METHOD FOR PLANT IMPROVEMENT USING A TRANSGENE CONTAINING THE BETL9 PROMOTER DRIVING EXPRESSION OF THE MRP1 PROTEIN

Abstract

The invention relates to the field of plant improvement, in particular of the improvement of yield for plants, by using a transgene containing the BETL9 promoter driving expression of the MRP1 protein.

Claims

1. An expression cassette comprising a nucleic acid molecule comprising a promoter as set forth in SEQ ID NO:1 (BETL9 promoter), operatively linked to a nucleic acid coding for a protein as set forth in SEQ ID NO:2 (MRP1 protein).

2. A vector containing the expression cassette of claim 1.

3. A host cell containing the expression cassette of claim 1.

4. The host cell of claim 3, wherein said expression cassette is stably integrated within the genome of said host cell.

5. A plant containing at least one cell according to claim 3.

6. The plant of claim 5, which is a cereal.

7. The plant of claim 6, which is selected from the group consisting of maize, wheat, barley and rice.

8. A method for obtaining a transgenic plant, the method comprising the steps: a. transforming at least a plant cell or plant tissue with a vector containing the expression cassette of claim 1; and b. cultivating the cell(s) or plant tissue thus transformed so as to generate a transgenic plant containing at least a cell which contains, in its genome, at least the expression cassette of claim 1.

9. A method for obtaining a plant containing a transgene, wherein said transgene comprises the expression cassette of claim 1, the method comprising the steps of a. performing the method of claim 8 in order to obtain a transgenic plant, wherein the transgene comprises an expression cassette comprising a nucleic acid molecule comprising the BETL9 promoter as set forth in SEQ ID NO:1, operatively linked to a nucleic acid coding for the MRP1 protein as set forth in SEQ ID NO:2, b. crossing said transgenic plant with a plant line which does not contain said transgene (the receiver plant line), c. selecting, among the progeny, plants that contain said transgene and that have more molecular markers from the receiver plant line than from the parent containing the transgene, d. back-crossing said selected plants with said receiver plant line, e. repeating steps c) and d) if necessary until a line isogenic with said receiving line (and containing said transgene) is obtained, f. optionally, performing self-fertilization in order to obtain a plant homozygotic for said transgene.

10-16. (canceled)

Description

FIGURES

[0094] FIG. 1: map of the vector pBIOS849 which is used for expression of ZmMRP-1 in the BETL from the BETL9 promoter.

[0095] FIG. 2: expression in pBETL9-MRP1, measured by Q-PCR, of ZmMRP-1, BETL1, BETL2, RR and ESR6 transcripts in transgenic (EBP-4a-4) and a non-transgenic, segregant seed (EBP-4a-3).

[0096] FIG. 3: yield (expressed in Q/ha) for 4 wheat transformants

EXAMPLES

Example 1Cloning of ZmMRP-1 Downstream the BETL9 Promoter and Transformation

[0097] The ZmMRP1 coding sequence was amplified from the MRP1 cDNA (Gomez et al 2002) using the primers

TABLE-US-00001 (SEQ ID N.sup.o3) 5AGGTCGACGGGATCCATGAATCCCAACTTCAACAGTGTGTGG 3 and (SEQ ID N.sup.o4) 5TCAAGCTTATCGGTTATATATCTGGCTCTCCTCC 3

[0098] such that the ZmMRP-1 coding region could be cloned into SalI, HindIII-cut pBSKSII (Stratagene). Next ZmMRP-1 was excised from this plasmid as a SalI, PstI fragment and cloned into SalI, PstI-cut pBIOS503 forming the GATEWAY ENTRY clone pBIOS815. (pBIOS503 is a derivative of pENTRD/Topo (Invitrogen) containing a polylinker with the sites Eco47 III-SalI-Sma I-Pst I between the aatL1 and aatL2 recombinase sites.)

[0099] The BETL9 gene was isolated by Hueros et al (1995). The promoter sequence is, in part, described as pEND1 Patent WO 00/12733. FIG. 2 shows that by Northern and in situ analysis BETL9 is expressed in the lower half of the seed in the BETL. This analysis is confirmed by analysis of pBETL-GUS transgenic maize plants (FIG. 3). BETL9 is expressed early in BETL development, from 4-6 DAP (data not shown).

[0100] The 1904 bp maize BETL9 promoter was amplified by PCR from genomic DNA of the inbred line F2 using the primers:

TABLE-US-00002 pBETL9forXho (SEQ ID N.sup.o5) 5CCCTCGAGTTACTCATGATGGTCATCTAGG 3, and pBETL9revXba (SEQ ID N.sup.o6) 5GCTCTAGAGGGTATAACTTCAACTGTTGACGG 3.

[0101] These primers introduce an XhoI and an XbaI site 5 and 3 to the BETL9 promoter.

[0102] The PCR fragment was cloned as an XhoI, XbaI fragment into XhoI, XbaI-cut pBSKII forming pBETL9-BS. A GATEWAY cassette and a Sac66 polyadenylation sequence was cloned from pBIOS652 as a HindIII (filled), SacI fragment into XbaI (filled), SacI-cut pBETL9-BS thus forming pBIOS710. An LR clonase reaction was performed between pBIOS815 and pBIOS710 thus forming pBIOS817. The pBETL9-ZmMRP-1-Sac66 polyA chimeric gene from pBIOS817 was cloned as an XhoI fragment into XhoI-cut pBIOS340, forming pBIOS849. (The binary vector pBIOS340 is a derivative of pSB12 (Komari et al. (1996)) containing a pActin+actin intron-NptII nos polyA chimeric gene for selection of maize transformants).

[0103] pBIOS849 (FIG. 1) was transferred into agrobacteria LBA4404 (pSB1) according to Komari et al (1996). Maize cultivar A188 was transformed with these agrobacterial strains essentially as described by Ishida et al (1996).

[0104] Wheat immature embryos were transformed with the same agrobacterial strains essentially as described by WO 00/63398.

Example 2Transformed Corn Plant Analysis

[0105] Analysis of the pBETL9-MRP1 transformed corn plants indicated that some plants overexpressed ZmMRP-1 (FIG. 2).

[0106] Q-PCR analysis showed that transgenic seed expressed 30-fold higher transcript levels of the BETL genes BETL1, BETL2 and TC-RR, whereas expression of ESR6 which is expressed in the Embryo Surrounding Region (ESR) was unchanged in transgenic and non transgenic segregant seed from the same cob (FIG. 2).

[0107] Sections of transgenic seed showed an abnormally well-developed BETL that expressed high levels of BETL1 and BETL2 protein (in wild-type seed the BETL1 antibody does not detect the secretion of BETL1 protein from the BETL, but in transgenic seed BETL1 can be seen both in the BETL and in the maternal pedicel region).

[0108] These plants possess seeds that are larger than segregant seeds that lack the transgene and thus do not express ZmMRP-1. The transgenic seed of these plants also possess improved pathogen resistance compared to segregant seeds that lack the transgene and thus do not express ZmMRP-1.

Example 3Transformed Wheat Plant Analysis

[0109] Transgenic plants were generated using pBIOS849. Selection of events was based on molecular characterization (simple copy, monolocus).

Example 4Corn Field Trials

[0110] Field trials show that seed yield and the stability of yield are improved.

[0111] AField Trials

[0112] Hybrids with a tester line were obtained from T3 plants issued from the MRP1 transgenic maize line (proBETL9+ZmMRP1+Sac66 term) chosen according to example 2.

[0113] The transformants (T0) plant was first crossed with the A188 line thereby producing T1 plants. T1 plants were then self pollinated twice, producing T3 plants which are homozygous lines containing the transgene. These T3 plants were then crossed with the tester line thereby leading to a hybrid. This hybrid is at a T4 level with regards to the transformation step and is heterozygous for the transgene. These hybrid plants are used in field experiments.

[0114] Control hybrids are obtained as follows:

[0115] Control Equiv corresponds to a cross between a A188 line (the line used for transformation) and the tester line.

[0116] Control T 00260 corresponds to a cross between a null segregant (isolated after the second self-pollination of the T1 plants) and the tester line. Said null segregant is a homozygous line which does not bear the transgene. Although the null segregant theoretically presents the same genome as A188, it has undergone in vitro culture (via the steps of callus differentiation and regeneration) and may thus present mutations (either genetic or epigenetic) with regards to a A188 line that has not undergone in vitro culture.

[0117] These two control lines are used to avoid any effect that could be due to mutations (genetic or epigenetic) coming from in vitro culture.

[0118] Improved yield was observed for the hybrid corn plants containing the MRP1 construct as compared to the controls, as can be seen in Table I. The yield observed ranged from 102% to 111% of the mean of the yield of the controls. No effect on seed moisture content was observed.

[0119] Yield was calculated as follows:

[0120] During harvest, grain weight and grain moisture are measured using on-board equipment on the combine harvester.

[0121] Grain weight is then normalized to moisture at 15%, using the following formula:

Normalized grain weight=measured grain weight(100measured moisture (as a percentage))/85 (which is 100normalized moisture at 15%).

[0122] As an example, if the measured grain moisture is 25%, the normalized grain weight will be: normalized grain weight=measured grain weight75/85. Yield is then expressed in a conventional unit (such as quintal per hectare).

[0123] BExperimental Design:

[0124] Field trials were conducted in 2009 (3 locations) and 2010 (two locations)

In 2009, plants were sown between Jun. 15 and Jun. 25 2009, Harvest was between the 10 and the 12 of Nov. 2009.
In 2010, plants were sown between the 6th and 18th of May 6. Harvest was between the 15 and 29 Sep. 2010.

[0125] The experimental block comprised of between 5 and 6 replicates. The experimental design was Randomized complete block or Lattice. Each replicate comprised of two row plots with about 62 plants per plot at a density of 73 800 plants/ha.

[0126] Two controls were used present in this experiment as described above (a null segregant T00260 and a control equivalent (A188 crossed with the tester line). The

[0127] Results are represented in Table I, with the yield expressed in (Qx/ha). This table demonstrates that the transgenic plants present an increased yield (normalized for moisture). No other phenotypes were observed for these plants.

TABLE-US-00003 TABLE I yield (expressed in Qx/ha) for T 00260-6 tranformant P value compared Number Control T 00260-6 % with the of Yield Yield Yield of mean of Year Site replicates (Qx/Ha) (Qx/Ha) Control controls 2008 Henderson 3 91.8 94.6 103 0.5027 2008 Bluffton 5 65.8 63.2 96 0.5163 2009 Huxley 6 78.5 80.0 102 0.4300 2009 Arlington 6 77 79.2 103 0.2731 2009 Bluffton 6 71.8 77.2 108 0.2244 2010 Alleman 5 63.5 70.4 111 0.0204 2010 Masson 5 61.9 65.9 107 0.037 2011 Finch 7 71.9 68.5 95 0.1769 2011 Masson 7 56.5 53.4 95 0.0119

Example 5Wheat Field Trials

[0128] Field trials show that stability of yield is improved.

[0129] AField Trials

[0130] Homozygous transgenic lines were selfed for seed increase. T4 (proBETL9+ZmMRP1+Sac66 term) homozygous plants were used for field trial

[0131] Controls are obtained by bulking null segregant sibling isolated from T1 segregation screened by qPCR. The untransformed line is also included as a separate control. These two control lines are used to avoid any effect that could be due to mutations (genetic or epigenetic) coming from in vitro culture. No significant difference is observed between the two controls and thus the wild type line is used for statistical analysis.

[0132] Improved yield was observed for wheat plants containing the MRP1 construct as compared to the controls, as can be seen in FIG. 3. Two conditions were tested: normal conditions and heat stress condition whereby temperatures measures during flowering were equal or above 30 C. for at least five hours out of 24 h during several days in a row.

[0133] In normal conditions, the yield observed ranged from 98% to 105% of the mean of the yield of the controls with a global average of 102%. No effect on seed moisture content was observed.

[0134] In stressed conditions, the yield observed ranged from 100% to 128% of the mean of the yield of the controls with a global average of 115%. No effect on seed moisture content was observed.

[0135] Yield was calculated as follows:

[0136] During harvest, grain weight and grain moisture are measured using on-board equipment on the combine harvester.

[0137] Grain weight is then normalized to moisture at 15%, using the following formula:

Normalized grain weight=measured grain weight(100measured moisture (as a percentage))/85 (which is 100normalized moisture at 15%).

[0138] As an example, if the measured grain moisture is 25%, the normalized grain weight will be: normalized grain weight=measured grain weight75/85. Yield is then expressed in a conventional unit (such as quintal per hectare).

[0139] BExperimental Design:

[0140] Field trials were conducted in 2010 (1 location) and 2011 (1 location)

In 2010, plants were sown between April 15 (for the unstressed condition) and June 02 (for stressed conditions),
In 2011, plants were sown on April 28 (no stress condition) and on June 03 (stressed condition).

[0141] The experimental block comprised of 5 replicates. The experimental design was Randomized complete block or Lattice. Each replicate comprised of 10 m.sup.2 plot seeded at 360 seeds/m.sup.2.

[0142] Two controls were used present in this experiment as described above (a bulk null segregant T00260 and a control equivalent (NB1 line).

[0143] Results are represented in FIG. 3 with the yield expressed in (Qx/ha). This figure demonstrates that the transgenic plants present an increased yield stability (normalized for moisture). No other phenotypes were observed for these plants.