip (LFS) for canamycin No. Name of DNA Sequence (5′-3′) 1 Aptamer.sub.(20 + 0) T SEQID NO: 6 poly A-DNA.sub.(20 + 0) AAAAAAAAAAAAAAATTATATTATTATTATAGAGTG SEQID NO: 7 2 Aptamer.sub.(15 + 0) TGGGGG SEQID NO: 8 poly A-DNA.sub.(15 + 0) AAAAAAAAAAAAAAATTATATTATTATTATAGAGTG SEQID NO: 9 3 Aptamer.sub.(5 + 10) TGGGGGTTGAGGCTAA TTTTTTTTTT SEQID NO: 10 poly A-DNA.sub.(5 + 10) AAAAAAAAAAAAAAATTATATTATTATTATAGAGTG AAAAAAA SEQID NO: 11 AA 4 Aptamer.sub.(5 + 5) TGGGGGTTGAGGCTAA TTTTT SEQID NO: 12 poly A-DNA.sub.(5 + 5) AAAAAAAAAAAAAAATTATATTATTATTATAGAGTGAAAAA SEQID NO: 13 5 Aptamer.sub.(10 + 5) TGGGGGTTGAG TTTTT SEQID NO: 1 poly A-DNA.sub.(10 + 5) AAAAAAAAAAAAAAATTATATTATTATTATAGAGTGAAAAA SEQID NO: 2 DNA.sub.C AAAAACACTCTATAATAATAAT SEQID NO: 5

[0072] (Sequences underlined or in bold represent complementary sequences; sequences in bold italics represent aptamer partial sequences or complementary sequences thereof; and sequences in bold represent aptamer extended sequences or complementary sequences thereof.)

[0073] Design of polyA-DNA: polyA-DNA had three functional regions. A first functional region was polyA which acted as an anchor block to anchor polyA-DNA on gold nanoparticles; a second functional region was a region complementary to a DNAc; and a third functional region was a region complementary to an aptamer (FIG. 9).

[0074] Design of oligonucleotide DNAc: as shown in Table 1 and Table 2, the underlined position of the DNAc sequence was complementary to the polyA-DNA and 5 A bases were connected to a 3′ end of the DNAc.

TABLE-US-00002 TABLE 2 DNA sequences of test strip for rapidly detecting kanamycin Nucleic acid Sequence (5′-3′) Kanamycin aptamer TGGGGGTTGAGGCTAAGCCGA SEQ ID NO: 1 Aptamer(10 + 5) Kanamycin colloidal gold AAAAAAAAAAAATTATATTATTATTATAGAGTG ATCGGCTT SEQ ID NO: 2 labeled nucleic acid probe AGC polyA-DNA (10 + 5) DNAc AAAAACACTCTATAATAATAAT SEQ ID NO: 5

[0075] (Sequences underlined or in bold represent complementary sequences; sequences in bold represent aptamer partial sequences or complementary sequences thereof; and sequences in bold italics represent aptamer extended sequences or complementary sequences thereof.)

TABLE-US-00003 TABLE 3 DNA sequences of test strip for rapidly detecting OTA Nucleic acid Sequence (5′-3′) OTA aptamer Aptamer (10 + 5) GATCGGGTGTGGGTGGCGTAAAGGGAGCATCGGACA SEQ ID NO: 3 OTA colloidal gold labeled AAAAAAAAAAAAAAATTATATTATTATTATAGAGTG TGTCC SEQ ID NO: 4 nucleic acid probe polyA-DNA GATGC (10 + 5) DNAc AAAAACACTCTATAATAATAAT SEQ ID NO: 5

[0076] (Sequences underlined or in bold represent complementary sequences; sequences in bold represent aptamer partial sequences or complementary sequences thereof; and sequences in bold italics represent aptamer extended sequences or complementary sequences thereof.)

2. Preparation and Functionalization of Gold Nanoparticles (AuNPs)

(1) Preparation of AuNPs

[0077] Glassware used for synthesis and storage of nanomaterials in the experiment was soaked in aqua regia (hydrochloric acid:nitric acid=3:1) for 12 h and washed with ultrapure water for later use.

[0078] The AuNPs were prepared by a sodium citrate reduction method. The specific steps were as follows:

[0079] 1) 100 mL of 0.01% HAuCl.sub.4 was added to a 250-mL conical flask, heating and stirring were carried out until the solution was boiling, and maintained for 1-2 min.

[0080] 2) 2 mL of a 1% trisodium citrate solution was rapidly added to the conical flask, and heating and stirring were continued. The color of the mixed solution gradually changed from light yellow to dark purple and finally to wine red. Heating was kept for 10 min to prepare the AuNPs with the particle size of 15 nm. The AuNPs were cooled to room temperature and refrigerated at 4° C. for later use.

(2) Functionalization of AuNPs

[0081] 1) 5-15 μL of 100 μM polyA-DNA was added to 1 mL of the AuNPs (10 nM) prepared in step (1) to be mixed evenly, and 20 μL of 500 mM citrate buffer (pH 3.0) was added. After mixed evenly, a mixture was incubated at room temperature for 3 min.

[0082] 2) After incubation, 60 μL of 500 mM HEPES buffer at pH 7.6 was added to adjust the pH of the AuNPs solution to be neutral, and a mixture was incubated at room temperature for 5-10 min.

[0083] 3) After incubation, centrifugation was conducted at 10000 r/min for 20 min. A supernatant was removed. A resuspension solution was added to precipitates for redissolving. Repeat centrifugation was conducted at 10000 r/min for 20 min for three times to remove unreacted nucleic acid. 400 μL of the resuspension solution was added to obtain the functionalized AuNPs, namely the probe AuNPs@polyA-DNA which was refrigerated at 4° C. for later use.

[0084] The AuNPs prepared in step (1) and the AuNPs@polyA-DNA prepared in step (2) were characterized by transmission electron microscopy respectively. Results are shown in FIG. 2. The prepared AuNPs with the particle size of 15 nm have a single characteristic absorption peak at 520 nm. When the AuNPs bind to the polyA-DNA, the maximum absorption wavelength is shifted to 530 nm, which preliminarily proves that the polyA-DNA successfully modifies the AuNPs.

[0085] The resuspension solution consists of 20 mM of Na.sub.3PO.sub.4, 5% of BSA, 10% of sucrose and 0.25% of Tween-20.

3. Preparation of Streptavidin-Biotin-DNAc

[0086] (1) 100 μL of 2.5 mg/mL streptavidin was mixed with 100 μL of 250 μM DNAc with a 5′-end labeled with biotin, and incubation was conducted at 4° C. for 1 h to obtain a mixed solution.

[0087] (2) The mixed solution was treated by an ultrafiltration tube (MWCO 30 kDa). Centrifugation was conducted at 6000 r/min for 20 min for three times. Precipitates were resuspended in 300 μL of 10 mM PBS to obtain streptavidin-biotin-DNAc which was stored at 4° C. for later use.

4. Assembly of Aptamer Test Strip

[0088] (1) A sample pad and a conjugate pad (gold label pad) were cut into appropriate sizes. The pads were soaked with 10 mM PBS for 30 min and then were dried at 45° C.

[0089] (2) The probe AuNPs@polyA-DNA obtained in step 1 was evenly sprayed on the conjugate pad and the pad was dried at 37° C. for 2 h.

[0090] (3) The streptavidin and the streptavidin-biotin-DNAc prepared in step 2 were sprayed on an NC membrane at the speed of 0.9 μL/cm by a three-dimensional spraying instrument to serve as a test zone (T line) and a control zone (C line) respectively. The distance between the test zone and the control zone was fixed at 5 mm. Drying was conducted at 37° C. for 2 h.

[0091] (4) The sample pad, the conjugate pad, the NC membrane and an absorbent pad prepared in steps (1)-(3) were pasted on a PVC plate in sequence according to FIG. 1. The assembled test strip was evenly cut into the width of 4 mm, and the cut test strip was put into a packaging bag for sealed storage.

Example 2: Determination of Kanamycin Standard Solution With Test Strip

(1) Preparation of Kanamycin Standard Solution

[0092] A kanamycin standard solution was diluted with Running buffer (4×SSC, pH 7) to final concentrations of 0.5, 5, 15, 25, 50, 150, 250 and 400 ng/mL respectively. A kanamycin aptamer with the nucleotide sequence as shown in SEQ ID NO: 1 was diluted to 0.5 μM with ultrapure water.

(2) Establishment of Standard Curve For Detection by Kanamycin Nucleic Acid Test Strip:

[0093] 99 μL of the kanamycin standard solutions with different concentrations in step (1) were mixed with 1 μL of the kanamycin aptamer solution. The mixture was incubated for 20 min. After mixing and reacting, the mixture was dropwise added to the sample pad for detection. After reaction for 3 min, the relative signal intensity (T/C) was determined, and a standard curve of a corresponding relationship between the relative signal intensity (T/C) and different concentrations of kanamycin was established.

[0094] Results are shown in FIG. 3. When the concentration of kanamycin is 15 ng/mL, the color of the T line on the test strip shows a significant difference when compared with that of the solution containing no kanamycin (0 ng/mL of kanamycin). When the concentration of kanamycin is 5-250 ng/mL, the color of the T line decreases with the increase of the concentration of kanamycin. When the concentration of kanamycin is 250 ng/mL, there is basically no change in the color of the T line. Therefore, a lower limit of detection by the naked eyes is 15 ng/mL and an upper limit of detection is 250 ng/mL.

[0095] The relative signal intensity (T/C) of kanamycin with different concentrations was read by a colloidal gold test strip quantitative analyzer and a relationship curve between the relative signal intensity (T/C) and the concentration of kanamycin was obtained as shown in FIG. 4 with a lowest limit of detection of 0.3 ng/mL. In the concentration range of 5-250 ng/mL, there is a linear relationship between the relative signal intensity (T/C) and the concentration. A linear regression equation is y=−0.1637×+0.4341, R.sup.2=0.9819, where y is the relative signal Intensity (T/C) and x is a Log function of the concentration of kanamycin (ng/mL).

Example 3: Determination of Ochratoxin A (OTA) Standard Solution With Test Strip

(1) Preparation of OTA Standard Solution

[0096] An OTA standard solution was diluted with Running buffer (4×SSC, pH 7) to final concentrations of 1, 10, 50, 100, 250 and 500 ng/mL respectively. An OTA aptamer with the nucleotide sequence as shown in SEQ ID NO: 1 was diluted to 0.5 μM with ultrapure water.

(2) Establishment of Standard Curve For Detection by OTA Nucleic Acid Test Strip:

[0097] 99 μL of the OTA standard solutions with different concentrations in step (1) were mixed with 1 μL of the OTA aptamer solution. The mixture was incubated for 20 min. After mixing and reacting, the mixture was dropwise added to the sample pad for detection. After reaction for 3 min, the relative signal intensity (T/C) was determined, and a standard curve of a corresponding relationship between the relative signal intensity (T/C) and different concentrations of OTA was established.

[0098] Results are shown in FIG. 5. When the concentration of OTA is 10 ng/mL, the color of the T line on the test strip shows a significant difference when compared with that of the solution containing no OTA (0 ng/mL of OTA). When the concentration of OTA is 1-250 ng/mL, the color of the T line decreases with the increase of the concentration of OTA. When the concentration of OTA is 250 ng/mL, there is basically no change in the color of the T line. Therefore, a lower limit of detection by the naked eyes is 10 ng/mL and an upper limit of detection is 250 ng/mL.

[0099] The relative signal intensity (T/C) of OTA with different concentrations was read by a colloidal gold test strip quantitative analyzer and a relationship curve between the relative signal intensity (T/C) and the concentration of OTA was obtained as shown in FIG. 6 with a lowest limit of detection of 0.18 ng/mL. In the concentration range of 1-250 ng/mL, there is a linear relationship between the relative signal intensity (T/C) and the concentration. A linear regression equation is y=−0.151×+0.4371, R.sup.2=0.9794, where y is the relative signal Intensity (T/C) and x is a Log function of the concentration of OTA (ng/mL).

Example 4: Detection of Kanamycin Residues in Honey Sample

[0100] Honey was used to stimulate a sample to test the recovery rate, the steps were as follows:

[0101] (1) Pretreatment of AuNPs@polyA-DNA solution: 0.8-1.4 μL of the prepared and stored AuNPs@polyA-DNA was added onto the gold label pad of the test strip and stored at 4° C.

[0102] (2) Pretreatment of sample: A honey sample was diluted for 10 times and filtered with a 0.22 μm microfiltration membrane. Different concentrations of kanamycin (50, 150 and 250 ng/mL) were added to the honey.

[0103] (3) Determination of recovery rate of kanamycin in honey: 1 μL of a kanamycin aptamer (0.5 μM) with the nucleotide sequence as shown in SEQ ID NO: 1 in Example 1 was taken to be mixed with 99 μL of honey solutions containing different concentrations of kanamycin in step (2). The mixture was incubated for 20 min. After mixing and reacting, the mixture was detected by using the test strip.

[0104] The aptamer-based test strip prepared in Example 1 was used to detect the content of kanamycin in honey. Results are shown in Table 4 and FIG. 7.

TABLE-US-00004 TABLE 4 Detection of kanamycin residues in honey sample Addition Detection Spiked concentration concentration recovery RSD Sample (ng/mL) (ng/mL) rate (%) (%) Honey  15  14.1  94.0 8.1  50  51.9 103.8 3.7 250 248.6  99.4 4.4

[0105] Although the present disclosure has been disclosed as above in the preferred examples, it is not intended to limit the present disclosure. Any person skilled in the art can make various changes and modifications without departing from the spirit and scope of the present disclosure. Therefore, the protection scope of the present disclosure should be as defined in the claims.