Massive parallel method for decoding DNA and RNA
09725480 ยท 2017-08-08
Assignee
Inventors
- Jingyue Ju (Englewood Cliffs, NJ)
- Zengmin Li (Flushing, NY, US)
- John Robert Edwards (St. Louis, MO, US)
- Yasuhiro Itagaki (New York, NY, US)
Cpc classification
C12Q2525/186
CHEMISTRY; METALLURGY
C12Q1/6874
CHEMISTRY; METALLURGY
C12Q2525/186
CHEMISTRY; METALLURGY
C07H21/00
CHEMISTRY; METALLURGY
C12Q2535/101
CHEMISTRY; METALLURGY
C12Q2535/101
CHEMISTRY; METALLURGY
C07H19/10
CHEMISTRY; METALLURGY
C12Q1/6876
CHEMISTRY; METALLURGY
C07B2200/11
CHEMISTRY; METALLURGY
International classification
C07H21/00
CHEMISTRY; METALLURGY
Abstract
This invention provides methods for attaching a nucleic acid to a solid surface and for sequencing nucleic acid by detecting the identity of each nucleotide analog after the nucleotide analog is incorporated into a growing strand of DNA in a polymerase reaction. The invention also provides nucleotide analogs which comprise unique labels attached to the nucleotide analog through a cleavable linker, and a cleavable chemical group to cap the OH group at the 3-position of the deoxyribose.
Claims
1. A guanine deoxyribonucleotide analogue having the structure: ##STR00005## wherein R (a) represents a small, chemically cleavable, chemical group capping the oxygen at the 3 position of the deoxyribose of the deoxyribonucleotide analogue, (b) does not interfere with recognition of the analogue as a substrate by a DNA polymerase, (c) is stable during a DNA polymerase reaction, and (d) does not contain a ketone group; wherein OR is not a methoxy group or an ester group; wherein the covalent bond between the 3-oxygen and R is stable during a DNA polymerase reaction; wherein tag represents a detectable fluorescent moiety; wherein Y represents a chemically cleavable, chemical linker which (a) does not interfere with recognition of the analogue as a substrate by a DNA polymerase and (b) is stable during a DNA polymerase reaction; and wherein the guanine deoxyribonucleotide analogue: i) is recognized as a substrate by a DNA polymerase, ii) is incorporated at the end of a growing strand of DNA during a DNA polymerase reaction, iii) produces a 3-OH group on the deoxyribose upon cleavage of R, iv) no longer includes a tag on the base upon cleavage of Y, and v) is capable of forming hydrogen bonds with cytosine or a cytosine nucleotide analogue.
Description
BRIEF DESCRIPTION OF THE FIGURES
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
(23)
(24)
DETAILED DESCRIPTION OF THE INVENTION
(25) The following definitions are presented as an aid in understanding this invention.
(26) As used herein, to cap an OH group means to replace the H in the OH group with a chemical group. As disclosed herein, the OH group of the nucleotide analogue is capped with a cleavable chemical group. To uncap an OH group means to cleave the chemical group from a capped OH group and to replace the chemical group with H, i.e., to replace the R in OR with H wherein R is the chemical group used to cap the OH group.
(27) The nucleotide bases are abbreviated as follows: adenine (A), cytosine (C), guanine (G), thymine (T), and uracil (U).
(28) An analogue of a nucleotide base refers to a structural and functional derivative of the base of a nucleotide which can be recognized by polymerase as a substrate. That is, for example, an analogue of adenine (A) should form hydrogen bonds with thymine (T), a C analogue should form hydrogen bonds with G, a G analogue should form hydrogen bonds with C, and a T analogue should form hydrogen bonds with A, in a double helix format. Examples of analogues of nucleotide bases include, but are not limited to, 7-deaza-adenine and 7-deaza-guanine, wherein the nitrogen atom at the 7-position of adenine or guanine is substituted with a carbon atom.
(29) A nucleotide analogue refers to a chemical compound that is structurally and functionally similar to the nucleotide, i.e. the nucleotide analogue can be recognized by polymerase as a substrate. That is, for example, a nucleotide analogue comprising adenine or an analogue of adenine should form hydrogen bonds with thymine, a nucleotide analogue comprising C or an analogue of C should form hydrogen bonds with G, a nucleotide analogue comprising G or an analogue of G should form hydrogen bonds with C, and a nucleotide analogue comprising T or an analogue of T should form hydrogen bonds with A, in a double helix format. Examples of nucleotide analogues disclosed herein include analogues which comprise an analogue of the nucleotide base such as 7-deaza-adenine or 7-deaza-guanine, wherein the nitrogen atom at the 7-position of adenine or guanine is substituted with a carbon atom. Further examples include analogues in which a label is attached through a cleavable linker to the 5-position of cytosine or thymine or to the 7-position of deaza-adenine or deaza-guanine. Other examples include analogues in which a small chemical moiety such as CH.sub.2OCH.sub.3 or CH.sub.2CHCH.sub.2 is used to cap the OH group at the 3-position of deoxyribose. Analogues of dideoxynucleotides can similarly be prepared.
(30) As used herein, a porous surface is a surface which contains pores or is otherwise uneven, such that the surface area of the porous surface is increased relative to the surface area when the surface is smooth.
(31) The present invention is directed to a method for sequencing a nucleic acid by detecting the identity of a nucleotide analogue after the nucleotide analogue is incorporated into a growing strand of DNA in a polymerase reaction, which comprises the following steps: (i) attaching a 5 end of the nucleic acid to a solid surface; (ii) attaching a primer to the nucleic acid attached to the solid surface; (iii) adding a polymerase and one or more different nucleotide analogues to the nucleic acid to thereby incorporate a nucleotide analogue into the growing strand of DNA, wherein the incorporated nucleotide analogue terminates the polymerase reaction and wherein each different nucleotide analogue comprises (a) a base selected from the group consisting of adenine, guanine, cytosine, thymine, and uracil, and their analogues; (b) a unique label attached through a cleavable linker to the base or to an analogue of the base; (c) a deoxyribose; and (d) a cleavable chemical group to cap an OH group at a 3-position of the deoxyribose; (iv) washing the solid surface to remove unincorporated nucleotide analogues; (v) detecting the unique label attached to the nucleotide analogue that has been incorporated into the growing strand of DNA, so as to thereby identify the incorporated nucleotide analogue; (vi) adding one or more chemical compounds to permanently cap any unreacted OH group on the primer attached to the nucleic acid or on a primer extension strand formed by adding one or more nucleotides or nucleotide analogues to the primer; (vii) cleaving the cleavable linker between the nucleotide analogue that was incorporated into the growing strand of DNA and the unique label; (viii) cleaving the cleavable chemical group capping the OH group at the 3-position of the deoxyribose to uncap, the OH group, and washing the solid surface to remove cleaved compounds; and (ix) repeating steps (iii) through (viii) so as to detect the identity of a newly incorporated nucleotide analogue into the growing strand of DNA; wherein if the unique label is a dye, the order of steps (v) through (vii) is: (v), (vi), and (vii); and wherein if the unique label is a mass tag, the order of steps (v) through (vii) is: (vi), (vii), and (v).
(32) In one embodiment of any of the nucleotide analogues described herein, the nucleotide base is adenine. In one embodiment, the nucleotide base is guanine. In one embodiment, the nucleotide base is cytosine. In one embodiment, the nucleotide base is thymine. In one embodiment, the nucleotide base is uracil. In one embodiment, the nucleotide base is an analogue of adenine. In one embodiment, the nucleotide base is an analogue of guanine. In one embodiment, the nucleotide base is an analogue of cytosine. In one embodiment, the nucleotide base is an analogue of thymine. In one embodiment, the nucleotide base is an analogue of uracil.
(33) In different embodiments of any of the inventions described herein, the solid surface is glass, silicon, or gold. In different embodiments, the solid surface is a magnetic bead, a chip, a channel in a chip, or a porous channel in a chip. In one embodiment, the solid surface is glass. In one embodiment, the solid surface is silicon. In one embodiment, the solid surface is gold. In one embodiments, the solid surface is a magnetic bead. In one embodiment, the solid surface is a chip. In one embodiment, the solid surface is a channel in a chip. In one embodiment, the solid surface is a porous channel in a chip. Other materials can also be used as long as the material does not interfere with the steps of the method.
(34) In one embodiment, the step of attaching the nucleic acid to the solid surface comprises: (i) coating the solid surface with a phosphine moiety, (ii) attaching an azido group to the 5 end of the nucleic acid, and (iii) immobilizing the 5 end of the nucleic acid to the solid surface through interaction between the phosphine moiety on the solid surface and the azido group on the 5 end of the nucleic acid.
(35) In one embodiment, the step of coating the solid surface with the phosphine moiety comprises: (i) coating the surface with a primary amine, and (ii) covalently coupling a N-hydroxysuccinimidyl eater of triarylphosphine with the primary amine.
(36) In one embodiment, the nucleic acid that is attached to the solid surface is a single-stranded deoxyribonucleic acid (DNA). In another embodiment, the nucleic acid that is attached to the solid surface in step (i) is a double-stranded DNA, wherein only one strand is directly attached to the solid surface, and wherein the strand that is not directly attached to the solid surface is removed by denaturing before proceeding to step (ii). In one embodiment, the nucleic acid that is attached to the solid surface is a ribonucleic acid (RNA), and the polymerase in step (iii) is reverse transcriptase.
(37) In one embodiment, the primer is attached to a 3 end of the nucleic acid in step (ii), and the attached primer comprises a stable loop and an OH group at a 3-position of a deoxyribose capable of self-priming in the polymerase reaction. In one embodiment, the step of attaching the primer to the nucleic acid comprises hybridizing the primer to the nucleic acid or ligating the primer to the nucleic acid. In one embodiment, the primer is attached to the nucleic acid through a ligation reaction which links the 3 end of the nucleic acid with the 5 end of the primer.
(38) In one embodiment, one or more of four different nucleotide analogs is added in step (iii), wherein each different nucleotide analogue comprises a different base selected from the group consisting of thymine or uracil or an analogue of thymine or uracil, adenine or an analogue of adenine, cytosine or an analogue of cytosine, and guanine or an analogue of guanine, and wherein each of the four different nucleotide analogues comprises a unique label.
(39) In one embodiment, the cleavable chemical group that caps the OH group at the 3-position of the deoxyribose in the nucleotide analogue is CH.sub.2OCH.sub.3 or CH.sub.2CHCH.sub.2. Any chemical group could be used as long as the group 1) is stable during the polymerase reaction, 2) does not interfere with the recognition of the nucleotide analogue by polymerase as a substrate, and 3) is cleavable.
(40) In one embodiment, the unique label that is attached to the nucleotide analogue is a fluorescent moiety or a fluorescent semiconductor crystal. In further embodiments, the fluorescent moiety is selected from the group consisting of 5-carboxyfluorescein, 6-carboxyrhodamine-6G, N,N,N,N-tetramethyl-6-carboxyrhodamine, and 6-carboxy-X-rhodamine. In one embodiment, the fluorescent moiety is 5-carboxyfluorescein. In one embodiment, the fluorescent moiety is 6-carboxyrhodamine-6G, N,N,N,N-tetramethyl-6-carboxyrhodamine. In one embodiment, the fluorescent moiety is 6-carboxy-X-rhodamine.
(41) In one embodiment, the unique label that is attached to the nucleotide analogue is a fluorescence energy transfer tag which comprises an energy transfer donor and an energy transfer acceptor. In further embodiments, the energy transfer donor is 5-carboxyfluorescein or cyanine, and wherein the energy transfer acceptor is selected from the group consisting of dichlorocarboxyfluorescein, dichloro-6-carboxyrhodamine-6G, dichloro-N,N,N,N-tetramethyl-6-carboxyrhodamine, and dichloro-6-carboxy-X-rhodamine. In one embodiment, the energy transfer acceptor is dichlorocarboxyfluorescein. In one embodiment, the energy transfer acceptor is dichloro-6-carboxyrhodamine-6G. In one embodiment, the energy transfer acceptor is dichloro-N,N,N,N-tetramethyl-6-carboxyrhodamine. In one embodiment, the energy transfer acceptor is dichloro-6-carboxy-X-rhodamine.
(42) In one embodiment, the unique label that is attached to the nucleotide analogue is a mass tag that can be detected and differentiated by a mass spectrometer. In further embodiments, the mass tag is selected from the group consisting of a 2-nitro--methyl-benzyl group, a 2-nitro--methyl-3-fluorobenzyl group, a 2-nitro--methyl-3,4-difluorobenzyl group, and a 2-nitro--methyl-3,4-dimethoxybenzyl group. In one embodiment, the mass tag is a 2-nitro--methyl-benzyl group. In one embodiment, the mass tag is a 2-nitro--methyl-3-fluorobenzyl group. In one embodiment, the mass tag is a 2-nitro--methyl-3,4-difluorobenzyl group. In one embodiment, the mass tag is a 2-nitro--methyl-3,4-dimethoxybenzyl group. In one embodiment, the mass tag is detected using a parallel mass spectrometry system which comprises a plurality of atmospheric pressure chemical ionization mass spectrometers for parallel analysis of a plurality of samples comprising mass tags.
(43) In one embodiment, the unique label is attached through a cleavable linker to a 5-position of cytosine or thymine or to a 7-position of deaza-adenine or deaza-guanine. The unique label could also be attached through a cleavable linker to another position in the nucleotide analogue as long as the attachment of the label is stable during the polymerase reaction and the nucleotide analog can be recognized by polymerase as a substrate. For example, the cleavable label could be attached to the deoxyribose.
(44) In one embodiment, the linker between the unique label and the nucleotide analogue is cleaved by a means selected from the group consisting of one or more of a physical means, a chemical means, a physical chemical means, heat, and light. In one embodiment, the linker is cleaved by a physical means. In one embodiment, the linker is cleaved by a chemical means. In one embodiment, the linker is cleaved by a physical chemical means. In one embodiment, the linker is cleaved by heat. In one embodiment, the linker is cleaved by light. In one embodiment, the linker is cleaved by ultraviolet light. In a further embodiment, the cleavable linker is a photocleavable linker which comprises a 2-nitrobenzyl moiety.
(45) In one embodiment, the cleavable chemical group used to cap the OH group at the 3-position of the deoxyribose is cleaved by a means selected from the group consisting of one or more of a physical means, a chemical means, a physical chemical means, heat, and light. In one embodiment, the linker is cleaved by a physical chemical means. In one embodiment, the linker is cleaved by heat. In one embodiment, the linker is cleaved by light. In one embodiment, the linker is cleaved by ultraviolet light.
(46) In one embodiment, the chemical compounds added in step (vi) to permanently cap any unreacted OH group on the primer, attached to the nucleic acid or on the primer extension strand are a polymerase and one or more different dideoxynucleotides or analogues of dideoxynucleotides. In further embodiments, the different dideoxynucleotides are selected from the group consisting of 2,3-dideoxyadenosine 5-triphosphate, 2,3-dideoxyguanosine 5-triphosphate, 2,3-dideoxycytidine 5-triphosphate, 2,3-dideoxythymidine 5-triphosphate, 2,3-dideoxyuridine 5-triphosphase, and their analogues. In one embodiment, the dideoxynucleotide is 2,3-dideoxyadenosine 5-triphosphate. In one embodiment, the dideoxynucleotide is 2,3-dideoxyguanosine 5-triphosphate. In one embodiment, the dideoxynucleotide is 2,3-dideoxycytidine 5-triphosphate. In one embodiment, the dideoxynucleotide is 2,3-dideoxythymidine 5-triphosphate. In one embodiment, the dideoxynucleotide is 2,3-dideoxyuridine 5-triphosphase. In one embodiment, the dideoxynucleotide is an analogue of 2,3-dideoxyadenosine 5-triphosphate. In one embodiment, the dideoxynucleotide is an analogue of 2,3-dideoxyguanosine 5-triphosphate. In one embodiment, the dideoxynucleotide is an analogue of 2,3-dideoxycytidine 5-triphosphate. In one embodiment, the dideoxynucleotide is an analogue of 2,3-dideoxythymidine 5-triphosphate. In one embodiment, the dideoxynucleotide is an analogue of 2,3-dideoxyuridine 5-triphosphase.
(47) In one embodiment, a polymerase and one or more of four different dideoxynucleotides are added in step (vi), wherein each different dideoxynucleotide is selected from the group consisting of 2,3-dideoxyadenosine 5-triphosphate or an analogue of 2,3-dideoxyadenosine 5-triphosphate; 2,3-dideoxyguanosine 5-triphosphate or an analogue of 2,3-dideoxyguanosine 5-triphosphate; 2,3-dideoxycytidine 5-triphosphate or an analogue of 2,3-dideoxycytidine 5-triphosphate; and 2,3-dideoxythymidine 5-triphosphate or 2,3-dideoxyuridine 5-triphosphase or an analogue of 2,3-dideoxythymidine 5-triphosphate or an analogue of 2,3-dideoxyuridine 5-triphosphase. In one embodiment, the dideoxynucleotide is 2,3-dideoxyadenosine 5-triphosphate. In one embodiment, the dideoxynucleotide is an analogue of 2,3-dideoxyadenosine 5-triphosphate. In one embodiment, the dideoxynucleotide is 2,3-dideoxyguanosine 5-triphosphate. In one embodiment, the dideoxynucleotide is an analogue of 2,3-dideoxyguanosine 5-triphosphate. In one embodiment, the dideoxynucleotide is 2,3-dideoxycytidine 5-triphosphate. In one embodiment, the dideoxynucleotide is an analogue of 2,3-dideoxycytidine 5-triphosphate. In one embodiment, the dideoxynucleotide is 2,3-dideoxythymidine 5-triphosphate. In one embodiment, the dideoxynucleotide is 2,3-dideoxyuridine 5-triphosphase. In one embodiment, the dideoxynucleotide is an analogue of 2,3-dideoxythymidine 5-triphosphate. In one embodiment, the dideoxynucleotide is an analogue of 2,3-dideoxyuridine 5-triphosphase.
(48) Another type of chemical compound that reacts specifically with the OH group could also be used to permanently cap any unreacted OH group on the primer attached to the nucleic acid or on an extension strand formed by adding one or more nucleotides or nucleotide analogues to the primer.
(49) The invention provides a method for simultaneously sequencing a plurality of different nucleic acids, which comprises simultaneously applying any of the methods disclosed herein for sequencing a nucleic acid to the plurality of different nucleic acids. In different embodiments, the method can be used to sequence from one to over 100,000 different nucleic acids simultaneously.
(50) The invention provides for the use of any of the methods disclosed herein for detection of single nucleotide polymorphisms, genetic mutation analysis, serial analysis of gene expression, gene expression analysis, identification in forensics, genetic disease association studies, DNA sequencing, genomic sequencing, translational analysis, or transcriptional analysis.
(51) The invention provides a method of attaching a nucleic acid to a solid surface which comprises: (i) coating the solid surface with a phosphine moiety, (ii) attaching an azido group to a 5 end of the nucleic acid, and (iii) immobilizing the 5 end of the nucleic acid to the solid surface through interaction between the phosphine moiety on the solid surface and the azido group on the 5 end of the nucleic acid.
(52) In one embodiment, the step of coating the solid surface with the phosphine moiety comprises: (i) coating the surface with a primary amine, and (ii) covalently coupling a N-hydroxysuccinimidyl ester of triarylphosphine with the primary amine.
(53) In different embodiments, the solid surface is glass, silicon, or gold. In different embodiments, the solid surface is a magnetic bead, a chip, a channel in an chip, or a porous channel in a chip.
(54) In different embodiments, the nucleic acid that is attached to the solid surface is a single-stranded or double-stranded DNA or a RNA. In one embodiment, the nucleic acid is a double-stranded DNA and only one strand is attached to the solid surface. In a further embodiment, the strand of the double-stranded DNA that is not attached to the solid surface is removed by denaturing.
(55) The invention provides for the use of any of the methods disclosed herein for attaching a nucleic acid to a surface for gene expression analysis, microarray based gene expression analysis, or mutation detection, translational analysis, transcriptional analysis, or for other genetic applications.
(56) The invention provides a nucleotide analogue which comprises: (a) a base selected from the group consisting of adenine or an analogue of adenine, cytosine or an analogue of cytosine, guanine or an analogue of guanine, thymine or an analogue of thymine, and uracil or an analogue of uracil; (b) a unique label attached through a cleavable linker to the base or to an analogue of the base; (c) a deoxyribose; and (d) a cleavable chemical group to cap an OH group at a 3-position of the deoxyribose.
(57) In one embodiment of the nucleotide analogue, the cleavable chemical group that caps the OH group at the 3-position of the deoxyribose is CH.sub.2OCH.sub.3 or CH.sub.2CHCH.sub.2.
(58) In one embodiment, the unique label is a fluorescent moiety or a fluorescent semiconductor crystal. In further embodiments, the fluorescent moiety is selected from the group consisting of 5-carboxyfluorescein, 6-carboxyrhodamine-6G, N,N,N,N-tetramethyl-6-carboxyrhodamine, and 6-carboxy-X-rhodamine.
(59) In one embodiment, the unique label is a fluorescence energy transfer tag which comprises an energy transfer donor and an energy transfer acceptor. In further embodiments, the energy transfer donor is 5-carboxyfluorescein or cyanine, and wherein the energy transfer acceptor is selected from the group consisting of dichlorocarboxyfluorescein, dichloro-6-carboxyrhodamine-6G, dichloro-N,N,N,N-tetramethyl-6-carboxyrhodamine, and dichloro-6-carboxy-X-rhodamine.
(60) In one embodiment, the unique label is a mass tag that can be detected and differentiated by a mass spectrometer. In further embodiments, the mass tag is selected from the group consisting of a 2-nitro--methyl-benzyl group, a 2-nitro--methyl-3-fluorobenzyl group, a 2-nitro--methyl-3,4-difluorobenzyl group, and a 2-nitro--methyl-3,4-dimethoxybenzyl group.
(61) In one embodiment, the unique label is attached through a cleavable linker to a 5-position of cytosine or thymine or to a 7-position of deaza-adenine or deaza-guanine. The unique label could also be attached through a cleavable linker to another position in the nucleotide analogue as long as the attachment of the label is stable during the polymerase reaction and the nucleotide analog can be recognized by polymerase as a substrate. For example, the cleavable label could be attached to the deoxyribose.
(62) In one embodiment, the linker between the unique label and the nucleotide analogue is cleavable by a means selected from the group consisting of one or more of a physical means, a chemical means, a physical chemical means, heat, and light. In a further embodiment, the cleavable linker is a photocleavable linker which comprises a 2-nitrobenzyl moiety.
(63) In one embodiment, the cleavable chemical group used to cap the OH group at the 3-position of the deoxyribose is cleavable by a means selected from the group consisting of one or more of a physical means, a chemical means, a physical chemical means, heat, and light.
(64) In different embodiments, the nucleotide analogue is selected from the group consisting of:
(65) ##STR00001## wherein Dye.sub.1, Dye.sub.2, Dye.sub.3, and Dye.sub.4 are four different unique labels; and wherein R is a cleavable chemical group used to cap the OH group at the 3-position of the deoxyribose.
(66) In different embodiments, the nucleotide analogue is selected from the group consisting of:
(67) ##STR00002## wherein R is CH.sub.2OCH.sub.3 or CH.sub.2CHCH.sub.2.
(68) In different embodiments, the nucleotide analogue is selected from the group consisting of:
(69) ##STR00003## wherein Tag.sub.1, Tag.sub.2, Tag.sub.3, and Tag.sub.4 are four different mass tag labels; and wherein R is a cleavable chemical group used to cap the OH group at the 3-position of the deoxyribose.
(70) In different embodiments, the nucleotide analogue is selected from the group consisting of:
(71) ##STR00004## wherein R is CH.sub.2OCH.sub.2 or CH.sub.2CHCH.sub.2.
(72) The invention provides for the use any of the nucleotide analogues disclosed herein for detection of single nucleotide polymorphisms, genetic mutation analysis, serial analysis of gene expression, gene expression analysis, identification in forensics, genetic disease association studies, DNA sequencing, genomic sequencing, translational analysis, or transcriptional analysis.
(73) The invention provides a parallel mass spectrometry system, which comprises a plurality of atmospheric pressure chemical ionization mass spectrometers for parallel analysis of a plurality of samples comprising mass tags. In one embodiment, the mass spectrometers are quadrupole mass spectrometers. In one embodiment, the mass spectrometers are time-of-flight mass spectrometers. In one embodiment, the mass spectrometers are contained in one device. In one embodiment, the system further comprises two turbo-pumps, wherein one pump is used to generate a vacuum and a second pump is used to remove undesired elements. In one embodiment, the system comprises at least three mass spectrometers. In one embodiment, the mass tags have molecular weights between 150 daltons and 250 daltons. The invention provides for the use of the system for DNA sequencing analysis, detection of single nucleotide polymorphisms, genetic mutation analysis, serial analysis of gene expression, gene expression analysis, identification in forensics, genetic disease association studies, DNA sequencing, genomic sequencing, translational analysis, or transcriptional analysis.
(74) This invention will be better understood from the Experimental Details which follow. However, one skilled in the art will readily appreciate that the specific methods and results discussed are merely illustrative of the invention as described more fully in the claims which follow thereafter.
(75) Experimental Details
(76) 1. The Sequencing by Synthesis Approach
(77) Sequencing DNA by synthesis involves the detection of the identity of each nucleotide as it is incorporated into the growing strand of DNA in the polymerase reaction. The fundamental requirements for such a system to work are: (1) the availability of 4 nucleotide analogues (aA, aC, aG, aT) each labeled with a unique label and containing a chemical moiety capping the 3-OH group; (2) the 4 nucleotide analogues (aA, aC, aG, aT) need to be efficiently and faithfully incorporated by DNA polymerase as terminators in the polymerase reaction; (3) the tag and the group capping the 3-OH need to be removed with high yield to allow the incorporation and detection of the next nucleotide; and (4) the growing strand of DNA should survive the washing, detection and cleavage processes to remain annealed to the DNA template.
(78) The sequencing by synthesis approach disclosed herein is illustrated in
(79) As shown in
(80) It is a routine procedure now to immobilize high density (>10,000 spots per chip) single stranded DNA on a 4 cm1 cm glass chip (Schena et al. 1995). Thus, in the DNA sequencing system disclosed herein, more than 10,000 bases can be identified after each cycle and after 100 cycles, a million base pairs will be generated from one sequencing chip.
(81) Possible DNA polymerases include Thermo Sequenase, Taq FS DNA polymerase, T7 DNA polymerase, and Vent (exo-) DNA polymerase. The fluorescence emission from each specific dye can be detected using a fluorimeter that is equipped with an accessory to detect fluorescence from a glass slide. For large scale evaluation, a multi-color scanning system capable of detecting multiple different fluorescent dyes (500 nm-700 nm) (GSI Lumonics ScanArray 5000 Standard Biochip Scanning System) on a glass slide can be used.
(82) An example of the sequencing by synthesis approach using mass tags is shown in
(83) Since the development of new ionization techniques such as matrix assisted laser desorption ionization (MALDI) and electrospray ionization (ESI), mass spectrometry has become an indispensable tool in many areas of biomedical research. Though these ionization methods are suitable for the analysis of bioorganic molecules, such as peptides and proteins, improvements in both detection and sample preparation are required for implementation of mass spectrometry for DNA sequencing applications. Since the approach disclosed herein uses small and stable mass tags, there is no need to detect large DNA sequencing fragments directly and it is not necessary to use MALDI or ESI methods for detection. Atmospheric pressure chemical ionization (APCI) is an ionization method that uses a gas-phase ion-molecular reaction at atmospheric pressure (Dizidic et al. 1975). In this method, samples are introduced by either chromatography or flow injection into a pneumatic nebulizer where they are converted into small droplets by a high-speed beam of nitrogen gas. When the heated gas and solution arrive at the reaction area, the excess amount of solvent is ionized by corona discharge. This ionized mobile phase acts as the ionizing agent toward the samples and yields pseudo molecular (M+H).sup.+ and (MH).sup. ions. Due to the corona discharge ionization method, high ionization efficiency is attainable, maintaining stable ionization conditions with detection sensitivity lower than femtomole region for small and stable organic compounds. However, due to the limited detection of large molecules, ESI and MALDI have replaced APCI for analysis of peptides and nucleic acids. Since in the approach disclosed the mass tags to be detected are relatively small and very stable organic molecules, the ability to detect large biological molecules gained by using ESI and MALDI is not necessary. APCI has several advantages over ESI and MALDI because it does not require any tedious sample preparation such as desaltinq or mixing with matrix to prepare crystals on a target plate. In ESI, the sample nature and sample preparation conditions (i.e. the existence of buffer or inorganic salts) suppress the ionization efficiency. MALDI requires the addition of matrix prior to sample introduction into the mass spectrometer and its speed is often limited by the need to search for an ideal irradiation spot to obtain interpretable mass spectra. These limitations are overcome by APCI because the mass tag solution can be injected directly with no additional sample purification or preparation into the mass spectrometer. Since the mass tagged samples are volatile and have small mass numbers, these compounds are easily detectable by APCI ionization with high sensitivity. This system can be scaled up into a high throughput operation.
(84) Each component of the sequencing by synthesis system is described in more detail below.
(85) 2. Construction of a Surface Containing Immobilized Self-Primed DNA Moiety
(86) The single stranded DNA template immobilized on a surface is prepared according to the scheme shown in
(87) The NHS eater of triarylphosphine (1) is prepared according to the scheme shown in
(88) The azido labeled DNA (2) is synthesized according to the scheme shown in
(89) The self-primed DNA template moiety on the sequencing chip is constructed as shown in
(90) 3. Sequencing by Synthesis Evaluation Using Nucleotide Analogues .sub.3-HO-A-.sub.Dye1, .sub.3-HO-C-.sub.Dye2, .sub.3-HO-G-.sub.Dye3, .sub.3-HO-T-.sub.Dye4
(91) A scheme has been developed for evaluating the photocleavage efficiency using different dyes and testing the sequencing by synthesis approach. Four nucleotide analogues .sub.3-HO-A-.sub.Dye1, .sub.3-HO-C-.sub.Dye2, .sub.3-HO-G-.sub.Dye3, .sub.3-HO-T=.sub.Dye4 each labeled with a unique fluorescent dye through a photocleavable linker are synthesized and used in the sequencing by synthesis approach. Examples of dyes include, but are not limited to: Dye1=FAM, 5-carboxyfluorescein; Dye2=R6G, 6-carboxyrhodamine-6G; Dye3=TAM, N,N,N,N-tetramethyl-6-carboxyrhodamine; and Dye4=ROX, 6-carboxy-X-rhodamine. The structures of the 4 nucleotide analogues are shown in
(92) The photocleavable 2-nitrobenzyl moiety has been used to link biotin to DNA and protein for efficient removal by UV light (350 nm) (Olejnik et al. 1995, 1999). In the approach disclosed herein the 2-nitrobenzyl group is used to bridge the fluorescent dye and nucleotide together to form the dye labeled nucleotides as shown in
(93) As a representative example, the synthesis of .sub.3-HO-G-.sub.Dye3 (Dye3=Tam) is shown in
(94) Results on Photochemical Cleavage Efficiency
(95) The expected photolysis products of DNA containing a photocleavable fluorescent dye at the 3 end of the DNA are shown in
(96) A photolysis setup can be used which allows a high throughput of monochromatic light from a 1000 watt high pressure xenon lamp (LX1000UV, ILC) in conjunction with a monochromator (Kratos, Schoeffel Instruments). This instrument allows the evaluation of the photocleavage of model systems as a function of the intensity and excitation wavelength of the absorbed light. Standard analytical analysis is used to determine the extent of photocleavage. From this information, the efficiency of the photocleavage as a function of wavelength can be determined. The wavelength at which photocleavage occurs most efficiently can be selected as for use in the sequencing system.
(97) Photocleavage results have been obtained using a model system as shown in
(98) 4. Sequencing by Synthesis Evaluation Using Nucleotide Analogues .sub.3-RO-A-.sub.Dye1, .sub.3-RO-C-.sub.Dye2, .sub.3-RO-G-.sub.Dye3, .sub.3-RO-T-.sub.Dye4
(99) Once the steps and conditions in Section 3 are optimized, the synthesis of nucleotide analogues .sub.3-RO-A-.sub.Dye1, .sub.3-RO-C-.sub.Dye2, .sub.3-RO-G-.sub.Dye3, .sub.3-RO-T-.sub.Dye4 can be pursued for further study of the system. Here the 3-OH is capped in all four nucleotide analogues, which then can be mixed together with DNA polymerase and used to evaluate the sequencing system using the scheme in
(100) 5. Using Energy Transfer Coupled Dyes to Optimize the Sequencing by Synthesis System
(101) The spectral property of the fluorescent tags can be optimized by using energy transfer (ET) coupled dyes. The ET primer and ET dideoxynucleotides have been shown to be a Superior set of reagents for 4-color DNA sequencing that allows the use of one laser to excite multiple sets of fluorescent tags (Ju et al. 1995). It has been shown that DNA polymerase (Thermo Sequenase and Taq FS) can efficiently incorporate the ET dye labeled dideoxynucleotides (Rosenblum et al. 1997). These ET dye-labeled sequencing reagents are now widely used in large scale DNA sequencing projects, such as the human genome project. A library of ET dye labeled nucleotide analogues can be synthesized as shown in
(102) 6. Sequencing by Synthesis Evaluation Using Nucleotide Analogues .sub.3-HO-A-.sub.Tag1, .sub.3-HO-C-.sub.Tag2, .sub.3-HO-G-.sub.Tag3, .sub.3-HO-T-.sub.Tag4
(103) The precursors of four examples of mass tags are shown in
(104) Different combinations of mass tags and nucleotides can be used, as indicated by the general scheme: .sub.3-HO-A-.sub.Tag1, .sub.3-HO-C-.sub.Tag2, .sub.3-HO-G-.sub.Tag3, .sub.3-HO-T-.sub.Tag4 where Tag1, Tag2, Tag3, and Tag4 are four different unique cleavable mass tags. Four specific examples of nucleotide analogues are shown in
(105) As a representative example, the synthesis of the NHS ester of one mass tag (Tag-3) is shown in
(106) The sequencing by synthesis approach can be tested using mass tags using a scheme similar to that show for dyes in
(107) The synthesis of nucleotide analogues .sub.3-HO-A-.sub.Tag1, .sub.3-HO-C-.sub.Tag2, .sub.3-HO-G-.sub.Tag3, .sub.3-HO-T-.sub.Tag4 can be pursued for further study of the system a discussed above for the case where the unique labels are dyes. Here the 3-OH is capped in all four nucleotide analogues, which then can be mixed together with DNA polymerase and used to evaluate the sequencing system using a scheme similar to that in
(108) 7. Parallel Channel System for Sequencing by Synthesis
(109)
(110) 8. Parallel Mass Tag Sequencing by Synthesis System
(111) The approach disclosed herein comprises detecting four unique photoreleased mass tags, which can have molecular weights from 150 to 250 daltons, to decode the DNA sequence, thereby obviating the issue of detecting large DNA fragments using a mass spectrometer as well as the stringent sample requirement for using mass spectrometry to directly detect long DNA fragments. It takes 10 seconds or less to analyze each mass tag using the APCI mass spectrometer. With 8 miniaturized APCI mass spectrometers in a system, close to 100,000 bp of high quality digital DNA sequencing data could be generated each day by each instrument using this approach. Since there is no separation and purification requirements using this approach, such a system is cost effective.
(112) To make mass spectrometry competitive with a 96 capillary array method for analyzing DNA, a parallel mass spectrometer approach is needed. Such a complete system has not been reported mainly due to the fact that most of the mass spectrometers are designed to achieve adequate resolution for large biomolecules. The system disclosed herein requires the detection of four mass tags, with molecular weight range between 150 and 250 daltons, coding for the identity of the four nucleotides (A, C, G, T). Since a mass spectrometer dedicated to detection of these mass tags only requires high resolution for the mass range of 150 to 250 daltons instead of covering a wide mass range, the mass spectrometer can be miniaturized and have a simple design. Either quadrupole (including ion trap detector) or time-of-flight mass spectrometers can be selected for the ion optics. While modern mass spectrometer technology has made it possible to produce miniaturized mass spectrometers, most current research has focused on the design of a single stand-alone miniaturized mass spectrometer. Individual components of the mass spectrometer has been miniaturized for enhancing the mass spectrometer analysis capability (Liu et al. 2000, Zhang et al. 1999). A miniaturized mass spectrometry system using-multiple analyzers (up to 10) in parallel has been reported (Badman and Cooks 2000). However, the mass spectrometer of Badman and Cook was designed to measure only single samples rather than multiple samples in parallel. They also noted that the miniaturization of the ion trap limited the capability of the mass spectrometer to scan wide mass ranges. Since the approach disclosed herein focuses on detecting four small stable mass tags (the mass range is less than 300 daltons), multiple miniaturized APCI mass spectrometers are easily constructed and assembled into a single unit for parallel analysis of the mass tags for DNA sequencing analysis.
(113) A complete parallel mass spectrometry system includes multiple APCI sources interfaced with multiple analyzers, coupled with appropriate electronics and power supply configuration. A mass spectrometry system with parallel detection capability will overcome the throughput bottleneck issue for application in DNA analysis. A parallel system containing multiple mass spectrometers in a single device is illustrated in
(114) As illustrated in
(115) 9. Validate the Complete Sequencing by Synthesis System by Sequencing P53 Genes
(116) The tumor suppressor gene p53 can be used as a model system to validate the DNA sequencing system. The p53 gene is one of the most frequently mutated genes in human cancer (O'Connor et al. 1997). First, a base pair DNA template (shown below) is synthesized containing an azido group at the 5 end and a portion of the sequences from exon 7 and exon 8 of the p53 gene:
(117) TABLE-US-00001 (SEQIDNO:2) 5-N.sub.3-TTCCTGCATGGGCGGCATGAACCCGAGGCCCATCCTCACCATC ATCACACTGGAAGACTCCAGTGGTAATCTACTGGGACGGAACAGCTTT GAGGTGCATT-3.
(118) This template is chosen to explore the use of the sequencing system for the detection of clustered hot spot single base mutations. The potentially mutated bases are underlined (A, G, C and T) in the synthetic template. The synthetic template is immobilized on a sequencing chip or glass channels, then the loop primer is ligated to the immobilized template as described in
REFERENCES
(119) Antao V P, Lai S Y, Tinoco I Jr. (1991) A thermodynamic study of unusually stable RNA and DNA hairpins. Nucleic Acids Res. 19: 5901-5905. Axelrod V D, Vartikyan R M, Aivazashvili V A, Beabealashvili R S. (1978) Specific termination of RNA polymerase synthesis as a method of RNA and DNA sequencing. Nucleic Acids Res. 5(10): 3549-3563. Badman E R and Cooks R G. (2000) Cylindrical Ion Trap Array with Mass Selection by Variation in Trap Dimensions Anal. Chem. 72(20):5079-5086. Badman E R and Cooks R G. (2000) A Parallel Miniature Cylindrical Ion Trap Array. Anal. Chem. 72(14):3291-3297. Bowling J M, Bruner K L, Cmarik J L, Tibbetts C. (1991) Neighboring nucleotide interactions during DNA sequencing gel electrophoresis. Nucleic Acids Res. 19: 3089-3097. Burgess K, Jacutin S E, Lim D, Shitangkoon A. (1997) An approach to photolabile, fluorescent protecting groups. J. Org. Chem. 62(13): 5165-5168. Canard B, Cardona B, Sarfati R S. (1995) Catalytic editing properties of DNA polymerases. Proc. Natl. Acad. Sci. USA 92: 10859-10863. Caruthers M H. (1985) Gene synthesis machines: DNA chemistry and its uses. Science 230: 281-285. Chee M, Yang R, Hubbell E, Berno, A, Huang, X C., Stern D, Winkler, J, Lockhart D J, Morris M S, Fodor, S P. (1996) Accessing genetic information with high-density DNA arrays. Science. 274: 610-614. Cheeseman P C. Method For Sequencing Polynucleotides, U.S. Pat. No. 5,302,509, issued Apr. 12, 1994. Dizidic I, Carrol, D I, Stillwell, R N, and Horning, M G. (1975) Atmospheric pressure ionization (API) mass spectrometry: formation of phenoxide ions from chlorinated aromatic compounds Anal. Chem., 47:1308-1312. Fu D J, Tang K, Braun A, Reuter D, Darnhofer-Demar B, Little D P, O'Donnell M J, Cantor C R, Koster H. (1998) Sequencing exons 5 to 8 of the p53 gene by MALDI-TOF mass spectrometry. Nat Biotechnol. 16: 381-384. Fuji K, Nakano S; Fujita E. (1975) An improved method for methoxymethylation of alcohols under mild acidic conditions. Synthesis 276-277. Hobbs F W Jr, Cocuzza A J. Alkynylamino-Nucleotides. U.S. Pat. No. 5,047,519, issued Sep. 10, 1991. Hung S C; Ju J; Mathies R A; Glazer A N. (1996) Cyanine dyes with high absorption cross section as donor chromophores in energy transfer primers. Anal Biochem. 243(1): 15-27. Hyman E D, (1988) A new method of sequencing DNA. Analytical Biochemistry 174: 423-436. Ireland R E, Varney M D (1986) Approach to the total synthesis of chlorothricolide-synthesis of (+/)-19,20-dihydro-24-O-methylchlorothricolide, methyl-ester, ethyl carbonate. J. Org. Chem. 51: 635-648. Ju J, Glazer A N, Mathies R A. (1996) Cassette labeling for facile construction of energy transfer fluorescent primers. Nucleic Acids Res. 24: 1144-1148. Ju J, Ruan C, Fuller C W, Glazer A N Mathies R A. (1995) Energy transfer fluorescent dye-labeled primers for DNA sequencing and analysis. Proc. Natl. Acad. Sci. USA 92: 4347-4351. Kamal A, Laxman E, Rao N V. (1999) A mild and rapid regeneration of alcohols from their allylic ethers by chlorotrimethylsilane/sodium iodide. Tetrahedron letters 40: 371-372. Kheterpal I, Scherer J, Clark S M, Radhakrishnan A, Ju J, Ginther C L, Sensabaugh G F, Mathies R A. (1996) DNA Sequencing Using a Four-Color Confocal Fluorescence Capillary Array Scanner. Electrophoresis. 17: 1852-1859. Khoukhi N, Vaultier M, Carrie R. (1987) Synthesis and reactivity of methyl-azido butyrates and ethyl-azido valerates and of the corresponding acid chlorides as useful reagents for the aminoalkylation. Tetrahedron 43: 1811-1822. Lee L G, Connell C R, Woo S L, Cheng R D, Mcardle B F, Fuller C W, Halloran N D, Wilson R K. (1992) DNA sequencing with dye-labeled terminators and T7 DNA-polymerase-effect of dyes and dNTPs on incorporation of dye-terminators and probability analysis of termination fragments. Nucleic Acids Res. 20: 2471-2483. Lee L G, Spurgeon S L, Heiner C R, Benson S C, Rosenblum B B, Menchen S M, Graham R J, Constantinescu A, upadhya K G, Cassel J M, (1997) New energy transfer dyes for DNA sequencing. Nucleic Acids Res. 25: 2816-2822.
(120) Liu H. H., Felton C., Xue Q. F., Zhang B., Jedrzejewski P., Karger B. L. and Foret F. (2000) Development of multichannel Devices with an Array of Electrospray tips for high-throughput mass spectrometry. Anal. Chem. 72:3303-3310. Metzker M L, Raghavachari R, Richards S, Jacutin S E, Civitello A, Burgess K, Gibbs R A. (1994) Termination of DNA synthesis by novel 3-modified-deoxyribonucleoside 5-triphosphates. Nucleic Acids Res. 22: 4259-4267. O'Connor P M, Jackman J, Bae I, Myers T G, Fan S, Mutoh M, Scudiero D A, Monks A, Sausville E A, Weinstein J N, Friend S, Fornace A J Jr, Kohn K W. (1997) Characterization of the p53 tumor suppressor pathway in cell lines of the National Cancer Institute anticancer drug screen and correlations with the growth-inhibitory potency of 123 anticancer agents. Cancer Res. 57: 4285-4300. Olejnik J, Ludemann H C, Krzymanska-Olejnik E, Berkenkamp S, Hillenkamp F, Rothschild K J. (1999) Photocleavable peptide-DNA conjugates: synthesis and applications to DNA analysis using MALDI-MS. Nucleic Acids Res. 27: 4626-4631. Olejnik J, Sonar S, Krzymanska-Olejnik E, Rothschild K J. (1995) Photocleavable biotin derivatives: a versatile approach for the isolation of biomolecules. Proc. Natl. Acad. Sci. USA. 92: 7590-7594. Pelletier H, Sawaya M R, Kumar A, Wilson S H, Kraut J. (1994) Structures of ternary complexes of rat DNA polymerase , a DNA template-primer, and ddCTP. Science 264: 1891-1903. Pennisi E. (2000) DOE Team Sequences Three Chromosomes. Science 288: 417-419. Pillai V N R. (1980) Photoremovable Protecting Groups in Organic Synthesis. Synthesis 1-62. Prober J M, Trainor G L, Dam R J, Hobbs F W, Robertson C W, Zagursky R J, Cocuzza A J, Jensen M A, Baumeister K. (1987) A system for rapid DNA sequencing with fluorescent chain-terminating dideoxynucleotides. Science 238: 336-341. Rollaf F. (1982) Sodium-borohydride reactions under phase-transfer conditionsreduction of azides to amines. J. Org. Chem. 47: 4327-4329. Ronaghi M, Uhlen M, Nyren P. (1998) A sequencing Method based on real-time pyrophosphate. Science 281: 364-365. Rosenblum B B, Lee L G, Spurgeon S L, Khan S H, Menchen S M, Heiner C R, Chen S M. (1997) New dye-labeled terminators for improved DNA sequencing patterns. Nucleic Acids Res. 25: 4500-4504. Roses A. (2000) Pharmacogenetics and the practice of medicine. Nature. 405: 857-865. Salas-Solano O, Carrilho E, Kotler L, Miller A W, Goetzinger W, Sosic Z, Karger B L, (1998) Routine DNA sequencing of 1000 bases in less than one hour by capillary electrophoresis with replaceable linear polyacrylamide solutions. Anal. Chem. 70: 3996-4003. Saxon E and Bertozzi C R (2000) Cell surface engineering by a modified Staudinger reaction. Science 287: 2007-2010. Schena M, Shalon D, Davis, R. Brown P. O. (1995) Quantitative monitoring of gene expression patterns with a cDNA microarray. Science 270: 467-470. Simpson P C, Adam D R, Woolley T, Thorsen T, Johnston R, Sensabaugh G F, and Mathies R A. (1998) High-throughput genetic analysis using microfabricated 96-sample capillary array electrophoresis microplates. Proc. Natl. Acad. Sci. U.S.A. 95:2256-2261. Smith L M, Sanders J Z, Kaiser R J, Hughes P, Dodd C, Connell C R, Heiner C, Kent S B H, Hood L E. (1986) Fluorescence detection in automated DNA sequencing analysis. Nature 321: 674-679. Tabor S, Richardson C. C. (1987) DNA sequence analysis with a modified bacteriophage T7 DNA polymerase. Proc. Natl. Acad. Sci. U.S.A. 84: 4767-4771. Tabor S. & Richardson, C C. (1995) A single residue in DNA polymerases of the Escherichia coli DNA polymerase I family is critical for distinguishing between deoxy- and dideoxyribonucleotides. Proc. Natl. Acad. Sci. U.S.A. 92: 6339-6343. Turro N J. (1991) Modern Molecular Photochemistry; University Science Books, Mill Valley, Calif. Velculesu, V E, Zhang, I, Vogelstein, B. and Kinzler K W (1995) Serial Analysis of Gene Expression. Science 270: 484-487. Welch M B, Burgess K, (1999) Synthesis of fluorescent, photolabile 3-O-protected nucleoside triphosphates for the base addition sequencing scheme. Nucleosides and Nucleotides 18:197-201. Woolley A T, Mathies R A. (1994) Ultra-high-speed DNA fragment separations using microfabricated capillary array electrophoresis chips. Proc. Natl. Acad. Sci. USA. 91: 11348-11352. Woolley A T, Sensabaugh G F and Mathies R A. (1997) High-Speed DNA Genotyping Using Microfabricated Capillary Array Electrophoresis Chips, Anal. Chem. 69(11); 2181-2186. Yamakawa H, Ohara O. (1997) A DNA cycle sequencing reaction that minimizes compressions on automated fluorescent sequencers. Nucleic. Acids. Res. 25: 1311-1312. Zhang X H, Chiang V L, (1996) Single-stranded DNA ligation by T4 RNA ligase for PCR cloning of 5-noncoding fragments and coding sequence of a specific gene. Nucleic Acids Res. 24: 990-991. Zhang B., Liu H. Karger B L. Foret F. (1999) Microfabricated devices for capillary electrophoresis-electrospray mass spectrometry. Anal. Chem. 71:3258-3264. Zhu Z, Chao J, Yu H, Waggoner A S. (1994) Directly labeled DNA probes using fluorescent nucleotides with 3422.