miRNA-regulated differentiation-dependent self-deleting cassette
09745598 ยท 2017-08-29
Assignee
Inventors
- David Frendewey (New York, NY)
- David Jonathan Heslin (Closter, NJ, US)
- Ka-man Venus Lai (Tarrytown, NY)
- David M. Valenzuela (Yorktown Heights, NY)
Cpc classification
A01K67/0275
HUMAN NECESSITIES
C12N5/0606
CHEMISTRY; METALLURGY
C12N2800/22
CHEMISTRY; METALLURGY
C12N15/873
CHEMISTRY; METALLURGY
A01K2217/07
HUMAN NECESSITIES
A01K2217/206
HUMAN NECESSITIES
C12N15/8509
CHEMISTRY; METALLURGY
C12N2800/30
CHEMISTRY; METALLURGY
International classification
C12N15/00
CHEMISTRY; METALLURGY
C12N9/12
CHEMISTRY; METALLURGY
C12N15/90
CHEMISTRY; METALLURGY
Abstract
Targeting constructs and methods of using them are provided for differentiation-dependent modification of nucleic acid sequences in cells and in non-human animals. Targeting constructs comprising a promoter operably linked to a recombinase are provided, wherein the promoter drives transcription of the recombinase in an differentiated cell but not an undifferentiated cell. Promoters include Blimp1, Prm1, Gata6, Gata4, Igf2, Lhx2, Lhx5, and Pax3. Targeting constructs with a cassette flanked on both sides by recombinase sites can be removed using a recombinase gene operably linked to a 3-UTR that comprises a recognition site for an miRNA that is transcribed in undifferentiated cells but not in differentiated cells. The constructs may be included in targeting vectors, and can be used to automatically modify or excise a selection cassette from an ES cell, a non-human embryo, or a non-human animal.
Claims
1. A mouse embryonic stem (ES) cell, comprising: (i) a selection cassette comprising a selectable marker operably linked to a first promoter, wherein the selection cassette is flanked upstream and downstream by first and second recombinase recognition sites orientated to direct an excision; and (ii) a recombinase cassette comprising a second promoter operably linked to a gene encoding a recombinase that recognizes the first and second recombinase recognition sites, wherein the recombinase gene is separate from the selection cassette and is operably linked to a 3-UTR that comprises one or more miRNA recognition sites that are recognized by one or more miRNAs that are active in an undifferentiated cell but are not active in a differentiated cell so that the recombinase gene is expressed in the differentiated cell and works in trans to excise the nucleotide sequence flanked by the first and second recombinase recognition sites from the genome of the differentiated cell.
2. The mouse ES cell of claim 1, further comprising a reporter gene.
3. The mouse ES cell of claim 2, wherein the reporter gene is operably linked to the promoter of a targeted gene in the mouse ES cell.
4. The mouse ES cell of claim 2, wherein the reporter gene is selected from the group consisting of a luciferase gene, a LacZ gene, a GFP gene, an eGFP gene, a CFP gene, a YFP gene, an eYFP gene, a BFP gene, an eBFP gene, a DsRed gene, and a MmGFP gene.
5. The mouse ES cell of claim 1, wherein the gene encoding the recombinase is flanked by third and fourth recombinase recognition sites recognized by the recombinase.
6. The mouse ES cell of claim 1, wherein the selection cassette comprises a gene that encodes neomycin phosphotransferase (neo.sup.r), hygromycin B phosphotransferase (hyg.sup.r), puromycin-N-acetyltransferase (puro.sup.r), blasticidin S deaminase (bsr.sup.r), xanthine/guanine phosphoribosyl transferase (gpt), or Herpes simplex virus thymidine kinase (HSV-tk).
7. The mouse ES cell of claim 1, wherein the one or more miRNA recognition sites are present in 1, 2, 3, or 4 copies.
8. The mouse ES cell of claim 1, wherein the one or more miRNAs are selected from the group consisting of an miR 292-3p, an miR 294, and a combination thereof.
9. The mouse ES cell of claim 1, wherein the one or more miRNA recognition sites are present in 1, 2, 3, or 4 copies, and wherein the one or more miRNAs are selected from the group consisting of an miR 292-3p, an miR 294, and a combination thereof.
10. The mouse ES cell of claim 1, wherein the recombinase gene encodes a recombinase selected from the group consisting of Cre, Flp, and Dre.
11. The mouse ES cell of claim 10, wherein the recombinase gene encodes a Cre recombinase, and the first and second recombinase recognition sites are lox sites.
12. The mouse ES cell of claim 1, further comprising a modified allele at a genomic locus of interest.
13. The mouse ES cell of claim 12, wherein the modified allele is not flanked by the first and second recombinase recognition sites.
14. The mouse ES cell of claim 12, wherein the modified allele comprises a knockin, a knockout, a mutated nucleic acid sequence, or a combination thereof.
15. The mouse ES cell of claim 12, wherein the selection cassette is at the genomic locus of interest.
16. A mouse embryo comprising the mouse embryonic stem (ES) cell of claim 1.
17. The mouse embryo of claim 16, wherein the mouse ES cell further comprises a reporter gene.
18. The mouse embryo of claim 17, wherein the reporter gene is operably linked to the promoter of a targeted gene in the mouse ES cell.
19. The mouse embryo of claim 17, wherein the reporter gene is selected from the group consisting of a luciferase gene, a LacZ gene, a GFP gene, an eGFP gene, a CFP gene, a YFP gene, an eYFP gene, a BFP gene, an eBFP gene, a DsRed gene, and a MmGFP gene.
20. The mouse embryo of claim 16, wherein the gene encoding the recombinase is flanked by third and fourth recombinase recognition sites recognized by the recombinase.
21. The mouse embryo of claim 16, wherein the selection cassette comprises a gene that encodes neomycin phosphotransferase (neo.sup.r), hygromycin B phosphotransferase (hyg.sup.r), puromycin-N-acetyltransferase (puro.sup.r), blasticidin S deaminase (bsr.sup.r), xanthine/guanine phosphoribosyl transferase (gpt), or Herpes simplex virus thymidine kinase (HSV-tk).
22. The mouse embryo of claim 16, wherein the one or more miRNA recognition sites are present in 1, 2, 3, or 4 copies.
23. The mouse embryo of claim 16, wherein the one or more miRNAs are selected from the group consisting of an miR 292-3p, an miR 294, and a combination thereof.
24. The mouse embryo of claim 16, wherein the one or more miRNA recognition sites are present in 1, 2, 3, or 4 copies, and wherein the one or more miRNAs are selected from the group consisting of an miR 292-3p, an miR 294, and a combination thereof.
25. The mouse embryo of claim 16, wherein the recombinase gene encodes a recombinase selected from the group consisting of Cre, Flp, and Dre.
26. The mouse embryo of claim 25, wherein the recombinase gene encodes a Cre recombinase, and the first and second recombinase recognition sites are lox sites.
27. The mouse embryo of claim 16, wherein the mouse ES cell further comprises a modified allele at a genomic locus of interest.
28. The mouse embryo of claim 27, wherein the modified allele is not flanked by the first and second recombinase recognition sites.
29. The mouse embryo of claim 27, wherein the modified allele comprises a knockin, a knockout, a mutated nucleic acid sequence, or a combination thereof.
30. The mouse embryo of claim 27, wherein the selection cassette is at the genomic locus of interest in the mouse ES cell.
31. A method for making a genetically modified mouse, comprising: (a) introducing the mouse embryonic stem (ES) cell of claim 1 into a host mouse embryo, wherein the mouse ES cell further comprises a modified allele at a genomic locus of interest, wherein the modified allele is not flanked by the first and second recombinase recognition sites; (b) implanting the host mouse embryo comprising the mouse ES cell of step (a) into a mouse capable of gestating the host embryo; (c) maintaining the mouse of step (b) under conditions sufficient for gestation; and (d) obtaining from the mouse of step (c) a genetically modified mouse that lacks the selectable marker in its genome and comprises the modified allele.
32. The method of claim 31, wherein the mouse ES cell further comprises a reporter gene.
33. The method of claim 32, wherein the reporter gene is operably linked to the promoter of a targeted gene in the mouse ES cell.
34. The method of claim 32, wherein the reporter gene is selected from the group consisting of a luciferase gene, a LacZ gene, a GFP gene, an eGFP gene, a CFP gene, a YFP gene, an eYFP gene, a BFP gene, an eBFP gene, a DsRed gene, and a MmGFP gene.
35. The method of claim 31, wherein the gene encoding the recombinase is flanked by third and fourth recombinase recognition sites recognized by the recombinase.
36. The method of claim 31, wherein the selection cassette comprises a gene that encodes neomycin phosphotransferase (neo.sup.r), hygromycin B phosphotransferase (hyg.sup.r), puromycin-N-acetyltransferase (puro.sup.r), blasticidin S deaminase (bsr.sup.r), xanthine/guanine phosphoribosyl transferase (gpt), or Herpes simplex virus thymidine kinase (HSV-tk).
37. The method of claim 31, wherein the one or more miRNA recognition sites are present in 1, 2, 3, or 4 copies.
38. The method of claim 31, wherein the one or more miRNAs are selected from the group consisting of an miR 292-3p, an miR 294, and a combination thereof.
39. The method of claim 31, wherein the one or more miRNA recognition sites are present in 1, 2, 3, or 4 copies, and wherein the one or more miRNAs are selected from the group consisting of an miR 292-3p, an miR 294, and a combination thereof.
40. The method of claim 31, wherein the recombinase gene encodes a recombinase selected from the group consisting of Cre, Flp, and Dre.
41. The method of claim 40, wherein the recombinase gene encodes a Cre recombinase, and the first and second recombinase recognition sites are lox sites.
42. The method of claim 31, wherein the modified allele comprises a knockin, a knockout, a mutated nucleic acid sequence, or a combination thereof.
43. The method of claim 31, wherein the selection cassette is at the genomic locus of interest in the mouse ES cell.
44. A mouse made by the method of claim 31.
45. The mouse ES cell of claim 1, wherein the undifferentiated cell is an embryonic stem cell.
46. The mouse embryo of claim 16, wherein the undifferentiated cell is an embryonic stem cell.
47. The method of claim 31, wherein the undifferentiated cell is an embryonic stem cell.
Description
BRIEF DESCRIPTION OF THE FIGURES
(1)
(2)
(3)
(4)
(5)
(6)
(7)
DETAILED DESCRIPTION
(8) The invention is not limited to particular methods, and experimental conditions described, as such methods and conditions may vary. The terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention will be limited only by the claims.
(9) Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, particular methods and materials are now described. All publications mentioned herein are incorporated herein by reference in their entirety.
(10) Methods and compositions are provided for modifying or removing nucleic acid sequences in a differentiation-dependent manner. The methods and compositions include promoters or regulatory elements that induce modification (e.g., inversion) or removal (e.g., excision) of a nucleic acid sequence only when a cell undergoes differentiation or begins a differentiation process. The methods and compositions also include those that employ sequences recognized by miRNAs that are produced and/or function in undifferentiated cells but cease to be produced or cease to function in differentiated cells. They also include promoters that drive transcription effectively in differentiated cells, but not effectively in undifferentiated cells.
(11) Differentiation-dependent Regulation of Expression: Promoters and RNAs
(12) An ideal solution to the problem of selectable marker removal from genetically modified animals (e.g., knockout mice) would retain the selection cassette in ES cells to enable selection of clones that have incorporated the targeting vector but promote automatic excision (or modification, e.g., inversion) of the cassette with essentially 100% efficiency in all cells and tissues of the developing embryo and mouse without the need for additional treatments or manipulations of targeted ES cells or for breeding of mice. Such an ideal solution depends upon the recombinase that recognizes the recombination sites flanking the selection cassette being inactive, or substantially inactive, in undifferentiated ES cells and then becoming active once the ES cells are incorporated into a developing embryo and begin to differentiate.
(13) One way of achieving differentiation-dependent regulation of the recombinase is to drive the transcription of recombinase mRNA with a promoter that is off in ES cells but comes on once the ES cells begin to differentiate (e.g., into the cell and tissue types of a developing embryo) or, e.g., that is on in a germ cell such that progeny that develop from the germ cell have expressed the recombinase at a very early stage in development. In this way, a selection cassette flanked on each side by recombinase recognition sites is excised only upon differentiation (or development). For complete excision of the selection cassette, the promoter driving recombinase expression would, ideally, remain active in all the cells and tissues of the embryo and mouse. However, certain promoters, e.g., those active in germ cells, might also be useful because if the promoter is active in a germ cell of an F0 animal, breeding that animal will result in excision of the cassette in all cells and tissues of that animal's progeny.
(14) Embodiments are provided for promoters that are inactive in ES cells that have not undergone differentiation, but that are active either during differentiation or when the ES cells begin to differentiate (or, e.g., in germ cells or in germ lineage cells, e.g., in sperm lineage cells). A recombinase gene operably linked to such a promoter will be transcribed, or substantially transcribed, when an ES cell begins to differentiate (or, e.g., when a cell differentiates into a germ lineage cell, e.g., a sperm lineage cell). If a selection cassette is flanked by recombinase recognition sites that direct a deletion, then expression of the recombinase will cause the differentiating cell to lose the selection cassette and, if the cells are maintained under selective conditions, the cells will not survive selection. This affords methods and compositions for maintaining only undifferentiated ES cells in culture, for maintaining an ES cell culture enriched with respect to undifferentiated cells, and for automatic excision of a selection cassette upon differentiation of the ES cells while, e.g., the ES cells are differentiating as donor cells in a host embryo.
(15) In various embodiments, a suitable promoter is selected from a Prm1, Blimp1, Gata6, Gata4, Igf2, Lhx2, Lhx5, Pax3. In a specific embodiment, the promoter is the Gata6 or Gata4 promoter. In another specific embodiment, the promoter is a Prm1 promoter. In another specific embodiment, the promoter is a Blimp1 promoter or fragment thereof, e.g., a 1 kb or 2 kb fragment of a Blimp1 promoter. A suitable Prm1 promoter is shown in SEQ ID NO:1; a suitable Blimp1 promoter is shown in SEQ ID NO:2 (1 kb promoter) or SEQ ID NO:3 (2 kb promoter).
(16) Differentiation-dependent Regulation: miRNA Recognition Sequences
(17) Another way of achieving differentiation-dependent regulation of the recombinase is to regulate recombinase expression post-transcriptionally by miRNA-mediated mechanisms. Micro RNAs (miRNAs) are small RNAs (approximately 22 nucleotides, nt, in length) that associate with Argonaute proteins and regulate mRNA expression by binding to miRNA recognition sites in the 3-untranslated region (3-UTR) of mRNA and promoting inhibition of protein synthesis and destruction of the mRNA (see, e.g., Filipowicz et al. (2008) Mechanisms of post-transcriptional regulation by microRNAs: are the answers in sight? Nature Reviews Genetics 9:102-114).
(18) An miRNA interacts with its natural recognition site by forming a Watson-Crick (W-C) base-paired helix between the miRNA's so-called seed sequencenucleotides 2 through 8 numbering from the 5 endand a complementary sequence in the target mRNA's 3-UTR. The remainder of the miRNA forms an imperfect helix with the target. This type of imperfectly paired complex between the target mRNA and the miRNA bound to an Argonaute protein and other components of the RNA-induced silencing complex (RISC) triggers the events that result in the inhibition of translation of the target mRNA into protein. Another class of natural small RNA known as small interfering RNA (siRNA) is produced by cleavage of long double-stranded RNAs (dsRNAs) into short dsRNAs whose 21 nt (the most frequent length) single strands form a perfect W-C helix over their 5-terminal 19 nucleotides with the last two 3-terminal nucleotides left as unpaired overhangs on each end of the helix. Usually, one strand of a double-stranded siRNA gets loaded into an Argonaute-RISC in a manner similar to miRNAs, but unlike miRNAs, siRNA-loaded RISCs form perfect W-C helices with their target mRNAs and promote cleavage rather than translational inhibition. An mRNA cleaved by an siRNA-RISC is usually rapidly degraded by cellular ribonucleases, which usually results in a more severe reduction of the target mRNA and its encoded protein than that induced by a miRNA-RISC. Researchers have taken advantage of this difference to regulate expression of genes exogenously added to cells or animals. See, e.g., Mansfield et al. (2004) MicroRNA-responsive sensor transgenes uncover Hox-like and other developmentally regulated patterns of vertebrate microRNA expression, Nature Genetics 36:1079-1083; Brown et al. (2007) Endogenous microRNA can be broadly exploited to regulate transgene expression according to tissue, lineage and differentiation state, Nature Biotech. 25:1457-1467; Brown et al. (2009) Exploiting and antagonizing microRNA regulation for therapeutic and experimental applications, Nature Reviews Genetics 10:578-585.
(19) All miRNAs mentioned refer to mouse miRNAs, i.e., mmu-miRs.
(20) Differentiation-dependent miRNA Regulation of an Excising Protein
(21) Differential expression of endogenous miRNAs can be advantageously used to control expression of exogenously added genes in cells and in non-human animals. As discussed above, miRNAs can be potent inhibitors of translation. Where an miRNA has an expression profile that results in inhibition of its target under one set of conditions, but not under another, the difference in expression can be exploited to express a gene under one but not the other set of conditions. Thus, if an endogenous miRNA can be found that is expressed in undifferentiated cells but not in differentiated cells, the expression of a gene controlled by that endogenous miRNA can be modulated by placing a recognition sequence (or target sequence) for the endogenous miRNA in the gene. miRNA expression is expected to modulate expression of the target gene even where the target gene is an exogenous (or foreign) gene so long as the exogenous gene contains, or is operably linked to, an appropriate miRNA recognition sequence. In this way foreign genes, such as those introduced into a cell or a non-human animal by a targeting vector, can be placed under the control of an endogenous miRNA. miRNAs that are expressed only at a certain period in development can be used to silence exogenous genes during that developmental period. Thus, an miRNA that is expressed only in undifferentiated cells but not in differentiated cells can be exploited to silence expression of an exogenous gene in an undifferentiated cell but not following the cell's differentiation, by placing a recognition sequence recognized by the miRNA in operable linkage, e.g., in a 3-UTR, of the exogenous gene to be silenced.
(22) One advantageous application of placing an miRNA recognition sequence in a 3-UTR that is a target of a developmentally-regulated miRNA is that nucleic acid sequences in a cell or non-human animal of interest can be modified or excised by a site-specific recombinase in a developmentally-dependent manner. In this application, the sequence desired to be modified or excised is flanked on each side by RRSs, and a recombinase gene is employed that has a 3-UTR having a target sequence for an miRNA that is expressed in a developmentally-dependent manner. Modification or excision may occur by the option of how the RRSs are oriented. The miRNA recognition sequence is selected by determining at which developmental stage the recombinase gene is to be activated, and selecting the recognition sequence to bind an endogenous miRNA that is expressed at the selected developmental stage. For cases of selection cassette excision discussed herein concerning ES cells, miRNA recognition sequence selection is based on miRNAs that are expressed in undifferentiated cells, but are not expressed in differentiated cells.
(23) Thus, the 3-UTR of an mRNA of a recombinase is selected so that it contains one or more (e.g., one to four) miRNA recognition sites that comprise perfect (or, in some embodiments, near-perfect) Watson-Crick complements of endogenous natural miRNAs such that use of the sequence in the 3-UTR of the recombinase produces an siRNA-like RNA interference (RNAi) that results in the reduction of both the targeted recombinase mRNA and its encoded recombinase in cells that express the cognate miRNA.
(24) In various embodiments, the miRNA recognition sites comprise perfect or near-perfect Watson-Crick complements of endogenous natural miRNA seed sequences, or sufficiently recognize natural miRNA seed sequences such that the natural miRNA can bind the target and thus promote inhibition of expression of the gene bearing the target. In various embodiments, the miRNA recognition sequences are present in one, two, three, four, five, or six or more tandem copies in the 3-UTR. In various embodiments, the miRNA recognition sequences are specific for a single miRNA, in other embodiments, the miRNA recognition sequences bind two or more miRNAs. In various embodiments, the miRNA recognition sequences are identical and designed to bind two or more members of the same miRNA family, e.g., the miRNA recognition sequence is a consensus sequence of two or more miRNA target sequences. In various embodiments, the miRNA recognition sequences are two or more different recognition sequences that bind miRNAs in the same family (e.g., the miR 292-3p family).
(25) miRNAs that are expressed in undifferentiated cells but not in differentiated cells fall into different miRNA families, or clusters. miRNAs that are abundant in ES cells include, e.g., clusters 290-295, 17-92, chr2, chr12, 21, and 15b16. See, e.g., Calabrese et al. (2007) RNA sequence analysis defines Dicer's role in mouse embryonic stem cells, Proc. Natl. Acad. Sci. USA 104(46):18097-18102; Houbaviy et al. (2003) Developmental Cell 5:351-358, and Landgraf et al. (2007) Cell 129:1401-1414. Quantification of miRNA in mouse ES cells by sequencing of small RNAs revealed that the ten most abundant miRNAs are miR-291a-3p, miR-294, miR-292-5p, miR 295, miR-290, miR 293, miR-292-3p, miR-291a-5p, miR-130a, and miR-96. See, Marson et al. (2008) Cell 134:521-533, Supplemental
(26) As illustrated herein, the ten most abundant miRNAs present in two specific mouse ES cell lines was also determined. Mouse ES cell line VGB6 was isolated at Regeneron Pharmaceuticals, Inc. from a C57BL/6NTac mouse strain (Taconic). Mouse ES cell line VGF1, also isolated at Regeneron Pharmaceuticals, Inc., was isolated from a hybrid 129/B6 F1 mouse strain. The ten most abundant miRNAs were identified by microarray analysis and found to be miR-292-3p, miR-295, miR-294, miR-291a-3p, miR293, miR-720, miR-1224, miR-19b, miR92a, and miR-130a. The top 20 most abundant miRNAs also included, from 11.sup.th to 20.sup.th most abundant, miR-20b, miR-96, miR-20a, miR-21, miR-142-3p, miR-709, miR-466e-3p, and miR-183.
(27) For the case of VGB6 cells, quantitative PCR revealed that the 20 most abundant miRNAs in those cells are, in order, miR-296-3p, miR-434-5p, miR-494, miR-718, miR-181c, miR-709, miR-699, miR-690, miR-1224, miR-720, miR-370, miR-294, miR-135a*, miR-1900, miR-295, miR-293, miR-706, miR-212, and miR-712.
(28)
(29) The alignment of
(30) In one embodiment, the miRNA recognition sequence operably linked to the recombinase gene comprises a seed sequence that comprises a sequence that is identical to 5-AAGUGCC-3. In one embodiment, the miRNA recognition sequence operably linked to the recombinase gene comprises a seed sequence that is identical to 5-AAGUGCC-3 except for a single nucleic acid substitution. In a specific embodiment, the second nucleotide of the seed sequence is a G or an A. In a specific embodiment, the third nucleotide of the seed sequence is a G or a U. In a specific embodiment, the final position of the seed sequence is a C. In a specific embodiment, the final position of the seed sequence is a U. In a specific embodiment, the final position of the seed sequence is an A.
(31) In one embodiment, the miRNA recognition sequence operably linked to the recombinase gene comprises a seed sequence that is perfectly complementary to a seed sequence of an miRNA expressed in an ES cell but not expressed in a differentiated cell, the miRNA is one of the ten most abundant miRNAs expressed in the ES cell in an undifferentiated state, and the miRNA recognition sequence further comprises 14-18 further nucleotides that are about 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to an miRNA naturally expressed in the undifferentiated ES cell, and wherein the presence of the miRNA recognition sequence in the 3-UTR of the recombinase gene results in a decrease of expression of at least 50% as compared with a recombinase gene with a 3-UTR that lacks the miRNA recognition sequence. In a specific embodiment, the decrease in expression of the recombinase is at least 60%, at least 70%, at least 80%, at least 90%, or at least 95%.
(32) In one embodiment, the miRNA recognition sequence comprises a seed sequence of an miRNA selected from miR-292-3p and miR-294. In a specific embodiment, the miRNA recognition sequence further comprises a non-seed sequence that is at least 90% identical with a non-seed sequence of an miRNA selected from the group consisting of miR-292-3p and miR-294. In a specific embodiment, the miRNA recognition sequence further comprises a non-seed sequence that is at least 95% identical with a non-seed sequence of an miRNA selected from the group consisting of miR-292-3p and miR-294.
(33) In one embodiment, the miRNA recognition sequence operably linked to the recombinase gene is recognized by an miRNA selected from miR-292-3p, miR-290-3p, miR-291a-3p, miR-291b-3p, miR-294, miR-295, miR-302a, miR-302b, miR-302c, miR-302d, miR-367, miR-17, miR-18a, miR-18b, miR-20a, miR-106a, and miR-93.
(34) In one embodiment, the miRNA recognition sequence binds miR-292-3p, miR-290-3p, miR-291a-3p, miR-291b-3p, miR-294, miR-295, miR-302a, miR-302b, miR-302c, miR-302d, miR-367, miR-17, miR-18a, miR-18b, miR-20a, miR-106a, or miR-93, and is one of the 20 most abundant miRs specifically expressed in the target cell. In one embodiment, the miRNA is one of the 10 most abundant miRNAs expressed in the target cell. In one embodiment, the miRNA is one of the five most abundant miRNAs expressed in the target cell. In one embodiment, the target cell is a mouse ES cell and the miRNA is selected from an miR of Table 2. In one embodiment, the miR is selected from the group consisting of miR-292-3p, miR-290-3p, miR-291a-3p, miR-291b-3p, miR-294, miR-295, miR-302a, miR-302b, miR-302c, miR-302d, miR-367, miR-17, miR-18a, miR-18b, miR-20a, miR-106a, or miR-93, and a combination thereof. In one embodiment, the miRNA recognition sequence comprises a sequence that is complementary to a seed sequence of one of miR-292-3p, miR-290-3p, miR-291a-3p, miR-291 b-3p, miR-294, miR-295, miR-302a, miR-302b, miR-302c, miR-302d, miR-367, miR-17, miR-18a, miR-18b, miR-20a, miR-106a, or miR-93, and the remainder of the miRNA recognition site comprises a non-seed sequence that is about 85%, 90%, 95%, 96%, 97%, 98%, or 99% complementary to a non-seed sequence independently selected from one of miR-292-3p, miR-290-3p, miR-291a-3p, miR-291b-3p, miR-294, miR-295, miR-302a, miR-302b, miR-302c, miR-302d, miR-367, miR-17, miR-18a, miR-18b, miR-20a, miR-106a, or miR-93.
(35) In one embodiment, the miRNA recognition sequence contains a sequence that is a perfect Watson-Crick match to a seed sequence of an miRNA of Table 2, and the remainder of the miRNA recognition sequence (outside of the sequence that perfectly matches the miRNA seed sequence) is 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the non-seed sequence of an miRNA of Table 2. In one embodiment, the miRNA is selected from the group consisting of miR-292-3p, miR-295, miR-294, miR-291a-3p, miR-293, miR-720, miR-1224, and a combination thereof. Sequences of miRNAs are provided in Table 1 below.
(36) TABLE-US-00001 TABLE1 mmu-miRNASequences SEQ miR Sequence IDNO 17 CAAAGUGCUUACAGUGCAGGUAG 4 18a UAAGGUGCAUCUAGUGCAGAUA 5 18b UAAGGUGCAUCUAGUGCUGUUAG 6 19b UGUGCAAAUCCAUGCAAAACUGA 7 20a UAAAGUGCUUAUAGUGCAGGUAG 8 20b CAAAGUGCUCAUAGUGCAGGUAG 9 21 UAGCUUAUCAGACUGAUGUUGA 10 92a UAUUGCACUUGUCCCGGCCUG 11 93 CAAAGUGCUGUUCGUGCAGGUAG 12 96 UUUGGCACUAGCACAUUUUUGCU 13 106a CAAAGUGCUAACAGUGCAGGUAG 14 130a CAGUGCAAUGUUAAAAGGGCAU 15 135a* UAUAGGGAUUGGAGCCGUGGCG 16 142-3p UGUAGUGUUUCCUACUUUAUGGA 17 181c AACAUUCAACCUGUCGGUGAGU 18 183 GUGAAUUACCGAAGGGCCAUAA 19 212 UAACAGUCUCCAGUCACGGCCA 20 291a-5p CAUCAAAGUGGAGGCCCUCUCU 21 290-3p AAAGUGCCGCCUAGUUUUAAGCCC 22 292-5p ACUCAAACUGGGGGCUCUUUUG 23 291a-3p AAAGUGCUUCCACUUUGUGUGC 24 291b-3p AAAGUGCAUCCAUUUUGUUUGU 25 292-3p AAAGUGCCGCCAGGUUUUGAGUGU 26 293 AGUGCCGCAGAGUUUGUAGUGU 27 294 AAAGUGCUUCCCUUUUGUGUGU 28 295 AAAGUGCUACUACUUUUGAGUCU 29 302a UAAGUGCUUCCAUGUUUUGGUGA 30 302b UAAGUGCUUCCAUGUUUUAGUAG 31 302c AAGUGCUUCCAUGUUUCAGUGG 32 302d UAAGUGCUUCCAUGUUUGAGUGU 33 367 AAUUGCACUUUAGCAAUGGUGA 34 370 GCCUGCUGGGGUGGAACCUGGU 35 434-5p GCUCGACUCAUGGUUUGAACCA 36 494 UGAAACAUACACGGGAAACCUC 37 690 AAAGGCUAGGCUCACAACCAAA 38 706 AGAGAAACCCUGUCUCAAAAAA 39 709 GGAGGCAGAGGCAGGAGGA 40 712 CUCCUUCACCCGGGCGGUACC 41 718 CUUCCGCCCGGCCGGGUGUCG 42 720 AUCUCGCUGGGGCCUCCA 43 1224 GUGAGGACUGGGGAGGUGGAG 44 1900 GGCCGCCCUCUCUGGUCCUUCA 45
(37) Differentiation-dependent Excision of Selection Cassettes
(38) To create various embodiments of a self-deleting selection cassette whose excision is regulated by miRNA control of recombinase gene expression, a standard selection cassette is modified by insertion of a recombinase gene unit that comprises a promoter, which may or may not be active in ES cells but is active in embryonic stages after the blastocyst, linked to the protein coding sequence of a site-specific recombinase, e.g., Cre, Flp, or Dre, followed by a sequence encoding the 3-UTR of the recombinase mRNA, into which is inserted a copy of, or multiple copies of, a sequence complementary to one or more miRNAs that are expressed in ES cells but not in any of the cells of the developing embryo or mouse, and terminated with a polyadenylation signal. The modified selection cassette with the inserted miRNA-regulatable recombinase gene unit is flanked by recognition sites for the recombinase whose gene has been inserted. The orientation of the flanking recombinase recognition sites is such that the recombinase will catalyze the deletion of the modified selection cassette, including the recombinase gene. Embodiments are also possible where the selection cassette is on a separate construct, in which case the recombinase works in trans.
(39) In one embodiment, the recombinase gene is a Cre recombinase gene. In one embodiment, the Cre recombinase gene further comprises a nuclear localization signal to facilitate localization of Cre to the nucleus (e.g., the gene is an NL-Cre gene). In one embodiment, the Cre recombinase gene comprises an intron (e.g., the gene is a Crei gene), such that the Cre recombinase is not functional in bacteria. In a specific embodiment, the Cre recombinase gene further comprises a nuclear localization signal and an intron (e.g., NL-Crei).
(40) An example of part of a targeting vector designed to create a knockout allele in which the selectable marker is included within a Differentiation-Dependent Self-Deleting Cassette, or DDSDC, is illustrated in
(41) When a modified selection cassette containing the miRNA-regulatable recombinase gene is incorporated into a targeting vector and introduced into mouse ES cells by standard methods of gene targeting known in the art, expression in the ES cells of miRNAs that recognize their target sequence in the 3-UTR of the recombinase mRNA transcribed from the selection cassette will promote a reduction in recombinase protein synthesis to levels that are too low to substantially excise the selection cassette and, therefore, will permit selection of drug-resistant colonies. As long as the targeted ES cells remain undifferentiated, their endogenous ES-cell-specific miRNAs will control expression of the recombinase and permit drug selection of ES cells that contain the targeted construct. Targeted clones that differentiate away from the ES cell state, however, will lose expression of the ES cell-specific miRNAs, relieving inhibition of recombinase expression, which will result in substantial excision of the selection cassette and loss of drug resistance. Therefore, differentiated clones will be killed (i.e., not survive selection) and would not be used to generate gene-modified mice. Undifferentiated, drug-resistant gene-targeted clones, upon injection into an early mouse embryo (e.g., a premorula, e.g., 8-cell stage embryo, or a blastocyst) will become integrated into the inner cell mass that will ultimately contribute to the developing mouse embryo.
(42) When the injected embryos are transplanted into a surrogate mother and begin to differentiate along a normal developmental path, expression of ES cell-specific miRNAs will wane and the recombinase will be expressed and become active wherever the recombinase gene is transcribed. Driving recombinase expression with a ubiquitously active promoter (e.g., a phosphoglycerate kinase, -actin, ubiquitin promoter, or other promoter) will ensure that the recombinase will have ample opportunity to excise the selection cassette from all or most cell types during the course of development, resulting in pups born devoid of the selection cassette at the targeted locus. These new-born mice would be ready for phenotypic study without concerns about interference by a selection cassette.
(43) In one embodiment, a method for preparing an ES cell culture that lacks viable differentiated cells is provided, comprising introducing into an ES cell a selection cassette and a recombinase gene, wherein either the selection cassette alone or the recombinase gene and the selection cassette are flanked by RRSs recognized by the recombinase, and the recombinase gene is operably linked to an miRNA target sequence as described herein; growing the ES cell to form an ES cell culture, wherein cells that differentiate in culture lose the selection cassette and expire, thereby forming an ES cell culture that lacks or substantially lacks viable differentiated cells, or comprises a substantially reduced number of viable differentiated cells.
(44) In one embodiment, a method for preparing a population of donor mouse ES cells enriched with respect to undifferentiated ES cells is provided, comprising employing an ES cell as described herein that comprises a selection cassette and a recombinase operably linked to a miRNA recognition sequence as described herein, growing the ES cell to form an ES cell culture, and employing the ES cell culture as a source of donor ES cells for introduction into a mouse host embryo. In one embodiment, the ES cell culture is enriched with respect to undifferentiated ES cells by about 10%, 20%, 30%, 40%, or 50% or that more in comparison to a culture in which ES cells do not comprise the miRNA recognition sequence operably linked to the promoter, and the cells are grown in a medium that requires the selection cassette for survival. In one embodiment, the ES cell culture comprises no more than one viable differentiated cell per 100 cells, no more than one viable differentiated cell per 200 cells, per 300 cells, per 400 cells, per 500 cells, per 1,000 cells, or per 2,000 cells. In a specific embodiment, the ES cell culture comprises no viable differentiated cells.
(45) In one embodiment, a differentiated mouse cell is provided, comprising a recombinase gene operably linked to a miRNA target sequence as described herein, and at least one recombinase recognition site. In one embodiment, the differentiated mouse cell is in a mouse embryo. In one embodiment, the differentiated mouse cell is in a tissue of a mouse. In one embodiment, the differentiated mouse cell further comprises a genetic modification selected from a knock-in, a knockout, a mutated nucleic acid sequence, and an ectopically expressed protein.
(46) In one embodiment, a method for making a genetically modified mouse that lacks a selection cassette is provided, comprising (a) introducing into a mouse host embryo a donor mouse ES cell that comprises (i) a selection cassette flanked 5 and 3 with RSSs oriented to direct a deletion, and a recombinase gene operably linked to a promoter that is inactive in undifferentiated cells but active in differentiated cells; or, (ii) a selection cassette flanked upstream and downstream with RSSs oriented to direct a deletion, and a recombinase gene operably linked to an miRNA target sequence as described herein; (b) introducing the embryo into a suitable host mouse for gestation; and (c) following gestation obtaining a mouse that lacks the selection cassette. In one embodiment, the F0 generation mouse lacks the selection cassette. In one embodiment, the F0 mouse is a chimera wherein less than all cells of the mouse lack the selection cassette, and upon breeding the F0 mouse an F1 generation mouse is obtained that lacks the selection cassette.
(47) In one embodiment, a method for identifying differentiated cells in culture is provided, comprising introducing into an undifferentiated cell (a) a marker cassette that contains a detectable marker gene in antisense orientation, wherein the marker cassette is flanked upstream and downstream with RRSs oriented to direct an inversion; and, (b) a recombinase gene operably linked to (i) a promotor that is inactive in undifferentiated cells but active in differentiated cells, and/or (ii) a miRNA target sequence as described herein; wherein the cell begins to differentiate and the recombinase is expressed and places the detectable marker gene in sense orientation, the detectable marker gene is transcribed, and the cell that begins to differentiate is identified by the expression of the detectable marker. In one embodiment, the detectable marker is a fluorescent protein, and the cell that begins to differentiate is identified by detecting fluorescence from the cell.
EXAMPLES
(48) The following examples are provided to describe to those of ordinary skill in the art a disclosure and description of how to make and use embodiments of the invention, and are not intended to limit the scope of what the inventors regard as their invention. Efforts have been made to ensure accuracy with respect to numbers used (e.g., amounts, temperature, etc.) but some experimental errors and deviations should be accounted for. Unless indicated otherwise, parts are parts by weight, molecular weight is average molecular weight, temperature is expressed by degrees Celsius, and pressure is at or near atmospheric.
Example 1
miRNA Abundance in VGB6 and VGF1 ES Cells
(49) Abundance of miRNAs in mouse ES cell lines VGB6 and VGF1 was determined by microarray analysis. Briefly, small RNAs were purified from the ES cells, labeled, and used to probe Agilent miRNA arrays. Abundance readings from array analysis are expressed as hybridization signal intensities.
(50) The twenty most abundant miRNAs are shown based on triplicate readings for VGB6 and for VGF1 in Table 2.
(51) TABLE-US-00002 TABLE 2 ES Cell miRNA Microarray Abundance Analysis miRNA Abundance (avg., n = 3) miRNA VGB6 VGF1 miR-292-3p 111769 127534 miR-295 103566 117946 miR-294 98411 116437 miR-291a-3p 85478 99872 miR-293 73418 11048 miR-720 47419 107611 miR-1224 41173 19402 miR-19b 28868 37820 miR-92a 27722 29698 miR-130a 22974 21864 miR-20b 18677 25450 miR-96 16218 12988 miR-20a 15654 20744 miR-21 15427 29023 miR-142-3p 10369 7152 miR-709 10078 3117 miR-466e-3p 9645 8797 miR-183 8714 7346
(52) The microarray abundance analysis revealed that the top ten abundant miRNAs (ranked by VGB6 abundance) fell largely within the miRNA-290 cluster.
(53) Abundance of miRNAs in VGB6 cells was also determined by quantitative RT-PCR. The qRT-PCR results showed that miRNA-290 family and the miRNA-17-92 family were among the most abundant miRNAs in VGB6 cells.
Example 2
Targeting Vector with miRNA in a Recombinase 3-UTR
(54) A targeting vector in accordance with an embodiment of the invention is constructed by employing, from 5 to 3 with respect to transcription of the targeted gene, a 5 homology arm, a lacZ reporter gene followed by a polyA sequence, a loxP site, a neo.sup.r gene driven by a UbC promoter, a polyA sequence, a promoter driving expression of a Cre recombinase gene, a 3-UTR containing four copies of an miR-292-3p target site (see
(55) Construction of a quadruple miR-292-3p target site by annealing of 4 oligos. To assemble a quadruple miR-292-3p target site, oligodeoxynucleotides S1 and AS1 of
(56) The targeting vector containing the miRNA target site of
(57) Since miR-292-3p is expressed in ES cells, the selection cassette should remain in the ES cell genome during growth and selection of ES cells genetically modified by the targeting vector. To the extent that one or more ES cells bearing the targeting vector would differentiate in culture, those cells would lose the selection cassette and not survive selection.
(58) Once placed into the embryo, the ES cell would divide and populate the embryo. As ES cells within the embryo differentiated, the level of miR-292-3p in the differentiating cell would drop substantially or fall to essentially none. As a result, repression of expression of the Cre recombinase would be relieved, the Cre would express, and the floxed cassette would be excised. Consequently, all or substantially all of the tissues of a mouse born from the surrogate mother would lack the selection cassette.
Example 3
Placement of an miRNA in a 3-UTR of a Reporter Gene
(59) A commercially available luciferase expression vector was modified by adding a single copy of an exact Watson-Crick complement of an miRNA expressed in ES cells to the 3-UTR of the luciferase gene. The vector was transiently transfected into the ES cells, and luciferase expression was knocked down as compared to luciferase expression from a vector lacking the miRNA target sequence. This experiment established that placement of an exogenous miRNA into a 3-UTR of a reporter gene results in an operable unit that can effectively repress gene expression.
Example 4
miRNA Control of Cre Expression in Cells and Mice: Selection
(60) Mouse ES cells from a hybrid line (129S6C57BL6; F1) were electroporated with a first LacZ-containing construct having a floxed neomycin resistance cassette (
(61) The ES cells were genotyped for the presence of the transfected construct and screened for copy number, then introduced into 8-cell stage Swiss Webster embryos using the VELOCIMOUSE method (see, U.S. Pat. Nos. 7,659,442, 7,576,259, 7,294,754, and Poueymirou et al. (2006) F0 generation mice fully derived from gene-targeted embryonic stem cells allowing immediate phenotypic analyses, Nat. Biotech. 25:91-99; each hereby incorporated by reference). E10.5 embryos fully derived from the transfected hybrid ES cells were analyzed for the presence of the transfected cassettes. Results are shown in Table 3 (Cre 1,2=construct with NL-Crei lacking miRNA in 3-UTR; Cre-miR 1,2,3=construct with NL-Crei and miR 292-3p target sequence in 3-UTR). Using these constructs and maintaining the ES cells under conditions selected to retain pluripotency and in the presence of hygromycin or G418 and hygromycin, only those cells that contain the floxed neo cassette but do not express Cre will survive G418 selection. Overall, in all studies, 46% of ES cell clones carrying a floxed selection cassette and a miR-regulated NL-Crei gene exhibited complete deletion of the selection cassette either in embryos or in live-born mice.
(62) Genotyping results for the embryos (whole embryo analyzed) and mice (six tissues analyzed) indicate that regulation of the Cre recombinase by the ES cell-specific miRNAs is relieved upon differentiation and development, as early as day 10.5 of gestation. Live-born mice can be obtained that lack the floxed selection cassette, when multiple tissues are examined.
(63) TABLE-US-00003 TABLE 3 Genotyping of E10.5 Embryos and Mice Total Neo Deleted Total Neo Deleted ES Cell Embryos Embryos Mice Mice Clone Selection (n) (n) (%) (n) (n) (%) Parental 4 0 0 2 0 0 Cre 1 Hyg 9 9 100 3 3 100 Cre 2 Hyg 4 4 100 3 3 100 Cre-miR 1 Hyg + neo 6 5 83.3 3 3 100 Cre-miR 2 Hyg + neo 8 1 12.5 n.d. n.d. n.d. Cre-miR 3 Hyg + neo n.d. n.d. n.d. 1 1 100
(64) Gentoyping results established that ES cells transfected with a construct comprising NL-Crei operably linked to four copies of a miR 292-3p target sequence (in the NL-Crei gene 3-UTR) and selected in G418 (i.e., selected for the presence of neo expression) yielded embryos that lacked the neomycin resistance gene (the floxed selection cassette). These results establish that ES donor cells bearing a NL-Crei gene operably linked to a target miRNA sequence for an miRNA expressed in ES cells but not in differentiated cells can be propagated in culture using a suitable selection cassette and, when introduced into a host embryo, the ES cells can perform an automatic deletion of the cassette when they differentiate (and thus no longer express the miRNA that binds to the target miRNA sequence). Therefore, ES cells that bear a selection or marker cassette flanked with recombinase recognition sites, and a recombinase gene operably linked to a miRNA target sequence for a miRNA that is expressed in ES cells but not in differentiated cells, can be maintained in culture such that pluripotency is maintained, and after introduction of the cells into a host embryo and differentiation, the selection or marker cassette is automatically removed.
(65) In in vitro culture studies, cells bearing the NL-Crei gene but lacking the miRNA recognition site in the 3-UTR (
(66) In separate experiments, similar cells bearing the constructs described above were grown in the presence of one of either hygromycin, G418, or both, in either the presence or absence of LIF, and/or in the presence or absence of retinoic acid for seven or eight days. Control cells that bore a floxed neo cassette and a constitutive Cre substantially expired in the presence of G418, whereas cells in which the NL-Crei gene was linked to the miR 292-3p target sequences had a substantially lower death rate (as low as about 0-25%, compared with cells lacking the miR target sequence; based on colony counts; data not shown). Cells that bore the NL-Crei gene operably linked to the miR 292-3p target sequences exhibited about a 2- to 3-fold higher death ratewhen grown without LIF and in the presence of retinoic acid, hygromycin, and G418than control cells (based on colony counts; data not shown). Similar results were had with a similar experiment using C57BL/6 ES cells (VGB6 cells).
(67) These results establish that ectopic miRNA recognition sequences can effectively inhibit expression of an ectopically expressed recombinase operably linked to the miRNA recognition sequences, and that this phenomenon can be used to control recombination of recombinase-flanked cassettes in ES cells, including for automatic expression or deletion of the recombinase-flanked cassettes. The results also establish that operably linking an ES cell-specific miRNA recognition sequence to the recombinase gene can assist in maintaining an ES cell culture enriched with respect to undifferentiated ES cells by reducing viability of differentiated cells in a selection medium.
Example 5
miRNA Control of Cre Expression in Cells and Mice: Markers
(68) Mouse ES cells were transfected as described above with a first construct containing a GFP gene in antisense orientation flanked by nonidentical recombinase recognition sites (
(69) GFP expression analysis of 210.sup.4 cells each for four separate clones expressing Cre from a hUbC-driven construct in the absence of an miRNA target sequence in the Cre gene 3-UTR (
(70) In contrast, clones containing a construct having an NL-Crei gene having four tandem copies of a miR 291a-5p target sequence, or four tandem copies of a miR 1-1 target sequence, in its 3-UTR showed essentially no difference in GFP expression as measured by FACS as compared with clones containing the same NL-Crei gene but lacking any miR target sequences. These results establish that inhibition of Cre gene expression was specific for the miR 292-3p target sequences, and not merely a random miRNA target sequence.
(71) In another experiment, clones containing a construct having an NL-Crei gene with four copies of an miRNA recognition sequence for miR 292-3p, miR 291a-5p, miR 1-1, or miR 294 in its 3-UTR were tested in a similar FACS assay for GFP expression. Four clones of each were tested. Average percent GFP on FACS analysis revealed that neither clones containing the miR 291a-5p recognition sequence nor the miR 1-1 recognition sequence showed inhibition of Cre expression (percent GFP greater than or equal to 96%), whereas an average of only about 46.5% of all cells containing miR 292-3p recognition sequence, and an average of only about 37.0% of all cells containing the miR 294 recognition sequence, exhibited GFP expression.
(72) None of the cells were selected for maintenance of pluripotency in the course of this experiment. This experiment establishes that recombinase activity can effectively be reduced by operably linking the recombinase gene to a miRNA target sequence in the 3-UTR of the recombinase gene. These results also establish that it is possible to select for ES cells, from a mixture of cells (using FACS) that have not differentiated, e.g., that have not ceased expressing miRNAs expressed only in ES cells, or separating out cells that have ceased to express miRNAs expressed only in ES cells.
Example 6
Promoter Control of Expression: Prm1 and Blimp1
(73) Mouse ES cells were transfected as described above with a first construct containing a GFP gene in reverse orientation flanked by recombinase recognition sites directing an inversion (
(74) Four clones having a Prm1 promoter driving Cre expression, four clones having a Blimp1 (1 kb fragment) driving Cre expression, and four clones having a Blimp1 (2 kb fragmetn) driving Cre expression were analyzed by phase contrast microscopy and by fluorescence microscopy to detect GFP-expressing cells. Cell counts were averaged and less than 1% of cells having the Prm1 promoter were GFP-positive, less than 0.1% of cells having the Blimp1 (1 kb fragment) promoter were GFP-positive, and less than 0.1% of cells having the Blimp1 (2 kb fragment) promoter were GFP-positive. These results establish that the Prm1 promoter and both Blimp1 promoter fragments were inactive in ES cells grown under conditions sufficient to support pluripotency. Thus, these promoters can be operably linked to a recombinase in ES cells maintained under pluripotency conditions, without any significant expression of the recombinase. Upon loss of pluripotency or differentiation, or upon activation in a germ cell, the promoters are expected to effectively drive Cre expression.
(75) FACS analysis of ES cell clones comprising a Prm1-driven NL-Crei gene, a 1 kb Blimp1-driven NL-Crei gene, and a 2 kb Blimp1-driven NL-Crei gene supported the microscopy results described above. Essentially no GFP-expressing cells were detected in non-differentiated ES cell samples (data not shown).
(76) One clone bearing the Blimp1 (2 kb fragment) was used as a donor ES cell to generate a mouse using the VELOCIMOUSE method as described above, with a Swiss Webster host embryo. E13.5 F0 generation embryos were harvested and examined for donor and host contribution. They appeared normal and genotyping results (donor cell vs. host embryo contribution) established that five embryos were essentially fully ES cell-derived (i.e., derived from the donor ES cell bearing a Blimp1 (2 kb fragment)-driven NL-Crei gene and the reverse-oriented GFP construct). Fluorescence analysis of one of the five embryos revealed a significant and apparently homogenous widespread fluorescence over background, where background was fluorescence in embryos derived wholly from host cells (i.e., embryos lacking a GFP gene). These results establish that, upon differentiation, the donor ES cells effectively drive transcription of the NL-Crei gene from the Blimp1 promoter, which produces Cre and places the inverted GFP gene in orientation for transcription, and GFP is effectively transcribed.
(77) Consistent with the GFP fluorescence seen in embryos, genotyping of a tail biopsy from live-born mice of the same genotype as the embryos described above (with NL-Crei operably linked to a Blimp1 promoter) revealed that the embryos were mosaic with respect to the Cre-mediated rearrangement of the GFP allele; both rearranged and unrearranged alleles were detected in tail DNA of live-born mice. Blimp1 is known to drive expression in some lineages, but not others. Blimp1 is also well-known to be active in cells of male gametogenic lineage (leading to sperm). Thus, it is expected that breeding F0 mice will result in an F1 generation that exhibits uniform expression of GFP in all cells and tissues.
(78) Genotyping of a tail biopsy from live-born mice of the same genotype as the embryos described above (with NL-Crei operably linked to a Prm1 promoter) revealed no detectable Cre-driven rearrangement of the GFP allele, as expected. The Prm1 promoter is expected to drive expression in sperm lineage cells. Thus, it is expected that breeding F0 mice will result in an F1 generation that exhibits uniform expression of GFP in all cells and tissues.