Mutations Associated With Cystic Fibrosis

20170218452 ยท 2017-08-03

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention provides novel mutations identified in the cystic fibrosis transmembrane conductance regulator (CFTR) gene that can be used for a more accurate diagnosis of cystic fibrosis (CF) and CF related disorders. Methods for testing a sample obtained from a subject to determine the presence of one or more mutations in the CFTR gene are provided wherein the presence of one or more mutations indicates that the subject has CF or a CF related disorder, or is a carrier of a CFTR mutation.

Claims

1. A method comprising: detecting in a sample obtained from a human subject the presence of one or more of a 2957delT, 4089insT, 4374+2T>C, 3064A>T, or 246C>G mutation in a cystic fibrosis transmembrane conductance regulator (CFTR) gene or protein; and indicating that the subject has cystic fibrosis, or is at risk of developing cystic fibrosis when the subject is homozygous for at least one of the 2957delT, 4089insT, 4374+2T>C, 3064A>T, or 246C>G mutation, or is a carrier of cystic fibrosis when the subject is heterozygous for at least one of the 2957delT, 4089insT, 4374+2T>C, 3064A>T, or 246C>G mutation.

2. The method of claim 1, further comprising detecting one or more of a 269C>T, 2902G>T, 3814G>A, 502G>C, 1520G>T, 511-513 dup TTA, 978A>T, 843G>C, 829C>T, 4096-6C>T, 4375-7delT, 1586G>C, 875+4G>T, or 4005+3G>T mutation of the cystic fibrosis transmembrane conductance regulator (CFTR) gene or protein.

3. The method of claim 1, further comprising detecting one or more of a 2711T>C, 3891G>C, 2524C>T or 2894G>A mutation of the cystic fibrosis transmembrane conductance regulator (CFTR) gene or protein.

4. The method of claim 1, further comprising detecting one or more of a 405+10247C>T, 405+10255 del C, 1811+1643 G>T, 1812-13A>G, 2752-33insA, 3849+12192 G>A, 724G>A, 3899C>T, 3986C>T, 901G>A, 392T>C, 3463T>C, 1757G>A, 4025G>C, 4129G>T, 663T>G, 3200T>C, 4412T>C, 620A>C, 1738A>G, 3370A>C, 1129C>T, 2383C>T, 2761delTCT, 1106A>G or 622A>G mutation of the cystic fibrosis transmembrane conductance regulator (CFTR) gene or protein.

5. The method of claim 1, further comprising detecting a 1824delA mutation of the cystic fibrosis transmembrane conductance regulator (CFTR) gene or protein and indicating that the subject has cystic fibrosis, or is at risk of developing cystic fibrosis when the subject is homozygous for the 1824delA mutation, or is a carrier of cystic fibrosis when the subject is heterozygous for the 1824delA mutation.

6. A composition comprising a plurality of labeled nucleic acid molecules that each comprise a fragment of a cystic fibrosis transmembrane conductance regulator gene and that specifically hybridize to a mutant but not a wild-type cystic fibrosis transmembrane conductance regulator gene, wherein at least one of the labeled nucleic acid molecules contains a cystic fibrosis transmembrane conductance regulator 2957delT mutation, and wherein the label comprises one of a radionucleotide, a fluorophore, a chemiluminescent agent, a microparticle, an enzyme, a colorimetric label, a magnetic label, a hapten, a molecular beacon, or an aptamer beacon.

7. The composition of claim 6, wherein the plurality of labeled nucleic acid molecules that each comprise a fragment of a cystic fibrosis transmembrane conductance regulator gene and that specifically hybridize to a mutant but not a wild-type cystic fibrosis transmembrane conductance regulator gene contains at least one or more of a cystic fibrosis transmembrane conductance regulator 1824delA, 4089insT, 4374+2T>C, 3064A>T, or 246C>G mutation.

8. The composition of claim 6, wherein the plurality of labeled nucleic acid molecules that each comprise a fragment of a cystic fibrosis transmembrane conductance regulator gene and that specifically hybridize to a mutant but not a wild-type cystic fibrosis transmembrane conductance regulator gene contains at least one or more of a cystic fibrosis transmembrane conductance regulator 269C>T, 2902G>T, 3814G>A, 502G>C, 1520G>T, 511-513 dup TTA, 978A>T, 843G>C, 829C>T, 4096-6C>T, 4375-7delT, 1586G>C, 875+4G>T, or 4005+3G>T mutation.

9. The composition of claim 6, wherein the plurality of labeled nucleic acid molecules that each comprise a fragment of a cystic fibrosis transmembrane conductance regulator gene and that specifically hybridize to a mutant but not a wild-type cystic fibrosis transmembrane conductance regulator gene contains at least one or more of a cystic fibrosis transmembrane conductance regulator 2711T>C, 3891G>C, 2524C>T or 2894G>A mutation.

10. The composition of claim 6, wherein the plurality of labeled nucleic acid molecules that each comprise a fragment of a cystic fibrosis transmembrane conductance regulator gene and that specifically hybridize to a mutant but not a wild-type cystic fibrosis transmembrane conductance regulator gene contains at least one or more of a 405+10247C>T, 405+10255 del C, 1811+1643 G>T, 1812-13A>G, 2752-33insA, 3849+12192 G>A, 724G>A, 3899C>T, 3986C>T, 901G>A, 392T>C, 3463T>C, 1757G>A, 4025G>C, 4129G>T, 663T>G, 3200T>C, 4412T>C, 620A>C, 1738A>G, 3370A>C, 1129C>T, 2383C>T, 2761delTCT, 1106A>G or 622A>G cystic fibrosis transmembrane conductance regulator mutation.

11. A kit consisting of a plurality of labeled nucleic acid molecules that each comprise a fragment of a cystic fibrosis transmembrane conductance regulator gene and that specifically hybridize to a mutant but not a wild-type cystic fibrosis transmembrane conductance regulator gene, wherein at least one of the labeled nucleic acid molecules contains a cystic fibrosis transmembrane conductance regulator 2957delT mutation, wherein the label comprises one of a radionucleotide, a fluorophore, a chemiluminescent agent, a microparticle, an enzyme, a colorimetric label, a magnetic label, a hapten, a molecular beacon, or an aptamer beacon; and instructions for indicating that a subject has cystic fibrosis, or is at risk of developing cystic fibrosis when the subject is homozygous for the 2957delT mutation, or is a carrier of cystic fibrosis when the subject is heterozygous for the 2957delT mutation.

12. The kit of claim 11, wherein the plurality of labeled nucleic acid acid molecules that each comprise a fragment of a cystic fibrosis transmembrane conductance regulator gene and that specifically hybridize to a mutant but not a wild-type cystic fibrosis transmembrane conductance regulator gene contains a cystic fibrosis transmembrane conductance regulator 1824delA, 4089insT, 4374+2T>C, 3064A>T, or 246C>G mutation; and instructions for indicating that a subject has cystic fibrosis, or is at risk of developing cystic fibrosis when the subject is homozygous for the at least one or more of the 1824delA, 4089insT, 4374+2T>C, 3064A>T, or 246C>G mutation, or is a carrier of cystic fibrosis when the subject is heterozygous for the at least one or more of the 1824delA, 4089insT, 4374+2T>C, 3064A>T, or 246C>G mutation.

13. The kit of claim 11, wherein the plurality of labeled nucleic acid molecules that each comprise a fragment of a cystic fibrosis transmembrane conductance regulator gene and that specifically hybridize to a mutant but not a wild-type cystic fibrosis transmembrane conductance regulator gene contains a cystic fibrosis transmembrane conductance regulator 269C>T, 2902G>T, 3814G>A, 502G>C, 1520G>T, 511-513 dup TTA, 978A>T, 843G>C, 829C>T, 4096-6C>T, 4375-7delT, 1586G>C, 875+4G>T, or 4005+3G>T mutation; and instructions for indicating that a subject has cystic fibrosis, or is at risk of developing cystic fibrosis when the subject is homozygous for the at least one or more of the 269C>T, 2902G>T, 3814G>A, 502G>C, 1520G>T, 511-513 dup TTA, 978A>T, 843G>C, 829C>T, 4096-6C>T, 4375-7delT, 1586G>C, 875+4G>T, or 4005+3G>T mutation, or is a carrier of cystic fibrosis when the subject is heterozygous for the at least one or more of the 269C>T, 2902G>T, 3814G>A, 502G>C, 1520G>T, 511-513 dup TTA, 978A>T, 843G>C, 829C>T, 4096-6C>T, 4375-7delT, 1586G>C, 875+4G>T, or 4005+3G>T mutation.

14. The kit of claim 11, wherein the plurality of labeled nucleic acid molecules that each comprise a fragment of a cystic fibrosis transmembrane conductance regulator gene and that specifically hybridize to a mutant but not a wild-type cystic fibrosis transmembrane conductance regulator gene contains a cystic fibrosis transmembrane conductance regulator 2711T>C, 3891G>C, 2524C>T or 2894G>A mutation; and instructions for indicating that a subject has cystic fibrosis, or is at risk of developing cystic fibrosis when the subject is homozygous for the at least one or more of the 2711T>C, 3891G>C, 2524C>T or 2894G>A mutation, or is a carrier of cystic fibrosis when the subject is heterozygous for the at least one or more of the 2711T>C, 3891G>C, 2524C>T or 2894G>A mutation.

15. The kit of claim 11, wherein the plurality of labeled nucleic acid molecules that each comprise a fragment of a cystic fibrosis transmembrane conductance regulator gene and that specifically hybridize to a mutant but not a wild-type cystic fibrosis transmembrane conductance regulator gene contains a cystic fibrosis transmembrane conductance regulator 405+10247C>T, 405+10255 del C, 1811+1643 G>T, 1812-13A>G, 2752-33insA, 3849+12192 G>A, 724G>A, 3899C>T, 3986C>T, 901G>A, 392T>C, 3463T>C, 1757G>A, 4025G>C, 4129G>T, 663T>G, 3200T>C, 4412T>C, 620A>C, 1738A>G, 3370A>C, 1129C>T, 2383C>T, 2761delTCT, 1106A>G or 622A>G mutation; and instructions for indicating that a subject has cystic fibrosis, or is at risk of developing cystic fibrosis when the subject is homozygous for the at least one or more of the 405+10247C>T, 405+10255 del C, 1811+1643 G>T, 1812-13A>G, 2752-33insA, 3849+12192 G>A, 724G>A, 3899C>T, 3986C>T, 901G>A, 392T>C, 3463T>C, 1757G>A, 4025G>C, 4129G>T, 663T>G, 3200T>C, 4412T>C, 620A>C, 1738A>G, 3370A>C, 1129C>T, 2383C>T, 2761delTCT, 1106A>G or 622A>G mutation, or is a carrier of cystic fibrosis when the subject is heterozygous for the at least one or more of the 405+10247C>T, 405+10255 del C, 1811+1643 G>T, 1812-13A>G, 2752-33insA, 3849+12192 G>A, 724G>A, 3899C>T, 3986C>T, 901G>A, 392T>C, 3463T>C, 1757G>A, 4025G>C, 4129G>T, 663T>G, 3200T>C, 4412T>C, 620A>C, 1738A>G, 3370A>C, 1129C>T, 2383C>T, 2761delTCT, 1106A>G or 622A>G mutation.

Description

FIGURES

[0023] FIG. 1 is a genomic sequence of the CFTR gene according to an embodiment of the invention.

[0024] FIG. 2 is a cDNA sequence of CFTR according to an embodiment of the invention.

[0025] FIG. 3 is an amino acid sequence of CFTR according to an embodiment of the invention.

[0026] FIG. 4 is a nucleotide sequence of the 5 end of the CFTR gene according to an embodiment of the invention.

[0027] FIG. 5 is is a schematic of a system according to an embodiment of the invention.

DEFINITIONS

[0028] In order for the present invention to be more readily understood, certain terms are first defined. Additional definitions for the following terms and other terms are set forth throughout the specification.

[0029] In this application, the use of or means and/or unless stated otherwise. As used in this application, the term comprise and variations of the term, such as comprising and comprises, are not intended to exclude other additives, components, integers or steps. As used in this application, the terms about and approximately are used as equivalents. Any numerals used in this application with or without about/approximately are meant to cover any normal fluctuations appreciated by one of ordinary skill in the relevant art. In certain embodiments, the term approximately or about refers to a range of values that fall within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction (greater than or less than) of the stated reference value unless otherwise stated or otherwise evident from the context (except where such number would exceed 100% of a possible value).

[0030] Antibody: As used herein, the term antibody refers to a polypeptide consisting of one or more polypeptides substantially encoded by immunoglobulin genes or fragments of immunoglobulin genes. The recognized immunoglobulin genes include the kappa, lambda, alpha, gamma, delta, epsilon and mu constant region genes, as well as myriad immunoglobulin variable region genes. Light chains are typically classified as either kappa or lambda. Heavy chains are typically classified as gamma, mu, alpha, delta, or epsilon, which in turn define the immunoglobulin classes, IgG, IgM, IgA, IgD and IgE, respectively. A typical immunoglobulin (antibody) structural unit is known to comprise a tetramer. Each tetramer is composed of two identical pairs of polypeptide chains, each pair having one light (about 25 kD) and one heavy chain (about 50-70 kD). The N-terminus of each chain defines a variable region of about 100 to 110 or more amino acids primarily responsible for antigen recognition. The terms variable light chain (VL) and variable heavy chain (VH) refer to these light and heavy chains respectively. An antibody can be specific for a particular antigen. The antibody or its antigen can be either an analyte or a binding partner. Antibodies exist as intact immunoglobulins or as a number of well-characterized fragments produced by digestion with various peptidases. Thus, for example, pepsin digests an antibody below the disulfide linkages in the hinge region to produce F(ab)2, a dimer of Fab which itself is a light chain joined to VH-CH1 by a disulfide bond. The F(ab)2 may be reduced under mild conditions to break the disulfide linkage in the hinge region thereby converting the (Fab)2 dimer into an Fab monomer. The Fab monomer is essentially an Fab with part of the hinge region (see, Fundamental Immunology, W. E. Paul, ed., Raven Press, N.Y. (1993), for a more detailed description of other antibody fragments). While various antibody fragments are defined in terms of the digestion of an intact antibody, one of ordinary skill in the art will appreciate that such Fab fragments may be synthesized de novo either chemically or by utilizing recombinant DNA methodology. Thus, the term antibody, as used herein also includes antibody fragments either produced by the modification of whole antibodies or synthesized de novo using recombinant DNA methodologies. In some embodiments, antibodies are single chain antibodies, such as single chain Fv (scFv) antibodies in which a variable heavy and a variable light chain are joined together (directly or through a peptide linker) to form a continuous polypeptide. A single chain Fv (scFv) polypeptide is a covalently linked VH::VL heterodimer which may be expressed from a nucleic acid including VH- and VL-encoding sequences either joined directly or joined by a peptide-encoding linker. (See, e.g., Huston, et al. (1988) Proc. Nat. Acad. Sci. USA, 85:5879-5883, the entire contents of which are herein incorporated by reference.) A number of structures exist for converting the naturally aggregated, but chemically separated light and heavy polypeptide chains from an antibody V region into an scFv molecule which will fold into a three dimensional structure substantially similar to the structure of an antigen-binding site. See, e.g. U.S. Pat. Nos. 5,091,513 and 5,132,405 and 4,956,778.

[0031] Allele: As used herein, the term allele refers to different versions of a nucleotide sequence of a same genetic locus (e.g., a gene).

[0032] Allele specific primer extension (ASPE): As used herein, the term allele specific primer extension (ASPE) refers to a mutation detection method utilizing primers which hybridize to a corresponding DNA sequence and which are extended depending on the successful hybridization of the 3 terminal nucleotide of such primer. Typically, extension primers that possess a 3 terminal nucleotide which form a perfect match with the target sequence are extended to form extension products. Modified nucleotides can be incorporated into the extension product, such nucleotides effectively labeling the extension products for detection purposes. Alternatively, an extension primer may instead comprise a 3 terminal nucleotide which forms a mismatch with the target sequence. In this instance, primer extension does not occur unless the polymerase used for extension inadvertently possesses exonuclease activity.

[0033] Amplification: As used herein, the term amplification refers to any methods known in the art for copying a target nucleic acid, thereby increasing the number of copies of a selected nucleic acid sequence. Amplification may be exponential or linear. A target nucleic acid may be either DNA or RNA. Typically, the sequences amplified in this manner form an amplicon. Amplification may be accomplished with various methods including, but not limited to, the polymerase chain reaction (PCR), transcription-based amplification, isothermal amplification, rolling circle amplification, etc. Amplification may be performed with relatively similar amount of each primer of a primer pair to generate a double stranded amplicon. However, asymmetric PCR may be used to amplify predominantly or exclusively a single stranded product as is well known in the art (e.g., Poddar et al. Molec. And Cell. Probes 14:25-32 (2000)). This can be achieved using each pair of primers by reducing the concentration of one primer significantly relative to the other primer of the pair (e.g., 100 fold difference). Amplification by asymmetric PCR is generally linear. Additionally, methods such as real-time PCR may be utilized. A skilled artisan will understand that different amplification methods may be used together.

[0034] Animal: As used herein, the term animal refers to any member of the animal kingdom. In some embodiments, animal refers to humans, at any stage of development. In some embodiments, animal refers to non-human animals, at any stage of development. In certain embodiments, the non-human animal is a mammal (e.g., a rodent, a mouse, a rat, a rabbit, a monkey, a dog, a cat, a sheep, cattle, a primate, and/or a pig). In some embodiments, animals include, but are not limited to, mammals, birds, reptiles, amphibians, fish, insects, and/or worms. In some embodiments, an animal may be a transgenic animal, genetically-engineered animal, and/or a clone.

[0035] Approximately: As used herein, the term approximately or about, as applied to one or more values of interest, refers to a value that is similar to a stated reference value. In certain embodiments, the term approximately or about refers to a range of values that fall within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction (greater than or less than) of the stated reference value unless otherwise stated or otherwise evident from the context (except where such number would exceed 100% of a possible value).

[0036] Biological sample: As used herein, the term biological sample encompasses any sample obtained from a biological source. A biological sample can, by way of non-limiting example, include blood, amniotic fluid, sera, urine, feces, epidermal sample, skin sample, cheek swab, sperm, amniotic fluid, cultured cells, bone marrow sample and/or chorionic Convenient biological samples may be obtained by, for example, scraping cells from the surface of the buccal cavity. The term biological sample encompasses samples which have been processed to release or otherwise make available a nucleic acid or protein for detection as described herein. For example, a biological sample may include a cDNA that has been obtained by reverse transcription of RNA from cells in a biological sample. The biological sample may be obtained from a stage of life such as a fetus, young adult, adult, and the like. Fixed or frozen tissues also may be used.

[0037] Carrier: The term carrier, as used in the context of CF, refers to a person who is symptom-free but carries a CFTR mutation that can be passed to his/her children. Typically, a carrier has one CFTR allele that contains a disease causing mutation and a second allele that is normal or not disease-related. CF and CF related disorders are autosomal recessive diseases, meaning that a mutation produces little or no phenotypic effect when present in a heterozygous configuration with a non-disease related allele, but produces a disease state when a person is homozygous, i.e., both CFTR alleles are mutant alleles that contain the same disease causing mutation or compound heterozygous, i.e., both CFTR alleles are mutant alleles that contain two different disease-causing mutations. A carrier status is whether or not one is a carrier.

[0038] Coding sequence vs. non-coding sequence: As used herein, the term coding sequence refers to a sequence of a nucleic acid or its complement, or a part thereof, that can be transcribed and/or translated to produce the mRNA for and/or the polypeptide or a fragment thereof. Coding sequences include exons in a genomic DNA or immature primary RNA transcripts, which are joined together by the cell's biochemical machinery to provide a mature mRNA. The anti-sense strand is the complement of such a nucleic acid, and the encoding sequence can be deduced therefrom. As used herein, the term non-coding sequence refers to a sequence of a nucleic acid or its complement, or a part thereof, that is not transcribed into amino acid in vivo, or where tRNA does not interact to place or attempt to place an amino acid. Non-coding sequences include both intron sequences in genomic DNA or immature primary RNA transcripts, and gene-associated sequences such as promoters, enhancers, silencers, etc.

[0039] Complement: As used herein, the terms complement, complementary and complementarity, refer to the pairing of nucleotide sequences according to Watson/Crick pairing rules. For example, a sequence 5-GCGGTCCCA-3 has the complementary sequence of 5-TGGGACCGC-3. A complement sequence can also be a sequence of RNA complementary to the DNA sequence. Certain bases not commonly found in natural nucleic acids may be included in the complementary nucleic acids including, but not limited to, inosine, 7-deazaguanine, Locked Nucleic Acids (LNA), and Peptide Nucleic Acids (PNA). Complementary need not be perfect; stable duplexes may contain mismatched base pairs, degenerative, or unmatched bases. Those skilled in the art of nucleic acid technology can determine duplex stability empirically considering a number of variables including, for example, the length of the oligonucleotide, base composition and sequence of the oligonucleotide, ionic strength and incidence of mismatched base pairs.

[0040] Control: As used herein, the term control has its art-understood meaning of being a standard against which results are compared. Typically, controls are used to augment integrity in experiments by isolating variables in order to make a conclusion about such variables. In some embodiments, a control is a reaction or assay that is performed simultaneously with a test reaction or assay to provide a comparator. In one experiment, the test (i.e., the variable being tested) is applied. In the second experiment, the control, the variable being tested is not applied. In some embodiments, a control is a historical control (i.e., of a test or assay performed previously, or an amount or result that is previously known). In some embodiments, a control is or comprises a printed or otherwise saved record. A control may be a positive control or a negative control.

[0041] Crude: As used herein, the term crude, when used in connection with a biological sample, refers to a sample which is in a substantially unrefined state. For example, a crude sample can be cell lysates or biopsy tissue sample. A crude sample may exist in solution or as a dry preparation.

[0042] Deletion: As used herein, the term deletion encompasses a mutation that removes one or more nucleotides from a naturally-occurring nucleic acid.

[0043] Epitope: As used herein, the term epitope refers to a fragment or portion of a molecule or a molecule compound (e.g., a polypeptide or a protein complex) that makes contact with a particular antibody or antibody like proteins.

[0044] Familial history: As used herein, the term familial history typically refers to occurrence of events (e.g., CF disease, CF related disorder or CFTR mutation carrier) relating to an individual's immediate family members including parents and siblings. Sometimes, family history also may include grandparents.

[0045] Flanking: As used herein, the term flanking is meant that a primer hybridizes to a target nucleic acid adjoining a region of interest sought to be amplified on the target. The skilled artisan will understand that preferred primers are pairs of primers that hybridize 3 from a region of interest, one on each strand of a target double stranded DNA molecule, such that nucleotides may be add to the 3 end of the primer by a suitable DNA polymerase. For example, primers that flank mutant CTFR sequences do not actually anneal to the mutant sequence but rather anneal to sequence that adjoins the mutant sequence. In some cases, primers that flank a CFTR exon are generally designed not to anneal to the exon sequence but rather to anneal to sequence that adjoins the exon (e.g. intron sequence). However, in some cases, amplification primer may be designed to anneal to the exon sequence.

[0046] Genotype: As used herein, the term genotype refers to the genetic constitution of an organism. More specifically, the term refers to the identity of alleles present in an individual. Genotyping of an individual or a DNA sample refers to identifying the nature, in terms of nucleotide base, of the two alleles possessed by an individual at a known polymorphic site.

[0047] Heterozygous: As used herein, the term heterozygous or HET refers to an individual possessing two different alleles of the same gene. As used herein, the term heterozygous encompasses compound heterozygous or compound heterozygous mutant. As used herein, the term compound heterozygous refers to an individual possessing two different alleles. As used herein, the term compound heterozygous mutant refers to an individual possessing two different copies of an allele, such alleles are characterized as mutant forms of a gene. The term mutant as used herein refers to a mutated, or potentially non-functional form of a gene. (See mutations of the CFTR gene.)

[0048] Homozygous: As used herein, the term homozygous refers to an individual possessing two copies of the same allele. As used herein, the term homozygous mutant refers to an individual possessing two copies of the same allele, such allele being characterized as the mutant form of a gene. The term mutant as used herein refers to a mutated, or potentially non-functional form of a gene.

[0049] Hybridize: As used herein, the term hybridize or hybridization refers to a process where two complementary nucleic acid strands anneal to each other under appropriately stringent conditions. Oligonucleotides or probes suitable for hybridizations typically contain 10-100 nucleotides in length (e.g., 18- 50, 12-70, 10-30, 10-24, 18-36 nucleotides in length). Nucleic acid hybridization techniques are well known in the art. See, e.g., Sambrook, et al., 1989, Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Press, Plainview, N.Y. Those skilled in the art understand how to estimate and adjust the stringency of hybridization conditions such that sequences having at least a desired level of complementary will stably hybridize, while those having lower complementary will not. For examples of hybridization conditions and parameters, see, e.g., Sambrook, et al., 1989, Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Press, Plainview, N.Y.; Ausubel, F. M. et al. 1994, Current Protocols in Molecular Biology. John Wiley & Sons, Secaucus, N.J.

[0050] Insertion or addition: As used herein, the term insertion or addition refers to a change in an amino acid or nucleotide sequence resulting in the addition of one or more amino acid residues or nucleotides, respectively, as compared to the naturally occurring molecule.

[0051] In vitro: As used herein, the term in vitro refers to events that occur in an artificial environment, e.g., in a test tube or reaction vessel, in cell culture, etc., rather than within a multi-cellular organism.

[0052] In vivo: As used herein, the term in vivo refers to events that occur within a multi-cellular organism such as a non-human animal.

[0053] Isolated: As used herein, the term isolated refers to a substance and/or entity that has been (1) separated from at least some of the components with which it was associated when initially produced (whether in nature and/or in an experimental setting), and/or (2) produced, prepared, and/or manufactured by the hand of man. Isolated substances and/or entities may be separated from at least about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 98%, about 99%, substantially 100%, or 100% of the other components with which they were initially associated. In some embodiments, isolated agents are more than about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, substantially 100%, or 100% pure. As used herein, a substance is pure if it is substantially free of other components. As used herein, the term isolated cell refers to a cell not contained in a multi-cellular organism.

[0054] Labeled: The terms labeled and labeled with a detectable agent or moiety are used herein interchangeably to specify that an entity (e.g., a nucleic acid probe, antibody, etc.) can be visualized, for example following binding to another entity (e.g., a nucleic acid, polypeptide, etc.). The detectable agent or moiety may be selected such that it generates a signal which can be measured and whose intensity is related to (e.g., proportional to) the amount of bound entity. A wide variety of systems for labeling and/or detecting proteins and peptides are known in the art. Labeled proteins and peptides can be prepared by incorporation of, or conjugation to, a label that is detectable by spectroscopic, photochemical, biochemical, immunochemical, electrical, optical, chemical or other means. A label or labeling moiety may be directly detectable (i.e., it does not require any further reaction or manipulation to be detectable, e.g., a fluorophore is directly detectable) or it may be indirectly detectable (i.e., it is made detectable through reaction or binding with another entity that is detectable, e.g., a hapten is detectable by immunostaining after reaction with an appropriate antibody comprising a reporter such as a fluorophore). Suitable detectable agents include, but are not limited to, radionucleotides, fluorophores, chemiluminescent agents, microparticles, enzymes, colorimetric labels, magnetic labels, haptens, molecular beacons, aptamer beacons, and the like.

[0055] Multiplex PCR: As used herein, the term multiplex PCR refers to amplification of two or more regions which are each primed using a distinct primers pair.

[0056] Multiplex ASPE: As used herein, the term multiplex ASPE refers to an assay combining multiplex PCR and allele specific primer extension for detecting polymorphisms. Typically, multiplex PCR is used to first amplify regions of DNA that will serve as target sequences for ASPE primers. See the definition of allele specific primer extension.

[0057] Mutations of the CFTR gene: As used herein, the term mutations of the CFTR gene refers to one or more abnormal nucleic acid sequences as compared to a wild-type CFTR gene sequence. The mutations of the CFTR gene are also referred to as mutant CF sequences. Mutations of the CFTR gene encompass substitutions (e.g., single nucleotide polymorphisms (SNP)), deletions, insertions, additions, and/or duplications.

[0058] Primer: As used herein, the term primer refers to a short single-stranded oligonucleotide capable of hybridizing to a complementary sequence in a nucleic acid sample. Typically, a primer serves as an initiation point for template dependent DNA synthesis. Deoxyribonucleotides can be added to a primer by a DNA polymerase. In some embodiments, such deoxyribonucleotides addition to a primer is also known as primer extension. The term primer, as used herein, includes all forms of primers that may be synthesized including peptide nucleic acid primers, locked nucleic acid primers, phosphorothioate modified primers, labeled primers, and the like. A primer pair or primer set for a PCR reaction typically refers to a set of primers typically including a forward primer and a reverse primer. As used herein, a forward primer refers to a primer that anneals to the anti-sense strand of dsDNA. A reverse primer anneals to the sense-strand of dsDNA.

[0059] Polymorphism: As used herein, the term polymorphism refers to the coexistence of more than one form of a gene or portion thereof.

[0060] Pure or substantially pure: As used herein, the term pure or substantially pure refers to a compound, e.g., a protein or polypeptide that has been separated from components which naturally accompany it. Typically, a compound is substantially pure when at least 10%, more preferably at least 20%, more preferably at least 50%, more preferably at least 60%, more preferably at least 75%, more preferably at least 90%, and most preferably at least 99% of the total material (by volume, by wet or dry weight, or by mole percent or mole fraction) in a sample is the compound of interest. Purity can be measured by any appropriate method, e.g., in the case of polypeptides by column chromatography, gel electrophoresis or HPLC analysis. A compound, e.g., a protein, is also substantially purified when it is essentially free of naturally associated components or when it is separated from the native contaminants which accompany it in its natural state.

[0061] Real-time PCR: As used herein, the term real-time PCR refers to quantitative real time polymerase chain reaction (Q-PCR/qPCR/qrt-PCR) or kinetic polymerase chain reaction (KPCR), is a laboratory technique based on the PCR, which is used to amplify and simultaneously quantify a targeted DNA molecule. It enables both detection and quantification (as absolute number of copies or relative amount when normalized to DNA input or additional normalizing genes) of one or more specific sequences in a DNA sample.

[0062] Sense strand vs. anti-sense strand: As used herein, the term sense strand refers to the strand of double-stranded DNA (dsDNA) that includes at least a portion of a coding sequence of a functional protein. As used herein, the term anti-sense strand refers to the strand of dsDNA that is the reverse complement of the sense strand.

[0063] Specific: As used herein, the term specific, when used in connection with an oligonucleotide primer, refers to an oligonucleotide or primer, under appropriate hybridization or washing conditions, is capable of hybridizing to the target of interest and not substantially hybridizing to nucleic acids which are not of interest. Higher levels of sequence identity are preferred and include at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity. In some embodiments, a specific oligonucleotide or primer contains at least 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 35, 40, 45, 50, 55, 60, 65, 70, or more bases of sequence identity with a portion of the nucleic acid to be hybridized or amplified when the oligonucleotide and the nucleic acid are aligned.

[0064] Subject: As used herein, the term subject refers to a human or any non-human animal. A subject can be a patient, which refers to a human presenting to a medical provider for diagnosis or treatment of a disease. A human includes pre and post natal forms. Particularly preferred subjects are humans being tested for the existence of a CFTR carrier state, CF disease or CF related disorder state.

[0065] Substantially: As used herein, the term substantially refers to the qualitative condition of exhibiting total or near-total extent or degree of a characteristic or property of interest. One of ordinary skill in the biological arts will understand that biological and chemical phenomena rarely, if ever, go to completion and/or proceed to completeness or achieve or avoid an absolute result. The term substantially is therefore used herein to capture the potential lack of completeness inherent in many biological and chemical phenomena.

[0066] Substantially complementary: As used herein, the term substantially complementary refers to two sequences that can hybridize under stringent hybridization conditions. The skilled artisan will understand that substantially complementary sequences need not hybridize along their entire length. In some embodiments, stringent hybridization conditions refer to hybridization conditions at least as stringent as the following: hybridization in 50% formamide, 5SSC, 50 mM NaH.sub.2PO.sub.4, pH 6.8, 0.5% SDS, 0.1 mg/mL sonicated salmon sperm DNA, and 5Denhart's solution at 42 C., overnight; washing with 2SSC, 0.1% SDS at 45 C.; and washing with 0.2SSC, 0.1% SDS at 45 C. In some embodiments, stringent hybridization conditions should not allow for hybridization of two nucleic acids which differ over a stretch of 20 contiguous nucleotides by more than two bases.

[0067] Substitution: As used herein, the term substitution refers to the replacement of one or more amino acids or nucleotides by different amino acids or nucleotides, respectively, as compared to the naturally occurring molecule.

[0068] Suffering from: An individual who is suffering from a disease, disorder, and/or condition has been diagnosed with or displays one or more symptoms of the disease, disorder, and/or condition.

[0069] Susceptible to: An individual who is susceptible to a disease, disorder, and/or condition has not been diagnosed with the disease, disorder, and/or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and/or condition may not exhibit symptoms of the disease, disorder, and/or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and/or condition will develop the disease, disorder, and/or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and/or condition will not develop the disease, disorder, and/or condition.

[0070] Wild-type: As used herein, the term wild-type refers to the typical or the most common form existed in nature. For example, a wild-type CFTR gene or protein refers to the typical or the most common form of CFTR gene or protein existed in a natural population. As used herein, wild-type is used interchangeably with naturally-occurring. In some embodiment, a wild-type CFTR gene or a locus thereof, refers to the CFTR gene sequence which is found in NCBI GenBank locus ID M58478 (HUMCFTC) (SEQ ID NO:4) (FIG. 4). The CFTR gene is located on chromosome 7, which may be found in NCBI GenBank locus AC000111 and AC000061, the contents of which are incorporated herein in their entirety by reference. The cDNA for the CFTR gene is found in Audrezet et al., Hum. Mutat. (2004) 23 (4), 343-357.

DETAILED DESCRIPTION

[0071] The present invention provides, among other things, methods, products and systems that use novel mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene in screening and/or testing for CF and CF related diseases, disorders or conditions. For example, the novel mutations provided herein can be used to assist in clinical diagnosis of CF disease, CF related disease, disorder or condition, or carrier status and for genetic counseling (e.g., for evaluation of an individual's risk for developing CF or being a carrier of a CFTR mutation). The novel mutations provided herein can be used alone or in combination with other known CFTR mutations as part of a panel of CFTR mutations.

[0072] Various aspects of the invention are described in detail in the following sections. The use of sections is not meant to limit the invention. Each section can apply to any aspect of the invention. In this application, the use of or means and/or unless stated otherwise.

Novel Mutations in the CFTR Gene

[0073] The CFTR gene was mapped to chromosome 7 and described in, for example, U.S. Pat. No. 6,201,107 and U.S. Pat. No. 5,776,677, the disclosures of which are incorporated by reference herein in their entirety. The CFTR genomic sequence is described in GenBank Accession Number NC_000007 (range: 117120016 . . . 117308718; the entire contents of which are herein incorporated by reference) (SEQ ID NO:1) (FIG. 1). The CFTR gene contains 27 exons. The exons are numbered 1, 2, 3, 4, 5, 6a, 6b, 7, 8, 9, 10, 11, 12, 13, 14a, 14b, 15, 16, 17a, 17b, 18, 19, 20, 21, 22, 23, and 24. The CFTR cDNA sequence is described in GenBank Accession Number AR016032.1 (SEQ ID NO:2) (FIG. 2).

[0074] The CFTR protein is described in, for example, U.S. Pat. No. 5,543,399, the disclosure of which is incorporated by reference herein in its entirety. The CFTR protein sequence is also described in GenBank Accession Number AAC90840.1 (SEQ ID NO:3) (FIG. 3).

[0075] As described in Example 1, the inventors of the present application identified various novel mutations in the CFTR gene (Table 5). These mutations were identified by sequence analysis of the CFTR gene in specimens submitted for clinical testing obtained from individuals who were known to be affected with CF or likely to be a carrier because of familial history, or suspected to be affected with CF based on other CF testing (see Clinical Indication listed in Table 5). The mutations were identified by comparing the CFTR gene sequence from patient samples to the wild-type CFTR gene or protein sequence (see SEQ ID NO:1-3). As shown in Table 5, patients carrying these mutations were from different ethnic groups including Caucasians, African Americans, Hispanics, and Asians. Thus, these mutations may be particularly useful for developing more effective genetic testing for patients from non-Caucasian racial groups.

[0076] Novel mutations described herein are located in introns (e.g., intron 3, intron 6a, intron 11, intron 14a, intron 19, intron 20, intron 21, and intron 23) and exons (e.g., exon 2, exon 3, exon 4, exon 5, exon 6a, exon 6b, exon 7, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14a, exon 14b, exon 15, exon 16, exon 17a, exon 17b, exon 19, exon 20, exon 21, exon 22, and exon 24). Some of the novel mutations are nonsense mutations, i.e., mutations that result in a stop codon. Some of the novel mutations are missense mutations, i.e., mutations that result in amino acid substitutions. Some of the novel mutations cause in-frame insertions and/or deletions. Some of the novel mutations delete one or more nucleotides in such a manner as to lead to a shift in the reading frame. Some of the novel mutations alter the sequence at a splice junction, for example, consensus splice site ag/gt or other splice sites. Thus, most of the novel mutations described herein are likely to disrupt CFTR gene or protein expression or function.

[0077] The ACMG recommendations for standards for interpretation and reporting of sequence variations: Revisions 2007 (Richards S C et al. Genetics in Medicine, 10:294-300, which is incorporated herein by reference), provides interpretive categories and definitions of sequence variations which can be used, along with additional test results and clinical information to classify the novel mutations described herein into the following groups.

[0078] Group I: Patient has a novel sequence change that can be classified as category 2 according to the ACMG guidelines (i.e., nonsense, frame shift (FS), consensus splice site ag/gt). Patient has another well established CF disease causing mutation (i.e. F508, W1282X, etc). Patient indication is suspected of having CF, known to be affected with CF or identified through newborn screening. The Group I mutations, which are of particular interest, are shown in Table 1 and these mutations are expected to cause CF or CF related diseases, disorders or conditions.

[0079] Group IIA: Patient has novel sequence change that can be classified as category 3 according to the ACMG guidelines (i.e., missense, in-frame ins/del, other splice site mutations, etc). Patient has another well established CF disease causing mutation (i.e., F508, W1282X, etc.) Patient is suspected of having CF, known to be affected with CF, or identified through positive newborn screening. The Group IIA mutations are shown in Table 2 (under subsection Group IIA).

[0080] Group IIB: Patent has a novel sequence change that can be classified as category 3 according to the ACMG guidelines (i.e., missense, in-frame ins/del, other splice site mutations, etc). Patient is suspected of having CF, known to be affected with CF, or identified through positive newborn screening. The Group JIB mutations are shown in Table 2 (under subsection Group IIB).

[0081] Group III: Patient has novel sequence change that can be classified as category 3 according to the ACMG guidelines (i.e., missense, in-frame insertions/deletions, other splice site mutations, etc). Patient has another well established CF disease causing mutation (i.e. F508, W1282X, etc). Patient indication is suspected of having CF, known to be affected with CF, or identified through newborn screening. Patient has an additional change(s) of unknown clinical significance. The Group III mutations are shown in Table 3.

[0082] Group IV: Mutations other than the Group I, II, and III mutations identified above. The Group IV mutations are shown in Table 4.

[0083] Novel CFTR mutations according to the invention however are not limited to the specific nucleotide or amino acid variations identified in Tables 1-4 and should encompass any abnormal nucleotides or amino acid residues, as compared to the wild-type CFTR gene or protein sequences, that may be present at any of the positions identified in Tables 1-4.

TABLE-US-00001 TABLE1 Sequence Typeof AA Other Change mutation Change Ethnicity Mutations ClinicalInformation Exon GroupImutatations 1824delA Frame- n/a Caucasian F508del Mutationwasidentifiedina22yearold e12 shift patientwithaknowndiagnosisofCF. (FS) Thispatientcarriedasecondmutation knowntocauseCF(F508del). 2957delT FS n/a Caucasian F508del Mutationwasidentifiedina1yearold e15 patientwithaknowndiagnosisofCF. Thepatientcarriedasecondmutation knowntocauseCF(F508del). 4089ins4 FS n/a Caucasian F508del Mutationwasidentifiedina7yearold e21 patientwithaknowndiagnosisofCF. Thepatienthadapositivesweatchloride test.Thepatientcarriedasecond mutationknowntocauseCF(F508del). 4374+ Splice n/a 1. 1. Patient#1:Mutationwasidentifiedina i23 2T> C site Caucasian F508del 45yearoldpatientwithasuspected mutation 2. 2. diagnosisofCF.Thepatientcarrieda Caucasian F508del secondmutationknowntocauseCF (F508del). Patient#2:Mutationwasidentifiedina 52yearoldpatientwithasuspected diagnosisofCF.Thepatientcarrieda secondmutationknowntocauseCF (F508del). 3064A> T Nonsense K978X African Q1042X Mutationwasidentifiedina26yearold e16 American patientwithaknowndiagnosisofCF. Thepatientcarriedasecondmutation likelytocauseCFQ1042X. 246C> G Nonsense Y38X Caucasian F508del Mutationwasidentifiedina1monthold e2 patientwithasuspecteddiagnosisofCF. Thepatienthadapositivesweatchloride test.Thepatientcarriedasecond mutationknowntocauseCF(F508del). GroupIIA 269C> T Missense A46V 1) 1)3849+ Patient#1:Mutationwasidentifiedina e2 (MS) Caucasian 12192G> A 32yearoldpatientwhowastesteddueto 2)Black 2)F508del abnormalitiesfoundonfetalultrasound. 3)African 3)none Thepatientcarriedasecondmutationof American unknownclinicalsignificance (3849+ 12192G> A). Patient#2:Mutationwasidentifiedina2 montholdpatientwhowastestedbased onfollow-upforapositivenewborn screen.Thepatientcarriedasecond mutationknowntocausecysticfibrosis (F508del). Patient#3:Mutationwasidentifiedina 24yearoldpatientwhowastestedasa parentalfollow-uptoapositivenewborn screen. 2902G> T MS D924Y Caucasian F508del Mutationwasidentifiedina1monthold e15 patientwithasuspecteddiagnosisofCF. Thepatientalsohadapositivesweat chloridetestandcarriedasecond mutationknowntocauseCF(F508del) 3814G> A MS E1228K Caucasian F508del Mutationwasidentifiedina1monthold e19 patientwithasuspecteddiagnosisofCF. Thepatienthadaborderlinesweat chloridetest.Thepatientcarrieda secondmutationknowntocauseCF (F508del). 502G> C MS G124R Not F508del Mutationwasidentifiedina2monthold e4 Provided patientwithasuspecteddiagnosisofCF. Thepatienthadapositivesweatchloride test.Thepatientcarriedasecond mutationknowntocauseCF(F508del). 1520G> T MS G463V Caucasian F508del Mutationwasidentifiedina17yearold e9 patientwithaknowndiagnosisofCF. Patientcarriedasecondmutationknown tocauseCF(F508del). 511_513 Inframe L127dup Caucasian, W1282X Mutationwasidentifiedinanewborn e4 dupTTA dupli- Asian withasuspecteddiagnosisofCF.The cation patienthadclinicalsymptomsofCF includingasapositivesweatchloride test,meconiumileus,echogenicbowel, andpancreaticinsufficiency.Thepatient carriedasecondmutationknownto causeCF(W1282X). 978A> T MS E282D 1.not 1.3120+ Patient#1:Mutationwasidentifiedina e6b provided 1G> A 10yearoldpatientwithasuspected 2)none 2.none diagnosisofCF.Thepatienthada provided positivesweatchloridetest.Thepatient carriedasecondmutationknownto causeCF(3120+ 1G> A). Patient#2:Mutationwasidentifiedina4 yearoldpatientwithasuspected diagnosisofCFandafamilyhistoryof CF. 843G> C MS Q237H Caucasian F508del Mutationwasidentifiedina2monthold e6a patientwithaknowndiagnosisofCF. Thepatientcarriedasecondmutation knowntocauseCF(F508del). 829C> T MS L233F Caucasian D1152H Mutationwasidentifiedina1monthold e6a patientwhowastestedfollowinga positivenewbornscreen.Thepatient carriedasecondmutationknownto causeCF(D1152H). 4096-6C> T Splice None Caucasian F508del Mutationwasidentifiedina58yearold i21 site patientwithasuspecteddiagnosisofCF. mutation Thepatientcarriedasecondmutation knowntocauseCF(F508del). 4375-7delT Splice None Caucasian F508del Mutationwasidentifiedina6yearold i23 site patientwithasuspecteddiagnosisofCF. mutation Patienthasafamilyhistory,aborderline sweatchloridetestandrecurrent pneumonia.Thepatientcarriedasecond mutationknowntocauseCF(F508del). 1586G> C MS 5485T Caucasian 51235R Mutationwasidentifiedina2yearold e10 patientwithasuspecteddiagnosisofCF. Thepatientcarriedasecondmutation S1235R(3837T> G)whichhasbeen reportedinindividualswithvaryingCF phenotypes. 875+ G> T Splice n/a African none Mutationwasidentifiedina1monthold i6a site American patientwhohadapositivenewborn mutation screeningtest. 4005+ Splice n/a Caucasian none Mutationwasidentifiedina40yearold i20 3G> T site patientwhowastestedtodetermineif mutation theywereacarrier,therewasnofamily historyofCF.

[0084] text missing or illegible when filed

TABLE-US-00002 TABLE3 GroupIIIMutations Sequence Typeof AA Other Change mutation Change Ethnicity Mutations ClinicalInformation Exon 2711T> C MS 1860T Caucasian F508del, Mutationwasidentifiedina58yearold e14a E528E womanwithasuspecteddiagnosisofCF. Thepatientcarriedasecondmutation knowntocauseCF(F508del)andan additionalmutationofunknownclinical significance(E528E).. 3891G> C MS L1253F Not G85E,L15P Mutationwasidentifiedina32yearold e20 provided patientwithaknowndiagnosisofCF. Thepatientcarriedasecondmutation knowntocauseCF(G85E)andan additionalmutationofunknownclinical significance(L15P). 2524C> T MS P798S African F508del, Mutationwasidentifiedina5yearold e13 American R74W, patientwithasuspecteddiagnosisofCF. G921E, Thepatienthadapositivesweatchloride D1270N test.Thispatientcarriedasecond mutationknowntocauseCF(F508del) andthreeadditionalmutationsof unknownclinicalsignificance(R74W, G921E,D1270N). 2894G> A MS G921E African F508del, Mutationwasidentifiedina5yearold e15 American R74W, patientwithasuspecteddiagnosisofCF. P798S, Thepatienthadapositivesweatchloride D1270N test.Thispatientcarriedasecond mutationknowntocauseCF(F508del) andthreeadditionalmutationsof unknownclinicalsignificance(R74W, P789S,D1270N).

TABLE-US-00003 TABLE4 GroupIVMutations Sequence Typeof AA Other Change mutation Change Ethnicity Mutations ClinicalInformation Exon 405+ Possible n/a Caucasian F508del Mutationwasidentifiedina35yearold i3 10247C> T splice patientwhowastestedtodetermineif site theywereacarrier,therewasnofamily mutation historyofCF.Thispatientcarrieda secondmutationknowntocauseCF (F508del). 405+ 10255 Possible n/a Not F508del, Mutationwasidentifiedina10yearold i3 delC splice Provided 124del23bp patient.Thepatientcarriestwomutations site knowtocauseCF(F508deland mutation 124del23). 1811+ Possible n/a 1. 1.F508del Patient#1:Mutationwasidentifiedina1 i11 1643G> T splice Hispanic yearoldpatientwithaknowndiagnosis site 2. 2.F508del ofCF.Patienthadapositivesweat mutation Hispanic chloridetest.Thepatientcarrieda 3.Not 3.none secondmutationknowntocauseCF provided (F508del). Patient#2:Mutationwasidentifiedina6 yearoldpatientwithaknowndiagnosis ofCF.Thepatientcarriedasecond mutationknowtocauseCF(F508del). Patient#3:Mutationwasidentifiedinan 8montholdpatientwithasuspected diagnosisofCF. 1812- Splice n/a Caucasian none Mutationwasidentifiedina15yearold i11 13A> G site patientwithasuspecteddiagnosisofCF. mutation Thepatienthaschronicsinusitis. 2752- Possible n/a African F693L Mutationwasidentifiedina6yearold i14a 33insA splice American patientwithaknowndiagnosisofCF. site Thepatientcarriesasecondmutationof mutation unknownclinicalsignificance(F693L). 3849+ Possible n/a Caucasian A46V Mutationwasidentifiedina32yearold i19 12192G> A splice patientwhowastesteddueto site abnormalitiesfoundonfetalultrasound. mutation Thepatientcarriedanadditional mutationofknownclinicalsignificance (A46V). 724G> A MS A198T Hispanic none Mutationwasidentifiedina4monthold e6a patientwithasuspecteddiagnosisofCF. 3899C> T MS A1256V Guyanese none Mutationwasidentifiedina45yearold e20 patientwhowastestedtodetermineif theywereacarrier,therewasnofamily historyofCF. 3986C> T MS A1285V Not none Mutationwasidentifiedina23yearold e20 Provided patientwhowastestedtodetermineif theywereacarrier,therewasnofamily historyofCF. 901G> A MS E257K Hispanic none Mutationwasidentifiedina4yearold e6b patientwithasuspecteddiagnosisofCF. Thepatienthasasthmaandrecurring pneumonia. 392T> C MS F875 Not none Themutationwasidentifiedina1month e3 Provided oldpatientwithasuspecteddiagnosisof CF. 3463T> C MS F1111L Hispanic none Mutationwasidentifiedina6yearold e17b patientwithasuspecteddiagnosisofCF. Thepatienthasasthma 1757G> A MS G542E Hispanic none Mutationwasidentifiedina25yearold e11 patientwhowastestedtodetermineif theywereacarrier,therewasnofamily historyofCF.Thepatientcarried2 copiesofG542E.. 4025G> C MS G1298A Asian G970D, Mutationwasidentifiedina34yearold e21 Q1352H patientwithcongenitalabsenceofthe vasdeferens.Thepatientcarriedtwo othermutationsofunknownclinical significance(G970DandQ1352H) 4129G> T MS G1333W Not none Mutationwasidentifiedinan8yearold e22 Provided patientwithasuspecteddiagnosisofCF. Patienthadrecurrentrespiratory infectionsandchroniccough. 663T> G MS I177M Caucasian none Mutationwasidentifiedina34yearold e5 patientwhowastestedtodetermineif theywereacarrier,therewasnofamily historyofCF. 3200T> C MS I1023T Hispanic none Mutationwasidentifiedina34yearold e17a patientwhowastestedtodetermineif theywereacarrier,therewasnofamily historyofCF. 4412T> C MS I1427T Asian S1444S Mutationwasidentifiedina34yearold e24 patientwhowastestedtodetermineif theywereacarrier,therewasnofamily historyofCF.Thepatientcarriedanother mutationthatisconsideredlikelytobe clinicallybenign(S144S). 620A> C MS K163T Caucasian none Mutationwasidentifiedina32yearold e4 patientwithafamilyhistoryofCF. 1738A> G MS K536 Hispanic I488I Mutatinwasidentifiedina19 e11 yearoldpatientwho'ssonhada positivenewbornscreeningtest. Thepatientcarriedanother mutationthatisconsideredlikely tobeclinicallybenign(I1488I).. 3370A> C MS K1080Q Caucasian none Mutationwasidentifedina9 e17b yearoldpatientwithasuspected diagnosisofCF.Thepatiendhad asthmaandfailuretothrive. 1129C> T MS L33F Asian none Mutationwasidentifedina37 e7 yearoldpatientwhotestedto determindiftheywereacarrier, therewasnofamilyhistoryofCF. 2383C> T MS R751C Caucasian 2183 Mutationwasidentifedina36 e13 delAA> G yaroldpatientwhowasbeing testedduetoapartnerbeingaCF carrier.Thepatiendalsocarrieda secondmutationknowntocause CF(2183delAA> G). 2761delTCT Inframe S877del Caucasian F508del, Mutationwasidentiedin1 e14b deletion C1152H montholdpatientwhohada positivesweatchloridetest.The patientcarriedtwoadditional mutationsknowntocauseCF (F508delandD1125H). 1106A> G MS Y325C Caucasian R334W Mutationwasidentifedina35 c7 yearoldpatientwhowastestedto determineiftheywereacarrier, therewasnofamilyhistoryofCF. Patientcarriedasecondmutation knowntocauseCF(R334W). 622A> G MS T164A Caucasian none Mutationwasidentiiedina3 e5 montholdpatientwithasuspected diagnosisofCF.

Detection of CFTR Mutations

[0085] A variety of methods known in the art can be used to detect CFTR gene mutations disclosed in the present invention. For example, methods that have been used to detect previously identified CFTR gene mutations have been described and are adaptable for use with the present invention. See e.g., Audrezet et al., Genomic rearrangements in the CFTR gene: extensive allelic heterogeneity and diverse mutational mechanisms Hum Mutat. 2004 April; 23(4):343-57; PCT WO 2004/040013 A1 and corresponding US application No. 20040110138; titled Method for the detection of multiple genetic targets by Spiegelman and Lem; US patent application No. 20030235834; titled Approaches to identify cystic fibrosis by Dunlop et al.; and US patent application No. 20040126760 titled Novel compositions and methods for carrying out multiple PCR reactions on a single sample by N. Broude, the entire contents of each of which are herein incorporated by reference.

Nucleic Acid Analyses

[0086] In certain embodiments, CFTR gene mutations disclosed herein are detected at the nucleic acid level. For example, nucleic acid can be analyzed by sequencing, hybridization, PCR amplification, restriction enzyme digestion, primer extension such as single-base primer extension or multiplex allele-specific primer extension (ASPE).

[0087] Nucleic acid analyses can be performed on genomic DNA, messenger RNAs, and/or cDNA. In many embodiments, nucleic acids are extracted from a biological sample. In some embodiments, nucleic acids are analyzed without having been amplified. In some embodiments, nucleic acids are amplified using techniques known in the art (such as polymerase chain reaction (PCR)) and amplified nucleic acids are used in subsequent analyses. Multiplex PCR, in which several amplicons (e.g., from different genomic regions) are amplified at once using multiple sets of primer pairs, may be employed. Additionally, methods such as real-time PCR, as are known in the art, may be used to perform nucleic acid analysis.

[0088] In some embodiments, nucleic acids are amplified in a manner such that the amplification product for a wild-type allele differs in size from that of a mutant allele. Thus, presence or absence of a particular mutant allele can be determined by detecting size differences in the amplification products, e.g., on an electrophoretic gel. For example, deletions or insertions of CFTR gene regions may be particularly amenable to using size-based approaches.

[0089] Certain exemplary nucleic acid analysis methods are described in detail below.

[0090] Allele-Specific Amplification

[0091] In some embodiments, CFTR gene mutations are detected using an allele-specific amplification assay. This approach is variously referred to as PCR amplification of specific allele (PASA) (Sarkar, et al., 1990 Anal. Biochem. 186:64-68), allele-specific amplification (ASA) (Okayama, et al., 1989 J. Lab. Clin. Med. 114:105-113), allele-specific PCR (ASPCR) (Wu, et al. 1989 Proc. Natl. Acad. Sci. USA. 86:2757-2760), and amplification-refractory mutation system (ARMS) (Newton, et al., 1989 Nucleic Acids Res. 17:2503-2516). The entire contents of each of these references is incorporated herein. This method is applicable for single base substitutions as well as micro deletions/insertions.

[0092] For example, for PCR-based amplification methods, amplification primers may be designed such that they can distinguish between different alleles (e.g., between a wild-type allele and a mutant allele). Thus, the presence or absence of amplification product can be used to determine whether a CFTR gene mutation is present in a given nucleic acid sample. In some embodiments, allele specific primers can be designed such that the presence of amplification product is indicative of a CFTR gene mutation. In some embodiments, allele specific primers can be designed such that the absence of amplification product is indicative of a CFTR gene mutation.

[0093] In some embodiments, two complementary reactions are used. One reaction employs a primer specific for the wild type allele (wild-type-specific reaction) and the other reaction employs a primer for the mutant allele (mutant-specific reaction). The two reactions may employ a common second primer. PCR primers specific for a particular allele (e.g., the wild-type allele or mutant allele) generally perfectly match one allelic variant of the target, but are mismatched to other allelic variant (e.g., the mutant allele or wild-type allele). The mismatch may be located at/near the 3 end of the primer, leading to preferential amplification of the perfectly matched allele. Whether an amplification product can be detected from one or in both reactions indicates the absence or presence of the mutant allele. Detection of an amplification product only from the wild-type-specific reaction indicates presence of the wild-type allele only (e.g., homozygosity of the wild-type allele). Detection of an amplification product in the mutant-specific reaction only indicates presence of the mutant allele only (e.g. homozygosity of the mutant allele). Detection of amplification products from both reactions indicate (e.g., a heterozygote). As used herein, this approach will be referred to as allele specific amplification (ASA).

[0094] Allele-specific amplification can also be used to detect duplications, insertions, or inversions by using a primer that hybridizes partially across the junction. The extent of junction overlap can be varied to allow specific amplification.

[0095] Amplification products can be examined by methods known in the art, including by visualizing (e.g., with one or more dyes) bands of nucleic acids that have been migrated (e.g., by electrophoresis) through a gel to separate nucleic acids by size.

[0096] Allele-Specific Primer Extension

[0097] In some embodiments, an allele-specific primer extension (ASPE) approach is used to detect CFTR gene mutations. ASPE employs allele-specific primers that can distinguish between alleles (e.g., between a mutant allele and a wild-type allele) in an extension reaction such that an extension product is obtained only in the presence of a particular allele (e.g., mutant allele or wild-type allele). Extension products may be detectable or made detectable, e.g., by employing a labeled deoxynucleotide in the extension reaction. Any of a variety of labels are compatible for use in these methods, including, but not limited to, radioactive labels, fluorescent labels, chemiluminescent labels, enzymatic labels, etc. In some embodiments, a nucleotide is labeled with an entity that can then be bound (directly or indirectly) by a detectable label, e.g., a biotin molecule that can be bound by streptavidin-conjugated fluorescent dyes. In some embodiments, reactions are done in multiplex, e.g., using many allele-specific primers in the same extension reaction.

[0098] In some embodiments, extension products are hybridized to a solid or semi-solid support, such as beads, matrix, gel, among others. For example, the extension products may be tagged with a particular nucleic acid sequence (e.g., included as part of the allele-specific primer) and the solid support may be attached to an anti-tag (e.g., a nucleic acid sequence complementary to the tag in the extension product). Extension products can be captured and detected on the solid support. For example, beads may be sorted and detected. One such system that can be employed in this manner is the LUMINEX MAP system, which can be adapted for cystic fibrosis mutation detection by Luminex Corporation and is sold commercially as a universal bead array (TAG-IT) (See, e.g., Example 2)

[0099] Additional ASPE methods and reagents are described in, e.g., U.S. patent publication number 2008/0138803 A1, the entire contents of which are herein incorporated by reference.

[0100] Single Nucleotide Primer Extension

[0101] In some embodiments, a single nucleotide primer extension (SNuPE) assay is used, in which the primer is designed to be extended by only one nucleotide. In such methods, the identity of the nucleotide just downstream (e.g., 3) of the 3 end of the primer is known and differs in the mutant allele as compared to the wild-type allele. SNuPE can be performed using an extension reaction in which the only one particular kind of deoxynucleotide is labeled (e.g., labeled dATP, labeled dCTP, labeled dGTP, or labeled dTTP). Thus, the presence of a detectable extension product can be used as an indication of the identity of the nucleotide at the position of interest (e.g., the position just downstream of the 3 end of the primer), and thus as an indication of the presence or absence of a mutation at that position. SNuPE can be performed as described in U.S. Pat. No. 5,888,819; U.S. Pat. No. 5,846,710; U.S. Pat. No. 6,280,947; U.S. Pat. No. 6,482,595; U.S. Pat. No. 6,503,718; U.S. Pat. No. 6,919,174; Piggee, C. et al. Journal of Chromatography A 781 (1997), p. 367-375 (Capillary Electrophoresis for the Detection of Known Point Mutations by Single-Nucleotide Primer Extension and Laser-Induced Fluorescence Detection); Hoogendoom, B. et al., Human Genetics (1999) 104:89-93, (Genotyping Single Nucleotide Polymorphism by Primer Extension and High Performance Liquid Chromatography), the entire contents of each of which are herein incorporated by reference.

[0102] In some embodiments, primer extension can be combined with mass spectrometry for accurate and fast detection of the presence or absence of a mutation. See, U.S. Pat. No. 5,885,775 to Haff et al. (analysis of single nucleotide polymorphism analysis by mass spectrometry); U.S. Pat. No. 7,501,251 to Koster (DNA diagnosis based on mass spectrometry); the teachings of both of which are incorporated herein by reference. Suitable mass spectrometric format includes, but is not limited to, Matrix-Assisted Laser Desorption/Ionization, Time-of-Flight (MALDI-TOF), Electrospray (ES), IR-MALDI, Ion Cyclotron Resonance (ICR), Fourier Transform, and combinations thereof.

[0103] Oligonucleotide Ligation Assay

[0104] In some embodiments, an oligonucleotide ligation assay (OLA or OL) is used. OLA employs two oligonucleotides that are designed to be capable of hybridizing to abutting sequences of a single strand of a target molecules. Typically, one of the oligonucleotides is biotinylated, and the other is detectably labeled, e.g., with a streptavidin-conjugated fluorescent moiety. If the precise complementary sequence is found in a target molecule, the oligonucleotides will hybridize such that their termini abut, and create a ligation substrate that can be captured and detected. See e.g., Nickerson et al. (1990) Proc. Natl. Acad. Sci. U.S.A. 87:8923-8927, Landegren, U. et al. (1988) Science 241:1077-1080 and U.S. Pat. No. 4,998,617, the entire contents of which are herein incorporated by reference in their entirety.

[0105] Hybridization Approach

[0106] In some embodiments, nucleic acids are analyzed by hybridization using one or more oligonucleotide probes specific for a region in the CFTR gene (SEQ ID NO:1) corresponding to the one or more mutations selected from Table 1, 2, 3 or 4, and under conditions sufficiently stringent to disallow a single nucleotide mismatch. In certain embodiments, suitable nucleic acid probes can distinguish between a normal CFTR gene and a mutant CFTR gene containing one or more mutations selected from Table 1, 2, 3, or 4. For example, suitable nucleic acid probes specifically bind to a normal CFTR gene but not to a mutant CFTR gene containing one ore more mutations selected from Table 1, 2, 3, or 4. Alternatively, nucleic acid probes specifically bind to a mutant CFTR gene containing one or more mutations selected from Table 1, 2, 3, or 4 but not to a normal CFTR gene. Probes of the present invention include those that are capable of specifically hybridizing a mutant CFTR allele containing one or more mutations listed in Tables 1, 2, 3, or 4. Probes of the present invention also include those that are capable of specifically hybridizing a normal allele in a particular region of the CFTR gene and therefore capable of distinguishing a normal allele from a mutant CFTR allele containing one or more mutations listed in Tables 1, 2, 3, or 4. Thus, for example, one of ordinary skill in the art could use probes of the invention to determine whether an individual is homozygous or heterozygous for a particular allele.

[0107] Nucleic acid hybridization techniques are well known in the art. See, e.g., Sambrook, et al., 1989, Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Press, Plainview, N.Y. Those skilled in the art understand how to estimate and adjust the stringency of hybridization conditions such that sequences having at least a desired level of complementary will stably hybridize, while those having lower complementary will not. For examples of hybridization conditions and parameters, see, e.g., Sambrook, et al., 1989, Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Press, Plainview, N.Y.; Ausubel, F. M. et al. 1994, Current Protocols in Molecular Biology. John Wiley & Sons, Secaucus, N.J.

[0108] In some embodiments, probe molecules that hybridize to the mutant or wildtype CFTR sequences can be used for detecting such sequences in the amplified product by solution phase or, more preferably, solid phase hybridization. Solid phase hybridization can be achieved, for example, by attaching the CFTR probes to a microchip.

[0109] Nucleic acid probes may comprise ribonucleic acids and/or deoxyribonucleic acids. In some embodiments, provided nucleic acid probes are oligonucleotides (i.e., oligonucleotide probes). Generally, oligonucleotide probes are long enough to bind specifically to a homologous region of the CFTR gene, but short enough such that a difference of one nucleotide between the probe and the nucleic acid sample being tested disrupts hybridization. Typically, the sizes of oligonucleotide probes vary from approximately 10 to 100 nucleotides. In some embodiments, oligonucleotide probes vary from 15 to 90, 15 to 80, 15 to 70, 15 to 60, 15 to 50, 15 to 40, 15 to 35, 15 to 30, 18 to 30, or 18 to 26 nucleotides in length. As appreciated by those of ordinary skill in the art, the optimal length of an oligonucleotide probe may depend on the particular methods and/or conditions in which the oligonucleotide probe may be employed.

[0110] In some embodiments, nucleic acid probes are useful as primers, e.g., for nucleic acid amplification and/or extension reactions.

[0111] In some embodiments, nucleic acid probes are labeled with a detectable moiety as described herein.

[0112] Arrays

[0113] A variety of the methods mentioned herein may be adapted for use with arrays that allow sets of mutations to be analyzed and/or detected in a single experiment. For example, multiple novel CFTR mutations described herein (e.g., Tables 1, 2, 3 or 4) can be analyzed at the same time. Additionally or alternatively, one or more novel CFTR mutations described herein (e.g., Tables 1, 2, 3 or 4) can be analyzed together with other CFTR mutations known in the art at the same time. In particular, methods that involve use of nucleic acid reagents (e.g., probes, primers, oligonucleotides, etc.) are particularly amenable for adaptation to an array-based platform (e.g., microarray). In some embodiments, an array containing one or more probes specific for detecting CFTR mutations described herein (e.g., Tables 1, 2, 3 or 4) can be designed and adapted for various methods described herein. Additionally or alternatively, probes specific for detecting CFTR mutations described herein (e.g., Tables 1, 2, 3 or 4) can be combined with probes specific for CFTR mutations known in the art. In some embodiments, an array containing multiple probes are known as a mutation panel. See, e.g., Wall et al. A 31-mutation assay for cystic fibrosis testing in the clinical molecular diagnostics laboratory, Human Mutation, 1995; 5(4):333-8, the entire contents of which are herein incorporated by reference. Other methods may include the use of real-time PCR with probes for detecting CFTR mutations as described herein.

Protein-Based Analyses

[0114] In certain embodiments, CFTR mutations are detected at the protein (or peptide or polypeptide level), that is, a gene product from a CFTR gene mutation is analyzed. For example, CFTR protein or fragment thereof can be analyzed by amino acid sequencing methods, or immuno assays using one or more antibodies that specifically recognize one or more epitopes corresponding to the one or more novel mutations described herein (e.g., Table 1, 2, 3 and 4). CFTR proteins can also be analyzed by protease digestion (e.g., trypsin digestion) and, in some embodiments, the digested protein products can be further analyzed by 2D-gel electrophoresis.

[0115] Antibody Detection of Mutant Proteins

[0116] For example, specific antibodies that can differentiate between a normal CFTR protein and a mutant CFTR protein can be employed in any of a variety of methods known in the art to detect CFTR mutations. In certain embodiments, suitable antibodies can distinguish between a normal CFTR protein and a mutant CFTR protein containing one or mutations selected from Tables 1, 2, 3, or 4. For example, suitable antibodies specifically bind to a normal CFTR protein but not to a mutant CFTR protein containing one or more mutations selected from Table 1, 2, 3, or 4. Alternatively, suitable antibodies specifically bind to a mutant CFTR protein containing one or more mutations selected from Table 1, 2, 3, or 4 but not to a normal CFTR protein.

[0117] Antibodies against particular epitopes, polypeptides, and/or proteins (e.g., mutant or normal CFTR proteins) can be generated using any of a variety of known methods in the art. For example, the epitope, polypeptide, or protein against which an antibody is desired can be produced and injected into an animal, typically a mammal (such as a donkey, mouse, rabbit, horse, chicken, etc.), and antibodies produced by the animal can be collected from the animal. Monoclonal antibodies can also be produced by generating hybridomas that express an antibody of interest with an immortal cell line. For more details on methods of producing, and uses of, antibodies to detect CFTR mutants, see, e.g., U.S. Pat. No. 5,776,677, the entire contents of which are herein incorporated by reference.

[0118] In some embodiments, antibodies are labeled with a detectable moiety as described herein.

[0119] Antibody detection methods are well known in the art including, but are not limited to, enzyme-linked immunosorbent assays (ELISAs) and Western blots. Some such methods are amenable to being performed in an array format. For example, a variety of different antibodies, each of which is specific for different epitopes within the CFTR protein, could be immobilized in an array and used in an assay such as an ELISA.

Detectable Moieties

[0120] In certain embodiments, certain molecules (e.g., nucleic acid probes, antibodies, etc.) used in accordance with and/or provided by the invention comprise one or more detectable entities or moieties, i.e., such molecules are labeled with such entities or moieties.

[0121] Any of a wide variety of detectable agents can be used in the practice of the present invention. Suitable detectable agents include, but are not limited to: various ligands, radionuclides; fluorescent dyes; chemiluminescent agents (such as, for example, acridinum esters, stabilized dioxetanes, and the like); bioluminescent agents; spectrally resolvable inorganic fluorescent semiconductors nanocrystals (i.e., quantum dots); microparticles; metal nanoparticles (e.g., gold, silver, copper, platinum, etc.); nanoclusters; paramagnetic metal ions; enzymes; colorimetric labels (such as, for example, dyes, colloidal gold, and the like); biotin; dioxigenin; haptens; and proteins for which antisera or monoclonal antibodies are available.

[0122] In some embodiments, the detectable moiety is biotin. Biotin can be bound to avidins (such as streptavidin), which are typically conjugated (directly or indirectly) to other moieties (e.g., fluorescent moieties) that are detectable themselves.

[0123] Below are described some non-limiting examples of other detectable moieties.

[0124] Fluorescent Dyes

[0125] In certain embodiments, a detectable moiety is a fluorescent dye. Numerous known fluorescent dyes of a wide variety of chemical structures and physical characteristics are suitable for use in the practice of the present invention. A fluorescent detectable moiety can be stimulated by a laser with the emitted light captured by a detector. The detector can be a charge-coupled device (CCD) or a confocal microscope, which records its intensity.

[0126] Suitable fluorescent dyes include, but are not limited to, fluorescein and fluorescein dyes (e.g., fluorescein isothiocyanine or FITC, naphthofluorescein, 4,5-dichloro-2,7-dimethoxyfluorescein, 6-carboxyfluorescein or FAM, etc.), carbocyanine, merocyanine, styryl dyes, oxonol dyes, phycoerythrin, erythrosin, eosin, rhodamine dyes (e.g., carboxytetramethylrhodamine or TAMRA, carboxyrhodamine 6G, carboxy-X-rhodamine (ROX), lissamine rhodamine B, rhodamine 6G, rhodamine Green, rhodamine Red, tetramethylrhodamine (TMR), etc.), coumarin and coumarin dyes (e.g., methoxycoumarin, dialkylaminocoumarin, hydroxycoumarin, aminomethylcoumarin (AMCA), etc.), Oregon Green Dyes (e.g., Oregon Green 488, Oregon Green 500, Oregon Green 514, etc.), Texas Red, Texas Red-X, SPECTRUM RED, SPECTRUM GREEN, cyanine dyes (e.g., CY-3, CY-5, CY-3.5, CY5.5, etc.), ALEXA FLUOR dyes (e.g., ALEXA FLUOR 350, ALEXA FLUOR 488, ALEXA FLUOR 532, ALEXA FLUOR 546, ALEXA FLUOR 568, ALEXA FLUOR 594, ALEXA FLUOR 633, ALEXA FLUOR 660, ALEXA FLUOR 680, etc.), BODIPY dyes (e.g., BODIPY FL, BODIPY R6G, BODIPY TMR, BODIPY TR, BODIPY 530/550, BODIPY 558/568, BODIPY 564/570, BODIPY 576/589, BODIPY 581/591, BODIPY 630/650, BODIPY 650/665, etc.), IRDyes (e.g., IRD40, IRD 700, IRD 800, etc.), and the like. For more examples of suitable fluorescent dyes and methods for coupling fluorescent dyes to other chemical entities such as proteins and peptides, see, for example, The Handbook of Fluorescent Probes and Research Products, 9th Ed., Molecular Probes, Inc., Eugene, Oreg. Favorable properties of fluorescent labeling agents include high molar absorption coefficient, high fluorescence quantum yield, and photostability. In some embodiments, labeling fluorophores exhibit absorption and emission wavelengths in the visible (i.e., between 400 and 750 nm) rather than in the ultraviolet range of the spectrum (i.e., lower than 400 nm). For example, a suitable dye for use in real-time PCR procedures may include SYBR Green.

[0127] A detectable moiety may include more than one chemical entity such as in fluorescent resonance energy transfer (FRET). Resonance transfer results an overall enhancement of the emission intensity. For instance, see Ju et. al. (1995) Proc. Nat'l Acad. Sci. (USA) 92:4347, the entire contents of which are herein incorporated by reference. To achieve resonance energy transfer, the first fluorescent molecule (the donor fluor) absorbs light and transfers it through the resonance of excited electrons to the second fluorescent molecule (the acceptor fluor). In one approach, both the donor and acceptor dyes can be linked together and attached to the oligo primer. Methods to link donor and acceptor dyes to a nucleic acid have been described previously, for example, in U.S. Pat. No. 5,945,526 to Lee et al., the entire contents of which are herein incorporated by reference. Donor/acceptor pairs of dyes that can be used include, for example, fluorescein/tetramethylrohdamine, IAEDANS/fluroescein, EDANS/DABCYL, fluorescein/fluorescein, BODIPY FL/BODIPY FL, and Fluorescein/ QSY 7 dye. See, e.g., U.S. Pat. No. 5,945,526 to Lee et al. Many of these dyes also are commercially available, for instance, from Molecular Probes Inc. (Eugene, Oreg.). Suitable donor fluorophores include 6-carboxyfluorescein (FAM), tetrachloro-6-carboxyfluorescein (TET), 2-chloro-7-phenyl-1,4-dichloro-6-carboxyfluorescein (VIC), and the like.

[0128] Enzymes

[0129] In certain embodiments, a detectable moiety is an enzyme. Examples of suitable enzymes include, but are not limited to, those used in an ELISA, e.g., horseradish peroxidase, beta-galactosidase, luciferase, alkaline phosphatase, etc. Other examples include beta-glucuronidase, beta-D-glucosidase, urease, glucose oxidase, etc. An enzyme may be conjugated to a molecule using a linker group such as a carbodiimide, a diisocyanate, a glutaraldehyde, and the like.

[0130] Radioactive Isotopes

[0131] In certain embodiments, a detectable moiety is a radioactive isotope. For example, a molecule may be isotopically-labeled (i.e., may contain one or more atoms that have been replaced by an atom having an atomic mass or mass number different from the atomic mass or mass number usually found in nature) or an isotope may be attached to the molecule. Non-limiting examples of isotopes that can be incorporated into molecules include isotopes of hydrogen, carbon, fluorine, phosphorous, copper, gallium, yttrium, technetium, indium, iodine, rhenium, thallium, bismuth, astatine, samarium, and lutetium (i.e., .sup.3H, .sup.13C, .sup.14C, .sup.18F, .sup.19F, .sup.32P, .sup.35S, .sup.64Cu, .sup.67Cu, .sup.67Ga, .sup.90Y, .sup.99mTc, .sup.111In, .sup.125I, .sup.123I, .sup.129I, .sup.131I, .sup.135I, .sup.186Re, .sup.187Re, .sup.201Tl, .sup.212Bi, .sup.213Bi, .sup.211At, .sup.153Sm, .sup.177Lu).

[0132] In some embodiments, signal amplification is achieved using labeled dendrimers as the detectable moiety (see, e.g., Physiol Genomics 3:93-99, 2000), the entire contents of which are herein incorporated by reference in their entirety. Fluorescently labeled dendrimers are available from Genisphere (Montvale, N.J.). These may be chemically conjugated to the oligonucleotide primers by methods known in the art.

Kits

[0133] In certain embodiments, the invention provides kits for use in accordance with the invention. Generally, inventive kits comprise one or more reagents that differentiate a normal CFTR gene or protein from a mutant CFTR gene or protein containing one or more mutations selected from Table 1, 2, 3, or 4. For example, kits may comprise one or more (e.g., any combination of) reagents as described herein, and optionally additional components. For example, a kit according to the present invention may also include reagents that can detect other CFTR mutations well known in the art.

[0134] Suitable reagents may include nucleic acid probes and/or antibodies or fragments thereof. In some embodiments, suitable reagents are provided in a form of an array such as a microarray or a CFTR mutation panel.

[0135] In some embodiments, provided kits further comprise reagents for carried out various detection methods described herein (e.g., sequencing, hybridization, primer extension, multiplex ASPE, immuno assays, etc.). For example, kits according to the invention may optionally contain buffers, enzymes, and/or reagents for use in methods described herein, e.g., for amplifying nucleic acids via primer-directed amplification, for performing ELISA experiments, etc.

[0136] In some embodiments, provided kits further comprise a control indicative of a healthy individual, e.g., a nucleic acid and/or protein sample from an individual who does not carry a CFTR mutation associated with CF or a CF related disorder. In some embodiments, provided kits further comprise a control indicative of known CFTR mutant alleles (such as F508). Kits may also contain instructions on how to determine if an individual has CF or a CF related disorder, is at risk of developing CF or a CF related disorder, or is a carrier of CFTR mutation.

[0137] In some embodiments, a computer readable medium encoding information corresponding to one or more mutations shown in Tables 1, 2, 3, and 4 is provided. Such computer readable medium may be included in a kit of the invention.

Systems

[0138] In an embodiment, the present invention provides systems for carrying out the analysis of the invention. Thus, in an embodiment, the present invention comprises a computer-readable medium on which is encoded programming code for the methods described herein. Also in an embodiment, present invention may comprise a system comprising a processor in communication with a computer-readable medium, the processor configured to perform the methods described herein. Suitable processors and computer-readable media for various embodiments of the present invention are described in greater detail below and are illustrated in FIG. 5.

[0139] Thus, in certain embodiments, the invention comprises a system for predicting the activity of at least one gene comprising: a computer readable medium; and a processor in communication with the computer readable medium, the processor configured to estimate the effects of individual mutations in the at least one gene. The processor may, in certain embodiments, be further in communication with a database comprising data for a plurality of sequences for the portion of the at least one gene, where the processor is configured to compare the nucleic acid and/or amino acid sequence of the portion of the at least one gene to the data of the plurality of sequences for the portion of the at least one gene to determine if there is a mutation in the portion of the at least one gene in the biological sample obtained from the subject.

[0140] In other embodiments, the invention comprises a computer readable medium on which is encoded program code for predicting the activity of at least one gene, the program code comprising code for applying a model to estimate the effects of individual mutations in the at least one gene. In certain embodiments, the programming code comprises code configured to compare the amino acid and/or nucleic acid sequence of the portion of the at least one gene to the data for a plurality of sequences for the portion of the at least one gene stored in a database to determine if there is a mutation in the portion of the at least one gene in the biological sample obtained from the subject.

[0141] Some embodiments of the systems and computer readable media of the invention may be applied to various genes. In certain embodiments, the at least one gene comprises the CFTR gene.

[0142] As noted herein, the sequence of the portion of the at least one gene and the biological activity of interest as assessed for a particular subject may be compared to a database of amino acid and/or nucleic acid sequences and biological activity as assess for a plurality of subjects. Thus, in certain embodiments of the systems and computer readable media, the database comprises data for the biological activity as measured in a plurality of samples from which the sequence of the portion of the at least one gene was determined.

[0143] Embodiments in accordance with aspects of the present subject matter can be implemented in digital electronic circuitry, in computer hardware, firmware, software, or in combinations of the preceding. In one embodiment, a computer may comprise a processor or processors. The processor may comprise, or have access to, a computer-readable medium, such as a random access memory coupled to the processor. The processor may execute computer-executable program instructions stored in memory, such as executing one or more computer programs including a sampling routine and suitable programming to produce output to generate the analysis described in detail herein.

[0144] Such processors may comprise a microprocessor, a digital signal processor (DSP), an application-specific integrated circuit (ASIC), field programmable gate arrays (FPGAs), and state machines. Such processors may further comprise programmable electronic devices such as PLCs, programmable interrupt controllers (PICs), programmable logic devices (PLDs), programmable read-only memories (PROMs), electronically programmable read-only memories (EPROMs or EEPROMs), or other similar devices.

[0145] Such processors may comprise, or may be in communication with, media, for example tangible computer-readable media that may store instructions that when executed by the processor, can cause the processor to perform the steps described herein as carried out, or assisted, by a processor. Embodiments of computer-readable media may comprise, but are not limited to, all electronic, optical, magnetic, or other storage devices capable of providing a processor, such as the processor in a web server, with computer-readable instructions. Other examples of media comprise, but are not limited to, a floppy disk, CD-ROM, magnetic disk, memory chip, ROM, RAM, ASIC, configured processor, all optical media, all magnetic tape or other magnetic media, or any other medium from which a computer processor can read. Also, various other devices may include computer-readable media, such as a router, private or public network, or other transmission device. The processor, and the processing may be in one or more structures, and may be dispersed through one or more structures. The processor may comprise code for carrying out one or more of the methods (or parts of methods) described herein.

[0146] The system may comprise a data compiling system as well as a means for the user to interact with the system as the analysis proceeds. Thus, in an embodiment, the present invention may comprise a system for collecting and/or compiling data from a plurality of assay measurements and/or sequencing data and transmitting the data to a computer, and a system for transmitting the results of the analysis to a user. The systems of the present invention may be designed for high-throughput analysis of DNA and/or amino acid sequencing data. Thus, in an embodiment, the plurality of measured signals comprise a plurality of known DNA sequences isolated from at least one cell type.

[0147] FIG. 5 shows an embodiment of the flow of information in a system comprising the software of the present invention. As discussed above, a computer processor or CPU may include, for example, digital logic processors capable of processing input, executing algorithms, and generating output as necessary in response to the inputs received from the touch-sensitive input device. As detailed herein, such processors may include a microprocessor, such as an ASIC, and state machines, and/or other components. Such processors include, or may be in communication with, media, for example computer-readable media, which stores instructions that, when executed by the processor, cause the processor to perform the steps described herein.

[0148] Thus, in an embodiment, the starting point may comprise data (100) that may comprise a normal CFTR gene (100A) and mutant CFTR gene (100B). Once the data has been collected (110), it may be compiled (120) and/or transformed if necessary using any standard spreadsheet software such as Microsoft Excel, FoxPro, Lotus, or the like. In an embodiment, the data are entered into the system for each experiment. Alternatively, data from previous runs are stored in the computer memory (150) and used as required.

[0149] At each point in the analysis, the user may input instructions via a keyboard (180), floppy disk, remote access (e.g., via the internet) (190), or other access means. The user may enter instructions including options for the run, how reports should be printed out, and the like. Also, at each step in the analysis, the data may be stored in the computer using a storage device common in the art such as disks, drives or memory (150). As is understood in the art, the processor (160) and I/O controller (170) are required for multiple aspects of computer function. Also, in a embodiment, there may be more than one processor.

[0150] The data may also be processed to remove noise (130). In some cases, the user, via the keyboard (180), floppy disk, or remote access (190), may want to input variables or constraints for the analysis, as for example, the threshold for determining noise. The results of the analysis may then be compiled and provided in a form for review by a user (140).

[0151] The following examples serve to illustrate the present invention. These examples are in no way intended to limit the scope of the invention.

EXAMPLES

Example 1

Identification of Novel Mutations in the CFTR Gene

[0152] Novel mutations in the CFTR gene were identified using the CF full sequencing assay. Typically, samples submitted for CF full sequencing assays were from individuals for whom testing in CF mutation panels has been uninformative, or partially uninformative. These individuals include 1) patients with idiopathic chronic pancreatitis; 2) patients with congenital bilateral absence of the vas deferens (CBAVD); 3) couples who test positive/negative by mutation analysis; 4) CF-affected or suspected patients in whom one or no mutations have been identified; 5) obligate carriers of a rare familial mutation; 6) patients with a family history of CF, for whom mutation analysis by other methodologies is negative; 7) patients with a CF related disease or condition. Sequence changes in the CFTR gene were identified by comparing the patient gene sequence to the wild-type gene sequence. Novel mutations in the CFTR gene that were unreported previously are summarized in Table 5.

[0153] As shown in Table 5, patients carrying these novel mutations were from different ethnic groups including Caucasians, African Americans, Hispanics, and Asians. Some of the mutations are located in introns (e.g., intron 3, intron 6a, intron 11, intron 14a, intron 19, intron 20, intron 21, and intron 23). Some of the mutations are located in exons (e.g., exon 2, exon 3, exon 4, exon 5, exon 6a, exon 6b, exon 7, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14a, exon 14b, exon 15, exon 16, exon 17a, exon 17b, exon 19, exon 20, exon 21, exon 22, and exon 24).

[0154] As shown in Table 5, most of the novel mutations identified result in codon changes or altered gene splicing sites, which will likely affect the CFTR gene expression and/or protein function. In particular, some of the mutations are nonsense mutations (i.e., mutations predicted to result in the introduction of a stop codon). Some of the mutations affect consensus splice site ag/gt. Some of these mutations are insertion or deletion of at least one nucleotide. These mutations are category 2 mutations according to the ACMG guidelines, and are of the type expected to cause CF or CF related disease, disorder or condition.

[0155] Some mutations are missense mutations. Some are predicted to cause cause in-frame insertions and/or deletions. Some are likely to affect splice sites. These mutations are category 3 mutations according to the ACMG guidelines.

[0156] Thus, the novel mutations provided herein can be used, alone or in combination with other known CF mutations, to detect CF or a CF related disorder in CFTR testing assays including carrier testing.

TABLE-US-00004 TABLE5 NovelMutationsintheCFTRgene Sequence Typeof AA Other Change mutation Change Ethnicity Mutations ClinicalInformation Exon 1824delA Frame- n/a Caucasian F508del Mutationwasidentifiedina22yearold e12 shift patientwithaknowndiagnosisofCF. (FS) Thispatientcarriedasecondmutation knowntocauseCF(F508del). 2957delT FS n/a Caucasian F508del Mutationwasidentifiedina1yearold e15 patientwithaknowndiagnosisofCF. Thepatientcarriedasecondmutation knowntocauseCF(F508del). 4089ins4 FS n/a Caucasian F508del Mutationwasidentifiedina7yearold e21 patientwithaknowndiagnosisofCF. Thepatienthadapositivesweatchloride test.Thepatientcarriedasecond mutationknowntocauseCF(F508del). 4374+ Splice n/a 1. 1.F508del Patient#1:Mutationwasidentifiedina i23 2T> C site Caucasian 45yearoldpatientwithasuspected mutation 2. 2.F508del diagnosisofCF.Thepatientcarrieda Caucasian secondmutationknowntocauseCF (F508del). Patient#2:Mutationwasidentifiedina 52yearoldpatientwithasuspected diagnosisofCF.Thepatientcarrieda secondmutationknowntocauseCF (F508del). 3064A> T Nonsense K978X African Q1042X Mutationwasidentifiedina26yearold e16 American patientwithaknowndiagnosisofCF. Thepatientcarriedasecondmutation likelytocauseCFQ1042X. 246C> G Nonsense Y38X Caucasian F508del Mutationwasidentifiedina1monthold e2 patientwithasuspecteddiagnosisofCF. Thepatienthadapositivesweatchloride test.Thepatientcarriedasecond mutationknowntocauseCF(F508del). 269C> T Missense A46V 1) 1)3849+ Patient#1:Mutationwasidentifiedina e2 (MS) Caucasian 12192G> A 32yearoldpatientwhowastesteddueto 2)Black 2)F508del abnormalitiesfoundonfetalultrasound. 3)African 3)none Thepatientcarriedasecondmutationof American unknownclinicalsignificance (3849+ 12192G> A). Patient#2:Mutationwasidentifiedina2 montholdpatientwhowastestedbased onfollow-upforapositivenewborn screen.Thepatientcarriedasecond mutationknowntocausecysticfibrosis (F508del). Patient#3:Mutationwasidentifiedina 24yearoldpatientwhowastestedasa parentalfollow-uptoapositivenewborn screen. 2902G> T MS D924Y Caucasian F508del Mutationwasidentifiedina1monthold e15 patientwithasuspecteddiagnosisofCF. Thepatientalsohadapositivesweat chloridetestandcarriedasecond mutationknowntocauseCF(F508del) 3814G> A MS E1228K Caucasian F508del Mutationwasidentifiedina1monthold e19 patientwithasuspecteddiagnosisofCF. Thepatienthadaborderlinesweat chloridetest.Thepatientcarrieda secondmutationknowntocauseCF (F508del). 502G> C MS G124R Not F508del Mutationwasidentifiedina2monthold e4 Provided patientwithasuspecteddiagnosisofCF. Thepatienthadapositivesweatchloride test.Thepatientcarriedasecond mutationknowntocauseCF(F508del). 1520G> T MS G463V Caucasian F508del Mutationwasidentifiedina17yearold e9 patientwithaknowndiagnosisofCF. Patientcarriedasecondmutationknown tocauseCF(F508del). 511_513 Inframe L127dup Caucasian, W1282X Mutationwasidentifiedinanewborn e4 dupTTA dupli- Asian withasuspecteddiagnosisofCF.The cation patienthadclinicalsymptomsofCF includingasapositivesweatchloride test,meconiumileus,echogenicbowel, andpancreaticinsufficiency.Thepatient carriedasecondmutationknownto causeCF(W1282X). 978A> T MS E282D 1.not 1. Patient#1:Mutationwasidentifiedina e6b provided 3120+ 10yearoldpatientwithasuspected 1G> A diagnosisofCF.Thepatienthada 2)none 2.none positivesweatchloridetest.Thepatient provided carriedasecondmutationknownto causeCF(3120+ 1G> A). Patient#2:Mutationwasidentifiedina4 yearoldpatientwithasuspected diagnosisofCFandafamilyhistoryof CF. 843G> C MS Q237H Caucasian F508del Mutationwasidentifiedina2monthold e6a patientwithaknowndiagnosisofCF. Thepatientcarriedasecondmutation knowntocauseCF(F508del). 829C> T MS L233F Caucasian D1152H Mutationwasidentifiedina1monthold e6a patientwhowastestedfollowinga positivenewbornscreen.Thepatient carriedasecondmutationknownto causeCF(D1152H). 4096-6C> T Splice None Caucasian F508del Mutationwasidentifiedina58yearold i21 site patientwithasuspecteddiagnosisofCF. mutation Thepatientcarriedasecondmutation knowntocauseCF(F508del). 4375-7delT Splice None Caucasian F508del Mutationwasidentifiedina6yearold i23 site patientwithasuspecteddiagnosisofCF. mutation Patienthasafamilyhistory,aborderline sweatchloridetestandrecurrent pneumonia.Thepatientcarriedasecond mutationknowntocauseCF(F508del). 1586G> C MS 5485T Caucasian 51235R Mutationwasidentifiedina2yearold e10 patientwithasuspecteddiagnosisofCF. Thepatientcarriedasecondmutation S1235R(3837T> G)whichhasbeen reportedinindividualswithvaryingCF phenotypes. 875+ G> T Splice n/a African none Mutationwasidentifiedina1monthold i6a site American patientwhohadapositivenewborn mutation screeningtest. 4005+ Splice n/a Caucasian none Mutationwasidentifiedina40yearold i20 3G> T site patientwhowastestedtodetermineif mutation theywereacarrier,therewasnofamily historyofCF. 2711T> C MS 1860T Caucasian F508del, Mutationwasidentifiedina58yearold e14a E528E womanwithasuspecteddiagnosisofCF. Thepatientcarriedasecondmutation knowntocauseCF(F508del)andan additionalmutationofunknownclinical significance(E528E).. 3891G> C MS L1253F Not G85E,L15P Mutationwasidentifiedina32yearold e20 provided patientwithaknowndiagnosisofCF. Thepatientcarriedasecondmutation knowntocauseCF(G85E)andan additionalmutationofunknownclinical significance(L15P). 2524C> T MS P798S African F508del, Mutationwasidentifiedina5yearold e13 American R74W, patientwithasuspecteddiagnosisofCF. G921E, Thepatienthadapositivesweatchloride D1270N test.Thispatientcarriedasecond mutationknowntocauseCF(F508del) andthreeadditionalmutationsof unknownclinicalsignificance(R74W, G921E,D1270N). 2894G> A MS G921E African F508del, Mutationwasidentifiedina5yearold e15 American R74W, patientwithasuspecteddiagnosisofCF. P798S, Thepatienthadapositivesweatchloride D1270N test.Thispatientcarriedasecond mutationknowntocauseCF(F508del) andthreeadditionalmutationsof unknownclinicalsignificance(R74W, P789S,D1270N). 405+ Possible n/a Caucasian F508del Mutationwasidentifiedina35yearold i3 10247C> T splice patientwhowastestedtodetermineif site theywereacarrier,therewasnofamily mutation historyofCF.Thispatientcarrieda secondmutationknowntocauseCF (F508del). 405+ 10255 Possible n/a Not F508del, Mutationwasidentifiedina10yearold i3 delC splice Provided 124del23bp patient.Thepatientcarriestwomutations site knowtocauseCF(F508deland mutation 124del23). 1811+ Possible n/a 1. 1.F508del Patient#1:Mutationwasidentifiedina1 i11 1643G> T splice Hispanic yearoldpatientwithaknowndiagnosis site 2. 2.F508del ofCF.Patienthadapositivesweat mutation Hispanic chloridetest.Thepatientcarrieda 3.Not 3.none secondmutationknowntocauseCF provided (F508del). Patient#2:Mutationwasidentifiedina6 yearoldpatientwithaknowndiagnosis ofCF.Thepatientcarriedasecond mutationknowtocauseCF(F508del). Patient#3:Mutationwasidentifiedinan 8montholdpatientwithasuspected diagnosisofCF. 1812- Splice n/a Caucasian none Mutationwasidentifiedina15yearold i11 13A> G site patientwithasuspecteddiagnosisofCF. mutation Thepatienthaschronicsinusitis. 2752- Possible n/a African F693L Mutationwasidentifiedina6yearold i14a 33insA splice American patientwithaknowndiagnosisofCF. site Thepatientcarriesasecondmutationof mutation unknownclinicalsignificance(F693L). 3849+ Possible n/a Caucasian A46V Mutationwasidentifiedina32yearold i19 12192G> A splice patientwhowastesteddueto site abnormalitiesfoundonfetalultrasound. mutation Thepatientcarriedanadditional mutationofknownclinicalsignificance (A46V). 724G> A MS A198T Hispanic none Mutationwasidentifiedina4monthold e6a patientwithasuspecteddiagnosisofCF. 3899C> T MS A1256V Guyanese none Mutationwasidentifiedina45yearold e20 patientwhowastestedtodetermineif theywereacarrier,therewasnofamily historyofCF. 3986C> T MS A1285V Not none Mutationwasidentifiedina23yearold e20 Provided patientwhowastestedtodetermineif theywereacarrier,therewasnofamily historyofCF. 901G> A MS E257K Hispanic none Mutationwasidentifiedina4yearold e6b patientwithasuspecteddiagnosisofCF. Thepatienthasasthmaandrecurring pneumonia. 392T> C MS F875 Not none Themutationwasidentifiedina1month e3 Provided oldpatientwithasuspecteddiagnosisof CF. 3463T> C MS F1111L Hispanic none Mutationwasidentifiedina6yearold e17b patientwithasuspecteddiagnosisofCF. Thepatienthasasthma 1757G> A MS G542E Hispanic none Mutationwasidentifiedina25yearold e11 patientwhowastestedtodetermineif theywereacarrier,therewasnofamily historyofCF.Thepatientcarried2 copiesofG542E.. 4025G> C MS G1298A Asian G970D, Mutationwasidentifiedina34yearold e21 Q1352H patientwithcongenitalabsenceofthe vasdeferens.Thepatientcarriedtwo othermutationsofunknownclinical significance(G970DandQ1352H) 4129G> T MS G1333W Not none Mutationwasidentifiedinan8yearold e22 Provided patientwithasuspecteddiagnosisofCF. Patienthadrecurrentrespiratory infectionsandchroniccough. 663T> G MS I177M Caucasian none Mutationwasidentifiedina34yearold e5 patientwhowastestedtodetermineif theywereacarrier,therewasnofamily historyofCF. 3200T> C MS I1023T Hispanic none Mutationwasidentifiedina34yearold e17a patientwhowastestedtodetermineif theywereacarrier,therewasnofamily historyofCF. 4412T> C MS I1427T Asian S1444S Mutationwasidentifiedina34yearold e24 patientwhowastestedtodetermineif theywereacarrier,therewasnofamily historyofCF.Thepatientcarriedanother mutationthatisconsideredlikelytobe clinicallybenign(S144S). 620A> C MS K163T Caucasian none Mutationwasidentifiedina32yearold e4 patientwithafamilyhistoryofCF.

Example 2

CFTR Mutation Detection Assay

[0157] The present example demonstrates that multiplex ASPE assay can be used to detect novel cystic fibrosis mutations described herein. Multiplex ASPE combines multiplex PCR and allele-specific primer extension. Multiplex PCR is performed to amplify target regions in the CFTR gene containing novel sequence variations described herein from genomic DNA in a sample. Multiplex primer extension reactions are then performed using allele-specific primers, i.e., extension primers that possess a 3 terminal nucleotide, which form a perfect complement with the target sequence, are extended to form extension products and modified nucleotides (e.g., biotinylated dCTP) are incorporated into the extension product for detection purposes. Alternatively, an extension primer may instead contain a 3 terminal nucleotide which forms a mismatch with the target sequence. In this instance, primer extension does not occur. Primer extension products are then hybridized to universal array beads with anti-tag sequence (sequences complementary to the tag sequence) for capture and detection purposes.

[0158] In some cases, the novel mutations described herein can be detected in combination of other known CF mutations, for example, mutations recommended by the American College of Genetics and American College of Obstetricians and Gynecologists, as well as other common and clinically relevant mutations, such as, for example, AF508 (exon 10), G542X (exon 11), G551D (exon 11), R117H (exon 4), W1282X (exon 20), N1303K (exon 21), 3905insT (exon 20), 3849+10KbC>T (intron 19), G85E (exon 3), R334W (exon 7), A455E (exon 9), 1898+1G>A (exon 12), and/or 2184delA (exon 13).

[0159] Various ASPE kits can be used to carry out the detection methods described herein. For example, Luminex's TAG-IT kit and Data Analysis software can be modified to detect a panel of CF mutations including one or more novel mutations described herein. Mutation detection kit may use non-isotopic fluorescent technology, and a 96-well assay format that is compatible with automation such that result analyses and genotype calling are automated.

Allele Specific Primers

[0160] Allele specific primers can be designed based on the sequence variations shown in Table 5 and the CFTR genomic sequences (including exon and intron sequences) using various methods and software known in the art. A universal tag sequence can be added to allele specific primers.

Specimens and Assay Format

[0161] Specimens containing genomic DNA to be analyzed can be obtained from, but not limited to, the following sources: Whole blood (e.g., whole blood in EDTA, ACD-A, ACD-B), fresh or frozen tissue, amniotic fluid, CVS (chorionic villus sampling) tissue, cultured cells (e.g., CVS, amniotic fluid, fibroblasts, POC (product of conception)), blood spots, cord blood, mouthwash, genomic DNA extracted by an outside laboratory. Blood and bloodspot DNA samples are typically run undiluted at a 5 L input volume. An amount of 5 to 200 ng DNA is used as input. For testing prenatal and mouthwash samples, generally between 20 ng and 150 ng is used as input, for example, about 20 ng, 25 ng, 30 ng, 35 ng, 40 ng, 45 ng, 50 ng, 55 ng, 60 ng, 65 ng, 70 ng, 75 ng, 80 ng, 85 ng, 90 ng, 95 ng, 100 ng, 110 ng, 120 ng, 130 ng, 140 ng, or 150 ng.

[0162] A 96-well assay plate is used. Two genomic DNA controls are included with each assay plate. The specific controls are rotated sequentially through assay plates. Each assay plate also includes two cocktail blanks and ASPE (Allele-Specific Primer Extension) controls. A calibrating 96-well filter plate is also used during data acquisition.

Single-Well Multiplex PCR

[0163] Multiplex PCR are performed to amplify exons containing mutations described herein using consensus flanking intron sequences. Generally, amplicons range in size between about 150 bp and 600 bp (inclusive of endpoints).

[0164] Typically, 5 ng-200 ng of DNA is amplified to produce a product containing multiple amplicons using PCR amplification conditions known in the art or optimized/modified using routine experimentation.

Enzymatic Post-PCR Cleanup

[0165] PCR products are treated with Exonuclease I and Shrimp Alkaline Phosphatase to remove residual primers that will interfere with allele-specific primer extension reactions. PCR products are incubated with enzyme and then enzyme is heat-deactivated, according to standard protocols or modified protocols readily developed by one of ordinary skill in the art.

Single Well Allele Specific Primer Extension (ASPE) Reactions

[0166] Typically up to 100 sequence variations can be distinguished in a single-well reaction; using the Luminex bead set. For example, a set of allele-specific oligonucleotide (ASO) primers (including wildtype control ASOs) with tag sequences are used.

[0167] The Exo-SAP-treated PCR product is subjected to an allele-specific primer extension reaction containing tagged primers and biotinylated dCTP using PCR reaction conditions known in the art or modified readily by one of ordinary skill in the art.

Universal Array Sorting and Detection

[0168] Each bead is coupled with an anti-tag sequence complementary to the tag sequence ASPE primers. Therefore, any ASPE products, if present, can be captured for genotype analysis. Wild-type control for each amplicon is included. The signals from wildtype alleles serve as a control for each amplicon and provide information for allelic ratio calculation (typically obtained by calculating the ratio of signal for the mutant allele over signal for the wildtype allele), for the detected mutations.

[0169] The ASPE product is added to the universal bead array containing anti-tags to the ASPE primers and incubated for hybridization. Hybridization reactions are then washed over a filter that captures the beads and removes any non-hybridized ASPE products containing biotin. Bead hybridization conditions are known in the art and can be adapted readily by one skilled in the art.

[0170] Strepatavidin R-Phycoerythrin conjugate is added to the hybridized products on the filter plate and incubated at room temperature, followed by bead sorting and detection. For example, a modified LUMINEX 100 IS or 200 IS can be used. The LUMINEX 100 IS can upload sample sheets from text files or barcodes. Detection time averages 20-100 seconds per well.

Results

[0171] In the LUMINEX system, results are generated as a <.csv> file and exported in batches. The batch output file (.csv) is opened in TAG-IT Data Analysis Software (TDAS) version 6.0 where results are automatically generated based on pre-determined algorithms for allelic ratios on certain individually tested mutations and the presence or absence of signal on the remaining mutations.

Mutation Confirmation

[0172] Samples positive for any of the mutations described herein can be confirmed by a second assay run. Positive samples can also be confirmed by direct DNA sequencing.

Example 3

Cystic Fibrosis Sequencing Assays

[0173] The Cystic Fibrosis full sequencing assay and single exon sequence assay can be used to detect mutations in the CFTR gene directly in a patient sample. The Cystic Fibrosis full sequencing assay and single exon sequence assay can also be used to complement CF screening panels, and/or to serve as a confirmatory assay for samples that are positive for multiplex mutations or those without a normal counterpart in the CF mutation detection assay.

[0174] The CF full sequencing assay sequences the entire coding region of the CFTR gene plus 15 bp at the 3 end of each intron (30 bp for e17b to cover a known mutation) and 6 bp at the 5 beginning of each intron.

[0175] In addition, the assay includes portions of introns 1, 3, 11, and 19 useful in identifying the exon 2, 3 deletion, the A>G mutation at 1811+1.6 kb, and the C>T mutation at 3849+10 kb. Typically, the assay comprises analysis of 31 amplicons: e1, i1, e2, e3, i3, e4, e5, e6a, e6b, e7, e8, e9, e10, e11, e12, e13a, e14a, e14b, e15, e16, e17a, e17b, e18, e19, i19, e20, e21, e22, e23, and e24. Each amplicon includes the complete coding region of the exon with the exception of 13.1 and 13.2, in which, due to the large size of the exon, the amplicon is divided into two fragments. The CF Single Exon Sequencing assay uses the same primers but on an individual basis as needed.

[0176] Samples tested in the CF single exon sequencing assay in this Example include those from individuals that 1) tested positive in a CF mutation detection assay (e.g., multiplex ASPE assay as described in Examples 2) but require confirmation; 2) tested positive in the CF full sequencing assay and require repeat testing; 3) are being tested for a known familial mutation(s); and/or 4) are being tested for a mutation that is not detectable in the CF mutation detection assay of Example 2.

Specimens and Assay Format

[0177] Specimens to be analyzed can be extracted genomic DNA from any of, but not limited to, the following sources: Whole blood (e.g., whole blood in EDTA, ACD-A, ACD-B), blood spots, amniotic fluid, chorionic villus samples (CVS) (for single exon sequencing only), cultured cells (e.g., CVS, amniotic fluid, fibroblasts, POC), mouthwash (for single exon sequencing only).

[0178] A 96-well format is used. Cocktail blanks are run for all amplicons on each assay.

PCR Amplification

[0179] Target regions containing mutations described herein are first amplified by PCR amplification. Typically, 5 ng-200 ng of DNA is amplified in a 25 L volume reaction. PCR primers include 5 UPS tags-UPS1 for the Forward primers and UPS2 for the Reverse primers. Table 6 presents sequences of exemplary primers used in amplification of certain exemplary target exon or intron regions.

TABLE-US-00005 TABLE6 Primersequences Amplicon SEQID Amplicon PrimerName Sequence(5-3) Length NO. Primersforexonicsequences CFexon1 UP1CFe1F TTTAACCTGGGCAGTGAAG 373 5 UP2CFe1R AACCCAACCCATACACA 6 CFexon2 UP1CFe2F CAAATCAAGTGAATATCTGTTC 316 7 UP2CFe2R AGCCACCATACTTGGCTCCTA 8 CFexon3 UP1CFe3F2 CTAAAATATTTGCACATGCAAC 333 9 UP2CFe3R TTTCTTAGTGTTTGGAGTTGG 10 CFexon4 UP1CFe4F2 TCATTTTAAGTCTCCTCTAAAG 407 11 UP2CFe4R CGATACAGAATATATGTGCCA 12 CFexon5 UP1CFe5F2 AACAACTAGAAGCATGCCAG 394 13 UP2CFe5R2 GTTGTATAATTTATAACAATAGTG 14 CFexon6a UP1CFe6aF2 GGAAGATACAATGACACCTG 353 15 UP2CFe6aR3 CTGAAGATCACTGTTCTATGC 16 CFexon6b UP1CFe6bF3 ATGACTTAAAACCTTGAGCAGT 336 17 UP2CFe6bR2 GGAAGTCTACCATGATAAACAT 18 CFexon7 UP1CFe7F2 GAGACCATGCTCAGATCTTCC 507 19 UP2CFe7R ACTTTTATAACTTCCTAGTGAAG 20 CFexon8 UP1CFe8F2 AAGATGTAGCACAATGAGAGTA 268 21 UP2CFe8R CAGTTAGGTGTTTAGAGCAA 22 CFexon9 UP1CFe9F GTATACAGTGTAATGGATCATG 402 23 UP2CFe9R4 CACCAAATTAAGTTCTTAATAG 24 CFexon10 UP1CFe10F TTCTGCTTAGGATGATAATTGG 479 25 UP2CFe10R GCATAGGTCATGTGTTTTATTA 26 CFexon11 UP1CFe11F CAGATTGAGCATACTAAAAGTG 240 27 UTP2CFe11R TACATGAATGACATTTACAGCA 28 CFexon12 UP1CFel2F GCTACTTCTGCACCACTTTTG 344 29 UP2CFe12R CAGTCTGTCTTTCTTTTATTTTA 30 CFexon UP1CFe13F3 CAAAATGCTAAAATACGAGAC 388 31 13a UP2CFe13R5 TCCAGGAGACAGGAGCATC 32 CFexon UP1CFe13F4 CTCATGGGATGTGATTCTTT 714 33 13b UP2CFe13R2 GATACACCTTATCCTAATCCTA 34 CFexon UP1CFe14aF3 ACCACAATGGTGGCATGA 299 35 14a UP2CFe14aR2 TGTATACATCCCCAAACTATC 36 CFexon UP1CFe14bF TGGGCATGGGAGGAATAGGTG 228 37 14b UP2CFe14bR TTACAATACATACAAACATAGTG 38 G CFexon15 UP1CFe15F2 AAGTAACTTTGGCTGC 416 39 UP2CFe15R2 CTGCCATTAGAAAACCA 40 CFexon16 UP1CFe16F2 AAGTCTATCTGATTCTATTTGC 307 41 UP2CFe16R2 GTTTTTTTAATAATACAGACATAC 42 T CFexon3 UP1CFe17aF TGTCCACTITGCAATGTGAA 317 43 17a UP2CFe17aR3 CAATAAAGAATCTCAAATAGCTC 44 T CFexon3 UP1CFe17bF TAGTCTTTTTCAGGTACAAG 516 45 17b UP2CFe17bR6 CAATGGAAATTCAAAGAAATCAC 46 T CFexon18 UP1CFe18F6 GAATACTTACTATATGCAGAGCA 416 47 UP2CFe18R3 GTTCTTCCTCATGCTATTACTC 48 CFexon19 UP1CFe19F GCCCGACAAATAACCAAGTGA 494 49 UP2CFe19R2 CTAACACATTGCTTCAGGCTA 50 CFexon20 UP1CFe20F AAGGTTGTTTGTCTCCATATAT 544 51 UP2CFe20R GCCTATGAGAAAACTGCACT 52 CFexon21 UP1CFe21F ACATGGGTGTTTCTTATTTA 428 53 UP2CFe21R2 GTTAGGGGTAGGTCCAGT 54 CFexon22 UP1CFe22F GCTTGAGTGTTTTTAACTCTGTG 314 55 UP2CFe22R ATGATTCTGTTCCCACTGTGC 56 CFexon23 UP1CFe23F GTTCTGTGATATTATGTGTGG 226 57 UP2CFe23R CAAGGGCAATGAGATCTTAAG 58 CFexon24 UP1CFe24F2 AGTTTCTGTCCCTGCTCT 356 59 UP2CFe24R GAGCAAATGTCCCATGTCAAC 60 Primersforintronicsequences CFintron1 UP1CFin1F2A AATGGTGTTTACCTACCTAGAGA 250 61 UP4CFin1R2 CCTCCTCTGATTCCACAAG 62 CFintron3 UP3CFin3F3 CTGAGATTCTGTTCTAGGTGTG 366 63 UP2CFin3R CCTACACTCAGAACCCATCAT 64 CFintron UP1CFin19F TTCAGTTGACTTGTCATCTTG 223 65 19 UP2CFin19R AATATGTTGAAAGTTAAACAGTG 66 CFintron UP1CFin11F GTTACACTATAAAGGTTGTTTTAG 292 67 11 AC UP2CFin11R CACAGTTCCCATATTAATAGAAAT 68 G (Seq) CFe9.SEQF TTTTTAACAGGGATTTGGG N/A 69 (Seq) CFe6bF2 GATTGATTGATTGATTGATT N/A 70 (Seq) UPS1 GCGGTCGCATAAGGGTCAGT N/A 71 (Seq) UPS2 CGCCAGCGTATTCCCAGTCA N/A 72
PCR conditions are as shown in Table 7.

TABLE-US-00006 TABLE 7 PCR amplification conditions for CF full sequencing assay Cycles Temperature ( C.) Time Function 1 95 5 min Denaturation of enzyme 35 95 20 sec Denaturation of dsDNA 55 20 sec Annealing 72 40 sec Extension 1 72 7 min Final extension 1 8 Forever End

Enzymatic Post-PCR Clean Up

[0180] PCR products are treated with Exonuclease I (Exo) and Shrimp Alkaline Phosphatase (SAP) to remove residual primers that may interfere with sequencing. The following incubation conditions are used: [0181] 37 C. for 30 minutes (enzyme digestion) [0182] 99 C. for 15 minutes (enzyme deactivation) [0183] Hold at 8 C. until storage [0184] Products can be stored, e.g., at 80 C. or 20 C.

Sequencing

[0185] Exo-SAP treated products are diluted 1:2 in water, and 3 L is added to 7 L of each forward and reverse sequence cocktail containing Big Dye v3.1 (ABI). In order to obtain bidirectional sequencing results, two sequencing reactions are performed for each amplicon, using both UPS1 and UPS2 primers. An additional forward sequencing reaction using gene specific primers is performed for Exons 6b and 9 to obtain readable sequence beyond the repeat regions. Cycle sequencing is performed in a thermocycler with the conditions shown in Table 8.

TABLE-US-00007 TABLE 8 Thermocycler conditions for sequencing reactions for CF full sequencing assay Cycles Temperature ( C.) Time Function 1 96 1 min Denaturation of enzyme 25 96 10 sec Denaturation of dsDNA 53 5 sec Annealing 60 3 sec Extension 1 8 Forever End

[0186] Assay plates can be stored, e.g., at 80 C. for up to 2 weeks until analyzed or further manipulated.

Post-Sequencing Purification

[0187] Sequence products are purified using the Performa DTR Ultra 96 Well Plate (Edge Biosystems). Sequencing reactions are diluted 1:2 and 10 L is purified through the Edge Plate.

Sequencing Run: ABI 3730 Genetic Analyzer and Data Analysis

[0188] A 1 kV/14 second injection is performed on the 37301 Genetic Analyzer. POP7 polymer and a 50 cm array are used for optimal resolution. Parameters for a typical sequencing run are shown in Table 9.

TABLE-US-00008 TABLE 9 Parameters for typical sequencing runs Feature Parameter for CF full sequencing Run Temp 60 C. Pre Run Voltage 15.0 Kvolts Pre Run Time 180 sec Injection Voltage 1.0 Kvolts Injection Time 14 sec Voltage number of steps 30 Voltage Step Interval 15 sec Data Delay Time 240 sec Run Voltage 13.4 Kvolts Run Time 2400 sec

[0189] Sequence data Analysis is performed using SEQSCAPE software (ABI).

EQUIVALENTS

[0190] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. The scope of the present invention is not intended to be limited to the above Description, but rather is as set forth in the appended claims. The articles a, an, and the as used herein in the specification and in the claims, unless clearly indicated to the contrary, should be understood to include the plural referents. Claims or descriptions that include or between one or more members of a group are considered satisfied if one, more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process unless indicated to the contrary or otherwise evident from the context. The invention includes embodiments in which exactly one member of the group is present in, employed in, or otherwise relevant to a given product or process. The invention also includes embodiments in which more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process. Furthermore, it is to be understood that the invention encompasses variations, combinations, and permutations in which one or more limitations, elements, clauses, descriptive terms, etc., from one or more of the claims is introduced into another claim dependent on the same base claim (or, as relevant, any other claim) unless otherwise indicated or unless it would be evident to one of ordinary skill in the art that a contradiction or inconsistency would arise. Where elements are presented as lists, e.g., in Markush group or similar format, it is to be understood that each subgroup of the elements is also disclosed, and any element(s) can be removed from the group. It should it be understood that, in general, where the invention, or aspects of the invention, is/are referred to as comprising particular elements, features, etc., certain embodiments of the invention or aspects of the invention consist, or consist essentially of, such elements, features, etc. For purposes of simplicity those embodiments have not in every case been specifically set forth herein. It should also be understood that any embodiment of the invention, e.g., any embodiment found within the prior art, can be explicitly excluded from the claims, regardless of whether the specific exclusion is recited in the specification.

[0191] It should also be understood that, unless clearly indicated to the contrary, in any methods claimed herein that include more than one act, the order of the acts of the method is not necessarily limited to the order in which the acts of the method are recited, but the invention includes embodiments in which the order is so limited. Furthermore, where the claims recite a composition, the invention encompasses methods of using the composition and methods of making the composition. Where the claims recite a composition, it should be understood that the invention encompasses methods of using the composition and methods of making the composition.

INCORPORATION OF REFERENCES

[0192] All publications and patent documents cited in this application are incorporated by reference in their entirety to the same extent as if the contents of each individual publication or patent document were incorporated herein.