HYDROCARBON SYNTHASE GENE AND USE THEREOF

Abstract

A hydrocarbon synthase gene encoding protein having excellent capacity to synthesize a hydrocarbon such as alkane and novel functions is provided. The gene encodes a protein comprising an amino acid sequence comprising a motif sequence shown in SEQ ID NO: 1 and having activity of synthesizing a hydrocarbon with a carbon number one less than that of an aldehyde compound from the aldehyde compound.

Claims

1-6. (canceled)

7. A transformant, into which a gene encoding a protein having an activity of synthesizing, from an aldehyde compound, a hydrocarbon with a carbon number one less than that of the aldehyde compound, has been introduced, wherein said protein is selected from the group consisting of (a) and (b): (a) a protein comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 12, 26, 66, 72, 76, 80, 90, 92, 94, 98, 112, 116, 122 and 144; and (b) a protein comprising an amino acid sequence having 90% or more identity to an amino acid sequence selected from the group consisting of SEQ ID NOs: 12, 26, 66, 72, 76, 80, 90, 92, 94, 98, 112, 116, 122 and 144, and having an activity of synthesizing, from an aldehyde compound, a hydrocarbon with a carbon number one less than that of the aldehyde compound.

8. The transformant according to claim 7, which is obtained using Escherichia coli or yeast as a host.

9-15. (canceled)

Description

BRIEF DESCRIPTION OF DRAWINGS

[0036] FIG. 1 is a characteristic chart showing results of determining activity of synthesizing a hydrocarbon with a carbon number one less than that of an aldehyde compound from the aldehyde compound for transformants prepared using 10 types of genes from Klebsiella sp.

[0037] FIG. 2 shows a GC/MS analysis chart for a vector control strain and that for a strain into which gene02 has been introduced.

[0038] FIG. 3 is a characteristic chart showing results of determining activity of synthesizing a hydrocarbon with a carbon number one less than that of an aldehyde compound from the aldehyde compound for transformants prepared using 5 types of genes from the E. coli W3110 strain.

[0039] FIG. 4 is characteristic chart showing results of determining activity of synthesizing a hydrocarbon with a carbon number one less than that of an aldehyde compound from the aldehyde compound using different aldehyde compounds as substrates for disruption solution supernatants of transformants into which gene02 from Klebsiella sp. has been introduced.

[0040] FIG. 5 shows a GC/MS analysis chart for a vector control strain and that for a strain into which gene02 has been introduced created by assaying C.sub.13 alkane using a C.sub.14 aldehyde compound as a substrate.

[0041] FIG. 6 shows an image indicating SDS-PAGE results for a disruption solution of transformed Escherichia coli and a purified His-tag protein solution.

[0042] FIG. 7 shows GC/MS analysis charts indicating in vitro alkane synthesis results obtained using purified His-tag proteins.

[0043] FIG. 8 is a characteristic chart showing results of a comparison of alkane synthesis capacity between NADH and NADPH used as coenzymes.

[0044] FIG. 9 shows a GC/MS analysis chart of yeast transformants into which gene02 has been introduced.

[0045] FIG. 10-1 is the first half of a characteristic chart showing results of determining activity of synthesizing a hydrocarbon with a carbon number one less than that of an aldehyde compound from the aldehyde compound for transformants prepared using 53 types of genes from a variety of organism species.

[0046] FIG. 10-2 is the second half of a characteristic chart showing results of determining activity of synthesizing a hydrocarbon with a carbon number one less than that of an aldehyde compound from the aldehyde compound for transformants prepared using 53 types of genes from a variety of organism species.

DESCRIPTION OF EMBODIMENTS

[0047] The present invention is described in more detail below with reference to the drawings and the Examples.

[0048] The hydrocarbon synthesis gene of the present invention is a gene encoding a protein comprising an amino acid sequence comprising a motif sequence shown in SEQ ID NO: 1 and having activity of synthesizing a hydrocarbon with a carbon number one less than that of an aldehyde compound from the aldehyde compound (hereinafter referred to as hydrocarbon synthesis activity). The term hydrocarbon synthesis activity refers to an enzyme activity of synthesizing a hydrocarbon with a carbon number one less than that of an aldehyde compound from the aldehyde compound, which also can be said as enzyme activity of removing a carbonyl group from an aldehyde compound. The hydrocarbon synthesis activity may include a reaction for generating, as by-products, carbon monoxide, carbon dioxide, carbonic acid, formic acid, water, and the like.

[0049] Here, the motif sequence shown in SEQ ID NO: 1 is a sequence referred to as an aldehyde dehydrogenases glutamic acid active site. In the amino acid sequence shown in SEQ ID NO: 1, the 1st Xaa corresponds to an amino acid single letter code of L, I, V, M, F, G, or A. The 3rd Xaa corresponds to an amino acid single letter code of L, I, M, S, T, A, or C in the amino acid sequence shown in SEQ ID NO: 1. The 4th Xaa corresponds to an amino acid single letter code of G or S in the amino acid sequence shown in SEQ ID NO: 1. The 6th Xaa corresponds to an amino acid single letter code of K, N, L, or M in the amino acid sequence shown in SEQ ID NO: 1. The 7th Xaa corresponds to an amino acid single letter code of S, A, D, or N in the amino acid sequence shown in SEQ ID NO: 1. The 8th Xaa corresponds to an amino acid single letter code of T, A, P, F, or V in the amino acid sequence shown in SEQ ID NO: 1.

[0050] Particularly preferably, the hydrocarbon synthesis gene of the present invention is a gene encoding a protein having hydrocarbon synthesis activity and comprising an amino acid sequence further comprising the motif sequence shown in SEQ ID NO: 2 on the C-terminal side of the motif sequence shown in SEQ ID NO: 1. Here, the motif sequence shown in SEQ ID NO: 2 corresponds to the amino acid sequence of a region that is found to be highly conserved upon multiple alignment analysis of amino acid sequences of a plurality of proteins encoded by a gene from a Klebsiella sp. microorganism which is the hydrocarbon synthesis gene of the present invention. The first Xaa corresponds to an amino acid single letter code of P, A, or F in the amino acid sequence shown in SEQ ID NO: 2. In addition, the 2nd Xaa corresponds to an amino acid single letter code of F, H, or V in the amino acid sequence shown in SEQ ID NO: 2. Further, the 3rd Xaa corresponds to an amino acid single letter code of G or A in the amino acid sequence shown in SEQ ID NO: 2. The 5th Xaa may correspond to any amino acid in the amino acid sequence shown in SEQ ID NO: 2. The 6th Xaa corresponds to an amino acid single letter code of K, G, or R in the amino acid sequence shown in SEQ ID NO: 2. The 7th Xaa may correspond to any amino acid in the amino acid sequence shown in SEQ ID NO: 2. The 10th Xaa may correspond to any amino acid in the amino acid sequence shown in SEQ ID NO: 2. The 11th Xaa corresponds to an amino acid single letter code of G or H in the amino acid sequence shown in SEQ ID NO: 2. The 12th Xaa corresponds to an amino acid single letter code of R, K, or G in the amino acid sequence shown in SEQ ID NO: 2. The 13th Xaa corresponds to an amino acid single letter code of F, D, P, or A in the amino acid sequence shown in SEQ ID NO: 2.

[0051] Further, the hydrocarbon synthesis gene of the present invention may be a gene from any organism. For example, the hydrocarbon synthesis gene of the present invention can be identified/isolated from a Gram-negative organism, a Gram-positive organism, a fungus, a plant, or an animal. Examples of a Gram-negative organism include Escherichia coli and Pseudomonas putida. Examples of a Gram-positive organism include Bacillus subtilis, Corynebacterium glutamicum, and Lactobacillus reuteri. Examples of a fungus include Saccharomyces cerevisiae, Candida tropicalis, Debaryomyces hansenii, Pichia pastoris, and Aspergillus oryzae. Examples of a plant include Zea mays and Arabidopsis thaliana. Examples of an animal include Drosophila melanogaster, Rattus norvegicus, and Homo sapiens. The hydrocarbon synthesis gene of the present invention can be isolated from such various organisms and used in an adequate manner.

[0052] More specifically, an aldehyde dehydrogenase gene encoding a protein comprising the motif sequence shown in SEQ ID NO: 1 can be searched for in a database storing gene information such as the NCBI (National Center for Biotechnology Information) database. The target gene can be identified based on the corresponding accession number as described below.

[0053] Specifically, Escherichia coli K-12 W3110-derived genes, i.e., BAE77705, BAA35791, BAA14869, BAA14992, BAA15032, BAA16524, BAE77705, BAA15538, and BAA15073, can be identified as the hydrocarbon synthesis gene of the present invention. In addition, Pseudomonas putida_F1-derived genes, i.e., YP_001268218, YP_001265586, YP_001267408, YP_001267629, YP_001266090, YP_001270490, YP_001268439, YP_001267367, YP_001267724, YP_001269548, YP_001268395, YP_001265936, YP_001270470, YP_001266779, and YP_001270298, can be identified as the hydrocarbon synthesis gene of the present invention.

[0054] In addition, genes from the Bacillus subtilis 168 strain, i.e., NP_388129, NP_389813, NP_390984, NP_388203, NP_388616, NP_391658, NP_391762, NP_391865, and NP_391675, can be identified as the hydrocarbon synthesis gene of the present invention. Corynebacterium glutamicum ATCC13032-derived genes, i.e., NP_599351, NP_599725, NP_601988, NP_599302, NP_601867, and NP_601908, can be identified as the hydrocarbon synthesis gene of the present invention. A Lactobacillus reuteri DSM20016-derived gene, i.e., YP_001270647, can be identified as a hydrocarbon synthesis gene according to the present invention.

[0055] Further, Saccharomyces cerevisiae-derived genes, i.e., NP_010996, NP_011904, NP_015264, NP_013828, NP_009560, NP_015019, NP_013893, NP_013892, and NP_011902, can be identified as the hydrocarbon synthesis gene of the present invention. Candida tropicalis MYA-3404-derived genes, i.e., XP_002548035, XP_002545751, XP_002547036, XP_002547030, XP_002550712, XP_002547024, XP_002550173, XP_002546610, and XP_002550289, can be identified as the hydrocarbon synthesis gene of the present invention. Debaryomyces hansenii CBS767-derived genes, i.e., XP_460395, XP_457244, XP_457404, XP_457750, XP_461954, XP_462433, XP_461708, and XP_462528, can be identified as the hydrocarbon synthesis gene of the present invention. Pichia pastoris GS115-derived genes, i.e., XP_002489360, XP_002493450, XP_002491418, XP_002493229, XP_002490175, XP_002491360, and XP_002491779, can be identified as the hydrocarbon synthesis gene of the present invention. Schizosaccharomyces pombe-derived genes, i.e., NP_593172, NP_593499, and NP_594582 can be identified as hydrocarbon synthesis genes according to the present invention. Aspergillus oryzae RIB40-derived genes, i.e., XP_001822148, XP_001821214, XP_001826612, XP_001817160, XP_001817372, XP_001727192, XP_001826641, XP_001827501, XP_001825957, XP_001822309, XP_001727308, XP_001818713, XP_001819060, XP_001823047, XP_001817717, and XP_001821011, can be identified as the hydrocarbon synthesis gene of the present invention.

[0056] Furthermore, Zea mays-derived genes, i.e., NP_001150417, NP_001105047, NP_001147173, NP_001169123, NP_001105781, NP_001157807, NP_001157804, NP_001105891, NP_001105046, NP_001105576, NP_001105589, NP_001168661, NP_001149126, and NP_001148092 can be identified as the hydrocarbon synthesis gene of the present invention. Arabidopsis thaliana-derived genes, i.e., NP_564204, NP_001185399, NP_178062, NP_001189589, NP_566749, NP_190383, NP_187321, NP_190400, NP_001077676, and NP_175812, can be identified as the hydrocarbon synthesis gene of the present invention.

[0057] Moreover, Drosophila melanogaster-derived genes, i.e., NP_733183, NP_609285, NP_001014665, NP_649099, NP_001189159, NP_610285, and NP_610107 can be identified as the hydrocarbon synthesis gene of the present invention. Rattus norvegicus-derived genes, i.e., NP_001006999, XP_001067816, XP_001068348, XP_001068253, NP_113919, XP_001062926, NP_071609, NP_071852, NP_058968, NP_001011975, NP_115792, NP_001178017, NP_001178707, NP_446348, NP_071992, XP_001059375, XP_001061872, and NP_001128170 can be identified as the hydrocarbon synthesis gene of the present invention. Homo sapiens-derived genes, i.e., NP_036322, NP_001193826, NP_001029345, NP_000684, NP_000680, NP_000683, NP_000681, NP_001071, NP_000687, NP_001180409, NP_001173, NP_000682, NP_000373, NP_001154976, NP_000685, and NP_000686, can be identified as the hydrocarbon synthesis gene of the present invention.

[0058] Meanwhile, the aforementioned gene encoding a protein comprising the motif sequence shown in SEQ ID NO: 1 can be identified based on the genome sequence information obtained by elucidating the genome sequence of an organism with an unknown genome sequence that is not registered in a database such as the NCBI database. More specifically, when the genome sequence of the Klebsiella sp. NBRC100048 strain is analyzed according to a standard method, the gene encoding a protein comprising the motif sequence shown in SEQ ID NO: 1 can be identified based on the genome sequence information.

[0059] Ten types of genes can be identified as hydrocarbon synthesis genes from Klebsiella sp. according to the present invention. These ten different genes are designated as gene01 to gene 10 for convenience. Table 1 below lists nucleotide sequences of the coding regions of gene01 to gene10 and amino acid sequences encoded by the nucleotide sequences.

TABLE-US-00001 TABLE 1 Gene name Nucleotide sequence Amino acid sequence gene01 SEQ ID NO: 3 SEQ ID NO: 4 gene02 SEQ ID NO: 5 SEQ ID NO: 6 gene03 SEQ ID NO: 7 SEQ ID NO: 8 gene04 SEQ ID NO: 9 SEQ ID NO: 10 gene05 SEQ ID NO: 11 SEQ ID NO: 12 gene06 SEQ ID NO: 13 SEQ ID NO: 14 gene07 SEQ ID NO: 15 SEQ ID NO: 16 gene08 SEQ ID NO: 17 SEQ ID NO: 18 gene09 SEQ ID NO: 19 SEQ ID NO: 20 gene10 SEQ ID NO: 21 SEQ ID NO: 22

[0060] The genes from Klebsiella sp. listed in table 1 encode proteins comprising the motif sequence shown in SEQ ID NO: 2.

[0061] Table 2 below lists the nucleotide sequences of the coding regions and amino acid sequences encoded by the nucleotide sequences for 5 types of Escherichia coli K-12 W3110-derived genes, i.e., BAA14869, BAA14992, BAA16524, BAE77705, and BAA15538, as examples of genes registered with the NCBI database.

TABLE-US-00002 TABLE 2 Gene name Nucleotide sequence Amino acid sequence BAA14869 SEQ ID NO: 23 SEQ ID NO: 24 BAA14992 SEQ ID NO: 25 SEQ ID NO: 26 BAA16524 SEQ ID NO: 27 SEQ ID NO: 28 BAE77705 SEQ ID NO: 29 SEQ ID NO: 30 BAA15538 SEQ ID NO: 31 SEQ ID NO: 32

[0062] Table 3 below lists the nucleotide sequences of the coding regions and amino acid sequences encoded by the nucleotide sequences for Corynebacterium glutamicum ATCC13032-derived genes, a Lactobacillus reuteri DSM20016-derived gene, Saccharomyces cerevisiae-derived genes, Candida tropicalis MYA-3404-derived genes, Debaryomyces hansenii CBS767-derived genes, Pichia pastoris GS 115-derived genes, Schizosaccharomyces pombe-derived genes, Aspergillus oryzae RIB40-derived genes, a Zea mays-derived gene, Arabidopsis thaliana-derived genes, Drosophila melanogaster-derived genes, Rattus norvegicus-derived genes, and Homo sapiens-derived genes, as examples of the hydrocarbon synthesis genes of the present invention registered with the NCBI database. Here, the Gene name column in table 3 contains gene IDs in the Kyoto Encyclopedia of Genes and Genomes (KEGG) database.

TABLE-US-00003 TABLE 3 Nucleotide Amino acid Organism species Accession No. Gene name sequence sequence Corynebacterium NP_599351 NCgl0098 SEQ ID NO: 65 SEQ ID NO: 66 glutamicum NP_599725 NCgl0463 SEQ ID NO: 67 SEQ ID NO: 68 ATCC13032 NP_601988 NCgl2698 SEQ ID NO: 69 SEQ ID NO: 70 NP_599302 NCgl0049 SEQ ID NO: 71 SEQ ID NO: 72 NP_601867 NCgl2578 SEQ ID NO: 73 SEQ ID NO: 74 NP_601908 NCgl2619 SEQ ID NO: 75 SEQ ID NO: 76 Lactobacillus YP_001270647 Lreu_0034 SEQ ID NO: 77 SEQ ID NO: 78 reuteri DSM20016 Saccharomyces NP_010996 YER073W SEQ ID NO: 79 SEQ ID NO: 80 cerevisiae NP_011902 YHR037W SEQ ID NO: 81 SEQ ID NO: 82 NP_011904 YHR039C SEQ ID NO: 83 SEQ ID NO: 84 NP_013892 YMR169C SEQ ID NO: 85 SEQ ID NO: 86 NP_013893 YMR170C SEQ ID NO: 87 SEQ ID NO: 88 NP_015019 YOR374W SEQ ID NO: 89 SEQ ID NO: 90 NP_009560 YBR006W SEQ ID NO: 91 SEQ ID NO: 92 NP_013828 YMR110C SEQ ID NO: 93 SEQ ID NO: 94 NP_015264 YPL061W SEQ ID NO: 95 SEQ ID NO: 96 Candida tropicalis XP_002550289 CTRG_04587 SEQ ID NO: 97 SEQ ID NO: 98 MYA-3404 XP_002547036 CTRG_01342 SEQ ID NO: 99 SEQ ID NO: 100 XP_002545751 CTRG_00532 SEQ ID NO: 101 SEQ ID NO: 102 Debaryomyces XP_461708 DEHA2G03740g SEQ ID NO: 103 SEQ ID NO: 104 hansenii CBS767 XP_462528 DEHA2G22572g SEQ ID NO: 105 SEQ ID NO: 106 XP_457404 DEHA2B10384g SEQ ID NO: 107 SEQ ID NO: 108 Pichia pastoris XP_002489360 PAS_chr1-3_0024 SEQ ID NO: 109 SEQ ID NO: 110 GS115 XP_002491418 PAS_chr2-1_0853 SEQ ID NO: 111 SEQ ID NO: 112 XP_002493450 PAS_chr4_0043 SEQ ID NO: 113 SEQ ID NO: 114 Schizosaccharomyces NP_593172 SPAC139.05 SEQ ID NO: 115 SEQ ID NO: 116 pombe NP_593499 SPAC1002.12c SEQ ID NO: 117 SEQ ID NO: 118 NP_594582 SPAC9E9.09c SEQ ID NO: 119 SEQ ID NO: 120 Aspergillus oryzae XP_001821214 AOR_1_1204144 SEQ ID NO: 121 SEQ ID NO: 122 RIB40 XP_001822148 AOR_1_1330014 SEQ ID NO: 123 SEQ ID NO: 124 Zea mays NP_001150417 LOC100284047 SEQ ID NO: 125 SEQ ID NO: 126 Arabidopsis thaliana NP_564204 AT1G23800 SEQ ID NO: 127 SEQ ID NO: 128 NP_001185399 AT1G74920 SEQ ID NO: 129 SEQ ID NO: 130 NP_178062 AT1G79440 SEQ ID NO: 131 SEQ ID NO: 132 NP_001189589 AT2G24270 SEQ ID NO: 133 SEQ ID NO: 134 NP_566749 AT3G24503 SEQ ID NO: 135 SEQ ID NO: 136 NP_190383 AT3G48000 SEQ ID NO: 137 SEQ ID NO: 138 NP_175812 AT1G54100 SEQ ID NO: 139 SEQ ID NO: 140 Drosophila NP_609285 Dmel_CG3752 SEQ ID NO: 141 SEQ ID NO: 142 melanogaster NP_001189159 Dmel_CG7145 SEQ ID NO: 143 SEQ ID NO: 144 NP_610107 Dmel_CG8665 SEQ ID NO: 145 SEQ ID NO: 146 NP_610285 Dmel_CG11140 SEQ ID NO: 147 SEQ ID NO: 148 NP_733183 Dmel_CG31075 SEQ ID NO: 149 SEQ ID NO: 150 NP_001014665 Dmel_CG4685 SEQ ID NO: 151 SEQ ID NO: 152 NP_649099 Dmel_CG9629 SEQ ID NO: 153 SEQ ID NO: 154 Rattus NP_071852 24188 SEQ ID NO: 155 SEQ ID NO: 156 norvegicus NP_001128170 641316 SEQ ID NO: 157 SEQ ID NO: 158 Homo sapiens NP_000680 216 SEQ ID NO: 159 SEQ ID NO: 160 NP_000683 219 SEQ ID NO: 161 SEQ ID NO: 162 NP_000687 223 SEQ ID NO: 163 SEQ ID NO: 164 NP_000373 224 SEQ ID NO: 165 SEQ ID NO: 166 NP_001173 501 SEQ ID NO: 167 SEQ ID NO: 168 NP_001180409 64577 SEQ ID NO: 169 SEQ ID NO: 170

[0063] Note that the hydrocarbon synthesis gene of the present invention is not limited to genes identified based on the gene names, the nucleotide sequences, and the amino acid sequences described above.

[0064] The hydrocarbon synthesis gene of the present invention may be a gene encoding a protein having hydrocarbon synthesis activity and comprising an amino acid sequence derived from the amino acid sequence shown in any even-numbered sequence ID number of SEQ ID NOS: 3 to 32 and 65 to 170 by substitution, deletion, insertion, or addition of one or a plurality of amino acids. The expression a plurality of amino acids used herein means, for example, 2 to 100 amino acids, preferably 2 to 80 amino acids, more preferably 2 to 50 amino acids, and further preferably 2 to 15 amino acids.

[0065] In addition, the hydrocarbon synthesis gene of the present invention may be a gene encoding a protein having hydrocarbon synthesis activity and comprising an amino acid sequence having 70% or more, preferably 80% or more, more preferably 85% or more, further preferably 90% or more, and most preferably 98% or more identity to an amino acid sequence shown in any even-numbered sequence ID number of SEQ ID NOS: 3 to 32 and 65 to 170. Here, identity between sequences refers to a value (percentage) of alignment between two amino acid sequences determined using sequence similarity search software such as BLAST, PSI-BLAST, or HMMER at a default setting.

[0066] Further, the hydrocarbon synthesis gene of the present invention may be a gene encoding a protein having hydrocarbon synthesis activity which is encoded by a polynucleotide that hybridizes under stringent conditions to at least a portion of a polynucleotide comprising a sequence complementary to a nucleotide sequence shown in any odd-numbered sequence ID number of SEQ ID NOS: 3 to 32 and 65 to 170. Here, the term stringent conditions refers to conditions under which namely a specific hybrid is formed, but a non-specific hybrid is never formed. For example, such conditions can be adequately determined with reference to Molecular Cloning: A Laboratory Manual (Third Edition). In practice, stringency can be predetermined based on the temperature and the salt concentration in a solution upon Southern hybridization, and the temperature and the salt concentration in a solution in the step of washing during Southern hybridization. Specifically, stringent conditions include, for example, a sodium concentration of 25 to 500 mM and preferably 25 to 300 mM, and a temperature of 42 C. to 68 C. and preferably 42 C. to 65 C. More specifically, stringent conditions include 5SSC (83 mM NaCl, 83 mM sodium citrate) and a temperature of 42 C. In addition, the expression at least a portion of a polynucleotide means the entire polynucleotide comprising a nucleotide sequence complementary to a certain nucleotide sequence and a continuous portion of the entire polynucleotide comprising the complementary nucleotide sequence.

[0067] In addition, it is possible to introduce a mutation into a certain amino acid sequence by altering the nucleotide sequence of the above hydrocarbon synthesis gene by a technique known in the art. It is also possible to introduce a mutation into a nucleotide sequence by a known technique such as the Kunkel method or Gapped duplex method or a method according thereto. For example, a mutation is introduced using a mutagenesis kit using site-directed mutagenesis (e.g., Mutant-K and Mutant-G (both are commercial names, TAKARA Bio)) or an LA PCR in vitro Mutagenesis series kit (trade name, TAKARA Bio). Also, a mutagenesis method may be a method using a chemical mutagen represented by EMS (ethyl methanesulfonate), 5-bromouracil, 2-aminopurine, hydroxylamine, N-methyl-N-nitro-N nitrosoguanidine, or other carcinogenic compounds or a method that involves radiation treatment or ultraviolet treatment typically using X-rays, alpha rays, beta rays, gamma rays, an ion beam, or the like.

[0068] It is possible to confirm whether or not a gene comprising a certain nucleotide sequence encodes a protein having hydrocarbon synthesis activity in the following manner. An expression vector incorporating the gene between, for example, an appropriate promoter and an appropriate terminator is produced, an appropriate host is transformed using the expression vector, and hydrocarbon synthesis activity of a protein to be expressed is assayed. Here, it is possible to assay hydrocarbon synthesis activity in the following manner. The above transformant is cultured using a solution containing an aldehyde compound that serves as a substrate. Then, a hydrocarbon from the aldehyde compound (i.e., a hydrocarbon with a carbon number one less than that of the aldehyde compound serving as a substrate) is analyzed using a gas chromatography system/mass spectrometer. In addition, quantitative assay of hydrocarbon synthesis activity can be carried out by quantitatively determining generated hydrocarbon using a gas chromatography system/mass spectrometer. As an aldehyde compound described in detail below, for example, tetradecanal can be used.

[0069] The hydrocarbon synthesis gene of the present invention described above is incorporated into an appropriate expression vector so as to be introduced into a host. The host used herein is not particularly limited as long as it is an organism that can express the hydrocarbon synthesis gene of the present invention. Examples of such host include: bacteria belonging to the genus Escherichia such as Escherichia coli; bacteria belonging to the genus Bacillus such as Bacillus subtilis; bacteria belonging to the genus Pseudomonas such as Pseudomonas putida; bacteria belonging to the genus Rhizobium such as Rhizobium meliloti; yeast such as Saccharomyces cerevisiae, Schizosaccharomyces pombe, or Pichia pastoris; and fungi such as filamentous bacteria.

[0070] When a bacterium such as Escherichia coli is used as a host, it is preferable for an expression vector to be autonomously replicable in the bacterium, and at the same time, to be composed of promoters, a ribosome-binding sequence, the above gene, and a transcription termination sequence. Such expression vector may further comprise a gene that controls promoter activity.

[0071] Examples of Escherichia coli that can be used include conventionally known bacterial strains such as the Escherichia coli BL21 (DE3), K12, DH1, and JM109 strains. Specifically, so-called K strains such as the K12 strain and a strain produced from the K12 strain can be used as Escherichia coli. In addition, the Bacillus subtilis 168 strain and the like can be used as Bacillus subtilis.

[0072] Any promoter can be used as long as it can be expressed in a host such as Escherichia coli. Examples of a promoter that can be used include: Escherichia coli-derived promoters such as a trp promoter, a lac promoter, a PL promoter, and a PR promoter; and phage-derived promoters such as a T7 promoter. Alternatively, an artificially designed or modified promoter such as a tac promoter may be used.

[0073] A method for introducing an expression vector is not particularly limited as long as DNA is introduced into a bacterium. Examples of the method include a method using calcium ions [Cohen, S. N., et al.: Proc. Natl. Acad. Sci., USA, 69:2110-2114 (1972)] and electroporation.

[0074] Examples of yeast that can be used as a host include, but are not particularly limited to, yeast belonging to the genus Candida such as Candida Shehatae, yeast belonging to the genus Pichia such as Pichia stipitis, yeast belonging to the genus Pachysolen such as Pachysolen tannophilus, yeast belonging to the genus Saccharomyces such as Saccharomyces cerevisiae, and yeast belonging to the genus Schizosaccharomyces such as Schizosaccharomyces pombe. Saccharomyces cerevisiae is particularly preferable.

[0075] In addition, in order to enhance expression of the hydrocarbon synthesis gene of the present invention, an appropriate promoter having high transcription activity is used. Examples of such promoter that can be used include, but are not particularly limited to, a glyceraldehyde-3-phosphate dehydrogenase gene (TDH3) promoter, a 3-phosphoglycerate kinase gene (PGK1) promoter, and a hyperosmolarity-responsive 7 gene (HOR7) promoter. A pyruvate decarboxylase gene (PDC1) promoter is particularly preferable because it has high capacity to cause high expression of a gene of interest located downstream of the promoter. In addition to the above, a downstream gene can be strongly expressed using a gall promoter, a gal10 promoter, a heat shock protein promoter, an MF1 promoter, a PHOS promoter, a GAP promoter, an ADH promoter, an AOX1 promoter, or the like.

[0076] In addition, as a method for introducing the above gene, any conventionally known method of yeast transformation can be used. Specific examples of such method that can be carried out include, but are not limited to, an electroporation method (Meth. Enzym., 194, p. 182 (1990)), a spheroplast method (Proc. Natl. Acad. Sci. USA, 75 p. 1929 (1978)), and a lithium acetate method (J. Bacteriology, 153, p. 163 (1983), Proc. Natl. Acad. Sci. USA, 75 p. 1929 (1978), Methods in yeast genetics, 2000 Edition: A Cold Spring Harbor Laboratory Course Manual).

[0077] As described above, a recombinant organism into which the hydrocarbon synthesis gene of the present invention has been introduced (e.g., recombinant Escherichia coli or recombinant yeast) can synthesize a hydrocarbon from an aldehyde compound if the hydrocarbon synthesis gene is expressed in the presence of the aldehyde compound and a coenzyme such as NADH. For synthesis, NADH can be used as a coenzyme that allows a protein encoded by the hydrocarbon synthesis gene of the present invention to show hydrocarbon synthesis activity. Since NADH is abundantly present in cells, the amount of coenzyme would not be a rate-determining factor of a hydrocarbon synthesis reaction. Therefore, a recombinant organism into which the hydrocarbon synthesis gene of the present invention has been introduced (e.g., recombinant Escherichia coli or recombinant yeast) can synthesize a hydrocarbon with excellent reaction efficiency. Either of NADH and NADPH can be used as a coenzyme for a protein encoded by the hydrocarbon synthesis gene of the present invention.

[0078] Hydrocarbons that can be synthesized herein include hydrocarbons having chain structures (chain hydrocarbons) and hydrocarbons having cyclic structures (cyclic hydrocarbons). Hydrocarbons having chain structures may have one or more branches. Examples of branches include: an alkyl group such as a methyl group, an ethyl group, a propyl group, or a butyl group (including a tert-butyl group); an alkynyl group; and an alkenyl group. Also, examples of branches include a chloromethyl group, an acetyl group, a 2-pyridyl group, a hydroxyphenyl group, an aminoacetyl group, a methoxy group, a phenoxy group, a methylthio group, and a phenylthio group. Further, a hydrocarbon to be synthesized may be a saturated hydrocarbon (alkane) or an unsaturated hydrocarbon (alkene or alkyne).

[0079] Meanwhile, the number of carbons for a hydrocarbon to be synthesized is not particularly limited; however, it is preferably 5 to 20 so that the hydrocarbon is in a liquid form at ordinary temperatures. In addition, the hydrocarbon to be synthesized is preferably a C.sub.10-C.sub.20 saturated hydrocarbon in consideration of the use thereof for diesel fuel, more preferably a C.sub.12-C.sub.14 saturated hydrocarbon, and most preferably a C.sub.13 saturated hydrocarbon. More specifically, the hydrocarbon to be synthesized is C.sub.12 dodecane, C.sub.13 tridecane, C.sub.14 tetradecane, or the like.

[0080] When specific hydrocarbons such as those listed above are synthesized, an appropriate aldehyde compound that serves as a substrate can be selected. That is, since hydrocarbon synthesis activity causes synthesis of a hydrocarbon from an aldehyde compound used as a substrate, an appropriate aldehyde compound can be selected in accordance with the structure of a desired hydrocarbon.

[0081] Meanwhile, the hydrocarbon synthesis gene of the present invention also can be used for a method for producing a hydrocarbon in vitro. In one example, a hydrocarbon can be synthesized in vitro using a disruption solution obtained by disrupting a recombinant organism into which the hydrocarbon synthesis gene of the present invention has been introduced (e.g., recombinant Escherichia coli or recombinant yeast) or an extract obtained by extracting a fraction containing a protein encoded by the hydrocarbon synthesis gene from the disruption solution. Specifically, in vitro hydrocarbon synthesis can be carried out by adding an aldehyde compound that serves as a substrate (and, if necessary, a coenzyme such as NADH) to the disruption solution or extract. In particular, the disruption solution or extract is rich in a coenzyme such as NADH, and thus it is only necessary to add an aldehyde compound that serves as a substrate to the disruption solution or extract (without the need of adding a coenzyme such as NADH) in most cases. In other words, the use of the hydrocarbon synthesis gene of the present invention enables efficient hydrocarbon synthesis without the need of an expensive coenzyme such as NADPH.

[0082] Alternatively, a hydrocarbon can be synthesized in vitro by purifying or roughly purifying a protein encoded by the hydrocarbon synthesis gene of the present invention according to a standard method and mixing the purified or roughly purified protein, an aldehyde compound that serves as a substrate, and a coenzyme such as NADH. Here, NADH can be used as a coenzyme for a protein encoded by the hydrocarbon synthesis gene of the present invention so that the protein shows hydrocarbon synthesis activity. Thus, it is not always necessary to use an expensive coenzyme, i.e., NADPH. This means that when a protein encoded by the hydrocarbon synthesis gene of the present invention is used, in vitro hydrocarbon synthesis can be achieved at low cost using NADH as a less expensive coenzyme.

[0083] A synthesized hydrocarbon can be isolated by a standard method. For example, the above-described recombinant yeast is cultured in a medium so as to produce a hydrocarbon. Here, a hydrocarbon is synthesized in a medium and thus it can be isolated from a supernatant fraction obtained by isolating cells from the medium by means of centrifugation or the like. For example, a hydrocarbon can be isolated from a supernatant fraction as follows. An organic solvent such as ethyl acetate or methanol is added to a supernatant fraction. The mixture is sufficiently agitated and separated into an aqueous layer and a solvent layer. Then, a hydrocarbon is extracted from the solvent layer.

EXAMPLES

[0084] The present invention is hereafter described in greater detail with reference to the following examples, although the technical scope of the present invention is not limited thereto.

Example 1

[0085] In this Example, the genome sequence of a microorganism having alkane synthesis capacity of the Klebsiella sp. NBRC100048 strain was analyzed by a standard method. Ten types of genes encoding proteins comprising the motif sequence shown in SEQ ID NO: 1 were identified based on the obtained genome sequence information. The 10 types of genes identified herein were designated as gene01 to gene10 and functions thereof were estimated. Table 4 summarizes information about putative functions and sequences of the ten different genes.

TABLE-US-00004 TABLE 4 Gene name Putative function Nucleotide sequence Amino acid sequence gene01 phenylacetaldehyde: NAD+ oxidoreductase SEQ ID NO: 3 SEQ ID NO: 4 gene02 phenylacetaldehyde: NAD+ oxidoreductase SEQ ID NO: 5 SEQ ID NO: 6 gene03 4-aminobutanal: NAD+ 1-oxidoreductase SEQ ID NO: 7 SEQ ID NO: 8 gene04 aldehyde dehydrogenase SEQ ID NO: 9 SEQ ID NO: 10 gene05 succinate-semialdehyde: NAD+ oxidoreductase SEQ ID NO: 11 SEQ ID NO: 12 gene06 succinate-semialdehyde: NAD+ oxidoreductase SEQ ID NO: 13 SEQ ID NO: 14 gene07 betaine-aldehyde: NAD+ oxidoreductase SEQ ID NO: 15 SEQ ID NO: 16 gene08 N-succinyl-L-glutamate 5-semialdehyde: NAD+ SEQ ID NO: 17 SEQ ID NO: 18 oxidoreductase gene09 (S)-lactaldehyde: NAD+ oxidoreductase SEQ ID NO: 19 SEQ ID NO: 20 gene10 betaine-aldehyde: NAD+ oxidoreductase SEQ ID NO: 21 SEQ ID NO: 22

[0086] In this Example, genes encoding proteins comprising the motif sequence shown in SEQ ID NO: 1 were identified based on the genome information of the E. coli W3110 strain, as well as the 10 types of genes. Particularly in this Example, 5 types of genes listed in Table 5 below were mainly examined from among the identified genes.

TABLE-US-00005 TABLE 5 Gene name Putative function Nucleotide sequence Amino acid sequence BAA14869 gamma-Glu-gamma-aminobutyraldehyde SEQ ID NO: 23 SEQ ID NO: 24 dehydrogenase. NAD(P)H-dependent BAA14992 phenylacetaldehyde dehydrogenase SEQ ID NO: 25 SEQ ID NO: 26 BAA16524 succinate-semialdehyde SEQ ID NO: 27 SEQ ID NO: 28 dehydrogenase, NADP-dependent BAE77705 aldehyde dehydrogenase B SEQ ID NO: 29 SEQ ID NO: 30 BAA15538 succinylglutamic SEQ ID NO: 31 SEQ ID NO: 32 semialdehyde dehydrogenase

[0087] Nucleic acid fragments separately containing the above 15 types of genes were PCR-amplified using, as a template, genome DNA of the Klebsiella sp. NBRC100048 strain or the E. coli W3110 strain. Table 6 shows primers used for PCR. DNeasy Blood & Tissue Kits (QIAGEN) were used for genome DNA extraction.

TABLE-US-00006 TABLE6 Gene Sequence Sequence name Forwardprimer IDnumber Reverseprimer IDnumber gene04 cggtacccggggatccCAATATGCCGCTGCGT SEQIDNO:33 cgactctagaggatccACCCGAATGGATTG SEQIDNO:34 CTCAACCCTACA CGGACTGAGGA gene01 cggtacccggggatccATCTTGATGTTCATCG SEQIDNO:35 cgactctagaggatccCGATTAATATCGCA SEQIDNO:36 CGTTACCCCT CCATCACCGACTT gene02 cggtacccggggatccCGCGATGAATAAGGA SEQIDNO:37 cgactctagaggatccAGATTGCCCTCCAC SEQIDNO:38 AAGGGTATGTCCA AGTAGCGAGAA gene03 cggtacccggggatccTGGTAACGACGATACC SEQIDNO:39 cgactctagaggatccTGTGACTATTAGCG SEQIDNO:40 AATCTTAGGG GCCTAACACAC gene05 cggtacccggggatccAGTAGCGATAACAAG SEQIDNO:41 cgactctagaggatccCATGTGAGCGTTGA SEQIDNO:42 GAGACATGCGA GGTAAAGAGG gene06 cggtacccggggatccCCCTGAAGACAGGAA SEQIDNO:43 cgactctagaggatccTCGCTCCTGTTAAA SEQIDNO:44 GCAATTATGCAACTC GGCCAATGCAC gene07 cggtacccggggatccTATTCGTCAGCATTTA SEQIDNO:45 cgactctagaggatccCCGGTTAAAATATG SEQIDNO:46 CCGAACCCA GACTGGAATTTACCC gene08 cggtacccggggatccATCCCTGAGGAGAAA SEQIDNO:47 cgactctagaggatccAAAGGAGAGCCCGG SEQIDNO:48 ACTGCATGAGTCTGT CGTAGTGATGG gene09 cggtacccggggatccAGCCATGACAGCACCC SEQIDNO:49 cgactctagaggatccGTGCCTCAGGCCTG SEQIDNO:50 GTTCAACAC CAGATAGACCA gene10 cggtacccggggatccGCATAACGCAGAGAG SEQIDNO:51 cgactctagaggatccCCCTTTCTCAGTCG SEQIDNO:52 GCTGAGATGGA CACCAGTGGTT BAA14869 cggtacccggggatccATCTGATAGACGTGAA SEQIDNO:53 cggtacccggggatccGAGGCTTCGAGAAC SEQIDNO:54 ACAGGA CACTAC BAA14992 cggtacccggggatccTGTCACGATTTGCGGA SEQIDNO:55 cggtacccggggatccACCATGGAACTTCT SEQIDNO:56 GCTT TTGACGAAAC BAA16524 cggtacccggggatccCTTTGAAAACAGGATG SEQIDNO:57 cggtacccggggatccCCAGTTAAAGACCG SEQIDNO:58 TAGCGA ATGCAC BAE77705 cggtacccggggatccATACCTCACACCGCAA SEQIDNO:59 cggtacccggggatccCGACCAGCTTCTTA SEQIDNO:60 GGAG TATCAGAACAG

[0088] A sequence for homologous recombination (i.e., a sequence homologous to a vector region) was added to each primer. PfuUltra II Fusion HS DNA Polymerase (Stratagene) was also used for PCR. Each PCR-amplified nucleic acid fragment was mixed with a BamHI-treated pUC118 plasmid so as to incorporate the amplified nucleic acid fragment into a vector by homologous recombination. QIAquick PCR Purification Kits (QIAGEN) were used for the purification of PCR products. In-Fusion HD Cloning Kits (Clontech) were used for the ligation of PCR products.

[0089] The obtained expression plasmids were used for the transformation of E. coli JM109. Each of Escherichia coli transformants was cultured overnight in 1-ml LB medium (ampicillin: 100 g/ml) at 37 C. and 100 rpm. 3-ml LB medium (ampicillin: 100 g/ml; Triton X-100: 0.1%; IPTG: 0.5 mM; and tetradecanal: 1 mM) was inoculated with the obtained culture liquid to result in 10% culture liquid by volume, followed by culture at 30 C. and 100 rpm for 24 hours.

[0090] Cells were harvested from the culture product (room temperature, 6000g, 5 min). The supernatant (1 ml) was introduced into a glass vial bottle (Agilent Technologies) and subjected to GC/MS analysis so as to detect tridecane synthesized from tetradecanal. An HP7694 Headspace Sampler (Hewlett-Packard) was used for GC/MS analysis. Table 7 shows Headspace Sampler analysis conditions and table 8 shows GC/MS analysis conditions.

TABLE-US-00007 TABLE 7 Headspace Sampler: HP7694 (Hewlett-Packard) Zone Temp Oven 90 C. Loop 150 C. TR. Line 200 C. Event Time GC cycle time 8.5 min Vial EQ time 8.5 min Pressuriz. time 0.5 min Loop fill time 0.2 min Loop EQ time 0.2 min Inject time 1.0 min Vial Parameter Shake High

TABLE-US-00008 TABLE 8 <GC/MS analysis conditions> GC/MS: HP6890/5973 (Hewlett-Packard) Column: HP-INNOWAX (Agilent: 19091N-213) Inlet temperature: 260 C. Detector temperature: 260 C. Injection parameter split ratio: 1/20 Carrier gas: Helium 3.0 ml/min Oven heating conditions 60 C. 1 min Heating to 260 C. at 260 C. 1 min 50 C./min

[0091] FIG. 1 shows analysis results obtained using the 10 types of genes from Klebsiella sp. identified in this Example. As shown in FIG. 1, all of the 10 types of genes from Klebsiella sp. identified in this Example were found to have hydrocarbon synthesis activity. In addition, proteins encoded by gene02 and gene05 were found to have significantly excellent hydrocarbon synthesis activity. FIG. 2 shows a GC/MS analysis chart for a vector control strain and that for a strain into which gene02 has been introduced.

[0092] Similarly, FIG. 3 shows analysis results obtained using the 5 types of genes from the E. coli W3110 strain identified in this Example. As shown in FIG. 3, all of the 5 types of genes from the E. coli W3110 strain identified in this Example were found to have hydrocarbon synthesis activity. In addition, proteins encoded by BAA14992 and BAA14869 were found to have significantly excellent hydrocarbon synthesis activity.

Example 2

[0093] In this Example, in vitro alkane synthesis was attempted using gene02 specified in Example 1 as a gene encoding a protein having excellent hydrocarbon synthesis activity.

[0094] Specifically, recombinant Escherichia coli prepared in Example 1, into which gene02 had been introduced, was cultured overnight in 1-ml LB medium (ampicillin: 100 g/ml) at 37 C. and 100 rpm. Then, 1-ml LB medium (ampicillin 100 g/ml, IPTG 0.5 mM) was inoculated with the obtained culture liquid to result in 1% culture liquid by volume, followed by culture at 30 C. and 120 rpm for 6 hours. Next, cells were harvested from the culture product (4 C., 6000g, 3 minutes). The cells were suspended in 500 l of phosphate buffer (pH 7.2), following which the cells were disrupted using an ultrasonic disintegrator (4 C., 10 minutes). Subsequently, the obtained disruption solution was centrifuged (4 C., 10000g, 5 minutes) to collect the supernatant. The collected solution was subjected to enzymatic assay.

[0095] An enzymatic reaction was carried out overnight at 30 C. using the reaction composition shown in table 9. In addition, 8 types of C.sub.11-C.sub.18 aldehyde compounds were used in this Example. Here, alkane with a carbon number one less than that of an aldehyde compound is synthesized.

TABLE-US-00009 TABLE 9 <Reaction solution composition> Phosphate buffer (pH 7.2): 500 l Aldehyde: Final concentration 1 mM NADH: Final concentration 1 mM Disruption solution supernatant: 500 l

[0096] FIG. 4 shows the results of quantitative determination for synthesized C.sub.10-C.sub.17 alkanes. As is understood from FIG. 4, the protein encoded by gene02 was found to have excellent capacity to synthesize alkane, and in particular, C.sub.12-C.sub.14 alkane. FIG. 5 shows a GC/MS analysis chart for a vector control strain and that for a strain into which gene02 has been introduced created by assaying C.sub.13 alkane using a C.sub.14 aldehyde compound as a substrate.

Example 3

[0097] In this Example, in vitro alkane synthesis was attempted using the purified protein encoded by gene04 identified in Example 1.

[0098] Specifically, PCR was performed using, as a template, genome DNA of the Klebsiella sp. NBRC100048 strain prepared in the manner described in Example 1 and a pair of primers (forward primer: accacagccaggatccGCGTTATGCACACCCTGGCCAGCCCGGCGCCCTG (SEQ ID NO: 63); reverse primer: gctcgaattcggatccTCAGAACAGGCCCAGCGGCGCGGTGCCGTAGCT (SEQ ID NO: 64)). The PCR product was ligated to the BamHI site of pRSFduet-1 plasmid (Novagen). A PCR amplification kit, a PCR product purification kit, and a PCR product ligation kit used herein were the same as those used in Example 1.

[0099] Next, E. coli BL21 (DE3) was transformed using the obtained expression vector. Transformed Escherichia coli was cultured overnight in 2-ml LB medium (kanamycin: 20 g/ml) at 37 C. and 120 rpm. Then, 10-ml LB medium (kanamycin: 20 g/ml, IPTG 0.5 mM) was inoculated with the obtained culture liquid to result in 1% culture liquid by volume, followed by culture at 37 C. for 5 hours. Cells were harvested from the culture product (4 C., 6000g, 3 minutes). The cells were suspended in 1 ml of phosphate buffer (pH 7.2) and disrupted using an ultrasonic disintegrator (4 C., 10 minutes).

[0100] A His-tag protein was purified from the obtained disruption solution using TALON CellThru Resin (Clontech). FIG. 6 shows SDS-PAGE results for a disruption solution of Escherichia coli transformed with pRSFduet-1 plasmid to which gene04 had been ligated, a disruption solution of Escherichia coli transformed with pRSFduet-1 plasmid to which gene04 had not been ligated, and a solution containing the purified His-tag protein. In FIG. 6, lane 1 represents the disruption solution of Escherichia coli transformed with pRSFduet-1 plasmid to which gene04 had not been ligated, lane 2 represents the disruption solution of Escherichia coli transformed with pRSFduet-1 plasmid to which gene04 had been ligated, and lane 3 represents the solution containing the purified His-tag protein. As shown in FIG. 6, it was revealed that the purified His-tag protein was observed at a position corresponding to a molecular weight of 56.6 kDa of a protein predicted from the nucleotide sequence of gene04.

[0101] An alkane synthesis reaction was carried out in vitro using the solution containing the His-tag protein. An enzymatic reaction was carried out overnight at 30 C. using the reaction composition shown in table 10. In addition, tetradecanal was used as an aldehyde compound in this Example. Here, tridecane is synthesized as an alkane.

TABLE-US-00010 TABLE 10 <Reaction solution composition> Phosphate buffer (pH 7.2): 500 l Aldehyde: Final concentration 1 mM NADH: Final concentration 1 mM His-tag protein eluate: 500 l

[0102] After the termination of the enzymatic reaction, synthesized alkane was subjected to GC/MS analysis in the manner described in Example 1 or 2. FIG. 7 shows GC/MS analysis charts. In FIG. 7, chart (a) is an analysis chart for GC/MS analysis using the above reaction solution composition, chart (b) is an analysis chart for GC/MS analysis in which the His-tag protein eluate was not added to the reaction solution composition, and chart (c) is an analysis chart for GC/MS analysis in which no coenzyme was added to the reaction solution composition. As shown in FIG. 7, in this Example, it was revealed that a purified protein encoded by gene04 (but not a protein in cell extract) has hydrocarbon synthesis activity.

[0103] Further, hydrocarbon synthesis activity determined with the use of NADPH as a coenzyme was examined in this Example. Specifically, an enzymatic reaction was carried out in the manner described above except that NADPH was used as a coenzyme. A synthesized alkane was subjected to GC/MS analysis. FIG. 8 shows the results. As is understood from FIG. 8, it was found that both NADPH and NADH can be used as a coenzyme for a protein encoded by gene04. In addition, the protein encoded by gene04 was found to have superior hydrocarbon synthesis activity when NADH is used as a coenzyme compared with that obtained when NADPH is used.

Example 4

[0104] In this Example, alkane synthesis was attempted by allowing yeast to express gene02 specified in Example 1 as a gene encoding a protein having excellent hydrocarbon synthesis activity.

[0105] Specifically, PCR was performed using, as a template, genome DNA of the Klebsiella sp. NBRC100048 strain prepared in the manner described in Example 1 and a pair of primers (forward primer: aacaaacaaaggatccaaaaaaATGCGTTATGCACACCCTGGCCAGC (SEQ ID NO: 171); reverse primer: gtcgtattacggatccttaTCAGAACAGGCCCAGCGGCGCGGTG (SEQ ID NO: 172)). PfuUltra II Fusion HS DNA Polymerase (Stratagene) was used for PCR.

[0106] PCR-amplified nucleic acid fragments were ligated to the BamHI site of a pESCpgkgap-HIS vector (see W02012/098662) using an In-Fusion HD Cloning Kit (Clontech). The Saccharomyces cerevisiae YPH499 strain was transformed using the obtained expression plasmid. Yeast was transformed in accordance with the protocol provided with a Frozen-EZ Yeast Transformation II Kit (ZYMO RESEARCH).

[0107] Next, 1-ml SD-His liquid medium was inoculated with colonies of the obtained yeast transformant, followed by overnight culture at 30 C. (Oriental Giken Inc.: IFM type, 130 rpm). Thereafter, 3-ml SD-His medium (supplemented with 1 mM tetradecanal) was inoculated with the obtained preculture liquid to result in 1% preculture liquid by volume, followed by culture at 30 C. and 100 rpm for 2 days.

[0108] After the termination of culture, GC/MS analysis was performed in the manner described in Example 1. FIG. 9 shows the analysis results. As shown in FIG. 9, it was found that the Klebsiella sp. NBRC100048 strain-derived gene (gene02) functions as a gene encoding a protein having excellent hydrocarbon synthesis activity even if yeast is used as a host.

Example 5

[0109] In this Example, alkane synthase genes from a variety of organism species were evaluated for alkane synthesis capacity.

[0110] Specifically, the 53 types of genes (Corynebacterium glutamicum ATCC13032-derived genes, a Lactobacillus reuteri DSM20016-derived gene, Saccharomyces cerevisiae-derived genes, Candida tropicalis MYA-3404-derived genes, Debaryomyces hansenii CBS767-derived genes, Pichia pastoris GS 115-derived genes, Schizosaccharomyces pombe-derived genes, Aspergillus oryzae RIB40-derived genes, a Zea mays-derived gene, Arabidopsis thaliana-derived genes, Drosophila melanogaster-derived genes, Rattus norvegicus-derived genes, and Homo sapiens-derived genes) listed in table 3 above were evaluated for alkane synthesis capacity in the manner described in Example 1. In addition, the Escherichia coli JM109 strain was used as a host in this Example.

[0111] The 53 types of genes were amplified using pairs of primers listed in table 11 below.

TABLE-US-00011 TABLE11 Test Sequence Sequence No. Genename Forwardprimer IDnumber Reverseprimer IDnumber 1 NCg10098 cggtacccgggatccaaggagatatacc SEQIDNO:173 cgactctagaggatccTCAACGTTT SEQIDNO:174 ATGACGTCGATGAATCTGCCTATTG AAGTTCCTCCGCCAAC 2 NCg10463 cggtacccgggatccaaggagatatacc SEQIDNO:175 cgactctagaggatccTCACGGCAA SEQIDNO:176 ATGTCTTTGACCTTCCCAGTAATCA AGCGAGGTAACGCACG 3 NCg12698 cggtacccgggatccaaggagatatacc SEQIDNO:177 cgactctagaggatccTCAGAACAG SEQIDNO:178 ATGACTGTCTACGCAAATCCAGGAA TCCGGTTGGGTTTGGA 4 NCg10049 cggtacccgggatccaaggagatatacc SEQIDNO:179 cgactctagaggatccCTAGCCGGC SEQIDNO:180 ATGACTATTAATGTCTCCGAACTAC GTAAGGATCCCGGATA 5 NCg12578 cggtacccgggatccaaggagatatacc SEQIDNO:181 cgactctagaggatccTTAGCTGCG SEQIDNO:182 ATGACTGCAACATTTGCTGGAATCG CTTGATGCCGATCCAT 6 NCg12619 cggtacccgggatccaaggagatatacc SEQIDNO:183 cgactctagaggatccCTACGGCAA SEQIDNO:184 ATGATCAAACGTCTTCCTTTAGGTC AACTTTAAAGATTTTG 7 Lreu_0034 cggtacccgggatccaaggagatatacc SEQIDNO:185 cgactctagaggatccTTATTGTCGT SEQIDNO:186 ATGGCATATCAAAGTATCAATCCAT GCTTCGTAAATTAGA 8 YER073W cggtacccggggatccGCTTTCTCGCAC SEQIDNO:187 cgactctagaggatccTTATCAACG SEQIDNO:188 AAGAGCTGCAG AATTGGCTTGTCAATGGCA 9 YHR037W cggtacccggggatccGCTATCAGCAA SEQIDNO:189 cgactctagaggatccTTATTATTCA SEQIDNO:190 GGTGCCTCAAAT TAATTCGATGGATATTTG 10 YHR039C cggtacccggggatccGTCCAAGGTCTA SEQIDNO:191 cgactctagaggatccTTACTAGCT SEQIDNO:192 TCTGAATTCAG GGCTTCTTTAGCTAAAGAG 11 YMR169C cggtacccggggatccGCCTACCTTGTA SEQIDNO:193 cgactctagaggatccTTATTATTTA SEQIDNO:194 TACTGATATCG TCCAATGAAAGATCCACA 12 YMR170C cggtacccggggatccGCCTACCTTGTA SEQIDNO:195 cgactctagaggatccTTATTAGTT SEQIDNO:196 TACTGATATCG GTCCAAAGAGAGATTTATG 13 YOR374W cggtacccggggatccGTTCAGTAGATC SEQIDNO:197 cgactctagaggatccTTACTCGTC SEQIDNO:198 TACGCTCTGCT CAATTTGGCACGGACC 14 YBR006W cggtacccggggatccGACTTTGAGTAA SEQIDNO:199 cgactctagaggatccTTATTAAAT SEQIDNO:200 GTATTCTAAAC GCTGTTTGGCAAATTCCCA 15 YMR110C cggtacccggggatccGTCAAACGACG SEQIDNO:201 cgactctagaggatccTTATCAGGA SEQIDNO:202 GCTCAAAAATAT AGAACAATGAGCGTAAATG 16 YPL061W cggtacccggggatccGACTAAGCTAC SEQIDNO:203 cgactctagaggatccTTATTACAA SEQIDNO:206 ACTTTGACACTG CTTAATTCTGACAGCTTTT 17 CTRG_04587 cggtacccggggatccaacaaacaaag SEQIDNO:205 cgactctagaggatcctagtgagtc SEQIDNO:206 gatccaagatccaaaaaaATG gtattacggatcctta 18 CTRG_01342 cggtacccggggatccaacaaacaaag SEQIDNO:205 cgactctagaggatcctagtgagtc SEQIDNO:206 gatccaagatccaaaaaaATG gtattacggatcctta 19 CTRG_00532 cggtacccggggatccaacaaacaaag SEQIDNO:205 cgactctagaggatcctagtgagtc SEQIDNO:206 gatccaagatccaaaaaaATG gtattacggatcctta 20 DEHA2G cggtacccggggatccaacaaacaaag SEQIDNO:205 cgactctagaggatcctagtgagtc SEQIDNO:206 03740g gatccaagatccaaaaaaATG gtattacggatcctta 21 DEHA2G cggtacccggggatccaacaaacaaag SEQIDNO:205 cgactctagaggatcctagtgagtc SEQIDNO:206 22572g gatccaagatccaaaaaaATG gtattacggatcctta 22 DEHA2B cggtacccggggatccaacaaacaaag SEQIDNO:205 cgactctagaggatcctagtgagtc SEQIDNO:206 10384g gatccaagatccaaaaaaATG gtattacggatcctta 23 PAS_chr1- cggtacccggggatccaacaaacaaag SEQIDNO:205 cgactctagaggatcctagtgagtc SEQIDNO:206 3_0024 gatccaagatccaaaaaaATG gtattacggatcctta 24 PAS-chr2- cggtacccggggatccaacaaacaaag SEQIDNO:205 cgactctagaggatcctagtgagtc SEQIDNO:206 1_0853 gatccaagatccaaaaaaATG gtattacggatcctta 25 PAS_chr4_ cggtacccggggatccaacaaacaaag SEQIDNO:205 cgactctagaggatcctagtgagtc SEQIDNO:206 0043 gatccaagatccaaaaaaATG gtattacggatcctta 26 SPAC139. cggtacccggggatccaacaaacaaag SEQIDNO:205 cgactctagaggatcctagtgagtc SEQIDNO:206 05 gatccaagatccaaaaaaATG gtattacggatcctta 27 SPAC1002. cggtacccggggatccaacaaacaaag SEQIDNO:205 cgactctagaggatcctagtgagtc SEQIDNO:206 12c gatccaagatccaaaaaaATG gtattacggatcctta 28 SPAC9E9. cggtacccggggatccaacaaacaaag SEQIDNO:205 cgactctagaggatcctagtgagtc SEQIDNO:206 09c gatccaagatccaaaaaaATG gtattacggatcctta 29 AOR_1_ cggtacccggggatccaacaaacaaag SEQIDNO:205 cgactctagaggatcctagtgagtc SEQIDNO:206 1204144 gatccaagatccaaaaaaATG gtattacggatcctta 30 AOR_1_ cggtacccggggatccaacaaacaaag SEQIDNO:205 cgactctagaggatcctagtgagtc SEQIDNO:206 1330014 gatccaagatccaaaaaaATG gtattacggatcctta 31 100284047 cggtacccggggatccaacaaacaaag SEQIDNO:205 cgactctagaggatcctagtgagtc SEQIDNO:206 gatccaagatccaaaaaaATG gtattacggatcctta 32 AT1G23800 cggtacccggggatccGGCATCAAGAA SEQIDNO:207 cgactctagaggatccTTATTAGAG SEQIDNO:208 GACTTTCTTCGC CCAGGCAGGGTTCTTGAGG 33 AT1G74920 cggtacccggggatccGGCGATTCCGAT SEQIDNO:209 cgactctagaggatccTTATTAGTT SEQIDNO:210 GCCTACTCGCC GGGAGATTTGTACCATCCC 34 AT1G79440 cggtacccggggatccGGTAATAGGAG SEQIDNO:211 cgactctagaggatccTTATCAGTG SEQIDNO:212 CAGCAGCGCGTG TCTATTCATATCTCCCAAG 35 AT2G24270 cggtacccggggatccGGCCGGGACTG SEQIDNO:213 cgactctagaggatccTTACTAACC SEQIDNO:214 GATTGTTTGCTG CATAGAGTAAGAAGGTGTA 36 AT2G24503 cggtacccggggatccGGAGAACGGCA SEQIDNO:215 cgactctagaggatccTTATTACAT SEQIDNO:216 AATGCAACGGAG CCAAGGGGAATTGTGAGA 37 AT3G48000 cggtacccggggatccGGCGGCTCGTA SEQIDNO:217 cgactctagaggatccTTATCAGAT SEQIDNO:218 GAGTGTCTTCTC CCAGGCAGGCTTATTTAGA 38 AT1G54100 cggtacccggggatccGGGTTCGGCGA SEQIDNO:219 cgactctagaggatccTTACTAACC SEQIDNO:220 ACAACGAGTACG GAAGTTAATTCCTTGCGCT 39 Dmel_ cggtacccggggatccGCTGCGCGTTTT SEQIDNO:221 cgactctagaggatccTTATTAGGA SEQIDNO:222 CG3752 GAAGACCGGTG GTTCTTCTGGGCAACCTTG 40 Dmel_ cggtacccggggatccGTTGCGAATGAT SEQIDNO:223 cgactctagaggatccTTATTACTC SEQIDNO:224 CG7145 GCGAAGTTCCT GCACATGTATGGATAGTTG 41 Dmel_ cggtacccggggatccGGCTCTAAAAAT SEQIDNO:225 cgactctagaggatccTTACTAAATA SEQIDNO:226 CG8665 GAGAATCGCAA TTCAACTGTGACACTTG 42 Dmel_ cggtacccggggatccGTTTGACAACGC SEQIDNO:227 cgactctagaggatccTTATCACGT SEQIDNO:228 CG11140 GATTAAACCTC CCACCAAGATGGTGGGTTC 43 Dmel_ cggtacccggggatccGGCCCGATCCCA SEQIDNO:229 cgactctagaggatccTTATTAAAG SEQIDNO:230 CG31075 ACGCCAAGCCCA AAGTTTCATGGTGATGGTC 44 Dmel_ cggtacccggggatccGTGGCGACAGC SEQIDNO:231 cgactctagaggatccTTATCAGTC SEQIDNO:232 CG4685 TCAGCGGAGTCG GTACTTGAGGTTGGCCCATG 45 Dmel_ cggtacccggggatccGTTGGCACAATT SEQIDNO:233 cgactctagaggatccTTACTACTC SEQIDNO:234 CG9629 GAGAAATATTT CACATTGAAGACAACACCC 46 24188 cggtacccggggatccGTCTTCCCCTGC SEQIDNO:235 cgactctagaggatccTTATTAGGA SEQIDNO:236 ACAGCCTGCAG GTTCTTCTGAGATATTTTC 47 641316 cggtacccggggatccGCTGCCGCCGC SEQIDNO:237 cgactctagaggatccTTATTACTG SEQIDNO:238 TTTGCTTCGCC CATGTAGGAGTATCGCCAG 48 216 cggtacccggggatccGTCATCCTCAGG SEQIDNO:239 cgactctagaggatccTTATTATGA SEQIDNO:240 CACGCCAGACT GTTCTTCTGAGAGATTTTC 49 219 cggtacccggggatccGCTGCGCTTCCT SEQIDNO:241 cgactctagaggatccTTATTACGA SEQIDNO:242 GGCACCCCGGC GTTCTTCTGAGGAACCTTG 50 223 cggtacccggggatccGTTTCTCCGAGC SEQIDNO:243 cgactctagaggatccTTATCAAAA SEQIDNO:244 AGGCCTGGCCG AGCAGATTCCACATCACCC 51 224 cggtacccggggatccGGAGCTCGAAG SEQIDNO:245 cgactctagaggatccTTATCAGTA SEQIDNO:246 TCCGGCGGGTCC ATATTCTGCCTTGACAAGC 52 501 cggtacccggggatccGTGGCGCCTTCC SEQIDNO:247 cgactctagaggatccTTATTACTG SEQIDNO:248 TCGCGCGCTGT AAACTTGATTCCTTGGGCC 53 64577 cggtacccggggatccGGCTGGAACAA SEQIDNO:249 cgactctagaggatccTTATCAGTG SEQIDNO:250 ACGCACTTTTGA TTTAACGGTGATGGTTTTG

[0112] Among the 53 types of genes listed in table 11, genome DNAs extracted from the corresponding strains were used as templates for the Corynebacterium glutamicum ATCC13032-derived genes (NCg10098, NCg10463, NCg12698, NCg10049, NCg12578, and NCg12619), the Lactobacillus reuteri DSM20016-derived gene (Lreu_0034), and the Saccharomyces cerevisiae-derived genes (YER073W, YHR037W, YHR039C, YMR169C, YMR170C, YOR374W, YBR006W, YMR110C, and YPL061W). In addition, among the 53 types of genes listed in table 11, artificial genes chemically synthesized based on the amino acid sequences in the KEGG database were used as templates for the Candida tropicalis MYA-3404-derived genes (CTRG_04587, CTRG_01342, and CTRG_00532), the Debaryomyces hansenii CBS767-derived genes (DEHA2G03740g, DEHA2G22572g, and DEHA2B10384g), the Pichia pastoris GS115-derived genes (PAS_chr1-3_0024, PAS_chr2-1_0853, and PAS_chr4_0043), the Schizosaccharomyces pombe-derived genes (SPAC139.05, SPAC1002.12c and SPAC9E9.09c), the Aspergillus oryzae RIB40-derived genes (AOR_1_1204144 and AOR_1_1330014), and the Zea mays-derived gene (100284047). Further, among the 53 types of genes listed in table 11, a cDNA library (ATCC77500) purchased from the ATCC (American Type Culture Collection) was used as a template for the Arabidopsis thaliana-derived genes (AT1G23800, AT1G74920, AT1G79440, AT2G24270, AT3G24503, AT3G48000, and AT1G54100). Furthermore, among the 53 types of genes listed in table 11, a cDNA library (ATCC87285) purchased from the ATCC (American Type Culture Collection) was used as a template for the Drosophila melanogaster-derived genes (Dme1_CG3752, Dme1_CG7145, Dme1_CG8665, Dme1_CG11140, Dme1_CG31075, Dme1_CG4685, and Dme1_CG9629). Moreover, among the 53 types of genes listed in table 11, a cDNA library (ATCC77403) purchased from the ATCC (American Type Culture Collection) was used as a template for the Rattus norvegicus-derived genes (24188 and 641316). Also, among the 53 types of genes listed in table 11, a cDNA library (ATCC77402) purchased from the ATCC (American Type Culture Collection) was used as a template for the Homo sapiens-derived genes (216, 219, 223, 224, 501, and 64577).

[0113] Here, the PCR conditions, the conditions for culturing transformants, and the alkane analysis method are the same as those described in Example 1. FIGS. 10-1 and 10-2 show the alkane analysis results. As shown in FIGS. 10-1 and 10-2, it was revealed that all the 53 types of genes described above have hydrocarbon synthesis activity. In particular, the following genes were found to have remarkably excellent hydrocarbon synthesis activity: NCg10098 (Test No. 1), NCg10049 (Test No. 4), NCg12619 (Test No. 6), YER073W (Test No. 8), YOR374W (Test No. 13), YBROO6W (Test No. 14), YMR110C (Test No. 15), CTRG_04587 (Test No. 17), PAS_chr2-1_0853 (Test No. 24), SPAC139.05 (Test No. 26), AOR_1_1204144 (Test No. 29), and Dme1_CG7145 (Test No. 40).

[0114] All publications, patents, and patent applications cited herein are incorporated by reference in their entirety.