DHAD Variants for Butanol Production

20170218405 ยท 2017-08-03

    Inventors

    Cpc classification

    International classification

    Abstract

    Dihydroxy-acid dehydratase (DHAD) variants that display increased DHAD activity are disclosed. Such enzymes can result in increased production of compounds from DHAD requiring biosynthetic pathways. Also disclosed are isolated nucleic acids encoding the DHAD variants, recombinant host cells comprising the isolated nucleic acid molecules, and methods of producing butanol.

    Claims

    1-177. (canceled)

    178. A method for producing isobutanol comprising: (a) providing a recombinant host cell comprising an isolated polypeptide or fragment thereof having dihydroxy-acid dehydratase (DHAD) activity, wherein the polypeptide or fragment thereof comprises an amino acid sequence which is at least 95% identical to the amino acid sequence of SEQ ID NO: 565, and wherein the amino acid sequence comprises a deletion of about 5 to about 20 amino acids from the C-terminal end of the amino acid sequence; (b) contacting the recombinant host cell with a fermentation medium under conditions whereby isobutanol is produced; and (c) optionally, recovering the isobutanol.

    179. The method of claim 178, wherein the amino acid sequence further comprises one or more amino acid substitutions selected from P378A, P378G, P378V, P378I, P378L, G383S, G383A, G383V, G383L, G383I, I387V, I387M, I387L, I387G, I387A, L388I, L388V, L388A, and L388M.

    180. The method of claim 178, wherein the polypeptide or fragment further comprises a polycysteine or polyhistidine tag.

    181. The method of claim 178, wherein the polypeptide or fragment further comprises the amino acid sequence of SEQ ID NO: 589.

    182. The method of claim 179, wherein the amino acid comprises the amino acid sequence of SEQ ID NO: 573.

    183. The method of claim 178, wherein the polypeptide or fragment further comprises a polypeptide sequence selected from SEQ ID NO: 723, SEQ ID NO: 724, SEQ ID NO: 725, SEQ ID NO: 726, SEQ ID NO: 727, SEQ ID NO: 728, SEQ ID NO: 729, SEQ ID NO: 730, SEQ ID NO: 731, SEQ ID NO: 732, SEQ ID NO: 733, SEQ ID NO: 734, SEQ ID NO: 735, SEQ ID NO: 736, SEQ ID NO: 737, SEQ ID NO: 738, SEQ ID NO: 739, SEQ ID NO: 740, SEQ ID NO: 741, SEQ ID NO: 742, SEQ ID NO: 743, SEQ ID NO: 744, SEQ ID NO: 745, SEQ ID NO: 746, SEQ ID NO: 747, and SEQ ID NO: 748.

    184. The method of claim 178, wherein the amino acid sequence comprises a deletion of about 5 to about 15 amino acids from the C-terminal end of the amino acid sequence.

    185. The method of claim 178, wherein the amino acid sequence comprises a deletion of 9 C-terminal amino acids.

    186. The method of claim 178, wherein the recombinant host cell comprises an isobutanol biosynthetic pathway.

    187. The method of claim 186, wherein the recombinant host cell is genetically modified to disrupt a gene encoding pyruvate decarboxylase (PDC).

    188. The method of claim 186, wherein the recombinant host cell is genetically modified to disrupt a gene encoding glycerol-3-phosphate dehydrogenase (GPD2).

    189. The method of claim 178, wherein the recombinant host cell is a yeast cell.

    190. The method of claim 189, wherein the yeast cell comprises a disruption in one or more endogenous genes affecting iron-sulfur cluster biosynthesis selected from FRA2, GRX3, GRX4, and CCC1.

    191. The method of claim 178, wherein the isobutanol is recovered by distillation, liquid-liquid extraction, adsorption, decantation, pervaporation, or combinations thereof.

    192. The method of claim 178, wherein the isobutanol is recovered by contacting the fermentation medium with a water immiscible extractant to form a two-phase mixture comprising an aqueous phase and an organic phase.

    193. The method of claim 192, wherein the extractant is selected from the group consisting of C.sub.12 to C.sub.22 fatty alcohols, C.sub.12 to C.sub.22 fatty acids, esters of C.sub.12 to C.sub.22 fatty acids, C.sub.12 to C.sub.22 fatty aldehydes, and mixtures thereof.

    194. The method of claim 178, wherein the isobutanol is recovered by contacting the isobutanol with an organic acid and a catalyst capable of esterifying the isobutanol with the organic acid.

    195. The method of claim 178, wherein solids are removed from the fermentation medium.

    196. The method of claim 195, wherein the solids are removed from the fermentation medium by centrifugation, filtration, decantation, or combinations thereof.

    197. The method of claim 195, wherein the solids are removed before the isobutanol is recovered.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0046] The accompanying drawings, which are incorporated herein and form a part of the specification, illustrate the present invention and, together with the description, further serve to explain the principles of the invention and to enable a person skilled in the pertinent art to make and use the invention.

    [0047] FIG. 1 shows biosynthetic pathways for isobutanol production.

    [0048] FIG. 2 is a schematic diagram showing an 11 amino acid motif spanning positions 378 to 388 of Streptococcus mutans (S. mutans) DHAD (SEQ ID NO:547).

    [0049] FIG. 3 is a graph illustrating isobutanol production in yeast strain PNY2115 transformants harboring 9 (Delta 9) S. mutans DHAD variants (P2A1, G2S2, L2F3, L2V4, I2V5, I2M6, L2I7, and L2M8) and the parental 9 S. mutans DHAD (control).

    [0050] FIG. 4 is a graph illustrating the isobutanol production in yeast strain PNY2115 transformants harboring 9 S. mutans DHAD variants (I2V5, L2F3, L2M8, and L2V4) and the parental 9 S. mutans DHAD (control).

    [0051] FIG. 5 is a graph illustrating the isobutanol production in yeast strain PNY2115 transformants harboring full length S. mutans DHAD variants (I2V5 clones 1 and 2 and L2V4) and the parental full length S. mutans DHAD (WT).

    [0052] FIG. 6 is a graph illustrating DHAD activity in yeast strain PNY2115 harboring full length S. mutans DHAD variants (I2V5 clone 1, I2V5 clone 2, and L2V4) and the parental full length S. mutans DHAD (WT).

    [0053] FIG. 7 is a graph illustrating DHIV accumulation in yeast strain PNY2115 harboring full length S. mutans DHAD variants (804-L2V4 and 804-I2V5) and the parental full length S. mutans DHAD (WT control).

    [0054] FIG. 8 is a graph illustrating DHAD activity in yeast strains expressing full length S. mutans DHAD (PNY1566/pLH804 (control)) and a tagged S. mutans DHAD (PNY1566/pLH689 (tagged)).

    [0055] FIG. 9 is a graph illustrating DHAD activity in yeast strains expressing full length S. mutans DHAD (pHR81 FBA-ilvD(Sm)) and a C-terminal-tagged S. mutans DHAD (pHR81 FBA-ilvD(Sm)-lum).

    [0056] FIG. 10 is a graph illustrating DHAD activity in yeast strains expressing C-terminal-tagged or non-tagged DHAD enzymes, including C-terminal-tagged constructs for S. mutans DHAD, Streptococcus downei (S. downei) DHAD, and Lactococcus lactis (L. lactis) DHAD (pBP1296, pBP4579, and pBP4588, respectively).

    [0057] FIG. 11 is a gel image showing tag detection for selected DHAD variants as described in the examples.

    [0058] FIG. 12 is a gel image showing tag detection for selected DHAD variants as described in the examples.

    [0059] FIG. 13 is a protein stained gel for selected DHAD variants as described in the examples.

    [0060] FIG. 14 is a graph illustrating the specific activity of DHAD ilvD S. mutans and DHAD ilvD Streptococcus macacae (S. macacae) in a BY4741 strain background.

    [0061] FIG. 15 is a graph illustrating the specific activity of DHAD ilvD_S. mutans and DHAD ilvD S. macacae in a BY4741 fra2 strain background.

    [0062] FIG. 16 is a graph illustrating DHAD activity in yeast strains expressing full length S. mutans DHAD (PNY1566/pLH804 (control)) and a C-terminal deletion S. mutans DHAD (PNY1566/pLH691(9)).

    [0063] FIG. 17 is a graph illustrating DHAD activity in yeast strains expressing full length S. mutans DHAD (pHR81 FBA-ilvD(Sm)) and a C-terminal deletion S. mutans DHAD (pHR81 FBA-ilvD(Sm)9 amino acids).

    [0064] Table 6 is a table of the Profile HAM for dihydroxy-acid dehydratases based on enzymes with assayed function prepared as described in the Examples. Table 6 is submitted herewith electronically and is incorporated herein by reference.

    DETAILED DESCRIPTION OF THE INVENTION

    [0065] For improved production of compounds synthesized in pathways including dihydroxy-acid dehydratase (DHAD), it is desirable to express a heterologous DHAD enzyme that provides this enzymatic activity in the production host of interest. However, there exists a need for alternative DHAD enzymes and DHAD variants that display modified activity as compared to a parental DHAD enzyme in heterologous organisms. Such enzymes may be employed for production of compounds from DHAD-requiring biosynthetic pathways.

    [0066] The present invention satisfies these and other needs, and provides further related advantages, as will be made apparent by the description of the embodiments that follow.

    [0067] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In case of conflict, the present application including the definitions will control. Also, unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular. All publications, patents and other references mentioned herein are incorporated by reference in their entireties for all purposes.

    Definitions

    [0068] In order to further define this invention, the following terms and definitions are herein provided.

    [0069] As used herein, the terms comprises, comprising, includes, including, has, having, contains or containing, or any other variation thereof, will be understood to imply the inclusion of a stated integer or group of integers but not the exclusion of any other integer or group of integers. For example, a composition, a mixture, a process, a method, an article, or an apparatus that comprises a list of elements is not necessarily limited to only those elements but can include other elements not expressly listed or inherent to such composition, mixture, process, method, article, or apparatus. Further, unless expressly stated to the contrary, or refers to an inclusive or and not to an exclusive or. For example, a condition A or B is satisfied by any one of the following: A is true (or present) and B is false (or not present), A is false (or not present) and B is true (or present), and both A and B are true (or present).

    [0070] As used herein, the term consists of, or variations such as consist of or consisting of, as used throughout the specification and claims, indicate the inclusion of any recited integer or group of integers, but that no additional integer or group of integers can be added to the specified method, structure, or composition.

    [0071] As used herein, the term consists essentially of, or variations such as consist essentially of or consisting essentially of, as used throughout the specification and claims, indicate the inclusion of any recited integer or group of integers, and the optional inclusion of any recited integer or group of integers that do not materially change the basic or novel properties of the specified method, structure or composition.

    [0072] Also, the indefinite articles a and an preceding an element or component of the invention are intended to be nonrestrictive regarding the number of instances, i.e., occurrences of the element or component. Therefore a or an should be read to include one or at least one, and the singular word form of the element or component also includes the plural unless the number is obviously meant to be singular.

    [0073] The terms invention or present invention as used herein are non-limiting terms and are not intended to refer to any single embodiment of the particular invention but encompass all possible embodiments as described in the application.

    [0074] As used herein, the term about modifying the quantity of an ingredient or reactant of the invention employed refers to variation in the numerical quantity that can occur, for example, through typical measuring and liquid handling procedures used for making concentrates or solutions in the real world; through inadvertent error in these procedures; through differences in the manufacture, source, or purity of the ingredients employed to make the compositions or to carry out the methods; and the like. The term about also encompasses amounts that differ due to different equilibrium conditions for a composition resulting from a particular initial mixture. Whether or not modified by the term about, the claims include equivalents to the quantities. In one embodiment, the term about means within 10% of the reported numerical value; in another embodiment, within 5% of the reported numerical value.

    [0075] The term alcohol as used herein refers to any of a series of hydroxyl compounds, the simplest of which are derived from saturated hydrocarbons, having the general formula C.sub.nH.sub.2n+1OH. Examples of alcohol include ethanol and butanol.

    [0076] The term butanol as used herein refers to n-butanol, 2-butanol, isobutanol, tert-butyl alcohol, individually or any mixtures thereof. Butanol can be from a biological source (i.e., biobutanol), for example.

    [0077] The term [2Fe-2S].sup.2+ DHAD refers to DHAD enzymes having a bound [2Fe-2S].sup.2+ iron-sulfur cluster.

    [0078] The term [4Fe-4S].sup.2+ DHAD refers to DHAD enzymes having a bound [4Fe-4S].sup.2+ iron-sulfur cluster.

    [0079] The terms acetohydroxy acid dehydratase and dihydroxy-acid dehydratase (DHAD) refer to an enzyme that catalyzes the conversion of 2,3-dihydroxyisovalerate to -ketoisovalerate. Example acetohydroxy acid dehydratases are known by the EC number 4.2.1.9. Such enzymes are available from a vast array of microorganisms, including, but not limited to, Escherichia coli (GenBank Nos: YP_026248, NC_000913), Saccharomyces cerevisiae (GenBank Nos: NP_012550, NC_001142), Methanococcus maripaludis (GenBank Nos: CAF29874, BX957219), Bacillus subtilis (GenBank Nos: CAB14105, Z99115), Lactobacillus lactic, and Neurospora crassa. U.S. Appl. Pub. No. 2010/0081154 and U.S. Pat. No. 7,851,188, which are incorporated herein by reference, describe dihydroxy-acid dehydratases (DHADs), including a DHAD from Streptococcus mutans (Nucleic Acid: SEQ ID NO:543; Amino Acid: SEQ ID NO:544).

    [0080] The term isobutanol biosynthetic pathway as used herein refers to an enzyme pathway to produce isobutanol from pyruvate.

    [0081] The terms acetohydroxyacid synthase, acetolactate synthase and acetolactate synthetase (abbreviated ALS) are used interchangeably herein to refer to an enzyme that catalyzes the conversion of pyruvate to acetolactate and CO.sub.2. Example acetolactate synthases are known by the EC number 2.2.1.6 (Enzyme Nomenclature 1992, Academic Press, San Diego). These enzymes are available from a number of sources, including, but not limited to, Bacillus subtilis (GenBank Nos. CAB07802.1, CAB15618 and Z99122, NCBI (National Center for Biotechnology Information) amino acid sequence, NCBI nucleotide sequence, respectively), Klebsiella pneumoniae (GenBank Nos. AAA25079 and M73842), and Lactococcus lactis (GenBank Nos. AAA25161 and L16975).

    [0082] The terms ketol-acid reductoisomerase (KARI), acetohydroxy acid reductoisomerase, and acetohydroxy acid isomeroreductase are used interchangeably herein to refer an enzyme that catalyzes the reaction of (S)-acetolactate to 2,3-dihydroxyisovalerate. Example KARI enzymes are classified as EC number 1.1.1.86 (Enzyme Nomenclature 1992, Academic Press, San Diego), and are available from a vast array of microorganisms, including, but not limited to, Escherichia coli (GenBank Nos. NP_418222 and NC_000913), Saccharomyces cerevisiae (GenBank Nos. NP_013459 and NC_001144), Methanococcus maripaludis (GenBank Nos. CAF30210 and BX957220), and Bacillus subtilis (GenBank Nos. CAB14789 and Z99118). KARIs include, for example, Anaerostipes caccae KARI variants K9G9, K9D3, and K9JB4P (e.g., SEQ ID NO:697). KARI enzymes are also described in U.S. Pat. Nos. 7,910,342 and 8,129,162, U.S. Appl. Pub. No. 2010/0197519, and PCT Appl. Pub. Nos. WO2011/041415, WO2012/129555, and WO2013/176909A2, which are incorporated herein by reference. Examples of KARIs disclosed therein include those from Lactococcus lactis, Vibrio cholera, Pseudomonas aeruginosa PAO1, Pseudomonas fluorescens PF5, and Anaerostipes caccae. In some embodiments, KARI utilizes NADH (reduced nicotinamide adenine dinucleotide). In some embodiments, KARI utilizes NADPH (reduced nicotinamide adenine dinucleotide phosphate).

    [0083] The terms branched-chain -keto acid decarboxylase, -ketoacid decarboxylase, -ketoisovalerate decarboxylase, and 2-ketoisovalerate decarboxylase (KIVD) are used interchangeably herein to refer to an enzyme that catalyzes the conversion of -ketoisovalerate to isobutyraldehyde and CO.sub.2. Example branched-chain -keto acid decarboxylases are known by the EC number 4.1.1.72 and are available from a number of sources, including, but not limited to, Lactococcus lactis (GenBank Nos. AAS49166, AY548760, CAG34226, and AJ746364, Salmonella typhimurium (GenBank Nos. NP_461346 and NC_003197), Clostridium acetobutylicum (GenBank Nos. NP_149189 and NC_001988), Macrococcus caseolyticus, and Listeria grayi. Example KIVD enzymes are disclosed in U.S. Appl. Pub. US 2013/0203138, incorporated by reference.

    [0084] The terms branched-chain alcohol dehydrogenase and alcohol dehydrogenase (ADH) are used interchangeably herein to refer to an enzyme that catalyzes the conversion of isobutyraldehyde to isobutanol. Example branched-chain alcohol dehydrogenases are known by the EC number 1.1.1.265, but can also be classified under other alcohol dehydrogenases (specifically, EC numbers 1.1.1.1 or 1.1.1.2). Alcohol dehydrogenases can be, for example, NADPH dependent or NADH dependent. Such enzymes are available from a number of sources, including, but not limited to, Saccharomyces cerevisiae (GenBank Nos. NP_010656, NC_001136, NP_014051, and NC_001145), Escherichia coli (GenBank Nos. NP_417484 and NC_000913), and Clostridium acetobutylicum (GenBank Nos. NP_349892, NC_003030, NP_349891, and NC_003030). U.S. Pat. No. 8,188,250 (incorporated herein by reference) describes SadB, an alcohol dehydrogenase (ADH) from Achromobacter xylosoxidans. Alcohol dehydrogenases also include horse liver ADH and Beijerinkia indica ADH (as described in U.S. Appl. Publ. No. 2011/0269199, which is incorporated herein by reference).

    [0085] The terms carbon substrate and fermentable carbon substrate are used interchangeably herein to refer to a carbon source capable of being metabolized by host organisms of the present invention and particularly carbon sources selected from the group consisting of monosaccharides, oligosaccharides, polysaccharides, and one-carbon substrates or mixtures thereof. Carbon substrates can include six carbon (C6) and five carbon (C5) sugars and mixtures thereof, such as, for example, glucose, sucrose or xylose.

    [0086] The term polynucleotide as used herein encompasses a singular nucleic acid as well as plural nucleic acids, and refers to a nucleic acid molecule or construct, e.g., messenger RNA (mRNA) or plasmid DNA (pDNA). A polynucleotide can contain the nucleotide sequence of the full-length cDNA sequence, or a fragment thereof, including the untranslated 5 and 3 sequences and the coding sequences. The polynucleotide can be composed of any polyribonucleotide or polydeoxyribonucleotide, which can be unmodified RNA or DNA or modified RNA or DNA. For example, polynucleotides can be composed of single- and double-stranded DNA, DNA that is a mixture of single- and double-stranded regions, single- and double-stranded RNA, and RNA that is mixture of single- and double-stranded regions, hybrid molecules comprising DNA and RNA that can be single-stranded or, more typically, double-stranded or a mixture of single- and double-stranded regions. Polynucleotide embraces chemically, enzymatically, or metabolically modified forms.

    [0087] The term gene refers to a nucleic acid fragment that is capable of being expressed as a specific protein, optionally including regulatory sequences preceding (5 non-coding sequences) and following (3 non-coding sequences) the coding sequence. Native gene refers to a gene as found in nature with its own regulatory sequences. Chimeric gene refers to any gene that is not a native gene, comprising regulatory and coding sequences that are not found together in nature. Accordingly, a chimeric gene can comprise regulatory sequences and coding sequences that are derived from different sources, or regulatory sequences and coding sequences derived from the same source, but arranged in a manner different than that found in nature. Endogenous gene refers to a native gene in its natural location in the genome of an organism. A foreign gene or heterologous gene refers to a gene not normally found in the host organism, but that is introduced into the host organism by gene transfer. Foreign genes can comprise native genes inserted into a non-native organism, or chimeric genes. A transgene is a gene that has been introduced into the genome by a transformation procedure.

    [0088] As used herein, the term coding region refers to a DNA sequence that codes for a specific amino acid sequence. Suitable regulatory sequences refers to nucleotide sequences located upstream (5 non-coding sequences), within, or downstream (3 non-coding sequences) of a coding sequence, and which influence the transcription, RNA processing or stability, or translation of the associated coding sequence. Regulatory sequences can include promoters, translation leader sequences, introns, polyadenylation recognition sequences, RNA processing site, effector binding site and stem-loop structure.

    [0089] Regulatory sequences refers to nucleotide sequences located upstream (5 non-coding sequences), within, or downstream (3 non-coding sequences) of a coding sequence, and which influence the transcription, RNA processing or stability, or translation of the associated coding sequence. Regulatory sequences can include promoters, enhancers, operators, repressors, transcription termination signals, translation leader sequences, introns, polyadenylation recognition sequences, RNA processing site, effector binding site and stem-loop structure.

    [0090] The term promoter refers to a DNA sequence capable of controlling the expression of a coding sequence or functional RNA. In general, a coding sequence is located 3 to a promoter sequence. Promoters can be derived in their entirety from a native gene, or composed of different elements derived from different promoters found in nature, or even comprise synthetic DNA segments. It is understood by those skilled in the art that different promoters can direct the expression of a gene in different tissues or cell types, or at different stages of development, or in response to different environmental or physiological conditions. Promoters which cause a gene to be expressed in most cell types at most times are commonly referred to as constitutive promoters. It is further recognized that since in most cases the exact boundaries of regulatory sequences have not been completely defined, DNA fragments of different lengths can have identical promoter activity.

    [0091] The term operably linked refers to the association of nucleic acid sequences on a single nucleic acid fragment so that the function of one is affected by the other. For example, a promoter is operably linked with a coding sequence when it is capable of effecting the expression of that coding sequence (i.e., that the coding sequence is under the transcriptional control of the promoter). Coding sequences can be operably linked to regulatory sequences in sense or antisense orientation.

    [0092] The term expression, as used herein, refers to the transcription and stable accumulation of sense (mRNA) or antisense RNA derived from the nucleic acid fragment of the invention. Expression can also refer to translation of mRNA into a polypeptide.

    [0093] The term over-expression, as used herein, refers to expression that is higher than endogenous expression of the same or related polynucleotide or gene. A heterologous polynucleotide or gene is also over-expressed if its expression is higher than that of a comparable endogenous gene, or if its expression is higher than that of the same polynucleotide or gene introduced by a means that does not overexpress the polynucleotide or gene. For example, a polynucleotide can be expressed in a host cell from a low copy number plasmid, which is present in only limited or few copies, and the same polynucleotide can be over-expressed in a host cell from a high copy number plasmid or a plasmid with a copy number that can be regulated, which is present in multiple copies. Any means can be used to over-express a polynucleotide, so long as it increases the copies of the polynucleotide in the host cell. In addition to using a high copy number plasmid, or a plasmid with a copy number that can be regulated, a polynucleotide can be over-expressed by multiple chromosomal integrations.

    [0094] Expression or over-expression of a polypeptide of the invention in a recombinant host cell can be quantified according to any number of methods known to the skilled artisan and can be represented, e.g., by a percent of total cell protein. The percent of total protein can be an amount selected from greater than about 0.001% of total cell protein; greater than about 0.01% of total cell protein; greater than about 0.1% of total cell protein; greater than about 0.5% of total cell protein; greater than about 1.0% of total cell protein; greater than about 2.0% of total cell protein; greater than about 3.0% of total cell protein; greater than about 4.0% of total cell protein; greater than about 5.0% of total cell protein; greater than about 6.0% of total cell protein; greater than about 7.0% of total cell protein; greater than about 8.0% of total cell protein; greater than about 9.0% of total cell protein; greater than about 10% of total cell protein; or greater than about 20% of total cell protein. In one embodiment, the amount of polypeptide expressed is greater that about 0.5% of total cell protein. In another embodiment, the amount of polypeptide expressed is greater than about 1.0% of total cell protein or greater than about 2.0% of total cell protein.

    [0095] As used herein, the term transformation refers to the transfer of a nucleic acid fragment into a host organism, resulting in genetically stable inheritance. Host organisms containing the transformed nucleic acid fragments are referred to as transgenic or recombinant or transformed organisms.

    [0096] The terms plasmid and vector as used herein, refer to an extra chromosomal element often carrying genes which are not part of the central metabolism of the cell, and usually in the form of circular double-stranded DNA molecules. Such elements can be autonomously replicating sequences, genome integrating sequences, phage or nucleotide sequences, linear or circular, of a single- or double-stranded DNA or RNA, derived from any source, in which a number of nucleotide sequences have been joined or recombined into a unique construction which is capable of introducing a promoter fragment and DNA sequence for a selected gene product along with appropriate 3 untranslated sequence into a cell.

    [0097] A recombinant host cell is defined as a host cell that has been genetically manipulated to express a biosynthetic production pathway, wherein the host cell either produces a biosynthetic product in greater quantities relative to an unmodified host cell or produces a biosynthetic product that is not ordinarily produced by an unmodified host cell.

    [0098] The term engineered as applied to a isobutanol biosynthetic pathway refers to the isobutanol biosynthetic pathway that is manipulated, such that the carbon flux from pyruvate through the engineered isobutanol biosynthetic pathway is maximized, thereby producing an increased amount of isobutanol directly from the fermentable carbon substrate. Such engineering includes expression of heterologous polynucleotides or polypeptides, overexpression of endogenous polynucleotides or polypeptides, cytosolic localization of proteins that do not naturally localize to cytosol, increased cofactor availability, decreased activity of competitive pathways, etc.

    [0099] The term codon optimized as it refers to genes or coding regions of nucleic acid molecules for transformation of various hosts, refers to the alteration of codons in the gene or coding regions of the nucleic acid molecules to reflect the typical codon usage of the host organism without altering the polypeptide encoded by the DNA. Such optimization includes replacing at least one, or more than one, or a significant number, of codons with one or more codons that are more frequently used in the genes of that organism.

    [0100] Deviations in the nucleotide sequence that comprise the codons encoding the amino acids of any polypeptide chain allow for variations in the sequence coding for the gene. Since each codon consists of three nucleotides, and the nucleotides comprising DNA are restricted to four specific bases, there are 64 possible combinations of nucleotides, 61 of which encode amino acids (the remaining three codons encode signals ending translation). The genetic code which shows which codons encode which amino acids is reproduced herein as Table 1. As a result, many amino acids are designated by more than one codon. For example, the amino acids alanine and proline are coded for by four triplets, serine and arginine by six, whereas tryptophan and methionine are coded by just one triplet. This degeneracy allows for DNA base composition to vary over a wide range without altering the amino acid sequence of the proteins encoded by the DNA.

    TABLE-US-00001 TABLE 1 The Standard Genetic Code T C A G T TTT Phe (F) TCT Ser (S) TAT Tyr (Y) TGT Cys (C) TTC Phe (F) TCC Ser (S) TAC Tyr (Y) TGC TTA Leu (L) TCA Ser (S) TAA Stop TGA Stop TTG Leu (L) TCG Ser (S) TAG Stop TGG Trp (W) C CTT Leu (L) CCT Pro (P) CAT His (H) CGT Arg (R) CTC Leu (L) CCC Pro (P) CAC His (H) CGC Arg (R) CTA Leu (L) CCA Pro (P) CAA Gln (Q) CGA Arg (R) CTG Leu (L) CCG Pro (P) CAG Gln (Q) CGG Arg (R) A ATT Ile (I) ACT Thr (T) AAT Asn (N) AGT Ser (S) ATC Ile (I) ACC Thr (T) AAC Asn (N) AGC Ser (S) ATA Ile (I) ACA Thr (T) AAA Lys (K) AGA Arg (R) ATG Met ACG Thr (T) AAG Lys (K) AGG Arg (R) (M) G GTT Val (V) GCT Ala (A) GAT Asp (D) GGT Gly (G) GTC Val (V) GCC Ala (A) GAC Asp (D) GGC Gly (G) GTA Val (V) GCA Ala (A) GAA Glu (E) GGA Gly (G) GTG Val (V) GCG Ala (A) GAG Glu (E) GGG Gly (G)

    [0101] Many organisms display a bias for use of particular codons to code for insertion of a particular amino acid in a growing peptide chain. Codon preference, or codon bias, differences in codon usage between organisms, is afforded by degeneracy of the genetic code, and is well documented among many organisms. Codon bias often correlates with the efficiency of translation of messenger RNA (mRNA), which is in turn believed to be dependent on, inter alia, the properties of the codons being translated and the availability of particular transfer RNA (tRNA) molecules. The predominance of selected tRNAs in a cell is generally a reflection of the codons used most frequently in peptide synthesis. Accordingly, genes can be tailored for optimal gene expression in a given organism based on codon optimization.

    [0102] As used herein, an isolated nucleic acid fragment or isolated nucleic acid molecule are used interchangeably herein and mean a polymer of RNA or DNA that is single- or double-stranded, optionally containing synthetic, non-natural or altered nucleotide bases. Accordingly, an isolated nucleic acid fragment or molecule can be, for example, recombinant or engineered. An isolated nucleic acid fragment in the form of a polymer of DNA can be comprised of one or more segments of cDNA, genomic DNA or synthetic DNA.

    [0103] A nucleic acid fragment is hybridizable to another nucleic acid fragment, such as a cDNA, genomic DNA, or RNA molecule, when a single-stranded form of the nucleic acid fragment can anneal to the other nucleic acid fragment under the appropriate conditions of temperature and solution ionic strength. Hybridization and washing conditions are well known and exemplified, for example, in Sambrook, J., Fritsch, E. F. and Maniatis, T. Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory: Cold Spring Harbor, N.Y. (1989), particularly Chapter 11 and Table 11.1 therein (incorporated herein by reference in its entirety). The conditions of temperature and ionic strength determine the stringency of the hybridization. Stringency conditions can be adjusted to screen for moderately similar fragments (such as homologous sequences from distantly related organisms), to highly similar fragments (such as genes that duplicate functional enzymes from closely related organisms). Post-hybridization washes determine stringency conditions. One set of preferred conditions uses a series of washes starting with 6SSC, 0.5% SDS at room temperature for 15 min, then repeated with 2SSC, 0.5% SDS at 45 C. for 30 min, and then repeated twice with 0.2SSC, 0.5% SDS at 50 C. for 30 min. A more preferred set of stringent conditions uses higher temperatures in which the washes are identical to those above except for the temperature of the final two 30 min washes in 0.2SSC, 0.5% SDS was increased to 60 C. Another preferred set of highly stringent conditions uses two final washes in 0.1SSC, 0.1% SDS at 65 C. An additional set of stringent conditions include hybridization at 0.1SSC, 0.1% SDS, 65 C. and washes with 2SSC, 0.1% SDS followed by 0.1SSC, 0.1% SDS, for example.

    [0104] Hybridization requires that the two nucleic acids contain complementary sequences, although depending on the stringency of the hybridization, mismatches between bases are possible. The appropriate stringency for hybridizing nucleic acids depends on the length of the nucleic acids and the degree of complementation, variables well known in the art. The greater the degree of similarity or homology between two nucleotide sequences, the greater the value of Tm for hybrids of nucleic acids having those sequences. The relative stability (corresponding to higher Tm) of nucleic acid hybridizations decreases in the following order: RNA:RNA, DNA:RNA, DNA:DNA. For hybrids of greater than 100 nucleotides in length, equations for calculating Tm have been derived (see Sambrook et al., supra, 9.50-9.51). For hybridizations with shorter nucleic acids, i.e., oligonucleotides, the position of mismatches becomes more important, and the length of the oligonucleotide determines its specificity (see Sambrook et al., supra, 11.7-11.8). In one embodiment, the length for a hybridizable nucleic acid is at least about 10 nucleotides. Preferably, a minimum length for a hybridizable nucleic acid is at least about 15 nucleotides; more preferably at least about 20 nucleotides; and most preferably the length is at least about 30 nucleotides. Furthermore, the skilled artisan will recognize that the temperature and wash solution salt concentration can be adjusted as necessary according to factors such as length of the probe.

    [0105] As used herein, the term polypeptide is intended to encompass a singular polypeptide as well as plural polypeptides, and refers to a molecule composed of monomers (amino acids) linearly linked by amide bonds (also known as peptide bonds). The term polypeptide refers to any chain or chains of two or more amino acids, and does not refer to a specific length of the product. Thus, peptides, dipeptides, tripeptides, oligopeptides, protein, amino acid chain, or any other term used to refer to a chain or chains of two or more amino acids, are included within the definition of polypeptide, and the term polypeptide can be used instead of, or interchangeably with any of these terms. A polypeptide can be derived from a natural biological source or produced by recombinant technology, but is not necessarily translated from a designated nucleic acid sequence. It can be generated in any manner, including by chemical synthesis.

    [0106] By an isolated polypeptide or a fragment, variant, or derivative thereof is intended a polypeptide that is not in its natural milieu. No particular level of purification is required. For example, an isolated polypeptide can be removed from its native or natural environment. Recombinantly produced polypeptides and proteins expressed in host cells are considered isolated for purposes of the invention, as are native or recombinant polypeptides which have been separated, fractionated, or partially or substantially purified by any suitable technique.

    [0107] As used herein, the term variant refers to a polypeptide differing from a specifically recited polypeptide of the invention, such as DHAD, by amino acid insertions, deletions, mutations, and substitutions, created using, e.g., recombinant DNA techniques, such as mutagenesis. Guidance in determining which amino acid residues can be replaced, added, or deleted without abolishing activities of interest, can be found by comparing the sequence of the particular polypeptide with that of homologous polypeptides, e.g., yeast or bacterial, and minimizing the number of amino acid sequence changes made in regions of high homology (conserved regions) or by replacing amino acids with consensus sequences.

    [0108] Alternatively, recombinant polynucleotide variants encoding these same or similar polypeptides can be synthesized or selected by making use of the redundancy in the genetic code. Various codon substitutions, such as silent changes which produce various restriction sites, can be introduced to optimize cloning into a plasmid or viral vector for expression. Mutations in the polynucleotide sequence can be reflected in the polypeptide or domains of other peptides added to the polypeptide to modify the properties of any part of the polypeptide.

    [0109] Amino acid substitutions can be the result of replacing one amino acid with another amino acid having similar structural and/or chemical properties, i.e., conservative amino acid replacements, or they can be the result of replacing one amino acid with an amino acid having different structural and/or chemical properties, i.e., non-conservative amino acid replacements. Conservative amino acid substitutions can be made on the basis of similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity, or the amphipathic nature of the residues involved. For example, nonpolar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan, and methionine; polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine, and glutamine; positively charged (basic) amino acids include arginine, lysine, and histidine; and negatively charged (acidic) amino acids include aspartic acid and glutamic acid. Alternatively, non-conservative amino acid substitutions can be made by selecting the differences in polarity, charge, solubility, hydrophobicity, hydrophilicity, or the amphipathic nature of any of these amino acids. Insertions or deletions can be within the range of variation as structurally or functionally tolerated by the recombinant proteins. The variation allowed can be experimentally determined by systematically making insertions, deletions, or substitutions of amino acids in a polypeptide molecule using recombinant DNA techniques and assaying the resulting recombinant variants for activity.

    [0110] A substantial portion of an amino acid or nucleotide sequence is that portion comprising enough of the amino acid sequence of a polypeptide or the nucleotide sequence of a gene to putatively identify that polypeptide or gene, either by manual evaluation of the sequence by one skilled in the art, or by computer-automated sequence comparison and identification using algorithms such as BLAST (Altschul, S. F., et al., J. Mol. Biol., 215:403-410 (1993)). In general, a sequence of ten or more contiguous amino acids or thirty or more nucleotides is necessary in order to putatively identify a polypeptide or nucleic acid sequence as homologous to a known protein or gene. Moreover, with respect to nucleotide sequences, gene specific oligonucleotide probes comprising 20-30 contiguous nucleotides can be used in sequence-dependent methods of gene identification (e.g., Southern hybridization) and isolation (e.g., in situ hybridization of bacterial colonies or bacteriophage plaques). In addition, short oligonucleotides of 12-15 bases can be used as amplification primers in PCR in order to obtain a particular nucleic acid fragment comprising the primers. Accordingly, a substantial portion of a nucleotide sequence comprises enough of the sequence to specifically identify and/or isolate a nucleic acid fragment comprising the sequence. The instant specification teaches the complete amino acid and nucleotide sequence encoding particular proteins. The skilled artisan, having the benefit of the sequences as reported herein, can now use all or a substantial portion of the disclosed sequences for purposes known to those skilled in this art. Accordingly, the instant invention comprises the complete sequences as reported in the accompanying Sequence Listing, as well as substantial portions of those sequences as defined above.

    [0111] The term complementary is used to describe the relationship between nucleotide bases that are capable of hybridizing to one another. For example, with respect to DNA, adenosine is complementary to thymine and cytosine is complementary to guanine.

    [0112] The term percent identity, as known in the art, is a relationship between two or more polypeptide sequences or two or more polynucleotide sequences, as determined by comparing the sequences. In the art, identity or sequence identity also means the degree of sequence relatedness between polypeptide or polynucleotide sequences, as the case may be, as determined by the match between strings of such sequences. Identity and similarity can be readily calculated by known methods, including but not limited to those described in: (1. Computational Molecular Biology (Lesk, A. M., Ed.) Oxford University: NY (1988); (2) Biocomputing: Informatics and Genome Projects (Smith, D. W., Ed.) Academic: NY (1993); (3) Computer Analysis of Sequence Data, Part I (Griffin, A. M., and Griffin, H. G., Eds.) Humania: NJ (1994); (4) Sequence Analysis in Molecular Biology (von Heinje, G., Ed.) Academic (1987); and (5) Sequence Analysis Primer (Gribskov, M. and Devereux, J., Eds.) Stockton: NY (1991).

    [0113] Preferred methods to determine identity are designed to give the best match between the sequences tested. Methods to determine identity and similarity are codified in publicly available computer programs. Sequence alignments and percent identity calculations can be performed using the MegAlign program of the LASERGENE bioinformatics computing suite (DNASTAR Inc., Madison, Wis.). Multiple alignment of the sequences is performed using the Clustal method of alignment which encompasses several varieties of the algorithm including the Clustal V method of alignment corresponding to the alignment method labeled Clustal V (described by Higgins and Sharp, CABIOS. 5:151-153 (1989); Higgins, D. G. et al., Comput. Appl. Biosci., 8:189-191 (1992)) and found in the MegAlign program of the LASERGENE bioinformatics computing suite (DNASTAR Inc.). For multiple alignments, the default values correspond to GAP PENALTY=10 and GAP LENGTH PENALTY=10. Default parameters for pairwise alignments and calculation of percent identity of protein sequences using the Clustal method are KTUPLE=1, GAP PENALTY=3, WINDOW=5 and DIAGONALS SAVED=5. For nucleic acids these parameters are KTUPLE=2, GAP PENALTY=5, WINDOW=4 and DIAGONALS SAVED=4. After alignment of the sequences using the Clustal V program, it is possible to obtain a percent identity by viewing the sequence distances table in the same program. Additionally, the Clustal W method of alignment is available and corresponds to the alignment method labeled Clustal W (described by Higgins and Sharp, CABIOS. 5:151-153 (1989); Higgins, D. G. et al., Comput. Appl. Biosci. 8:189-191 (1992); Thompson, J. D., Higgins, D. G., and Gibson T. J. (1994) Nuc. Acid Res. 22: 4673-4680) and found in the MegAlign v6.1 program of the LASERGENE bioinformatics computing suite (DNASTAR Inc.). Default parameters for multiple alignment are GAP PENALTY=10, GAP LENGTH PENALTY=0.2, Delay Divergen Seqs (%)=30, DNA Transition Weight=0.5, Protein Weight Matrix=Gonnet Series, DNA Weight Matrix=IUB. After alignment of the sequences using the Clustal W program, it is possible to obtain a percent identity by viewing the sequence distances table in the same program.

    [0114] It is well understood by one skilled in the art that many levels of sequence identity are useful in identifying polypeptides, from other species, wherein such polypeptides have the same or similar function or activity. Useful examples of percent identities include, but are not limited to: 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%, or any integer percentage from 55% to 100% is useful in describing the present invention, such as 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%. Suitable nucleic acid fragments not only have the above homologies but typically encode a polypeptide having at least 50 amino acids, preferably at least 100 amino acids, more preferably at least 150 amino acids, still more preferably at least 200 amino acids, and most preferably at least 250 amino acids.

    [0115] The term sequence analysis software refers to any computer algorithm or software program that is useful for the analysis of nucleotide or amino acid sequences. Sequence analysis software can be commercially available or independently developed. Typical sequence analysis software will include, but is not limited to: (1) the GCG suite of programs (Wisconsin Package Version 9.0, Genetics Computer Group (GCG), Madison, Wis.); (2) BLASTP, BLASTN, BLASTX (Altschul et al., J. Mol. Biol., 215:403-410 (1990)); (3) DNASTAR (DNASTAR, Inc. Madison, Wis.); (4) Sequencher (Gene Codes Corporation, Ann Arbor, Mich.); and (5) the FASTA program incorporating the Smith-Waterman algorithm (W. R. Pearson, Comput. Methods Genome Res., [Proc. Int. Symp.] (1994), Meeting Date 1992, 111-20. Editor(s): Suhai, Sandor. Plenum: New York, N.Y.). Within the context of this application it will be understood that where sequence analysis software is used for analysis, that the results of the analysis will be based on the default values of the program referenced, unless otherwise specified. As used herein, default values means any set of values or parameters that originally load with the software when first initialized.

    [0116] Fermentation medium as used herein means a mixture of water, fermentable carbon substrates, dissolved solids, fermentation product and all other constituents of the material held in the fermentation vessel in which the fermentation product is being made by the reaction of fermentable carbon substrates to fermentation products, water and carbon dioxide (CO.sub.2) by the microorganisms present. From time to time, as used herein, the terms fermentation broth and fermentation mixture can be used synonymously with fermentation medium.

    [0117] As used herein, the term yield refers to the amount of product in grams per amount of carbon source in grams (g/g). The yield can be exemplified, for example, for glucose as the carbon source. It is understood, unless otherwise noted, that yield is expressed as a percentage of the theoretical yield. In reference to a microorganism or metabolic pathway, theoretical yield is defined as the maximum amount of product that can be generated per total amount of substrate as dictated by the stoichiometry of the metabolic pathway used to make the product. For example, the theoretical yield for one typical conversion of glucose to isopropanol is 0.33 g/g. As such, a yield of isopropanol from glucose of 0.297 g/g would be expressed as 90% of theoretical or 90% theoretical yield. It is understood that, while in the present disclosure the yield is exemplified for glucose as a carbon source, the invention can be applied to other carbon sources and the yield can vary depending on the carbon source used. One skilled in the art can calculate yields on various carbon sources.

    [0118] The term titer as used herein, refers to the total amount of butanol isomer produced by fermentation per liter of fermentation medium. The total amount of butanol isomer includes: (i) the amount of butanol in the fermentation medium; (ii) the amount of butanol isomer recovered from the organic extractant; and (iii) the amount of butanol isomer recovered from the gas phase, if gas stripping is used.

    [0119] Standard recombinant DNA and molecular cloning techniques used herein are well known in the art and are described by Sambrook, J., Fritsch, E. F. and Maniatis, T., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989) (hereinafter Maniatis); and by Silhavy, T. J., Bennan, M. L. and Enquist, L. W., Experiments with Gene Fusions, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1984); and by Ausubel, F. M. et al., Current Protocols in Molecular Biology, published by Greene Publishing Assoc. and Wiley-Interscience (1987). Additional methods used herein are in Methods in Enzymology, Volume 194, Guide to Yeast Genetics and Molecular and Cell Biology (Part A, 2004, Christine Guthrie and Gerald R. Fink (Eds.), Elsevier Academic Press, San Diego, Calif.).

    DHAD Variants

    [0120] As described above, dihydroxy-acid dehydratase (DHAD), also called acetohydroxy acid dehydratase, catalyzes the conversion of 2,3-dihydroxyisovalerate to -ketoisovalerate and of 2,3-dihydroxymethylvalerate to -ketomethylvalerate. The DHAD enzyme is part of naturally occurring biosynthetic pathways producing valine, isoleucine, leucine and pantothenic acid (vitamin B5). DHAD catalyzed conversion of 2,3-dihydroxyisovalerate to -ketoisovalerate is also a step in the multiple isobutanol biosynthetic pathways that are disclosed in U.S. Pat. No. 7,851,188 and (both incorporated herein by reference). For production of compounds synthesized in pathways including DHAD, it is desirable to express a heterologous DHAD enzyme that provides DHAD enzymatic activity in a host cell. A consideration for functional expression of dihydroxy-acid dehydratases in a heterologous host is the enzyme's requirement for an iron-sulfur (FeS) cluster, which involves availability and proper loading of the cluster into the DHAD apo-protein.

    [0121] The present invention is based on the discovery that certain variants of DHAD have DHAD activity, and, in some embodiments, improved activity compared to the parental DHAD molecule. DHAD variants are desirable for production of products produced by DHAD containing biosynthetic pathways, particularly isobutanol.

    [0122] It has been discovered that alterations in the amino acid sequence of an 11-amino acid motif found in DHAD enzymes can lead to improved DHAD activity as indicated by increased isobutanol production. For the purposes of the present invention, amino acid substitutions were made in the Streptococcus mutans DHAD enzyme (SEQ ID NO:544), however, equivalent substitutions can be made in the homologous regions of DHAD enzymes from other organisms. A list of example DHAD enzymes that may be used to produce the DHAD variants of the invention is included below in Tables 3-5. Other sources of DHADs include, for example, Streptococcus downei, Oscillatoria species PCC 6506, Zea mays, Lactococcus lactis, Neurospora crassa, and Streptococcus macacae.

    [0123] An 11-amino acid motif sequence which may be found in DHAD enzymes is: P-K-X-X-X-G-X-I/L-X-I-L, wherein X represents any amino acid (SEQ ID NO:875). This motif encompasses amino acid positions 378 through 388 of the Streptococcus mutans DHAD enzyme. Throughout this description, the positions of the amino acids in the 11-amino acid motif are numbered 1 through 11, with amino acid residue 1 representing the first proline and amino acid residue 11 representing the last leucine. In addition, amino acids are described herein using either the full name of the amino acid or the 1-letter or 3-letter abbreviation of the amino acid, as indicated in Table 2.

    TABLE-US-00002 TABLE 2 Amino Acids and their Abbreviations Amino Acid 1-Letter Symbol 3-Letter Symbol Alanine A Ala Arginine R Arg Asparagine N Asn Aspartic acid D Asp Cysteine C Cys Glutamine Q Gln Glutamic acid E Glu Pyroglutamic acid pQ pGlu Glycine G Gly Histidine H His Hydroxylysine Hyl Hydroxyproline, 4(R)-L- O Hyp Isoleucine I Ile Leucine L Leu Lysine K Lys Methionine M Met Phenylalanine F Phe Proline P Pro Serine S Ser Threonine T Thr Tryptophan W Trp Tyrosine Y Tyr Valine V Val

    [0124] The amino acid changes that were made and/or contemplated by the present invention to produce alternative, active DHAD enzymes are described herein, for example, by a three character code that begins with the 1-letter abbreviation of the native amino acid, followed by the amino acid position number, and followed by the 1-letter abbreviation of the identity of the substituted amino acid. For example, P1A refers to a proline to alanine substitution of the first position of the DHAD motif described, e.g., in SEQ ID NO:547. As explained above, the substitution in the first position represented by P1A (numbering according to the DHAD motif of SEQ ID NO:547) corresponds to position 378 of the Streptococcus mutans DHAD enzyme. Accordingly, P1A corresponds to P378A when the substitution is expressed in terms of the corresponding position of Streptococcus mutans DHAD. In some embodiments, the amino acid changes that were made and/or contemplated to produce alternative, active DHAD enzymes include, for example, P1A, P1G, P1V, P1I, P1L, K2I, K2L, G6S, G6A, G6V, G6L, G6I, L8F, L8V, L8G, L8A, L8V, I10V, I10M, I10L, I10G, I10A, L11I, L11M, L11V, L11A, and L11G, corresponding to the DHAD motif described, e.g., in SEQ ID NO:547. When expressed in terms of the corresponding positions of Streptococcus mutans DHAD, these substitutions are P378A, P378G, P378V, P378I, P378L, K379I, K379L, G383S, G383A, G383V, G383L, G383I, L385F, L385V, L385G, L385A, L385V, I387V, I387M, I387L, 1387G, I387A, L388I, L388M, L388V, L388A, and L388G. Accordingly, examples of DHAD variants of the invention include, for example, a DHAD having a substitution of one or more of P378A, P378G, P378V, P378I, P378L, K379I, K379L, G383S, G383A, G383V, G383L, G383I, L385F, L385V, L385G, L385A, L385V, I387V, I387M, I387L, I387G, I387A, L388I, L388M, L388V, L388A, and L388G. As described in the Examples, clones containing a P378A substitution are referenced as P2A1 (for example, delta9-P2A1 and 689-P2A1). Clones containing a G383S substitution are referenced as G2S2 (for example, delta9-G2S2 and 689-G2S2). Clones containing a L385F substitution are referenced as L2F3 (for example, delta9-L2F3 and 689-L2F3). Clones containing a L385V substitution are referenced as L2V4 (for example, delta9-L2V4, 804-L2V4 and 689-L2V4). Clones containing a I387V substitution are referenced as I2V5 (for example, delta9-I2V5, 804-I2V5 and 689-I2V5). Clones containing a I387M substitution are referenced as I2M6 (for example, delta9-I2M6 and 689-I2M6). Clones containing a L388I substitution are referenced as L2I7 (for example, delta9-L2I7 and 689-L2I7). Clones containing a L388M substitution are referenced as L2M8 (for example, delta9-L2M8 and 689-L2M8). However, one or more of such substitutions can be made in the corresponding residue(s) of other DHAD enzymes.

    [0125] Examples of alternative, active DHAD enzymes are described herein and include, for example, Streptococcus mutans P2A1 (Nucleic Acid: SEQ ID NO:549; Amino Acid: SEQ ID NO:550), Streptococcus mutans P2A1 delta9 (9) (Nucleic Acid: SEQ ID NO:551; Amino Acid: SEQ ID NO:552), Streptococcus mutans G2S2 (Nucleic Acid: SEQ ID NO:554; Amino Acid: SEQ ID NO:555), Streptococcus mutans G2S2 delta9 (9) (Nucleic Acid: SEQ ID NO:556; Amino Acid: SEQ ID NO:557), Streptococcus mutans L2F3 (Nucleic Acid: SEQ ID NO:559; Amino Acid: SEQ ID NO:560), Streptococcus mutans L2F3 (9) (Nucleic Acid: SEQ ID NO:561; Amino Acid: SEQ ID NO:562), Streptococcus mutans L2V4 (Nucleic Acid: SEQ ID NO:564; Amino Acid: SEQ ID NO:565), Streptococcus mutans L2V4 delta9 (9) (Nucleic Acid: SEQ ID NO:566; Amino Acid: SEQ ID NO:567), Streptococcus mutans I2V5 (Nucleic Acid: SEQ ID NO:569; Amino Acid: SEQ ID NO:570), Streptococcus mutans I2V5 delta9 (9) (Nucleic Acid: SEQ ID NO:571; Amino Acid: SEQ ID NO:572), Streptococcus mutans I2M6 (Nucleic Acid: SEQ ID NO:574; Amino Acid: SEQ ID NO:575), Streptococcus mutans I2M6 delta9 (9) (Nucleic Acid: SEQ ID NO:576; Amino Acid: SEQ ID NO:577), Streptococcus mutans L2I7 (Nucleic Acid: SEQ ID NO:579; Amino Acid: SEQ ID NO:580), Streptococcus mutans L2I7 delta9 (9) (Nucleic Acid: SEQ ID NO:581; Amino Acid: SEQ ID NO:582), Streptococcus mutans L2M8 (Nucleic Acid: SEQ ID NO:584; Amino Acid: SEQ ID NO:585), Streptococcus mutans L2M8 delta9 (9) (Nucleic Acid: SEQ ID NO:586; Amino Acid: SEQ ID NO:587), Streptococcus mutans 689-P2A1 (Nucleic Acid: SEQ ID NO:860; Amino Acid: SEQ ID NO:861), Streptococcus mutans 689-G2S2 (Nucleic Acid: SEQ ID NO:862; Amino Acid: SEQ ID NO:863), Streptococcus mutans 689-L2F3 (Nucleic Acid: SEQ ID NO:864; Amino Acid: SEQ ID NO:865), Streptococcus mutans 689-L2V4 (Nucleic Acid: SEQ ID NO:866; Amino Acid: SEQ ID NO:867), Streptococcus mutans 689-I2V5 (Nucleic Acid: SEQ ID NO:786; Amino Acid: SEQ ID NO:787), Streptococcus mutans 689-I2M6 (Nucleic Acid: SEQ ID NO:868; Amino Acid: SEQ ID NO:869), Streptococcus mutans 689-L2I7 (Nucleic Acid: SEQ ID NO:870; Amino Acid: SEQ ID NO:871), and Streptococcus mutans 689-L2M8 (Nucleic Acid: SEQ ID NO:872; Amino Acid: SEQ ID NO:873). Accordingly, in some embodiments, the invention is directed to an isolated polypeptide or fragment thereof having DHAD activity, wherein the polypeptide or fragment thereof comprises one or more amino acid substitutions selected from P1A, P1S, G6S, G6A, L8F, L8V, L8M, L8A, I10V, I10M, I10L, I10G, I10A, L11I, L11M, L11V, L11A, and L11F (numbering corresponding to the conserved 11-amino acid motif sequence found in DHAD enzymes of P-K-X-X-X-G-X-I/L-X-I-L, wherein X represents any amino acid amino acid), or one or more amino acid substitutions corresponding to amino acid positions P1A, P1S, G6S, G6A, L8F, L8V, L8M, L8A, I10V, I10M, I10L, I10G, I10A, L11I, L11M, L11V, L11A, and L11F of S. mutans DHAD.

    [0126] In some embodiments, the invention provides an isolated polypeptide or fragment thereof having DHAD activity, wherein the polypeptide or fragment thereof comprises an amino acid motif which is at least 90% identical to the amino acid sequence of SEQ ID NO:547, wherein the amino acid residue at position 2 of SEQ ID NO:547 is not isoleucine or leucine, and wherein the amino acid motif comprises one or more amino acid substitutions selected from: P1A, P1S, G6S, G6A, L8F, L8V, L8M, L8A, I10V, I10M, I10L, I10G, I10A, L11I, L11M, L11V, L11A, and L11F. In other embodiments, the polypeptide or fragment comprises an amino acid motif which is at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% to the amino acid sequence of SEQ ID NO:547, wherein the amino acid residue at position 2 of SEQ ID NO:547 is not isoleucine or leucine, and wherein the amino acid motif comprises one or more amino acid substitutions selected from: P1A, P1S, G6S, G6A, L8F, L8V, L8M, L8A, I10V, I10M, I10L, I10G, I10A, L11I, L11M, L11V, L11A, and L11F. In some embodiments, the amino acid residue at position 2 of SEQ ID NO:547 is lysine. In some embodiments, the amino acid motif comprises at least an amino acid substitution at I10V. In other embodiments, the amino acid motif comprises at least an amino acid substitution at L8V.

    [0127] The invention also provides an isolated polypeptide or fragment thereof having DHAD activity, wherein the polypeptide or fragment thereof comprises an amino acid motif which is at least 90% identical to the amino acid sequence of SEQ ID NO:548, wherein the amino acid motif comprises two or more amino acid substitutions selected from: P1A, P1S, G6S, G6A, L8F, L8V, L8M, L8A, I10V, I10M, I10L, I10G, I10A, L11I, L11M, L11V, L11A, and L11F. In other embodiments, the amino acid motif is at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identifcal to the amino acid sequence of SEQ ID NO:548, wherein the amino acid motif comprises two or more amino acid substitutions selected from: P1A, P1S, G6S, G6A, L8F, L8V, L8M, L8A, I10V, I10M, I10L, I10G, I10A, L11I, L11M, L11V, L11A, and L11F. In other embodiments, the amino acid motif comprises the amino acid sequence of SEQ ID NO:553, SEQ ID NO:558, SEQ ID NO:563, SEQ ID NO:568, SEQ ID NO:573, SEQ ID NO:578, SEQ ID NO:583, or SEQ ID NO:588. In other embodiments, the polypeptide or fragment thereof having DHAD activity comprises the amino acid sequence of SEQ ID NO:550, SEQ ID NO:555, SEQ ID NO:560, SEQ ID NO:565, SEQ ID NO:570, SEQ ID NO:575, SEQ ID NO:580, or SEQ ID NO:585. In other embodiments, the polypeptide or fragment thereof having DHAD activity comprises the amino acid sequence of SEQ ID NO:565. In other embodiments, the amino acid motif comprises the amino acid sequence of SEQ ID NO:573.

    [0128] In embodiments, DHAD variant proteins display increased DHAD activity compared to DHAD proteins without the amino acid substitutions. In some embodiments, DHAD variant proteins expressed in yeast cytosol have a specific activity of greater than about 0.10 units/mg, greater than about 0.15 units/mg, greater than about 0.20 units/mg, greater than about 0.25 units/mg, greater than about 0.30 units/mg, greater than about 0.35 units/mg, or greater than about 0.40 units/mg.

    [0129] Other alterations in the amino acid sequence of DHAD enzymes may lead to improved DHAD activity, as indicated, for example, by increased isobutanol production. These alterations include, for example, the addition of a peptide tag (tag) to the C-terminal region of a DHAD. In some embodiments, the alteration is, for example, the addition of a sequence comprising a polyhistidine tag, a polycysteine tag, a V5 epitope, a myc epitope, a Lumio tag (Life Technologies; DNA: SEQ ID NO:785; Amino Acid: SEQ ID NO:747), or a tag such as SEQ ID NO: 748, for example, or a variant thereof, to the C-terminal end of a DHAD. In other embodiments, the alterations include, for example, the addition of a tag to the C-terminal region of a DHAD that comprises the polypeptide sequence of CCPGCCG (SEQ ID NO:723), MCPGCCG (SEQ ID NO:724), CMPGCCG (SEQ ID NO:725), CCPGMCG (SEQ ID NO:726), CCPGCMG (SEQ ID NO:727), MCPGMCG (SEQ ID NO:728), MMPGCCG (SEQ ID NO:729), CMPGMCG (SEQ ID NO:730), CMPGCMG (SEQ ID NO:731), CCPGMMG (SEQ ID NO:732), MCPGCMG (SEQ ID NO:733), MMPGMCG (SEQ ID NO:734), CMPGMMG (SEQ ID NO:735), MCPGMMG (SEQ ID NO:736), MMPGCMG (SEQ ID NO:737), MMPGMMG (SEQ ID NO:738), CSCPGCCG (SEQ ID NO:739), CPCPGCCG (SEQ ID NO:740), CECPGCCG (SEQ ID NO:741), CCPGCSCG (SEQ ID NO:742), CCPGCPCG (SEQ ID NO:743), CCPGCECG (SEQ ID NO:744), CCPEGCCG (SEQ ID NO:745), CCPAGCCG (SEQ ID NO:746), or variant thereof.

    [0130] Disclosed herein are DHAD variants of a Streptococcus mutans DHAD enzyme (SEQ ID NO:773), however, equivalent alterations can be made in homologous regions of DHAD enzymes from other organisms. Examples include SEQ ID NOs:749-772. A list of other DHAD enzymes that can be used to produce the DHAD variants of the invention is included below in Tables 3-5. Other sources of DHADs include, for example, Streptococcus downei, Oscillatoria species PCC 6506, Zea mays, Lactococcus lactis, Neurospora crassa, and Streptococcus macacae.

    [0131] In some embodiments, DHAD variant proteins display increased DHAD activity compared to DHAD proteins without amino acid alterations. In some embodiments, DHAD variant proteins expressed in yeast cytosol have a specific activity of greater than 0.1 units/mg (U/mg), greater than 0.15 units/mg, greater than 0.2 units/mg, greater than 0.25 units/mg, greater than 0.3 units/mg, greater than 0.35 units/mg, greater than 0.4 units/mg, greater than 0.45 units/mg, greater than 0.5 units/mg, greater than 0.55 units/mg, greater than 0.6 units/mg, greater than 0.65 units/mg, greater than 0.7 units/mg, greater than 0.75 units/mg, greater than 0.8 units/mg, greater than 0.85 units/mg, greater than 0.9 units/mg, greater than 1 unit/mg, greater than 1.1 units/mg, greater than 1.2 units/mg, greater than 1.3 units/mg, greater than 1.4 units/mg, greater than 1.5 units/mg, greater than 1.6 units/mg, greater than 1.7 units/mg, greater than 1.8 units/mg, greater than 1.9 units/mg, greater than 2 units/mg, or any range of values thereof. In some embodiments, DHAD variant proteins expressed in yeast cytosol have a specific activity of about 0.1 units/mg, about 0.15 units/mg, about 0.2 units/mg, about 0.25 units/mg, about 0.3 units/mg, about 0.35 units/mg, about 0.4 units/mg, about 0.45 units/mg, about 0.5 units/mg, about 0.55 units/mg, about 0.6 units/mg, about 0.65 units/mg, about 0.7 units/mg, about 0.75 units/mg, about 0.8 units/mg, about 0.85 units/mg, about 0.9 units/mg, about 1 unit/mg, about 1.1 units/mg, about 1.2 units/mg, about 1.3 units/mg, about 1.4 units/mg, about 1.5 units/mg, about 1.6 units/mg, about 1.7 units/mg, about 1.8 units/mg, about 1.9 units/mg, about 2 units/mg, or more, or any range of values thereof. In some embodiments, the DHAD variant proteins have a specific activity of about 0.1 units/mg to about 2 units/mg, about 0.2 units/mg to about 2 units/mg, about 0.3 units/mg to about 2 units/mg, about 0.4 units/mg to about 2 units/mg, or about 0.5 units/mg to about 2 units/mg. In other embodiments, DHAD activity is increased in the DHAD variant by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 100% compared to DHAD proteins without an amino acid alteration, or any range of values thereof. In other embodiments, DHAD activity is increased in the DHAD variant by about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 100%, or more, compared to DHAD proteins without an amino acid alteration, or any range of values thereof. In some embodiments, DHAD activity is increased in the DHAD variant by about 10% to about 100%, about 20% to about 100%, about 30% to about 100%, about 40% to about 100%, about 50% to about 100%, about 60% to about 100%, about 10% to about 60%, about 20% to about 60%, about 30% to about 60%, about 40% to about 50%, or about 50% to about 60% compared to DHAD proteins without an amino acid alteration.

    [0132] Other alterations in the amino acid sequence of DHAD enzymes can lead to improved DHAD activity, as indicated, for example, by increased isobutanol production. These alterations include, for example, a deletion of one or more of the C-terminal amino acids of DHAD. In some embodiments, the deletion is a deletion of at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 31, at least 32, at least 33, at least 34, at least 35, at least 36, at least 37, at least 38, at least 39, or at least 40 C-terminal amino acids of DHAD, or any range of values thereof. In some embodiments, the deletion is a deletion of about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, about 30, about 31, about 32, about 33, about 34, about 35, about 36, about 37, about 38, about 39, about 40, or more C-terminal amino acids of DHAD, or any range of values thereof. In other embodiments, the deletion is a deletion of about 1 to about 40 C-terminal amino acids of DHAD, including, but not limited to, about 1 to about 35, about 1 to about 30, about 1 to about 25, about 1 to about 20, about 1 to about 15, about 1 to about 10, about 5 to about 40, about 5 to about 35, about 5 to about 30, about 5 to about 25, about 5 to about 20, about 5 to about 15, or about 5 to about 10 C-terminal amino acids of DHAD. In some embodiments, the deletion is the 9 C-terminal amino acids of DHAD (DNA: SEQ ID NO:545; Protein: SEQ ID NO:546).

    [0133] For the purposes of the present invention, amino acid deletions were made of the Streptococcus mutans DHAD enzyme (e.g., SEQ ID NO:544), however, equivalent deletions can be made in homologous regions of DHAD enzymes from other organisms. A list of other DHAD enzymes that may be used to produce the DHAD variants of the invention is included below in Tables 3-5.

    [0134] In some embodiments, the invention is directed to an isolated polypeptide or fragment thereof having DHAD activity, wherein the polypeptide or fragment thereof comprises an amino acid sequence which is at least 90% identical to the amino acid sequence of SEQ ID NO:544. In other embodiments, the polypeptide or fragment comprises an amino acid sequence which is at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the amino acid sequence of SEQ ID NO:528, or any range of values thereof. In other embodiments, the polypeptide or fragment comprises an amino acid sequence which is about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to the amino acid sequence of SEQ ID NO:544, or any range of values thereof. In other embodiments, the polypeptide or fragment comprises an amino acid sequence which is about 60% to about 99%, about 65% to about 99%, about 70% to about 99%, about 75% to about 99%, about 80% to about 99%, about 85% to about 99%, about 90% to about 99%, or about 95% to about 99% identical to the amino acid sequence of SEQ ID NO:544.

    [0135] In some embodiments, DHAD variant proteins display increased DHAD activity compared to DHAD proteins without amino acid deletions. In some embodiments, DHAD variant proteins expressed in yeast cytosol have a specific activity of greater than 0.1 units/mg (U/mg), greater than 0.15 units/mg, greater than 0.2 units/mg, greater than 0.25 units/mg, greater than 0.3 units/mg, greater than 0.35 units/mg, greater than 0.4 units/mg, greater than 0.43 units/mg, greater than 0.45 units/mg, greater than 0.5 units/mg, greater than 0.55 units/mg, greater than 0.6 units/mg, greater than 0.65 units/mg, greater than 0.7 units/mg, greater than 0.75 units/mg, greater than 0.8 units/mg, or any range of values thereof. In some embodiments, DHAD variant proteins expressed in yeast cytosol have a specific activity of about 0.1 units/mg, about 0.15 units/mg, about 0.2 units/mg, about 0.25 units/mg, about 0.3 units/mg, about 0.35 units/mg, about 0.4 units/mg, about 0.43 units/mg, about 0.45 units/mg, about 0.5 units/mg, about 0.55 units/mg, about 0.6 units/mg, about 0.65 units/mg, about 0.7 units/mg, about 0.75 units/mg, about 0.8 units/mg, or more, or any range of values thereof. In some embodiments, the DHAD variant proteins have a specific activity of about 0.10 units/mg to about 0.8 units/mg, about 0.2 units/mg to about 0.8 units/mg, about 0.3 units/mg to about 0.8 units/mg, about 0.4 units/mg to about 0.8 units/mg, or about 0.1 units/mg to about 0.5 units/mg. In other embodiments, DHAD activity is increased in the DHAD variant by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 100%, or more, compared to DHAD proteins without an amino acid deletion, or any range of values thereof. In other embodiments, DHAD activity is increased in the DHAD variant by about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 100%, or more, compared to DHAD proteins without an amino acid deletion, or any range of values thereof. In some embodiments, DHAD activity is increased in the DHAD variant by about 10% to about 100%, about 20% to about 100%, about 30% to about 100%, about 40% to about 100%, about 50% to about 100%, about 60% to about 100%, about 10% to about 60%, about 20% to about 60%, about 30% to about 60%, about 40% to about 50%, or about 50% to about 60% compared to DHAD proteins without an amino acid deletion.

    DHAD Proteins

    [0136] Any DHAD proteins may be used as a parental, or starting, molecule for creating a DHAD variant polypeptide of the invention. DHADs that may be used herein can be derived from bacterial, fungal, or plant sources. DHADs that may be used may have a [4Fe-4S].sup.2+ cluster or a [2Fe-2S].sup.2+ cluster bound by the apoprotein. Tables 3-5 list SEQ ID NOs for coding regions and proteins of representative DHADs that may be used in the present invention. Proteins with at least about 95% identity to those listed sequences have generally been omitted for simplification, but it is understood that the omitted proteins with at least about 95% sequence identity to any of the proteins listed in Tables 3-5 and having DHAD activity may be used as disclosed herein. As described herein, polynucleotide sequences encoding DHADs can be codon optimized for expression in a particular organism by methods known in the art. Examples of such DHAD sequences include, for example, Streptococcus downei (S. downei) (DNA SEQ ID NO:708; protein SEQ ID NO:709), Oscillatoria species PCC 6506 (DNA SEQ ID NO:710; protein SEQ ID NO:711), Zea mays (DNA SEQ ID NO:712; protein SEQ ID NO:713), Lactococcus lactis (DNA SEQ ID NO:714; protein SEQ ID NO:715), Neurospora crassa (DNA SEQ ID NOs:716 and 718; protein SEQ ID NOs:717 and 719) and S. mutans DHAD 689-I2V5 variant (DNA SEQ ID NO:786; protein SEQ ID NO:787). Other examples of DHADs include, for example, Streptococcus macacae DHAD (S. macacae) (DNA SEQ ID NO:700; protein SEQ ID NO:701), S. macacae DHAD L2V4 (DNA SEQ ID NO:702; protein SEQ ID NO:703), S. macacae DHAD I2V5 (DNA SEQ ID NO:704; protein SEQ ID NO:705) and S. mutans DHAD 689-I2V5 variant (DNA SEQ ID NO:706; protein SEQ ID NO:707). Additional DHAD proteins and their encoding sequences can be identified by BLAST searching of public databases, as well known to one skilled in the art. Typically BLAST (described above) searching of publicly available databases with known DHAD sequences, such as those provided herein, is used to identify DHADs and their encoding sequences that can be expressed in the present cells. For example, DHAD proteins having amino acid sequence identities of at least about 80-85%, at least about 85-90%, at least about 90-95%, or at least about 98% sequence identity to any of the DHAD proteins disclosed herein can be expressed in the present cells. Identities are based on the Clustal W method of alignment using the default parameters of GAP PENALTY=10, GAP LENGTH PENALTY=0.1, and Gonnet 250 series of protein weight matrix.

    TABLE-US-00003 TABLE 3 SEQ ID NOs of Representative Bacterial [2Fe2S].sup.2+ DHAD Proteins and Encoding Sequences SEQ SEQ ID NO: ID NO: Organism of derivation Nucleic acid Peptide Mycobacterium sp. MCS 1 2 Mycobacterium gilvum PYR-GCK 3 4 Mycobacterium smegmatis str. MC2 155 5 6 Mycobacterium vanbaalenii PYR-1 7 8 Nocardia farcinica IFM 10152 9 10 Rhodococcus sp. RHA1 11 12 Mycobacterium ulcerans Agy99 13 14 Mycobacterium avium subsp. 15 16 paratuberculosis K-10 Mycobacterium tuberculosis H37Ra 17 18 Mycobacterium leprae TN * 19 20 Kineococcus radiotolerans SRS30216 21 22 Janibacter sp. HTCC2649 23 24 Nocardioides sp. JS614 25 26 Renibacterium salmoninarum ATCC 33209 27 28 Arthrobacter aurescens TC1 29 30 Leifsonia xyli subsp. xyli str. CTCB07 31 32 marine actinobacterium PHSC20C1 33 34 Clavibacter michiganensis subsp. 35 36 michiganensis NCPPB 382 Saccharopolyspora erythraea NRRL 2338 37 38 Acidothermus cellulolyticus 11B 39 40 Corynebacterium efficiens YS-314 41 42 Brevibacterium linens BL2 43 44 Tropheryma whipplei TW08/27 45 46 Methylobacterium extorquens PA1 47 48 Methylobacterium nodulans ORS 2060 49 50 Rhodopseudomonas palustris BisB5 51 52 Rhodopseudomonas palustris BisB18 53 54 Bradyrhizobium sp. ORS278 55 56 Bradyrhizobium japonicum USDA 110 57 58 Fulvimarina pelagi HTCC2506 59 60 Aurantimonas sp. SI85-9A1 61 62 Hoeflea phototrophica DFL-43 63 64 Mesorhizobium loti MAFF303099 65 66 Mesorhizobium sp. BNC1 67 68 Parvibaculum lavamentivorans DS-1 69 70 Loktanella vestfoldensis SKA53 71 72 Roseobacter sp. CCS2 73 74 Dinoroseobacter shibae DFL 12 75 76 Roseovarius nubinhibens ISM 77 78 Sagittula stellata E-37 79 80 Roseobacter sp. AzwK-3b 81 82 Roseovarius sp. TM1035 83 84 Oceanicola batsensis HTCC2597 85 86 Oceanicola granulosus HTCC2516 87 88 Rhodobacterales bacterium HTCC2150 89 90 Paracoccus denitrificans PD1222 91 92 Oceanibulbus indolifex HEL-45 93 94 Sulfitobacter sp. EE-36 95 96 Roseobacter denitrificans OCh 114 97 98 Jannaschia sp. CCS1 99 100 Caulobacter sp. K31 101 102 Candidatus Pelagibacter ubique HTCC1062 103 104 Erythrobacter litoralis HTCC2594 105 106 Erythrobacter sp. NAP1 107 108 Comamonas testosterone KF-1 109 110 Sphingomonas wittichii RW1 111 112 Burkholderia xenovorans LB400 113 114 Burkholderia phytofirmans PsJN 115 116 Bordetella petrii DSM 12804 117 118 Bordetella bronchiseptica RB50 119 120 Bradyrhizobium sp. ORS278 121 122 Bradyrhizobium sp. BTAi1 123 124 Bradyrhizobium japonicum 125 126 Sphingomonas wittichii RW1 127 128 Rhodobacterales bacterium HTCC2654 129 130 Solibacter usitatus Ellin6076 131 132 Roseiflexus sp. RS-1 133 134 Rubrobacter xylanophilus DSM 9941 135 136 Salinispora tropica CNB-440 137 138 Acidobacteria bacterium Ellin345 139 140 Thermus thermophilus HB27 141 142 Maricaulis maris MCS10 143 144 Parvularcula bermudensis HTCC2503 145 146 Oceanicaulis alexandrii HTCC2633 147 148 Plesiocystis pacifica SIR-I 149 150 Bacillus sp. NRRL B-14911 151 152 Oceanobacillus iheyensis HTE831 153 154 Staphylococcus saprophyticus subsp. 155 156 saprophyticus ATCC 15305 Bacillus selenitireducens MLS10 157 158 Streptococcus pneumoniae SP6-BS73 159 160 Streptococcus sanguinis SK36 161 162 Streptococcus thermophilus LMG 18311 163 164 Streptococcus suis 89/1591 165 166 Streptococcus mutans UA159 167 168 Leptospira borgpetersenii serovar Hardjo- 169 170 bovis L550 Candidatus Vesicomyosocius okutanii HA 171 172 Candidatus Ruthia magnifica str. Cm 173 174 (Calyptogena magnifica) Methylococcus capsulatus str. Bath 175 176 uncultured marine bacterium EB80_02D08 177 178 uncultured marine gamma proteobacterium 179 180 EBAC31A08 uncultured marine gamma proteobacterium 181 182 EBAC20E09 uncultured gamma proteobacterium 183 184 eBACHOT4E07 Alcanivorax borkumensis SK2 185 186 Chromohalobacter salexigens DSM 3043 187 188 Marinobacter algicola DG893 189 190 Marinobacter aquaeolei VT8 191 192 Marinobacter sp. ELB17 193 194 Pseudoalteromonas haloplanktis TAC125 195 196 Acinetobacter sp. ADP1 197 198 Opitutaceae bacterium TAV2 199 200 Flavobacterium sp. MED217 201 202 Cellulophaga sp. MED134 203 204 Kordia algicida OT-1 205 206 Flavobacteriales bacterium ALC-1 207 208 Psychroflexus torquis ATCC 700755 209 210 Flavobacteriales bacterium HTCC2170 211 212 unidentified eubacterium SCB49 213 214 Gramella forsetii KT0803 215 216 Robiginitalea biformata HTCC2501 217 218 Tenacibaculum sp. MED152 219 220 Polaribacter irgensii 23-P 221 222 Pedobacter sp. BAL39 223 224 Flavobacteria bacterium BAL38 225 226 Flavobacterium psychrophilum JIP02/86 227 228 Flavobacterium johnsoniae UW101 229 230 Lactococcus lactis subsp. cremoris SK11 231 232 Psychromonas ingrahamii 37 233 234 Microscilla marina ATCC 23134 235 236 Cytophaga hutchinsonii ATCC 33406 237 238 Rhodopirellula baltica SH 1 239 240 Blastopirellula marina DSM 3645 241 242 Planctomyces maris DSM 8797 243 244 Algoriphagus sp. PR1 245 246 Candidatus Sulcia muelleri str. Hc 247 248 (Homalodisca coagulata) Candidatus Carsonella ruddii PV 249 250 Synechococcus sp. RS9916 251 252 Synechococcus sp. WH 7803 253 254 Synechococcus sp. CC9311 255 256 Synechococcus sp. CC9605 257 258 Synechococcus sp. WH 8102 259 260 Synechococcus sp. BL107 261 262 Synechococcus sp. RCC307 263 264 Synechococcus sp. RS9917 265 266 Synechococcus sp. WH 5701 267 268 Prochlorococcus marinus str. MIT 9313 269 270 Prochlorococcus marinus str. NATL2A 271 272 Prochlorococcus marinus str. MIT 9215 273 274 Prochlorococcus marinus str. AS9601 275 276 Prochlorococcus marinus str. MIT 9515 277 278 Prochlorococcus marinus subsp. pastoris str. 279 280 CCMP1986 Prochlorococcus marinus str. MIT 9211 281 282 Prochlorococcus marinus subsp. marinus 283 284 str. CCMP1375 Nodularia spumigena CCY9414 285 286 Nostoc punctiforme PCC 73102 287 288 Nostoc sp. PCC 7120 289 290 Trichodesmium erythraeum IMS101 291 292 Acaryochloris marina MBIC11017 293 294 Lyngbya sp. PCC 8106 295 296 Synechocystis sp. PCC 6803 297 298 Cyanothece sp. CCY0110 299 300 Thermosynechococcus elongatus BP-1 301 302 Synechococcus sp. JA-2-3Ba(2-13) 303 304 Gloeobacter violaceus PCC 7421 305 306 Nitrosomonas eutropha C91 307 308 Nitrosomonas europaea ATCC 19718 309 310 Nitrosospira multiformis ATCC 25196 311 312 Chloroflexus aggregans DSM 9485 313 314 Leptospirillum sp. Group II UBA 315 316 Leptospirillum sp. Group II UBA 317 318 Halorhodospira halophila SL1 319 320 Nitrococcus mobilis Nb-231 321 322 Alkalilimnicola ehrlichei MLHE-1 323 324 Deinococcus geothermalis DSM 11300 325 326 Polynucleobacter sp. QLW-P1DMWA-1 327 328 Polynucleobacter necessarius STIR1 329 330 Azoarcus sp. EbN1 331 332 Burkholderia phymatum STM815 333 334 Burkholderia xenovorans LB400 335 336 Burkholderia multivorans ATCC 17616 337 338 Burkholderia cenocepacia PC184 339 340 Burkholderia mallei GB8 horse 4 341 342 Ralstonia eutropha JMP134 343 344 Ralstonia metallidurans CH34 345 346 Ralstonia solanacearum UW551 347 348 Ralstonia pickettii 12J 349 350 Limnobacter sp. MED105 351 352 Herminiimonas arsenicoxydans 353 354 Bordetella parapertussis 355 356 Bordetella petrii DSM 12804 357 358 Polaromonas sp. JS666 359 360 Polaromonas naphthalenivorans CJ2 361 362 Rhodoferax ferrireducens T118 363 364 Verminephrobacter eiseniae EF01-2 365 366 Acidovorax sp. JS42 367 368 Delftia acidovorans SPH-1 369 370 Methylibium petroleiphilum PM1 371 372 gamma proteobacterium KT 71 373 374 Tremblaya princeps 375 376 Blastopirellula marina DSM 3645 377 378 Planctomyces maris DSM 8797 379 380 Microcystis aeruginosa PCC 7806 381 382 Salinibacter ruber DSM 13855 383 384 Methylobacterium chloromethanicum 385 386

    TABLE-US-00004 TABLE 4 SEQ ID NOs of Representative Fungal and Plant [2Fe2S].sup.2+ DHAD Proteins and Encoding Sequences SEQ ID NO: SEQ ID NO: Description Nucleic acid Peptide Schizosaccharomyces pombe ILV3 387 388 Saccharomyces cerevisiae ILV3 389 390 Kluyveromyces lactis ILV3 391 392 Candida albicans SC5314 ILV3 393 394 Pichia stipitis CBS 6054 ILV3 395 396 Yarrowia lipolytica ILV3 397 398 Candida glabrata CBS 138 ILV3 399 400 Chlamydomonas reinhardtii 401 402 Ostreococcus lucimarinus CCE9901 403 404 Vitis vinifera 405 406 (Unnamed protein product: CAO71581.1) Vitis vinifera 407 408 (Hypothetical protein: CAN67446.1) Arabidopsis thaliana 409 410 Oryza sativa (indica cultivar-group) 411 412 Physcomitrella patens subsp. patens 413 414 Chaetomium globosum CBS 148.51 415 416 Neurospora crassa OR74A 417 418 Magnaporthe grisea 70-15 419 420 Gibberella zeae PH-1 421 422 Aspergillus niger 423 424 Neosartorya fischeri NRRL 181 425 426 (XP_001266525.1) Neosartorya fischeri NRRL 181 427 428 (XP_001262996.1) Aspergillus niger 429 430 (hypothetical protein An03g04520) Aspergillus niger 431 432 (Hypothetical protein An14g03280) Aspergillus terreus NIH2624 433 434 Aspergillus clavatus NRRL 1 435 436 Aspergillus nidulans FGSC A4 437 438 Aspergillus oryzae 439 440 Ajellomyces capsulatus NAm1 441 442 Coccidioides immitis RS 443 444 Botryotinia fuckeliana B05.10 445 446 Phaeosphaeria nodorum SN15 447 448 Pichia guilliermondii ATCC 6260 449 450 Debaryomyces hansenii CBS767 451 452 Lodderomyces elongisporus NRRL YB- 453 454 4239 Vanderwaltozyma polyspora DSM 70294 455 456 Ashbya gossypii ATCC 10895 457 458 Laccaria bicolor S238N-H82 459 460 Coprinopsis cinerea okayama7#130 461 462 Cryptococcus neoformans var. neoformans 463 464 JEC21 Ustilago maydis 521 465 466 Malassezia globosa CBS 7966 467 468 Aspergillus clavatus NRRL 1 469 470 Neosartorya fischeri NRRL 181 471 472 (Putative) Aspergillus oryzae 473 474 Aspergillus niger (hypothetical protein 475 476 An18g04160) Aspergillus terreus NIH2624 477 478 Coccidioides immitis RS (hypothetical 479 480 protein CIMG_04591) Paracoccidioides brasiliensis 481 482 Phaeosphaeria nodorum SN15 483 484 Gibberella zeae PH-1 485 486 Neurospora crassa OR74A 487 488 Coprinopsis cinerea okayama 7#130 489 490 Laccaria bicolor S238N-H82 491 492 Ustilago maydis 521 493 494

    TABLE-US-00005 TABLE 5 SEQ ID NOs of Representative [4Fe4S].sup.2+ DHAD Proteins and Encoding Sequences SEQ ID NO: SEQ ID NO: Organism Nucleic acid Peptide Escherichia coli str. K-12 substr. MG1655 495 496 Bacillus subtilis subsp. subtilis str. 168 497 498 Agrobacterium tumefaciens str. C58 499 500 Burkholderia cenocepacia MC0-3 501 502 Psychrobacter cryohalolentis K5 503 504 Psychromonas sp. CNPT3 505 506 Deinococcus radiodurans R1 507 508 Wolinella succinogenes DSM 1740 509 510 Zymomonas mobilis subsp. mobilis ZM4 511 512 Clostridium acetobutylicum ATCC 824 513 514 Clostridium beijerinckii NCIMB 8052 515 516 Pseudomonas fluorescens Pf-5 517 518 Methanococcus maripaludis C7 519 520 Methanococcus aeolicus Nankai-3 521 522 Vibrio fischeri ATCC 700601 (ES114) 523 524 Shewanella oneidensis MR-1 ATCC 525 526 700550

    [0137] Additional [2Fe-2S].sup.2+ DHADs can be identified using the analysis described in co-pending U.S. Appl. Pub. No. 2010/0081154, which is herein incorporated by reference. The analysis is as follows: A Profile Hidden Markov Model (HMM) was prepared based on amino acid sequences of eight functionally verified DHADs. These DHADs are from Nitrosomonas europaea (DNA SEQ ID NO:309; protein SEQ ID NO:310), Synechocystis sp. PCC6803 (DNA SEQ ID:297; protein SEQ ID NO:298), Streptococcus mutans (DNA SEQ ID NO:167; protein SEQ ID NO:168), Streptococcus thermophilus (DNA SEQ ID NO:163; protein SEQ ID NO:164), Ralstonia metallidurans (DNA SEQ ID NO:345; protein SEQ ID NO:346), Ralstonia eutropha (DNA SEQ ID NO:343; protein SEQ ID NO:344), and Lactococcus lactis (DNA SEQ ID NO:231; protein SEQ ID NO:232). In addition, the DHAD from Flavobacterium johnsoniae (DNA SEQ ID NO:229; protein SEQ ID NO:230) was found to have DHAD activity when expressed in Escherichia coli and was used in making the Profile.

    [0138] The Profile HMM was built as follows:

    [0139] Step 1. Build a Sequence Alignment

    [0140] The eight sequences for the functionally verified DHADs listed above were aligned using Clustal W with default parameters.

    [0141] Step 2. Build a Profile HMM

    [0142] The hmmbuild program was run on the set of aligned sequences using default parameters. hmmbuild reads the multiple sequence alignment file, builds a new Profile HMM, and saves the Profile HMM to file. Using this program an un-calibrated profile was generated from the multiple alignment for each set of subunit sequences described above.

    [0143] The following information based on the HMMER software user guide gives some description of the way that the hmmbuild program prepares a Profile HMM. A Profile HMM is capable of modeling gapped alignments, e.g., including insertions and deletions, which lets the software describe a complete conserved domain (rather than just a small ungapped motif). Insertions and deletions are modeled using insertion (I) states and deletion (D) states. All columns that contain more than a certain fraction x of gap characters will be assigned as an insert column. By default, x is set to 0.5. Each match state has an I and a D state associated with it. HMMER calls a group of three states (M/D/I) at the same consensus position in the alignment a node. These states are interconnected with arrows called state transition probabilities. M and I states are emitters, while D states are silent. The transitions are arranged so that at each node, either the M state is used (and a residue is aligned and scored) or the D state is used (and no residue is aligned, resulting in a deletion-gap character, ). Insertions occur between nodes, and I states have a self-transition, allowing one or more inserted residues to occur between consensus columns.

    [0144] The scores of residues in a match state (i.e., match state emission scores), or in an insert state (i.e., insert state emission scores) are proportional to Log_2 (p_x)/(null_x). Where p_x is the probability of an amino acid residue, at a particular position in the alignment, according to the Profile HMM and null_x is the probability according to the Null model. The Null model is a simple one state probabilistic model with pre-calculated set of emission probabilities for each of the 20 amino acids derived from the distribution of amino acids in the SWISSPROT release 24.

    [0145] State transition scores are also calculated as log odds parameters and are proportional to Log_2 (t_x). Where t_x is the probability of transiting to an emitter or non-emitter state.

    [0146] Step 3. Calibrate the Profile HMM

    [0147] The Profile HMM was read using hmmcalibrate which scores a large number of synthesized random sequences with the Profile (the default number of synthetic sequences used is 5,000), fits an extreme value distribution (EVD) to the histogram of those scores, and re-saves the HMM file now including the EVD parameters. These EVD parameters ( and ) are used to calculate the E-values of bit scores when the profile is searched against a protein sequence database. hmmcalibrate writes two parameters into the HMM file on a line labeled EVD: these parameters are the (location) and (scale) parameters of an extreme value distribution (EVD) that best fits a histogram of scores calculated on randomly generated sequences of about the same length and residue composition as SWISS-PROT. This calibration was done once for the Profile HMM.

    [0148] The calibrated Profile HMM for the DHAD set of sequences is provided in Table 6. The Profile HMM is provided in a chart that gives the probability of each amino acid occurring at each position in the amino acid sequence. The highest probability is highlighted for each position. The first line for each position reports the match emission scores: probability for each amino acid to be in that state (highest score is highlighted). The second line reports the insert emission scores, and the third line reports on state transition scores: M.fwdarw.M, M.fwdarw.I, M.fwdarw.D; I.fwdarw.M, I.fwdarw.I; D.fwdarw.M, D.fwdarw.D; B.fwdarw.M; M.fwdarw.E.

    [0149] For example, the DHAD Profile HMM shows that methionine has a 1757 probability of being in the first position, the highest probability which is highlighted. In the second position glutamic acid has the highest probability, which is 1356. In the third position lysine has the highest probability, which is 1569.

    [0150] Step 4. Test the Specificity and Sensitivity of the Built Profile HMMs

    [0151] The Profile HMM was evaluated using hmmsearch, which reads a Profile HMM from hmmfile and searches a sequence file for significantly similar sequence matches. The sequence file searched contained 976 sequences (see above). During the search, the size of the database (Z parameter) was set to 1 billion. This size setting ensures that significant E-values against the current database will remain significant in the foreseeable future. The E-value cutoff was set at 10.

    [0152] A hmmer search with the Profile HMM generated from the alignment of the eight DHADs with experimentally verified function, matched all 976 sequences with an E value <10.sup.5. This result indicates that members of the dehydratase superfamily share significant sequence similarity. A hmmer search with a cutoff of E value 10.sup.5 was used to separate DHAD related dehydratases from other more remote but related proteins, as described above.

    [0153] The Profile HMM is prepared using the HMMER software package (The theory behind profile HMMs is described in R. Durbin, S. Eddy, A. Krogh, and G. Mitchison, Biological sequence analysis: probabilistic models of proteins and nucleic acids, Cambridge University Press, 1998; Krogh et al., 1994; J. Mol. Biol. 235:1501-1531), following the user guide which is available from HMMER (Janelia Farm Research Campus, Ashburn, Va.). The output of the HMMER software program is a Profile Hidden Markov Model (HMM) that characterizes the input sequences. The Profile HMM prepared for the eight DHAD proteins is given in Table 6.

    [0154] This Profile HMM for DHADs can be used to identify DHAD related proteins. Any protein that matches the Profile HMM with an E value of <10.sup.5 is a DHAD related protein, which includes [4Fe-4S].sup.2+ DHADs, [2Fe-2S].sup.2+ DHADs, aldonic acid dehydratases, and phosphogluconate dehydratases.

    [0155] Sequences matching the Profile HMM given herein are then analyzed for the presence of the three conserved cysteines described above. The exact positions of the three conserved cysteines can vary, and these can be identified in the context of the surrounding sequence using multiple sequence alignments performed with the Clustal W algorithm (Thompson, J. D., Higgins, D. G., and Gibson T. J. (1994) Nuc. Acid Res. 22: 4673 4680) employing the following parameters: 1) for pairwise alignment parameters, a Gap opening=10; Gap extend=0.1; matrix is Gonnet 250; and modeSlow-accurate, 2) for multiple alignment parameters, Gap opening=10; Gap extension=0.2; and matrix is Gonnet series. For example, the three conserved cysteines are located at amino acid positions 56, 129, and 201 in the Streptococcus mutans (S. mutans) DHAD (SEQ ID NO:168), and at amino acid positions 61, 135, and 207 in the Lactococcus lactis (L. lactis) DHAD (SEQ ID NO:232). The exact positions of the three conserved cysteines in other protein sequences correspond to these positions in the S. mutans or the L. lactis amino acid sequence. One skilled in the art will readily be able to identify the presence or absence of each of the three conserved cysteines in the amino acid sequence of a DHAD protein using pairwise or multiple sequence alignments. In addition, other methods can be used to determine the presence of the three conserved cysteines, such as analysis by eye.

    [0156] The DHAD Profile HMM matching proteins that have two but not the third (position 56) conserved cysteine include [4Fe-4S].sup.2+ DHADs and phosphogluconate dehydratases (EDDs). Proteins having the three conserved cysteines include arabonate dehydratases and [2Fe-2S].sup.2+ DHADs, and are members of a [2Fe-2S].sup.2+ DHAD/aldonic acid dehydratase group. The [2Fe-2S].sup.2+ DHADs can be distinguished from the aldonic acid dehydratases by analyzing for signature conserved amino acids found to be present in the [2Fe-2S].sup.2+ DHADs or in the aldonic acid dehydratases at positions corresponding to the following positions in the Streptococcus mutans DHAD amino acid sequence. These signature amino acids are in [2Fe-2S].sup.2+ DHADs or in aldonic acid dehydratases, respectively, at the following positions (with greater than 90% occurrence): 88 asparagine vs. glutamic acid; 113 not conserved vs. glutamic acid; 142 arginine or asparagine vs. not conserved; 165: not conserved vs. glycine; 208 asparagine vs. not conserved; 454 leucine vs. not conserved; 477 phenylalanine or tyrosine vs. not conserved; and 487 glycine vs. not conserved.

    [0157] The disclosed methods for identification of [2Fe-2S].sup.2+ DHAD enzymes can be carried out on a single sequence or on a group of sequences. In a preferred embodiment, one or more sequence databases are queried with a Profile HMM as described herein.

    [0158] Additionally, the sequences of DHAD coding regions provided herein can be used to identify other homologs in nature. Such methods are well-known in the art, and various methods that can be used to isolate genes encoding homologous proteins are described in U.S. Appl. Pub. No. 2010/0081154, which such methods are incorporated by reference herein.

    [0159] DHAD variant polypeptides provided herein may be, for example, of a size of about 10 or more, about 20 or more, about 25 or more, about 50 or more, about 75 or more, about 100 or more, about 200 or more, about 500 or more, about 1,000 or more, or about 2,000 or more amino acids. Polypeptides can have a defined three-dimensional structure, although they do not necessarily have such structure. Polypeptides with a defined three-dimensional structure are referred to as folded, and polypeptides which do not possess a defined three-dimensional structure, but rather can adopt a large number of different conformations, and are referred to as unfolded.

    [0160] Also provided are active fragments of the DHAD variant polypeptides. A fragment is a unique portion of a polypeptide or other enzyme used in the invention which is identical in sequence to but shorter in length than the parent full-length sequence. A fragment can comprise up to the entire length of the defined sequence, minus one amino acid residue. For example, a fragment can comprise from about 5 to about 1,000 contiguous amino acid residues. A fragment can be, for example, at least 5, 10, 15, 20, 25, 30, 40, 50, 60, 75, 100, 150, 250, 500, 750, or 1,000 contiguous amino acid residues in length. Fragments can be preferentially selected from certain regions of a molecule. For example, a polypeptide fragment can comprise a certain length of contiguous amino acids selected from the first 100, 200, 300, 400, or 500 amino acids of a polypeptide as shown in a certain defined sequence. Alternatively, a polypeptide fragment can comprise a certain length of contiguous amino acids selected from the last 100, 200, 300, 400, or 500 amino acids of a polypeptide as shown in a certain defined sequence. Clearly these lengths are exemplary, and any length that is supported by the specification, including the Sequence Listing, tables, and figures, can be encompassed by the present embodiments. An exemplary DHAD fragment encompassed by the present invention is the Streptococcus mutans DHAD enzyme (Amino Acid: SEQ ID NO:544; Nucleic Acid: SEQ ID NO:543) lacking the last 9 amino acids from the C-terminus (the 9 variant; Amino Acid: SEQ ID NO:546; Nucleic Acid: SEQ ID NO:545). In certain embodiments, the DHAD variant polypeptide fragments have DHAD activity, and thus are capable of catalyzing the conversion of 2,3-dihydroxy isovalerate to -ketoisovalerate.

    [0161] The DHAD variant polypeptides of the invention can further comprise a label (such as for detection) or peptide tag. Peptide tags can include, for example, a polyhistidine tag, a polycysteine tag, a V5 epitope, a myc epitope, or a sequence comprising a Lumio tag (protein SEQ ID NOs:589 or 720; DNA SEQ ID NO:721). A detectable label can include, for example, an enzyme, a substrate for an enzyme, a fluorescent compound, a luminescent compound, a chemiluminescent compound, a radionuclide, a paramagnetic compound, or biotin.

    DHAD Activity Assays

    [0162] The presence of DHAD activity in a cell engineered to express a heterologous DHAD can be confirmed using methods known in the art and/or described herein. As one example, crude extracts from cells engineered to express a bacterial DHAD can be used in a DHAD assay as described in the Examples herein or as described by Flint and Emptage (J. Biol. Chem. (1988) 263(8): 3558-64) using dinitrophenylhydrazine. In another example, DHAD activity can be assayed by the methods disclosed in U.S. App. Pub. No. US20100081154, incorporated herein by reference, in a yeast strain that lacks endogenous DHAD activity. In such a yeast strain, if sufficient DHAD activity is present, the yeast strain will grow in the absence of branched-chain amino acids. DHAD activity can also be confirmed by more indirect methods, such as by assaying for a downstream product in a pathway requiring DHAD activity. Any product that has -ketoisovalerate or -ketomethylvalerate as a pathway intermediate can be measured in an assay for DHAD activity. A list of such products includes, but is not limited to, valine, isoleucine, leucine, pantothenic acid, 2-methyl-1-butanol, 3-methyl-1-butanol, and isobutanol.

    Nucleic Acid Molecules

    [0163] Provided herein are isolated nucleic acid molecules that encode for the above-described DHAD variant polypeptides. The coding region of the isolated nucleic acid encoding the DHAD variant can be codon optimized for a particular target host cell, as well known to one skilled in the art. The isolated nucleic acid molecules of the invention can be comprised in a vector. Vectors useful for the transformation of a variety of host cells are common and commercially available from companies such as Epicentre (Madison, Wis.), Invitrogen Corp. (Carlsbad, Calif.), Stratagene (La Jolla, Calif.), and New England Biolabs, Inc. (Beverly, Mass.). Typically, the vector contains a selectable marker and sequences allowing autonomous replication or chromosomal integration in the desired host. In addition, suitable vectors comprise a promoter region which harbors transcriptional initiation controls and a transcriptional termination control region, between which a coding region DNA fragment can be inserted, to provide expression of the inserted coding region. Both control regions can be derived from genes homologous to the transformed host cell, although it is to be understood that such control regions can also be, for example, derived from genes that are not native to the specific species chosen as a host.

    [0164] Initiation control regions or promoters, which are useful to drive expression of bacterial DHAD variant coding regions in the desired bacterial host cell are numerous and familiar to those skilled in the art. Virtually any promoter capable of driving these genetic elements is suitable for the present invention including, but not limited to, lac, ara, tet, trp, IP.sub.L, IP.sub.R, T7, tac, and trc promoters (useful for expression in Escherichia coli, Alcaligenes, and Pseudomonas); the amy, apr, and npr promoters, and various phage promoters useful for expression in Bacillus subtilis, Bacillus licheniformis, and Paenibacillus macerans; nisA (useful for expression Gram-positive bacteria, Eichenbaum et al. Appl. Environ. Microbiol. 64(8):2763-2769 (1998)); and the synthetic P11 promoter (useful for expression in Lactobacillus plantarum, Rud et al., Microbiology 152:1011-1019 (2006)). In addition, the ldhL1 and fabZ1 promoters of L. plantarum are useful for expression of chimeric genes in bacteria. The fabZ1 promoter directs transcription of an operon with the first gene, fabZ1, encoding (3R)-hydroxymyristoyl-[acyl carrier protein] dehydratase. Termination control regions can also be derived from various genes, typically from genes native to the preferred hosts. In other embodiments, a termination site is unnecessary. Optionally, a termination site can be unnecessary; however, it is most preferred if included.

    [0165] Certain vectors are capable of replicating in a broad range of host bacteria and can be transferred by conjugation. The complete and annotated sequence of pRK404 and three related vectors: pRK437, pRK442, and pRK442(H), are available. These derivatives have proven to be valuable tools for genetic manipulation in Gram-negative bacteria (Scott et al., Plasmid 50(1):74-79 (2003)). Several plasmid derivatives of broad-host-range Inc P4 plasmid RSF1010 are also available with promoters that can function in a range of Gram-negative bacteria. Plasmids pAYC36 and pAYC37, have active promoters along with multiple cloning sites to allow for heterologous gene expression in Gram-negative bacteria. Some vectors that are useful for transformation of Bacillus subtilis and Lactobacillus include pAM1 and derivatives thereof (Renault et al., Gene 183:175-182 (1996); and O'Sullivan et al., Gene 137:227-231 (1993)); pMBB1 and pHW800, a derivative of pMBB1 (Wyckoff et al., Appl. Environ. Microbiol. 62:1481-1486 (1996)); pMG1, a conjugative plasmid (Tanimoto et al., J. Bacteriol. 184:5800-5804 (2002)); pNZ9520 (Kleerebezem et al., Appl. Environ. Microbiol. 63:4581-4584 (1997)); pAM401 (Fujimoto et al., Appl. Environ. Microbiol. 67:1262-1267 (2001)); and pAT392 (Arthur et al., Antimicrob. Agents Chemother. 38:1899-1903 (1994)). Several plasmids from Lactobacillus plantarum have also been reported (van Kranenburg et al., Appl. Environ. Microbiol. 71(3):1223-1230 (2005)).

    [0166] Chromosomal gene replacement tools are also widely available. For example, a thermosensitive variant of the broad-host-range replicon pWV101 has been modified to construct a plasmid pVE6002 which can be used to effect gene replacement in a range of Gram-positive bacteria (Maguin et al., J. Bacteriol. 174(17):5633-5638 (1992)). Additionally, in vitro transposomes are available from commercial sources such as Epicentre to create random mutations in a variety of genomes.

    [0167] Vectors suitable for expression and propagation in yeast cells are also well known. Methods for gene expression in yeast are known in the art (see, for example, Methods in Enzymology, Volume 194, Guide to Yeast Genetics and Molecular and Cell Biology (Part A, 2004, Christine Guthrie and Gerald R. Fink (Eds.), Elsevier Academic Press, San Diego, Calif.). Expression of genes in yeast typically requires a promoter, operably linked to a coding region of interest, and a transcriptional terminator. A number of yeast promoters can be used in constructing expression cassettes for genes in yeast, including, but not limited to, promoters derived from the following genes: CYC1, HIS3, GAL1, GAL10, ADH1, PGK, PHO5, GAPDH, ADC1, TRP1, URA3, LEU2, ENO, TPI, CUP1, FBA, GPD, GPM, AOX1, ILV5 and TEF(M7). Suitable transcriptional terminators include, but are not limited to, FBAt, GPDt, GPMt, ERG10t, GAL1t, CYC1, ADH1, and ILV5t.

    [0168] Suitable promoters, transcriptional terminators, and a DHAD variant coding regions can be cloned into Escherichia coli (E. coli)-yeast shuttle vectors, and transformed into yeast cells, for example. These vectors allow strain propagation in both E. coli and yeast strains. Typically, the vector used contains a selectable marker and sequences allowing autonomous replication or chromosomal integration in the desired host. Typically used plasmids in yeast are shuttle vectors pRS423, pRS424, pRS425, pHR81, and pRS426 (American Type Culture Collection, Rockville, Md.), which contain an E. coli replication origin (e.g., pMB1), a yeast 2 origin of replication, and a marker for nutritional selection. The selection markers for these four vectors are His3 (vector pRS423), Trp1 (vector pRS424), Leu2 (vector pRS425) and Ura3 (vector pRS426). Construction of expression vectors with a chimeric gene encoding the described DHAD variants can be performed, for example, by either standard molecular cloning techniques in E. coli or by the gap repair recombination method in yeast.

    [0169] The gap repair cloning approach takes advantage of the highly efficient homologous recombination in yeast (see, e.g., Ma et al. Gene 58:201-216; 1987)). Typically, a yeast vector DNA is digested (e.g., in its multiple cloning site) to create a gap in its sequence. A number of insert DNAs of interest are generated that contain a 21 by sequence at both the 5 and the 3 ends that sequentially overlap with each other, and with the 5 and 3 terminus of the vector DNA. For example, to construct a yeast expression vector for Gene X, a yeast promoter and a yeast terminator are selected for the expression cassette. The promoter and terminator are amplified from the yeast genomic DNA, and Gene X is either PCR amplified from its source organism or obtained from a cloning vector comprising Gene X sequence. There is at least a 21 by overlapping sequence between the 5 end of the linearized vector and the promoter sequence, between the promoter and Gene X, between Gene X and the terminator sequence, and between the terminator and the 3 end of the linearized vector. The gapped vector and the insert DNAs are then co-transformed into a yeast strain and plated on the medium containing the appropriate compound mixtures that allow complementation of the nutritional selection markers on the plasmids. The presence of correct insert combinations can be confirmed by PCR mapping using plasmid DNA prepared from the selected cells. The plasmid DNA isolated from yeast (usually low in concentration) can then be transformed into an E. coli strain, e.g., TOP10, followed by mini preps and restriction mapping to further verify the plasmid construct. Finally, the construct can be verified by sequence analysis.

    [0170] Like the gap repair technique, integration into the yeast genome also takes advantage of the homologous recombination system in yeast. Typically, a cassette containing a coding region plus control elements (promoter and terminator) and auxotrophic marker is PCR-amplified with a high-fidelity DNA polymerase using primers that hybridize to the cassette and contain 40-70 base pairs of sequence homology to the regions 5 and 3 of the genomic area where insertion is desired. The PCR product is then transformed into yeast and plated on medium containing the appropriate compound mixtures that allow selection for the integrated auxotrophic marker. For example, to integrate Gene X into chromosomal location Y, the promoter-coding region X-terminator construct is PCR amplified from a plasmid DNA construct and joined to an autotrophic marker (such as URA3) by either SOE PCR or by common restriction digests and cloning. The full cassette, containing the promoter-coding region X-terminator-URA3 region, is PCR amplified with primer sequences that contain 40-70 base pairs (bps) of homology to the regions 5 and 3 of location Y on the yeast chromosome. The PCR product is transformed into yeast and selected on growth media lacking uracil. Transformants can be verified either by colony PCR or by direct sequencing of chromosomal DNA.

    Recombinant Host Cells

    [0171] The isolated nucleic acid molecules and vectors of the invention can be transformed into a host cell for DHAD expression and activity. Suitable host cells include any cell capable of genetic manipulation, and include, for example, bacteria, cyanobacteria, filamentous fungi, and yeasts.

    [0172] The microbial hosts selected for the production of isobutanol are preferably tolerant to isobutanol and should be able to convert carbohydrates to isobutanol. The criteria for selection of suitable microbial hosts include, for example, the following: intrinsic tolerance to isobutanol, high rate of glucose utilization, availability of genetic tools for gene manipulation, and the ability to generate stable chromosomal alterations.

    Yeast Cells

    [0173] Yeast cells that can be hosts for expression of a DHAD variant of the invention are any yeast cells that are amenable to genetic manipulation and include, but are not limited to, Saccharomyces, Schizosaccharomyces, Hansenula, Candida, Kluyveromyces, Yarrowia, and Pichia. Suitable strains include, but are not limited to, Saccharomyces cerevisiae, Schizosaccharomyces pombe, Kluyveromyces lactis, Kluyveromyces thermotolerans, Candida glabrata, Candida albicans, Pichia stipitis, and Yarrowia lipolytica. In some embodiments, the yeast host is Saccharomyces cerevisiae. S. cerevisiae yeast are known in the art and are available from a variety of sources, including, but not limited to, American Type Culture Collection (Rockville, Md.), Centraalbureau voor Schimmelcultures (CBS) Fungal Biodiversity Centre, LeSaffre, Gert Strand AB, Ferm Solutions, North American Bioproducts, Martrex, and Lallemand. S. cerevisiae include, but are not limited to, BY4741, CEN.PK 113-7D, Ethanol Red yeast, Ferm Pro yeast, Bio-Ferm XR yeast, Gert Strand Prestige Batch Turbo alcohol yeast, Gert Strand Pot Distillers yeast, Gert Strand Distillers Turbo yeast, FerMax Green yeast, FerMax Gold yeast, Thermosacc yeast, BG-1, PE-2, CAT-1, CBS7959, CBS7960, and CBS7961.

    [0174] Expression is achieved by transforming the host cell with a gene comprising a sequence encoding any of the DHAD variants of the invention. The coding region for the DHAD to be expressed can be codon optimized for the yeast cell, as well known to one skilled in the art.

    [0175] In embodiments, reducing production of an endogenous iron-sulfur (FeS) protein in a yeast host cell may result in an improvement in activity of an expressed heterologous FeS cluster protein, such as the variant DHAD enzymes of the invention. For example, in the yeast Saccharomyces cerevisiae, the native DHAD is encoded by ILV3, and is a mitochondrially-localized protein. The applicants have found that a Saccharomyces cerevisiae host cell with a heterologous DHAD expressed in the cytosol had 1.5 fold comparative activity in a mitochondrial ILV3 deletion host cell. Thus, in any of the yeast hosts described herein, an endogenous ILV3 gene can be inactivated to reduce endogenous FeS protein expression. ILV3 encodes mitochondrial DHAD that is involved in branched chain amino acid biosynthesis. Mitochondrial DHAD is encoded by a nuclear gene, and has a mitochondrial targeting signal sequence so that it is transported to and localized in the mitochondrion. Any ILV3 gene can be inactivated in a yeast host cell of this disclosure. Examples of yeast ILV3 inactivation target genes and their encoded proteins are those from Saccharomyces cerevisiae YJM78 (coding SEQ ID NO:389; protein SEQ ID NO:390), Schizosaccharomyces pombe (coding SEQ ID NO:387; protein SEQ ID NO:388), Candida galbrata strain CBS 138 (coding SEQ ID NO:399; protein SEQ ID NO:400), Candida albicans SC5314 (coding SEQ ID NO:393; protein SEQ ID NO:394), Kluyveromyces lactis (coding SEQ ID NO:391; protein SEQ ID NO:392), Yarrowia lipolytica (coding SEQ ID NO:397; protein SEQ ID NO:398) and Pichia stipitis CBS 6054 (coding SEQ ID NO:395; protein SEQ ID NO:396).

    [0176] In addition, in embodiments, overexpression of the transcriptional activator genes AFT1 and/or AFT2 or homologs thereof in a recombinant yeast microorganism improves DHAD activity. Thus, the invention also provides recombinant yeast host cells comprising the isolated nucleic acid molecules of the invention, further genetically engineered to have increased heterologous or native expression of AFT1 and/or AFT2 or homologs thereof. In general, cells that overexpress AFT1 and/or AFT2 or homologs thereof exhibit enhanced DHAD activity. The observed increases in DHAD activity resulting from the increased expression of AFT1 and/or AFT2 have broad applicability to any DHAD-requiring biosynthetic pathway, as DHAD activity is often a rate-limiting component of such pathways.

    [0177] Grx3, Grx4, Fra2 and Ccc1 are proteins involved in iron-sulfur cluster biosynthesis in yeast. Grx3 and Grx4 are monothiol glutaredoxins that have been shown to be involved in cellular Fe content modulation and delivery in yeast. Glutaredoxins are glutathione-dependent thiol-disulfide oxidoreductases that function in maintaining the cellular redox homeostasis. Saccharomyces cerevisiae has two dithiol glutaredoxins (Grx1 and Grx2) and three monothiol glutaredoxins (Grx3, Grx4, and Grx5). The monothiol glutaredoxins are believed to reduce mixed disulfides formed between a protein and glutathione in a process known as deglutathionylation. Thus, the invention is also directed to a recombinant host described herein (e.g., yeast) further genetically modified to disrupt a gene encoding an endogenous Fra2, Grx3, Grx4, and/or Ccc1 or a homolog thereof. In embodiments, increases in DHAD activity may be observed in yeast cells with disruptions in FRA2, GRX3, GRX4, and/or CCC1.

    [0178] In some embodiments, the invention is also directed to a recombinant host described herein (e.g., yeast) further genetically modified to disrupt (e.g., delete) a gene encoding pyruvate decarboxylase (PDC). In some embodiments, the PDC is PDC1, PDC5, PDC6, or combinations thereof.

    Bacterial Cells

    [0179] In some embodiments, the recombinant host cell is a prokaryotic cell. In certain embodiments, the recombinant host cell is a bacterial cell. In other embodiments, the bacterial cell is a lactic acid bacterial (LAB) cell selected from the group consisting of Lactococcus, Lactobacillus, Leuconostoc, Oenococcus, Pediococcus, and Streptococcus. In still other embodiments, the bacterial host cell is the lactic acid bacteria Lactobacillus. In some embodiments, the bacterial host cell is Lactobacillus plantarum.

    [0180] Bacterial cells that can be hosts for expression of a heterologous bacterial [2Fe-2S].sup.2+ DHAD include, but are not limited to, Clostridium, Zymomonas, Escherichia, Salmonella, Rhodococcus, Pseudomonas, Bacillus, Lactobacillus, Enterococcus, Pediococcus, Alcaligenes, Klebsiella, Paenibacillus, Arthrobacter, Corynebacterium, Brevibacterium, Lactococcus, Leuconostoc, Oenococcus, Pediococcus, and Streptococcus. Engineering expression of a heterologous DHAD variant can increase DHAD activity in a host bacterial cell that naturally expresses a [2Fe-2S].sup.2+ DHAD or a [4Fe-4S].sup.2+ DHAD. Such host cells can include, for example, Escherichia coli and Bacillus subtilis. Furthermore, engineering expression of a heterologous DHAD variant provides DHAD activity in a host bacterial cell that has no endogenous DHAD activity. Such host cells can include, for example, Lactobacillus, Enterococcus, Pediococcus and Leuconostoc.

    [0181] Specific hosts include, for example, Escherichia coli, Alcaligenes eutrophus, Bacillus licheniformis, Paenibacillus macerans, Rhodococcus erythropolis, Pseudomonas putida, Lactobacillus plantarum, Enterococcus faecium, Enterococcus gallinarium, Enterococcus faecalis, and Bacillus subtilis. Bacterial cells can be genetically modified for expression of DHAD variants using methods well known to one skilled in the art. Expression of DHAD variants is generally achieved by transforming suitable bacterial host cells with a sequence encoding a DHAD variant protein. Typically, the coding sequence is part of a chimeric gene used for transformation, which includes a promoter operably linked to the coding sequence as well as a ribosome binding site and a termination control region. The coding region can be from the host cell for transformation and combined with regulatory sequences that are not native to the natural gene encoding the variant DHAD. Alternatively, the coding region can be from another host cell.

    [0182] Vectors can be introduced into LAB host cells using methods known in the art, such as electroporation (Cruz-Rodz et al., Molecular Genetics and Genomics 224:1252-154 (1990), Bringel et al., Appl. Microbiol. Biotechnol. 33: 664-670 (1990), Alegre et al., FEMS Microbiology letters 241:73-77 (2004)), and conjugation (Shrago et al., Appl. Environ. Microbiol. 52:574-576 (1986)). A chimeric DHAD gene can also be integrated into the chromosome of LAB using integration vectors (Hols et al., Appl. Environ. Microbiol. 60:1401-1403 (1990), and Jang et al., Micro. Lett. 24:191-195 (2003)).

    [0183] Lactic acid bacteria are well characterized and are used commercially in a number of industrial processes. Although it is known that some lactic acid bacteria possess iron-sulfur (FeS) cluster requiring enzymes (Liu et al., Journal of Biological Chemistry (2000), 275(17), 12367-12373), and therefore possess the genetic machinery to produce FeS clusters, little is known about the ability of lactic acid bacteria to insert FeS clusters into heterologous enzymes, and little is known about the facility with which FeS cluster forming proteins can be expressed in lactic acid bacteria.

    [0184] To obtain high levels of product in a lactic acid bacterium from a biosynthetic pathway including DHAD activity, high expression of DHAD activity is desired. The activity of the FeS requiring DHAD enzyme in a host cell can be limited, for example, by the availability of FeS clusters in the cell. Increasing the expression of FeS cluster forming proteins effectively increased the activity of DHAD in LAB cells. Thus, in certain embodiments, a lactic acid bacterial host cell is genetically engineered to express at least one recombinant genetic expression element encoding FeS cluster forming proteins. The genetic engineering of lactic acid bacteria to express iron-sulfur cluster forming proteins is described in U.S. Appl. Pub. No. 2010/0081182, which is herein incorporated by reference.

    [0185] Expression of any set of proteins for FeS cluster formation can be used to increase DHAD activity in LAB cells. There are three known groups of FeS cluster forming proteins. These proteins are encoded by three types of operons: the Suf operon, the Isc operon, and the Nif operon. U.S. Appl. Pub. No. 2010/0081182 discloses the Suf operons of Lactobacillus plantarum (L. plantarum), Lactobacillus lactis (L. lactis), and Escherichia coli (E. coli); the Isc operon of E. coli; and the Nif operon of Wolinella succinogenes. Additional FeS cluster forming proteins can be readily identified by a skilled artisan, for example, by using the sequences disclosed in U.S. Appl. Pub. No. 2010/0081182 as sequence probes to identify homologous proteins in a desired organism.

    Culture Conditions for Butanol Production

    [0186] The invention is also directed to a method for the production of butanol (e.g., isobutanol), comprising providing a recombinant host cell comprising the isolated nucleic acid molecules of the present invention encoding a variant DHAD described herein; culturing the recombinant host cell in a fermentation medium under suitable conditions to produce isobutanol from pyruvate; and recovering the isobutanol. In certain embodiments, the butanol (e.g., isobutanol) is produced at a titer that is increased as compared to a recombinant host cell that does not contain a variant DHAD.

    [0187] In other embodiments, the isobutanol is produced at a rate that is increased by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 15%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, or at least about 50%, or more, as compared to a recombinant host cell that does not contain a variant DHAD. In other aspects of the method to produce isobutanol, the concentration of isobutanol in the fermentation medium is greater than or equal to about 10 mM, greater than or equal to about 20 mM, greater than or equal to about 30 mM, greater than or equal to about 40 mM, greater than or equal to about 50 mM, greater than or equal to about 60 mM, greater than or equal to about 70 mM, greater than or equal to about 80 mM, greater than or equal to about 950 mM, or greater than or equal to about 100 mM.

    [0188] The invention is also directed to methods for the production of butanol comprising providing a recombinant host cell comprising a polypeptide or variant thereof of the present invention, or a nucleic acid molecule which encodes a polypeptide or variant thereof of the present invention. In some embodiments, the method is a method for the production of isobutanol, comprising providing a recombinant host cell comprising a nucleic acid molecule of the invention encoding a variant DHAD, culturing the recombinant host cell in a fermentation medium under suitable conditions to produce isobutanol from pyruvate; and recovering the isobutanol. In some embodiments, the butanol (e.g., isobutanol) is produced at a titer that is increased as compared to a recombinant host cell that does not contain a variant DHAD. In other embodiments, the butanol (e.g., isobutanol) is produced at a rate that is increased by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, or more, as compared to a recombinant host cell that does not contain a variant DHAD, or any range of values thereof. In other embodiments, the butanol (e.g., isobutanol) is produced at a titer that is increased as compared to a recombinant host cell that does not contain a variant DHAD. In other embodiments, the butanol (e.g., isobutanol) is produced at a rate that is increased by about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, or more, as compared to a recombinant host cell that does not contain a variant DHAD, or any range of values thereof. In other embodiments, the butanol (e.g., isobutanol) is produced at a rate that is increased by about 5% to about 50%, about 5% to about 45%, about 5% to about 40%, about 5% to about 35%, about 5% to about 30%, about 5% to about 25%, about 5% to about 20%, about 5% to about 15%, about 5% to about 10%, about 10% to about 50%, about 10% to about 45%, about 10% to about 40%, about 10% to about 35%, about 10% to about 30%, about 10% to about 25%, about 10% to about 20%, or about 10% to about 15%, as compared to a recombinant host cell that does not contain a variant DHAD.

    [0189] In other aspects of the method to produce butanol, the concentration of butanol (e.g., isobutanol) in the fermentation medium is greater than or equal to about 10 mM, greater than or equal to about 20 mM, greater than or equal to about 30 mM, greater than or equal to about 40 mM, greater than or equal to about 50 mM, greater than or equal to about 60 mM, greater than or equal to about 70 mM, greater than or equal to about 80 mM, greater than or equal to about 90 mM, greater than or equal to about 100 mM, or more, or any range of values thereof. In some embodiments, the concentration of butanol (e.g., isobutanol) in the fermentation medium is about 10 mM to about 100 mM, about 20 mM to about 100 mM, about 30 mM to about 100 mM, about 40 mM to about 100 mM, about 50 mM to about 100 mM, about 60 mM to about 100 mM, about 70 mM to about 100 mM, about 80 mM to about 100 mM, or about 90 mM to about 100 mM.

    [0190] In other embodiments, the invention is directed to a method of converting 2,3-dihydroxyisovalerate to -ketoisovalerate or 2,3-dihydroxymethylvalerate to -ketomethylvalerate, comprising providing a polypeptide or variant thereof of the invention. In some embodiments, the method comprises (a) providing a polypeptide or variant thereof of the invention, and (b) contacting the polypeptide or variant thereof with 2,3-dihydroxy isovalerate or 2,3-dihydroxymethylvalerate under conditions whereby 2,3-dihydroxyisovalerate is converted to -ketoisovalerate, or whereby 2,3-dihydroxymethylvalerate is converted to -ketomethylvalerate. It has been discovered that the activity of the polypeptides or variants of the invention is increased, and/or the conversion of 2,3-dihydroxyisovalerate to -ketoisovalerate or 2,3-dihydroxymethylvalerate to -ketomethylvalerate is improved, as compared to a control polypeptide having DHAD activity which does not comprise a tag.

    [0191] Recombinant host cells disclosed herein are grown in media which contains suitable carbon substrates. Additional carbon substrates can include, but are not limited to, monosaccharides such as fructose, oligosaccharides such as lactose, maltose, galactose, sucrose, or mixtures thereof, polysaccharides such as starch, cellulose or mixtures thereof, and unpurified mixtures from renewable feedstocks such as cheese whey permeate, cornsteep liquor, sugar beet molasses, and barley malt. Other carbon substrates can include, but are not limited to, ethanol, lactate, succinate, glycerol, or mixtures thereof.

    [0192] Additionally, in some embodiments, the carbon substrate can also be a one carbon substrate such as carbon dioxide, or methanol for which metabolic conversion into key biochemical intermediates has been demonstrated. In addition to one and two carbon substrates, methylotrophic organisms are also known to utilize a number of other carbon containing compounds such as methylamine, glucosamine, and a variety of amino acids for metabolic activity. For example, methylotrophic yeasts are known to utilize the carbon from methylamine to form trehalose or glycerol (Bellion et al., Microb. Growth Cl Compd., [Int. Symp.], 7th (1993), 415 32, Editor(s): Murrell, J. Collin; Kelly, Don P. Publisher: Intercept, Andover, UK). Similarly, various species of Candida will metabolize alanine or oleic acid (Sulter et al., Arch. Microbiol. 153:485 489 (1990)). Hence, it is contemplated that the source of carbon utilized in the present invention can encompass a wide variety of carbon containing substrates and will only be limited by the choice of organism.

    [0193] Although it is contemplated that all of the above mentioned carbon substrates and mixtures thereof are suitable in the present invention, in some embodiments, the carbon substrates are glucose, fructose, and sucrose, or mixtures of these with five-carbon (C5) sugars such as xylose and/or arabinose for yeasts cells modified to use C5 sugars. Sucrose can be derived from renewable sugar sources such as sugar cane, sugar beets, cassava, sweet sorghum, and mixtures thereof. Glucose and dextrose can be derived from renewable grain sources through saccharification of starch based feedstocks including grains such as corn, wheat, rye, barley, oats, and mixtures thereof. In addition, fermentable sugars can be derived from renewable cellulosic or lignocellulosic biomass through processes of pretreatment and saccharification, as described, for example, in U.S. Pat. No. 7,932,063, which is herein incorporated by reference. Biomass refers to any cellulosic or lignocellulosic material and includes materials comprising cellulose, and optionally further comprising hemicellulose, lignin, starch, oligosaccharides and/or monosaccharides. Biomass can also comprise additional components, such as protein and/or lipid. Biomass can be derived from a single source, or biomass can comprise a mixture derived from more than one source; for example, biomass can comprise a mixture of corn cobs and corn stover, or a mixture of grass and leaves. Biomass includes, but is not limited to, bioenergy crops, agricultural residues, municipal solid waste, industrial solid waste, sludge from paper manufacture, yard waste, wood and forestry waste. Examples of biomass include, but are not limited to, corn grain, corn cobs, crop residues such as corn husks, corn stover, grasses, wheat, wheat straw, barley, barley straw, hay, rice straw, switchgrass, waste paper, sugar cane bagasse, sorghum, soy, components obtained from milling of grains, trees, branches, roots, leaves, wood chips, sawdust, shrubs, bushes, vegetables, fruits, flowers, animal manure, and mixtures thereof.

    [0194] In addition to an appropriate carbon source, fermentation media contains suitable minerals, salts, cofactors, buffers and other components, known to those skilled in the art and suitable for growth of the cultures and promotion of an enzymatic pathway comprising a DHAD.

    [0195] Typically, cells are grown at a temperature in the range of about 20 C. to about 40 C. in an appropriate medium. Suitable growth media for the present invention include, for example, common commercially prepared media such as Luria Bertani (LB) broth, Sabouraud Dextrose (SD) broth, Yeast Medium (YM) broth, or broth that includes yeast nitrogen base, ammonium sulfate, and dextrose (as the carbon/energy source) or Yeast Extract Peptone Dextrose (YPD) Medium, a blend of peptone, yeast extract, and dextrose in optimal proportions for growing most Saccharomyces cerevisiae strains. Other defined or synthetic growth media can also be used, and the appropriate medium for growth of the particular microorganism will be known by one skilled in the art of microbiology or fermentation science. The use of agents known to modulate catabolite repression directly or indirectly, e.g., cyclic adenosine 2:3 monophosphate, can also be incorporated into the fermentation medium.

    [0196] Suitable pH ranges for the fermentation are from about pH 5.0 to about pH 9.0. In one embodiment, about pH 6.0 to about pH 8.0 is used for the initial condition. Suitable pH ranges for the fermentation of yeast are typically between about pH 3.0 to about pH 9.0. In one embodiment, about pH 5.0 to about pH 8.0 is used for the initial condition. Suitable pH ranges for the fermentation of other microorganisms are from about pH 3.0 to about pH 7.5. In one embodiment, about pH 4.5 to about pH 6.5 is used for the initial condition.

    [0197] Fermentations can be performed under aerobic or anaerobic conditions. In one embodiment, anaerobic or microaerobic conditions are used for fermentations.

    Industrial Batch and Continuous Fermentations

    [0198] Isobutanol, or other products, can be produced using a batch method of fermentation. A classical batch fermentation is a closed system where the composition of the medium is set at the beginning of the fermentation and not subject to artificial alterations during the fermentation. A variation on the standard batch system is the fed batch system. Fed batch fermentation processes are also suitable in the present invention and comprise a typical batch system with the exception that the substrate is added in increments as the fermentation progresses. Fed batch systems are useful when catabolite repression is apt to inhibit the metabolism of the cells and where it is desirable to have limited amounts of substrate in the media. Batch and fed batch fermentations are common and well known in the art, examples of which are found in Thomas D. Brock in Biotechnology: A Textbook of Industrial Microbiology, Second Edition (1989) Sinauer Associates, Inc., Sunderland, M.A., or Deshpande, Mukund V., Appl. Biochem. Biotechnol., 36:227, (1992), herein incorporated by reference.

    [0199] Isobutanol, or other products, can also be produced using continuous fermentation methods. Continuous fermentation is an open system where a defined fermentation medium is added continuously to a bioreactor and an equal amount of conditioned media is removed simultaneously for processing. Continuous fermentation generally maintains the cultures at a constant high density where cells are primarily in log phase growth. Continuous fermentation allows for the modulation of one factor or any number of factors that affect cell growth or end product concentration. Methods of modulating nutrients and growth factors for continuous fermentation processes as well as techniques for maximizing the rate of product formation are well known in the art of industrial microbiology and a variety of methods are detailed by Brock, supra.

    [0200] It is contemplated that the production of isobutanol, or other products, can be practiced using batch, fed batch or continuous processes and that any known mode of fermentation is suitable. Additionally, it is contemplated that cells can be immobilized on a substrate as whole cell catalysts and subjected to fermentation conditions for isobutanol production.

    Biosynthetic Pathways

    [0201] Expression of a DHAD variant in bacteria or yeast, as described herein, provides the transformed, recombinant host cell with dihydroxy-acid dehydratase (DHAD) activity for conversion of 2,3-dihydroxyisovalerate to -ketoisovalerate or 2,3-dihydroxymethylvalerate to -ketomethylvalerate. Any product that has -ketoisovalerate or -ketomethylvalerate as a pathway intermediate can be produced in a bacterial or yeast strain disclosed herein having the described heterologous DHAD variants. A list of such products includes, but is not limited to, valine, isoleucine, leucine, pantothenic acid, 2-methyl-1-butanol, 3-methyl-1-butanol and isobutanol.

    [0202] For example, yeast biosynthesis of valine includes steps of acetolactate conversion to 2,3-dihydroxyisovalerate by acetohydroxyacid reductoisomerase (ILV5), conversion of 2,3-dihydroxyisovalerate to -ketoisovalerate (also called 2-keto-isovalerate) by dihydroxy-acid dehydratase, and conversion of -ketoisovalerate to valine by branched-chain amino acid transaminase (BAT2) and branched-chain amino acid aminotransferase (BAT1). Biosynthesis of leucine includes the same steps to -ketoisovalerate, followed by conversion of -ketoisovalerate to -isopropylmalate by -isopropylmalate synthase (LEU9, LEU4), conversion of -isopropylmalate to beta-isopropylmalate by isopropylmalate isomerase (LEU1), conversion of beta-isopropylmalate to -ketoisocaproate by beta-IPM dehydrogenase (LEU2), and finally conversion of -ketoisocaproate to leucine by branched-chain amino acid transaminase (BAT2) and branched-chain amino acid aminotransferase (BAT1). The bacterial pathway is similar, involving differently named proteins and genes. Increased conversion of 2,3-dihydroxyisovalerate to -ketoisovalerate will increase flow in these pathways, particularly if one or more additional enzymes of a pathway is overexpressed. Thus, it is desired for production of valine or leucine to use a strain disclosed herein.

    [0203] Biosynthesis of pantothenic acid includes a step performed by DHAD, as well as steps performed by ketopantoate hydroxymethyltransferase and pantothenate synthase. Engineering of expression of these enzymes for enhanced production of pantothenic acid biosynthesis in microorganisms is described, for example, in U.S. Pat. No. 6,177,264, which is incorporated by reference herein.

    [0204] The -ketoisovalerate product of DHAD is an intermediate in the isobutanol biosynthetic pathways disclosed, for example, in U.S. Pat. No. 7,851,188, which is incorporated by reference herein. A diagram of the disclosed isobutanol biosynthetic pathways is provided in FIG. 1. Production of isobutanol in a strain disclosed herein benefits from increased DHAD activity. As disclosed herein, DHAD activity is provided by expression of a variant DHAD in a bacterial or yeast cell. As described in U.S. Pat. No. 7,851,188, steps in an example isobutanol biosynthetic pathway include conversion of: pyruvate to acetolactate as catalyzed for example by acetolactate synthase, acetolactate to 2,3-dihydroxyisovalerate as catalyzed for example by acetohydroxy acid isomeroreductase; 2,3-dihydroxy isovalerate to -ketoisovalerate as catalyzed for example by acetohydroxy acid dehydratase, also called dihydroxy-acid dehydratase (DHAD); -ketoisovalerate to isobutyraldehyde as catalyzed for example by branched-chain -keto acid decarboxylase; and isobutyraldehyde to isobutanol as catalyzed for example by branched-chain alcohol dehydrogenase. The substrate to product conversions, and enzymes involved in these reactions, are described, for example, in U.S. Pat. No. 7,851,188, which is incorporated by reference herein.

    [0205] Genes that can be used for expression of the pathway step enzymes named above other than the variant DHADs disclosed herein, as well as those for two additional isobutanol pathways, are described, for example, in U.S. Pat. No. 7,851,188, which is incorporated by reference herein. Additional genes that can be used can be identified by one skilled in the art through bioinformatics or experimentally as described above. Ketol-acid reductoisomerase (KARI) enzymes are also disclosed, for example, in U.S. Pat. No. 7,910,342 and PCT App. Pub. No. WO2012/129555, which are incorporated by reference herein. Examples of KARIs disclosed therein include KARIs from Vibrio cholerae (DNA: SEQ ID NO:684; protein SEQ ID NO:685), Pseudomonas aeruginosa PAO1, (DNA: SEQ ID NO:686; protein SEQ ID NO:687), Pseudomonas fluorescens PF5 (DNA: SEQ ID NO:688; protein SEQ ID NO:689) and Anaerostipes caccae (protein SEQ ID NO:697).

    [0206] Additionally described in U.S. Pat. No. 7,851,188 is the construction of chimeric genes and genetic engineering of bacteria and yeast for isobutanol production using the disclosed biosynthetic pathways. In some embodiments, one or more components of the above-described biosynthetic pathways can be endogenous to the host cell of choice, or can be heterologous. Additionally, in other embodiments, one or more of the genes encoding the enzymes required in the above-described biosynthetic pathways can be overexpressed in the host cell.

    Methods for Butanol Isolation from Fermentation Medium

    [0207] Bioproduced butanol (e.g., isobutanol) may be isolated from the fermentation medium using methods known in the art for ABE fermentations (see, e.g., Durre, Appl. Microbiol. Biotechnol. 49:639-648 (1998), Groot et al., Process. Biochem. 27:61-75 (1992), and references therein). For example, solids may be removed from the fermentation medium by centrifugation, filtration, decantation, or the like. Then, the isobutanol may be isolated from the fermentation medium using methods such as distillation, azeotropic distillation, liquid-liquid extraction, adsorption, gas stripping, membrane evaporation, or pervaporation.

    [0208] Because isobutanol forms a low boiling point, azeotropic mixture with water, distillation can be used to separate the mixture up to its azeotropic composition. Distillation may be used in combination with another separation method to obtain separation around the azeotrope. Methods that may be used in combination with distillation to isolate and purify butanol include, but are not limited to, decantation, liquid-liquid extraction, adsorption, and membrane-based techniques. Additionally, butanol may be isolated using azeotropic distillation using an entrainer (see, e.g., Doherty and Malone, Conceptual Design of Distillation Systems, McGraw Hill, New York, 2001).

    [0209] The butanol-water mixture forms a heterogeneous azeotrope so that distillation may be used in combination with decantation to isolate and purify the isobutanol. In this method, the isobutanol containing fermentation broth is distilled to near the azeotropic composition. Then, the azeotropic mixture is condensed, and the isobutanol is separated from the fermentation medium by decantation. The decanted aqueous phase may be returned to the first distillation column as reflux. The isobutanol-rich decanted organic phase may be further purified by distillation in a second distillation column.

    [0210] The isobutanol can also be isolated from the fermentation medium using liquid-liquid extraction in combination with distillation. In this method, the isobutanol is extracted from the fermentation broth using liquid-liquid extraction with a suitable solvent. The isobutanol-containing organic phase is then distilled to separate the butanol from the solvent.

    [0211] Distillation in combination with adsorption can also be used to isolate isobutanol from the fermentation medium. In this method, the fermentation broth containing the isobutanol is distilled to near the azeotropic composition and then the remaining water is removed by use of an adsorbent, such as molecular sieves (Aden et al., Lignocellulosic Biomass to Ethanol Process Design and Economics Utilizing Co-Current Dilute Acid Prehydrolysis and Enzymatic Hydrolysis for Corn Stover, Report NREL/TP-510-32438, National Renewable Energy Laboratory, June 2002).

    [0212] Additionally, distillation in combination with pervaporation may be used to isolate and purify the isobutanol from the fermentation medium. In this method, the fermentation broth containing the isobutanol is distilled to near the azeotropic composition, and then the remaining water is removed by pervaporation through a hydrophilic membrane (Guo et al., J. Membr. Sci. 245, 199-210 (2004)).

    [0213] In situ product removal (ISPR) (also referred to as extractive fermentation) can be used to remove butanol (or other fermentative alcohol) from the fermentation vessel as it is produced, thereby allowing the microorganism to produce butanol at high yields. One method for ISPR for removing fermentative alcohol that has been described in the art is liquid-liquid extraction. In general, with regard to butanol fermentation, for example, the fermentation medium, which includes the microorganism, is contacted with an organic extractant at a time before the butanol concentration reaches a toxic level. The organic extractant and the fermentation medium form a biphasic mixture. The butanol partitions into the organic extractant phase, decreasing the concentration in the aqueous phase containing the microorganism, thereby limiting the exposure of the microorganism to the inhibitory butanol.

    [0214] Liquid-liquid extraction can be performed, for example, according to the processes described in U.S. Patent Appl. Pub. No. 2009/0305370, the disclosure of which is hereby incorporated in its entirety. U.S. Patent Appl. Pub. No. 2009/0305370 describes methods for producing and recovering butanol from a fermentation broth using liquid-liquid extraction, the methods comprising the step of contacting the fermentation broth with a water immiscible extractant to form a two-phase mixture comprising an aqueous phase and an organic phase. Typically, the extractant can be an organic extractant selected from the group consisting of saturated, mono-unsaturated, poly-unsaturated (and mixtures thereof) C.sub.12 to C.sub.22 fatty alcohols, C.sub.12 to C.sub.22 fatty acids, esters of C.sub.12 to C.sub.22 fatty acids, C.sub.12 to C.sub.22 fatty aldehydes, and mixtures thereof. The extractant(s) for ISPR can be non-alcohol extractants. The ISPR extractant can be an exogenous organic extractant such as oleyl alcohol, behenyl alcohol, cetyl alcohol, lauryl alcohol, myristyl alcohol, stearyl alcohol, 1-undecanol, oleic acid, lauric acid, myristic acid, stearic acid, methyl myristate, methyl oleate, undecanal, lauric aldehyde, 20-methylundecanal, and mixtures thereof.

    [0215] In some embodiments, the alcohol can be formed by contacting the alcohol in a fermentation medium with an organic acid (e.g., fatty acids) and a catalyst capable of esterifying the alcohol with the organic acid. In such embodiments, the organic acid can serve as an ISPR extractant into which the alcohol esters partition. The organic acid can be supplied to the fermentation vessel and/or derived from the biomass supplying fermentable carbon fed to the fermentation vessel. Lipids present in the feedstock can be catalytically hydrolyzed to organic acid, and the same catalyst (e.g., enzymes) can esterify the organic acid with the alcohol. The catalyst can be supplied to the feedstock prior to fermentation, or can be supplied to the fermentation vessel before or contemporaneously with the supplying of the feedstock. When the catalyst is supplied to the fermentation vessel, alcohol esters can be obtained by hydrolysis of the lipids into organic acid and substantially simultaneous esterification of the organic acid with butanol present in the fermentation vessel. Organic acid and/or native oil not derived from the feedstock can also be fed to the fermentation vessel, with the native oil being hydrolyzed into organic acid. Any organic acid not esterified with the alcohol can serve as part of the ISPR extractant. The extractant containing alcohol esters can be separated from the fermentation medium, and the alcohol can be recovered from the extractant. The extractant can be recycled to the fermentation vessel. Thus, in the case of butanol production, for example, the conversion of the butanol to an ester reduces the free butanol concentration in the fermentation medium, shielding the microorganism from the toxic effect of increasing butanol concentration. In addition, unfractionated grain can be used as feedstock without separation of lipids therein, since the lipids can be catalytically hydrolyzed to organic acid, thereby decreasing the rate of build-up of lipids in the ISPR extractant.

    [0216] In situ product removal can be carried out in a batch mode or a continuous mode. In a continuous mode of in situ product removal, product is continually removed from the reactor. In a batchwise mode of in situ product removal, a volume of organic extractant is added to the fermentation vessel and the extractant is not removed during the process. For in situ product removal, the organic extractant can contact the fermentation medium at the start of the fermentation forming a biphasic fermentation medium. Alternatively, the organic extractant can contact the fermentation medium after the microorganism has achieved a desired amount of growth, which can be determined by measuring the optical density of the culture. Further, the organic extractant can contact the fermentation medium at a time at which the product alcohol level in the fermentation medium reaches a preselected level. In the case of butanol production according to some embodiments of the present invention, the organic acid extractant can contact the fermentation medium at a time before the butanol concentration reaches a toxic level, so as to esterify the butanol with the organic acid to produce butanol esters and consequently reduce the concentration of butanol in the fermentation vessel. The ester-containing organic phase can then be removed from the fermentation vessel (and separated from the fermentation broth which constitutes the aqueous phase) after a desired effective titer of the butanol esters is achieved. In some embodiments, the ester-containing organic phase is separated from the aqueous phase after fermentation of the available fermentable sugar in the fermentation vessel is substantially complete.

    Examples

    Example 1: Construction of Yeast Strain PNY2115, PNY2145 and Other Plasmids Creation of PNY2115

    [0217] Yeast strain PNY2115 has the following genotype: MATa ura3::loxP his3 pdc5::loxP66/71 fra2 2-micron plasmid (CEN.PK2) pdc1::P[PDC1]-ALS|alsS_Bs-CYC1t-loxP71/66 pdc6::(UAS)PGK1-P[FBA1]-KIVD|Lg(y)-TDH3t-loxP71/66 adh1::P[ADH1]-ADH|Bi(y)-ADHt-loxP71/66 fra2::P[ILV5]-ADH|Bi(y)-ADHt-loxP71/66 gpd2::loxP71/66.

    [0218] Saccharomyces cerevisiae strain PNY0827 is used as the starting strain for the construction of strain PNY2115. PNY0827 refers to a strain derived from Saccharomyces cerevisiae which has been deposited at the ATCC under the Budapest Treaty on Sep. 22, 2011 at the American Type Culture Collection, Patent Depository 10801 University Boulevard, Manassas, Va. 20110-2209 and has the patent deposit designation PTA-12105.

    1. Deletion of URA3 and Sporulation into Haploids

    [0219] In order to delete the endogenous URA3 coding region, a deletion cassette was PCR-amplified from pLA54 (SEQ ID NO:592) which contains a PTEF1-kanMX4-TEF1t cassette flanked by loxP sites to allow homologous recombination in vivo and subsequent removal of the KANMX4 marker. PCR was done by using Phusion High Fidelity PCR Master Mix (New England BioLabs; Ipswich, Mass.) and primers BK505 (SEQ ID NO:593) and BK506 (SEQ ID NO:594). The URA3 portion of each primer was derived from the 5 region 180 nucleotides upstream of the URA3 ATG and 3 region 78 nucleotides downstream of the coding region such that integration of the kanMX4 cassette results in replacement of the URA3 coding region. The PCR product was transformed into PNY0827 using standard genetic techniques (Methods in Yeast Genetics, 2005, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., pp. 201-202) and transformants were selected on Yeast Extract Peptone (YEP) medium supplemented with 2% glucose and 100 g/ml Geneticin (Invitrogen Life Technologies, Grand Island, N.Y.) at 30 C. Transformants were screened by colony PCR with primers LA468 (SEQ ID NO:595) and LA492 (SEQ ID NO:596) to verify presence of the integration cassette. A heterozygous diploid was obtained: NYLA98, which has the genotype MATa/ URA3/ura3::loxP-kanMX4-loxP. To obtain haploids, NYLA98 was sporulated using standard methods (Codn A. C., Gasent-Ramrez J. M., Bentez T. Factors which affect the frequency of sporulation and tetrad formation in Saccharomyces cerevisiae baker's yeast. Appl Environ Microbiol. 1995 PMID: 7574601). Tetrads were dissected using a micromanipulator and grown on rich YEP medium supplemented with 2% glucose. Tetrads containing four viable spores were patched onto synthetic complete medium lacking uracil supplemented with 2% glucose, and the mating type was verified by multiplex colony PCR using primers AK109-1 (SEQ ID NO:597), AK109-2 (SEQ ID NO:598), and AK109-3 (SEQ ID NO:599). The resulting identified haploid strain was called NYLA103, which has the genotype: MAT ura3::loxP-kanMX4-loxP, and NYLA106, which has the genotype: MATa ura3::loxP-kanMX4-loxP.

    2. Deletion of HIS3

    [0220] To delete the endogenous HIS3 coding region, a scarless deletion cassette was used. The four fragments for the PCR cassette for the scarless HIS3 deletion were amplified using Phusion High Fidelity PCR Master Mix (New England BioLabs; Ipswich, Mass.) and CEN.PK 113-7D genomic DNA as template, prepared with a Gentra Puregene Yeast/Bact kit (Qiagen Inc., Valencia, Calif.). HIS3 Fragment A was amplified with primer oBP452 (SEQ ID NO:600) and primer oBP453 (SEQ ID NO:601), containing a 5 tail with homology to the 5 end of HIS3 Fragment B. HIS3 Fragment B was amplified with primer oBP454 (SEQ ID NO:602), containing a 5 tail with homology to the 3 end of HIS3 Fragment A, and primer oBP455 (SEQ ID NO:603) containing a 5 tail with homology to the 5 end of HIS3 Fragment U. HIS3 Fragment U was amplified with primer oBP456 (SEQ ID NO:604), containing a 5 tail with homology to the 3 end of HIS3 Fragment B, and primer oBP457 (SEQ ID NO:605), containing a 5 tail with homology to the 5 end of HIS3 Fragment C. HIS3 Fragment C was amplified with primer oBP458 (SEQ ID NO:606), containing a 5 tail with homology to the 3 end of HIS3 Fragment U, and primer oBP459 (SEQ ID NO:607). PCR products were purified with a PCR Purification kit (Qiagen Inc., Valencia, Calif.). HIS3 Fragment AB was created by overlapping PCR by mixing HIS3 Fragment A and HIS3 Fragment B and amplifying with primers oBP452 (SEQ ID NO:600) and oBP455 (SEQ ID NO:603). HIS3 Fragment UC was created by overlapping PCR by mixing HIS3 Fragment U and HIS3 Fragment C and amplifying with primers oBP456 (SEQ ID NO:604) and oBP459 (SEQ ID NO:607). The resulting PCR products were purified on an agarose gel followed by a Gel Extraction kit (Qiagen Inc., Valencia, Calif.). The HIS3 ABUC cassette was created by overlapping PCR by mixing HIS3 Fragment AB and HIS3 Fragment UC and amplifying with primers oBP452 (SEQ ID NO:600) and oBP459 (SEQ ID NO:607). The PCR product was purified with a PCR Purification kit (Qiagen Inc., Valencia, Calif.). Competent cells of NYLA106 were transformed with the HIS3 ABUC PCR cassette and were plated on synthetic complete medium lacking uracil supplemented with 2% glucose at 30 C. Transformants were screened to verify correct integration by replica plating onto synthetic complete medium lacking histidine and supplemented with 2% glucose at 30 C. Genomic DNA preparations were made to verify the integration by PCR using primers oBP460 (SEQ ID NO:608) and LA135 (SEQ ID NO:609) for the 5 end and primers oBP461 (SEQ ID NO:610) and LA92 (SEQ ID NO:611) for the 3 end. The URA3 marker was recycled by plating on synthetic complete medium supplemented with 2% glucose and 5-fluoroorotic acid (5-FOA) at 30 C. following standard protocols. Marker removal was confirmed by patching colonies from 5-fluoroorotic Acid (5-FOA) plates onto SD-URA medium to verify the absence of growth. The resulting identified strain, called PNY2003 has the genotype: MATa ura3::loxP-kanMX4-loxP his3.

    3. Deletion of PDC1

    [0221] To delete the endogenous PDC1 coding region, a deletion cassette was PCR-amplified from pLA59 (SEQ ID NO:612), which contains a URA3 marker flanked by degenerate loxP sites to allow homologous recombination in vivo and subsequent removal of the URA3 marker. PCR was done by using Phusion High Fidelity PCR Master Mix (New England BioLabs; Ipswich, Mass.) and primers LA678 (SEQ ID NO:613) and LA679 (SEQ ID NO:614). The PDC1 portion of each primer was derived from the 5 region 50 nucleotides downstream of the PDC1 start codon and 3 region 50 nucleotides upstream of the stop codon such that integration of the URA3 cassette results in replacement of the PDC1 coding region but leaves the first 50 nucleotides and the last 50 nucleotides of the coding region. The PCR product was transformed into PNY2003 using standard genetic techniques and transformants were selected on synthetic complete medium lacking uracil and supplemented with 2% glucose at 30 C. Transformants were screened to verify correct integration by colony PCR using primers LA337 (SEQ ID NO:615), external to the 5 coding region and LA135 (SEQ ID NO:609), an internal primer to URA3. Positive transformants were then screened by colony PCR using primers LA692 (SEQ ID NO:616) and LA693 (SEQ ID NO:617), internal to the PDC1 coding region. The URA3 marker was recycled by transforming with pLA34 (SEQ ID NO:618) containing the CRE recombinase under the GAL1 promoter and plated on synthetic complete medium lacking histidine and supplemented with 2% glucose at 30 C. Transformants were plated on rich medium supplemented with 0.5% galactose to induce the recombinase. Marker removal was confirmed by patching colonies to synthetic complete medium lacking uracil and supplemented with 2% glucose to verify absence of growth. The resulting identified strain, called PNY2008 has the genotype: MATa ura3::loxP-kanMX4-loxP his3 pdc1::loxP71/66.

    4. Deletion of PDC5

    [0222] To delete the endogenous PDC5 coding region, a deletion cassette was PCR-amplified from pLA59 (SEQ ID NO:612), which contains a URA3 marker flanked by degenerate loxP sites to allow homologous recombination in vivo and subsequent removal of the URA3 marker. PCR was done by using Phusion High Fidelity PCR Master Mix (New England BioLabs; Ipswich, Mass.) and primers LA722 (SEQ ID NO:619) and LA733 (SEQ ID NO:620). The PDC5 portion of each primer was derived from the 5 region 50 nucleotides upstream of the PDC5 start codon and 3 region 50 nucleotides downstream of the stop codon such that integration of the URA3 cassette results in replacement of the entire PDC5 coding region. The PCR product was transformed into PNY2008 using standard genetic techniques and transformants were selected on synthetic complete medium lacking uracil and supplemented with 1% ethanol at 30 C. Transformants were screened to verify correct integration by colony PCR using primers LA453 (SEQ ID NO:621), external to the 5 coding region and LA135 (SEQ ID NO:609), an internal primer to URA3. Positive transformants were then screened by colony PCR using primers LA694 (SEQ ID NO:622) and LA695 (SEQ ID NO:623), internal to the PDC5 coding region. The URA3 marker was recycled by transforming with pLA34 (SEQ ID NO:618) containing the CRE recombinase under the GAL1 promoter and plated on synthetic complete medium lacking histidine and supplemented with 1% ethanol at 30 C. Transformants were plated on rich YEP medium supplemented with 1% ethanol and 0.5% galactose to induce the recombinase. Marker removal was confirmed by patching colonies to synthetic complete medium lacking uracil and supplemented with 1% ethanol to verify absence of growth. The resulting identified strain, called PNY2009 has the genotype: MATa ura3::loxP-kanMX4-loxP his3 pdc1::loxP71/66 pdc5::loxP71/66.

    5. Deletion of FRA2

    [0223] The FRA2 deletion was designed to delete 250 nucleotides from the 3 end of the coding sequence, leaving the first 113 nucleotides of the FRA2 coding sequence intact. An in-frame stop codon was present seven nucleotides downstream of the deletion. The four fragments for the PCR cassette for the scarless FRA2 deletion were amplified using Phusion High Fidelity PCR Master Mix (New England BioLabs; Ipswich, Mass.) and CEN.PK 113-7D genomic DNA as template, prepared with a Gentra Puregene Yeast/Bact kit (Qiagen Inc., Valencia, Calif.). FRA2 Fragment A was amplified with primer oBP594 (SEQ ID NO:624) and primer oBP595 (SEQ ID NO:625), containing a 5 tail with homology to the 5 end of FRA2 Fragment B. FRA2 Fragment B was amplified with primer oBP596 (SEQ ID NO:626), containing a 5 tail with homology to the 3 end of FRA2 Fragment A, and primer oBP597 (SEQ ID NO:627), containing a 5 tail with homology to the 5 end of FRA2 Fragment U. FRA2 Fragment U was amplified with primer oBP598 (SEQ ID NO:628), containing a 5 tail with homology to the 3 end of FRA2 Fragment B, and primer oBP599 (SEQ ID NO:629), containing a 5 tail with homology to the 5 end of FRA2 Fragment C. FRA2 Fragment C was amplified with primer oBP600 (SEQ ID NO:630), containing a 5 tail with homology to the 3 end of FRA2 Fragment U, and primer oBP601 (SEQ ID NO:631). PCR products were purified with a PCR Purification kit (Qiagen Inc., Valencia, Calif.). FRA2 Fragment AB was created by overlapping PCR by mixing FRA2 Fragment A and FRA2 Fragment B and amplifying with primers oBP594 (SEQ ID NO:624) and oBP597 (SEQ ID NO:627). FRA2 Fragment UC was created by overlapping PCR by mixing FRA2 Fragment U and FRA2 Fragment C and amplifying with primers oBP598 (SEQ ID NO:628) and oBP601 (SEQ ID NO:631). The resulting PCR products were purified on an agarose gel followed by a Gel Extraction kit (Qiagen Inc., Valencia, Calif.). The FRA2 ABUC cassette was created by overlapping PCR by mixing FRA2 Fragment AB and FRA2 Fragment UC and amplifying with primers oBP594 (SEQ ID NO:624) and oBP601 (SEQ ID NO:631). The PCR product was purified with a PCR Purification kit (Qiagen Inc., Valencia, Calif.).

    [0224] To delete the endogenous FRA2 coding region, the scarless deletion cassette obtained above was transformed into PNY2009 using standard techniques and plated on synthetic complete medium lacking uracil and supplemented with 1% ethanol. Genomic DNA preparations were made to verify the integration by PCR using primers oBP602 (SEQ ID NO:632) and LA135 (SEQ ID NO:609) for the 5 end, and primers oBP602 (SEQ ID NO:632) and oBP603 (SEQ ID NO:633) to amplify the whole locus. The URA3 marker was recycled by plating on synthetic complete medium supplemented with 1% ethanol and 5-FOA at 30 C. following standard protocols. Marker removal was confirmed by patching colonies from the 5-FOA plates onto synthetic complete medium lacking uracil and supplemented with 1% ethanol to verify the absence of growth. The resulting identified strain, PNY2037, has the genotype: MATa ura3::loxP-kanMX4-loxP his3 pdc1::loxP71/66 pdc5::loxP71/66 fra2.

    6. Addition of Native 2 Micron Plasmid

    [0225] The loxP71-URA3-loxP66 marker was PCR-amplified using Phusion DNA polymerase (New England BioLabs; Ipswich, Mass.) from pLA59 (SEQ ID NO:612), and transformed along with the LA811x817 (SEQ ID NOs:634 and 635) and LA812x818 (SEQ ID NOs:636 and 637) 2-micron plasmid fragments (amplified from the native 2-micron plasmid from CEN.PK 113-7D; Centraalbureau voor Schimmelcultures (CBS) Fungal Biodiversity Centre) into strain PNY2037 on SE-URA plates at 30 C. The resulting strain PNY2037 2::loxP71-URA3-loxP66 was transformed with pLA34 (pRS423::cre) (also called, pLA34) (SEQ ID NO:618) and selected on SE-HIS-URA plates at 30 C. Transformants were patched onto YP-1% galactose plates and allowed to grow for 48 hrs at 30 C. to induce Cre recombinase expression. Individual colonies were then patched onto SE-URA, SE-HIS, and YPE plates to confirm URA3 marker removal. The resulting identified strain, PNY2050, has the genotype: MATa ura3::loxP-kanMX4-loxP, his3 pdc1::loxP71/66 pdc5::loxP71/66 fra2 2-micron.

    7. Construction of PNY2115 from PNY2050

    [0226] Construction of PNY2115 [MATa ura3::loxP his3 pdc5::loxP66/71 fra2 2-micron plasmid (CEN.PK2) pdc1::P[PDC1]-ALS|alsS_Bs-CYC1t-loxP71/66 pdc6::(UAS)PGK1-P[FBA1]-KIVD|Lg(y)-TDH3t-loxP71/66 adh1::P[ADH1]-ADH|Bi(y)-ADHt-loxP71/66 fra2::P[ILV5]-ADH|Bi(y)-ADHt-loxP71/66 gpd2::loxP71/66] from PNY2050 was as follows:

    [0227] a. pdc1::P[PDC1]-ALS|alsS_Bs-CYC1t-loxP71/66

    [0228] To integrate alsS into the pdc1::loxP66/71 locus of PNY2050 using the endogenous PDC1 promoter, an integration cassette was PCR-amplified from pLA71 (SEQ ID NO:643), which contains the gene acetolactate synthase from the species Bacillus subtilis with a FBA1 promoter and a CYC1 terminator, and a URA3 marker flanked by degenerate loxP sites to allow homologous recombination in vivo and subsequent removal of the URA3 marker. PCR was done by using the KAPA HiFi PCR Kit (Kapabiosystems, Woburn, Mass.) and primers 895 (SEQ ID NO:663) and 679 (SEQ ID NO:664). The PDC1 portion of each primer was derived from 60 nucleotides of the upstream of the coding sequence and 50 nucleotides that are 53 nucleotides upstream of the stop codon. The PCR product was transformed into PNY2050 using standard genetic techniques and transformants were selected on synthetic complete media lacking uracil and supplemented with 1% ethanol at 30 C. Transformants were screened to verify correct integration by colony PCR using primers 681 (SEQ ID NO:665), external to the 3 coding region and 92 (SEQ ID NO:666), internal to the URA3 gene. Positive transformants were then prepped for genomic DNA and screened by PCR using primers N245 (SEQ ID NO:667) and N246 (SEQ ID NO:668). The URA3 marker was recycled by transforming with pLA34 (SEQ ID NO:618) containing the CRE recombinase under the GAL1 promoter and plated on synthetic complete media lacking histidine and supplemented with 1% ethanol at 30 C. Transformants were plated on rich media supplemented with 1% ethanol and 0.5% galactose to induce the recombinase. Marker removal was confirmed by patching colonies to synthetic complete media lacking uracil and supplemented with 1% ethanol to verify absence of growth. The resulting identified strain, called PNY2090 has the genotype MATa ura3::loxP, his3, pdc1::loxP71/66, pdc5::loxP71/66 fra2 2-micron pdc1::P[PDC1]-ALS|alsS_Bs-CYC1t-loxP71/66.

    [0229] b. pdc6::(UAS)PGK1-P[FBA1]-KIVD|Lg(y)-TDH3t-loxP71/66

    [0230] To delete the endogenous PDC6 coding region, an integration cassette was PCR-amplified from pLA78 (SEQ ID NO:648), which contains the kivD gene from the species Listeria grayi with a hybrid FBA1 promoter and a TDH3 terminator, and a URA3 marker flanked by degenerate loxP sites to allow homologous recombination in vivo and subsequent removal of the URA3 marker. PCR was done by using the KAPA HiFi PCR Kit (Kapabiosystems, Woburn, Mass.) and primers 896 (SEQ ID NO:669) and 897 (SEQ ID NO:670). The PDC6 portion of each primer was derived from 60 nucleotides upstream of the coding sequence and 59 nucleotides downstream of the coding region. The PCR product was transformed into PNY2090 using standard genetic techniques and transformants were selected on synthetic complete media lacking uracil and supplemented with 1% ethanol at 30 C. Transformants were screened to verify correct integration by colony PCR using primers 365 (SEQ ID NO:671) and 366 (SEQ ID NO:672), internal primers to the PDC6 gene. Transformants with an absence of product were then screened by colony PCR N638 (SEQ ID NO:673), external to the 5 end of the gene, and 740 (SEQ ID NO:674), internal to the FBA1 promoter. Genomic DNA was prepared from positive transformants and screened by PCR with two external primers to the PDC6 coding sequence. Positive integrants would yield a 4720 nucleotide long product, while PDC6 wild type transformants would yield a 2130 nucleotide long product. The URA3 marker was recycled by transforming with pLA34 containing the CRE recombinase under the GAL1 promoter and plated on synthetic complete media lacking histidine and supplemented with 1% ethanol at 30 C. Transformants were plated on rich media supplemented with 1% ethanol and 0.5% galactose to induce the recombinase. Marker removal was confirmed by patching colonies to synthetic complete media lacking uracil and supplemented with 1% ethanol to verify absence of growth. The resulting identified strain is called PNY2093 and has the genotype MATa ura3::loxP his3 pdc5::loxP71/66 fra2 2-micron pdc1::P[PDC1]-ALS|alsS_Bs-CYC1t-loxP71/66 pdc6::(UAS)PGK1-P[FBA1]-KIVD|Lg(y)-TDH3t-loxP71/66.

    [0231] c. adh1::P[ADH1]-ADH|Bi(y)-ADHt-loxP71/66

    [0232] To delete the endogenous ADH1 coding region and integrate BiADH using the endogenous ADH1 promoter, an integration cassette was PCR-amplified from pLA65 (SEQ ID NO:654), which contains the alcohol dehydrogenase from the species Beijerinckii indica with an ILV5 promoter and a ADH1 terminator, and a URA3 marker flanked by degenerate loxP sites to allow homologous recombination in vivo and subsequent removal of the URA3 marker. PCR was done by using the KAPA HiFi PCR Kit (Kapabiosystems, Woburn, Mass.) and primers 856 (SEQ ID NO:675) and 857 (SEQ ID NO:676). The ADH1 portion of each primer was derived from the 5 region 50 nucleotides upstream of the ADH1 start codon and the last 50 nucleotides of the coding region. The PCR product was transformed into PNY2093 using standard genetic techniques and transformants were selected on synthetic complete media lacking uracil and supplemented with 1% ethanol at 30 C. Transformants were screened to verify correct integration by colony PCR using primers BK415 (SEQ ID NO:677), external to the 5 coding region and N1092 (SEQ ID NO:678), internal to the BiADH gene. Positive transformants were then screened by colony PCR using primers 413 (SEQ ID NO:679), external to the 3 coding region, and 92 (SEQ ID NO:666), internal to the URA3 marker. The URA3 marker was recycled by transforming with pLA34 (SEQ ID NO:618) containing the CRE recombinase under the GAL1 promoter and plated on synthetic complete media lacking histidine and supplemented with 1% ethanol at 30 C. Transformants were plated on rich media supplemented with 1% ethanol and 0.5% galactose to induce the recombinase. Marker removal was confirmed by patching colonies to synthetic complete media lacking uracil and supplemented with 1% ethanol to verify absence of growth. The resulting identified strain, called PNY2101 has the genotype MATa ura3::loxP his3 pdc5::loxP71/66 fra2 2-micron pdc1::P[PDC1]-ALS|alsS_Bs-CYC1t-loxP71/66 pdc6::(UAS)PGK1-P[FBA1]-KIVD|Lg(y)-TDH3t-loxP71/66 adh1::P[ADH1]-ADH|Bi(y)-ADHt-loxP71/66.

    [0233] d. fra2::P[ILV5]-ADH|Bi(y)-ADHt-loxP71/66

    [0234] To integrate BiADH into the fra2 locus of PNY2101, an integration cassette was PCR-amplified from pLA65 (SEQ ID NO:654), which contains the alcohol dehydrogenase from the species Beijerinckii indica with an ILV5 promoter and an ADH1 terminator, and a URA3 marker flanked by degenerate loxP sites to allow homologous recombination in vivo and subsequent removal of the URA3 marker. PCR was done by using the KAPA HiFi PCR Kit (Kapabiosystems, Woburn, Mass.) and primers 906 (SEQ ID NO:680) and 907 (SEQ ID NO:681). The FRA2 portion of each primer was derived from the first 60 nucleotides of the coding sequence starting at the ATG and 56 nucleotides downstream of the stop codon. The PCR product was transformed into PNY2101 using standard genetic techniques and transformants were selected on synthetic complete media lacking uracil and supplemented with 1% ethanol at 30 C. Transformants were screened to verify correct integration by colony PCR using primers 667 (SEQ ID NO:682), external to the 5 coding region and 749 (SEQ ID NO:683), internal to the ILV5 promoter. The URA3 marker was recycled by transforming with pLA34 (SEQ ID NO:618) containing the CRE recombinase under the GAL1 promoter and plated on synthetic complete media lacking histidine and supplemented with 1% ethanol at 30 C. Transformants were plated on rich media supplemented with 1% ethanol and 0.5% galactose to induce the recombinase. Marker removal was confirmed by patching colonies to synthetic complete media lacking uracil and supplemented with 1% ethanol to verify absence of growth. The resulting identified strain, called PNY2110 has the genotype MATa ura3::loxP his3 pdc5::loxP66/71 2-micron pdc1::P[PDC1]-ALS|alsS_Bs-CYC1t-loxP71/66 pdc6::(UAS)PGK1-P[FBA1]-KIVD|Lg(y)-TDH3t-loxP71/66 adh1::P[ADH1]-ADH|Bi(y)-ADHt-loxP71/66 fra2::P[ILV5]-ADH|Bi(y)-ADHt-loxP71/66.

    [0235] e. GPD2 Deletion

    [0236] To delete the endogenous GPD2 coding region, a deletion cassette was PCR amplified from pLA59 (SEQ ID NO:612), which contains a URA3 marker flanked by degenerate loxP sites to allow homologous recombination in vivo and subsequent removal of the URA3 marker. PCR was done by using the KAPA HiFi PCR Kit (Kapabiosystems, Woburn, Mass.) and primers LA512 (SEQ ID NO:638) and LA513 (SEQ ID NO:639). The GPD2 portion of each primer was derived from the 5 region 50 nucleotides upstream of the GPD2 start codon and 3 region 50 nucleotides downstream of the stop codon such that integration of the URA3 cassette results in replacement of the entire GPD2 coding region. The PCR product was transformed into PNY2110 using standard genetic techniques and transformants were selected on synthetic complete medium lacking uracil and supplemented with 1% ethanol at 30 C. Transformants were screened to verify correct integration by colony PCR using primers LA516 (SEQ ID NO:640) external to the 5 coding region and LA135 (SEQ ID NO:609), internal to URA3. Positive transformants were then screened by colony PCR using primers LA514 (SEQ ID NO:641) and LA515 (SEQ ID NO:642), internal to the GPD2 coding region. The URA3 marker was recycled by transforming with pLA34 (SEQ ID NO:618) containing the CRE recombinase under the GAL1 promoter and plated on synthetic complete medium lacking histidine and supplemented with 1% ethanol at 30 C. Transformants were plated on rich medium supplemented with 1% ethanol and 0.5% galactose to induce the recombinase. Marker removal was confirmed by patching colonies to synthetic complete medium lacking uracil and supplemented with 1% ethanol to verify absence of growth. The resulting identified strain, called PNY2115, has the genotype MATa ura3::loxP his3 pdc5::loxP66/71 fra2 2-micron pdc1::P[PDC1]-ALS|alsS_Bs-CYC1t-loxP71/66 pdc6::(UAS)PGK1-P[FBA1]-KIVD|Lg(y)-TDH3t-loxP71/66 adh1::P[ADH1]-ADH|Bi(y)-ADHt-loxP71/66 fra2::P[ILV5]-ADH|Bi(y)-ADHt-loxP71/66 gpd2::loxP71/66.

    pLH689

    [0237] Plasmid pLH689 (SEQ ID NO:698) is a yeast-E. coli shuttle vector based on pHR81 (ATCC#87541). It contains genes for the expression of KARI variant K9JB4P (SEQ ID NO:697) and S. mutans DHAD with a C-terminal tag (SEQ ID NO:721). The positions of the relevant gene features are listed below in Table 7.

    TABLE-US-00006 TABLE 7 Nucleotide positions of pathway gene features of plasmid pLH689 (SEQ ID NO: 698) Element Description Start End Strand promoter ILV5p 427 1620 T CDS K9JB4P 1628 2659 T terminator ILV5t 2685 3307 T terminator FBAt 3320 3632 B CDS S. mutans ilvD-lum 3641 5377 B promoter TEF1(M7)p 5387 5787 B
    pLH691

    [0238] Plasmid pLH691 (SEQ ID NO:590) is a yeast-E. coli shuttle vector based on pHR81 (ATCC#87541). It contains genes for the expression of KARI variant K9JB4P and S. mutans DHAD with a 9 amino acid (9) deletion. The positions of the relevant gene features are listed in the Table 8.

    TABLE-US-00007 TABLE 8 Nucleotide positions of pathway gene features of plasmid pLH691 (SEQ ID NO: 590) Element Description Start End Strand promoter ILV5p 427 1620 T CDS K9JB4P 1628 2659 T terminator ILV5t 2685 3307 T terminator FBAt 3320 3632 B CDS S. mutans ilvD-9 3644 5335 B promoter TEF1(M7)p 5339 5739 B
    pLH804

    [0239] Plasmid pLH804 (SEQ ID NO:591) is a yeast-E. coli shuttle vector based on pHR81 (ATCC#87541). It contains genes for the expression of KARI variant K9JB4P and S. mutans DHAD. The positions of the relevant gene features are listed in the Table 9.

    TABLE-US-00008 TABLE 9 Nucleotide positions of pathway gene features of plasmid pLH804 (SEQ ID NO: 591) Element Description Start End Strand promoter ILV5p 427 1620 T CDS K9JB4P 1628 2659 T terminator ILV5t 2685 3307 T terminator FBAt 3320 3632 B CDS S. mutans ilvD 3641 5356 B promoter TEF1(M7)p 5366 5766 B
    pRS413::BiADH-kivD

    [0240] Plasmid pRS413::BiADH-kivD (SEQ ID NO:874) is a yeast-E. coli shuttle vector based on pRS413 (ATCC#87518). It contains genes for the expression of BiADH and kivD. The positions of the relevant gene features are listed in the Table 10.

    TABLE-US-00009 TABLE 10 Nucleotide positions of pathway gene features in plasmid pRS413::BiADH-kivD (SEQ ID NO: 874) Element Description Start End Strand Promoter FBA1p 2293 2893 T CDS kivD_Lg(y) 2902 4548 T Terminator TDH3t 4560 5139 T Promoter PDC1p 5983 6852 T CDS adhBiy 6853 7896 T Terminator ADH1t 7905 8220 T

    Creation of PNY2145

    [0241] PNY2145 was constructed from PNY2115 (MATa ura3::loxP his3 pdc5::loxP66/71 fra2 2-micron plasmid (CEN.PK2) pdc1::P[PDC1]-ALS|alsS_Bs-CYC1t-loxP71/66 pdc6::(UAS)PGK1-P[FBA1]-KIVD|Lg(y)-TDH3t-loxP71/66 adh1::P[ADH1]-ADH|Bi(y)-ADHt-loxP71/66 fra2::P[ILV5]-ADH|Bi(y)-ADHt-loxP71/66 gpd2::loxP71/66; described in, for example, U.S. Provisional Appl. No. 61/842,817, filed Jul. 3, 2013, which is incorporated by reference herein) by the additional integration of a phosphoketolase gene cassette at the pdc5 locus and by replacing the native AMN1 gene with a codon optimized version of the ortholog from CEN.PK. Integration constructs are further described below.

    pdc5::FBA(L8)-xpk1-CYC1t-loxP71/66

    [0242] The TEF(M4)-xpk1-CYC1t gene from pRS423::TEF(M4)-xpk1+ENO1-eutD (SEQ ID NO:829) was PCR amplified using primers N1341 and N1338 (SEQ ID NOs: 830 and 831), generating a 3.1 kb product. The loxP-flanked URA3 gene cassette from pLA59 (SEQ ID NO:832) was amplified with primers N1033c and N1342 (SEQ ID NOs: 833 and 834), generating a 1.6 kb product. The xpk1 and URA3 PCR products were fused by combining them without primers for an additional 10 cycles of PCR using Phusion DNA polymerase. The resulting reaction mix was then used as a template for a PCR reaction with KAPA Hi Fi and primers N1342 and N1364 (SEQ ID NOs:834 and 835). A 4.2 kb PCR product was recovered by purification from an electrophoresis agarose gel (Zymo kit). FBA promoter variant L8 (SEQ ID NO:836) was amplified using primers N1366 and N1368 (SEQ ID NOs:837 and 838). The xpk1::URA3 PCR product was combined with the FBA promoter by additional rounds of PCR. The resulting product was phosphorylated with polynucleotide kinase and ligated into pBR322 that had been digested with EcoRV and treated with calf intestinal phosphatase. The ligation reaction was transformed into E. coli cells (Stbl3 competent cells from Invitrogen). The integration cassette was confirmed by sequencing. To prepare DNA for integration, the plasmid was used as a template in a PCR reaction with Kapa HiFi and primers N1371 and N1372 (SEQ ID NOs:839 and 840). The PCR product was isolated by phenol-chloroform extraction and ethanol precipitation (using standard methods; e.g., Maniatas et al.). Five micrograms of DNA were used to transform strain PNY2115. Transformants were selected on medium lacking uracil (synthetic complete medium minus uracil with 1% ethanol as the carbon source). Colonies were screened for the integration event using PCR (JumpStart) with primers BK93 and N1114 (SEQ ID NOs:841 and 842). Two clones were selected to carry forward. The URA3 marker was recycled by transforming with pJT254 (SEQ ID NO:843) containing the CRE recombinase under the GAL1 promoter and plating on synthetic complete medium lacking histidine and supplemented with 1% ethanol at 30 C. Transformants were grown in rich medium supplemented with 1% ethanol to derepress the recombinase. Marker removal was confirmed for single colony isolates by patching to synthetic complete medium lacking uracil and supplemented with 1% ethanol to verify absence of growth. Loss of the recombinase plasmid, pJT254, was confirmed by patching the colonies to synthetic complete medium lacking histidine and supplemented with 1% ethanol. Proper marker removal was confirmed by PCR (primers N160SeqF5 (SEQ ID NO:844) and BK380). One resulting clone was designated PNY2293.

    amn1::AMN1(y)-loxP71/66

    [0243] To replace the endogenous copy of AMN1 with a codon-optimized version of the AMN1 gene from CEN.PK2, an integration cassette containing the CEN.PK AMN1 promoter, AMN1(y) gene (nucleic acid SEQ ID NO:845; amino acid SEQ ID NO:846), and CEN.PK AMN1 terminator was assembled by SOE PCR and subcloned into the shuttle vector pLA59. The AMN1(y) gene was ordered from DNA 2.0 with codon-optimization for S. cerevisiae. The completed pLA67 plasmid (SEQ ID NO:847) contained: 1) pUC19 vector backbone sequence containing an E. coli replication origin and ampicillin resistance gene; 2) URA3 selection marker flanked by loxP71 and loxP66 sites; and 3) P.sub.AMN1(CEN.PK)-AMN1(y)-term.sub.AMN1(CEN.PK) expression cassette.

    [0244] PCR amplification of the AMN1(y)-loxP71-URA3-loxP66 cassette was done by using KAPA HiFi from Kapa Biosystems, Woburn, Mass. and primers LA712 (SEQ ID NO:848) and LA746 (SEQ ID NO:849). The PCR product was transformed into PNY2293 using standard genetic techniques and transformants were selected on synthetic complete medium lacking uracil and supplemented with 1% ethanol at 30 C. Transformants were observed under magnification for the absence of a clumping phenotype with respect to the control (PNY2293). The URA3 marker was recycled using the pJT254 Cre recombinase plasmid as described above. After marker recycle, clones were again observed under magnification to confirm absence of the clumping phenotype. A resulting identified strain, PNY2145, has the genotype: MATa ura3::loxP his3 pdc5::P[FBA(L8)]-XPK|xpk1_Lp-CYCt-loxP66/71 fra2 2-micron plasmid (CEN.PK2) pdc1::P[PDC1]-ALS|alsS_Bs-CYC1t-loxP71/66 pdc6::(UAS)PGK1-P[FBA1]-KIVD|Lg(y)-TDH3t-loxP71/66 adh1::P[ADH1]-ADH|Bi(y)-ADHt-loxP71/66 fra2::P[ILV5]-ADH|Bi(y)-ADHt-loxP71/66 gpd2::loxP71/66 amn1::AMN1(y).

    Example 2: Site Directed Mutagenesis of A9 Variant of S. mutans DHAD

    [0245] Amino acid replacements at positions 378, 383, 385, 387, and 388 were individually incorporated into a truncated version of Streptococcus mutans DHAD lacking the nine c-terminal amino acids (9 variant) via site directed mutagenesis. Mutagenesis was performed with a yeast shuttle plasmid employing the QuikChange Lightning Site-Directed Mutagenesis Kit (Catalog #210518; Agilent Technologies, Stratagene Products Division, La Jolla, Calif.). Mutagenesis primers listed in Table 11 were commercially synthesized by Integrated DNA Technologies, Inc. (Coralville, Iowa). Primers were combined into mixes, as indicated in Table 11 (column labeled Mix).

    TABLE-US-00010 TABLE11 PrimerMixesEmployedforSiteDirectedMutagenesis SEQID Mix NO: Primers Sequence P2A1mix 527 P2A1 GTTATTATGCCGCTTGAAAATGCTAAACG TGAAGATGGTCCGCTC P2A1mix 528 P2A1rev GAGCGGACCATCTTCACGTTT AGCATTTTCAAGCGGCATAAT AAC G2S2mix 529 G2S2 GAAAATCCTAAACGTGAAGATTCTCCGCT CATTATTCTCCATGG G2S2mix 530 G2S2rev TGGAGAATAATGAGCGGAGAA TCTTCACGTTTAGGATTTTC L2F3mix 531 L2F3 CTAAACGTGAAGATGGTCCGTTCATTATT CTCCATGGTAACTTGG L2F3mix 532 L2F3rew CCAAGTTACCATGGAGAATAA TGAACGGACCATCTTCACGTT TAG L2V4mix 533 L2V4 CTAAACGTGAAGATGGTCCGGTCATTATT CTCCATGGTAACTTGG L2V4mix 534 L2V4rev CCAAGTTACCATGGAGAATAA TGACCGGACCATCTTCACGTT TAG I2V5mix 535 I2V5 GAAGATGGTCCGCTCATTGTTCTCCATGG TAACTTGGC I2V5mix 536 I2V5rev GCCAAGTTACCATGGAGAACA ATGAGCGGACCATCTTC I2M6mix 537 I2M6 GAAGATGGTCCGCTCATTATGCTCCATGG TAACTTGGC I2M6mix 538 I2M6rev GCCAAGTTACCATGGAGCATA ATGAGCGGACCATCTTC L2I7mix 539 L2I7 GAAGATGGTCCGCTCATTATTATCCATGG TAACTTGGCTCCAGAC L2I7mix 540 L2I7rev GTCTGGAGCCAAGTTACCATG GATAATAATGAGCGGACCATC TTC L2M8mix 541 L2M8 GAAGATGGTCCGCTCATTATTATGCATGG TAACTTGGCTCCAGAC L2M8mix 542 L2M8rev GTCTGGAGCCAAGTTACCATG CATAATAATGAGCGGACCATC TTC

    [0246] Except for the primers, templates, and double distilled water (ddH.sub.2O), all reagents used here were supplied with the kit indicated above. A stock mixture for the eight mutagenesis reactions contained 1 l of pLH691 (495 ng)(SEQ ID NO:590), 50 l of 10 reaction buffer, 10 l of dNTP mix, 15 l of QuikSolution reagent, and 404 l of ddH.sub.2O. Each mutagenesis reaction mixture contained 48 ul of the stock mixture, 1 l of a primer mix (10 uM each primer), and 1 l of QuikChange Lightning Enzyme. The following conditions were used for the reactions: The starting temperature was 95 C. for 2 min followed by 18 heating/cooling cycles. Each cycle consisted of 95 C. for 20 sec, 60 C. for 10 sec, and 68 C. for 10 min. At the completion of the temperature cycling, the samples were incubated at 68 C. for 5.0 min and then held awaiting sample recovery at 4 C. 2 l of the Dpn I was added to each reaction and the mixtures were incubated for 1 hr at 37 C.

    [0247] 2 l of each mutagenic reaction was transformed into One Shot Stbl3 Chemically Competent Escherichia coli (E. coli)(Invitrogen, Catalog # C7373-03) or One Shot TOP10 Chemically Competent E. coli (Invitrogen, Catalog #C404003) according to the manufacturer's instructions. The transformants were spread on agar plates containing the LB medium and 100 g/ml ampicillin (Catalog #L1004, Teknova Inc. Hollister, Calif.) and incubated at 37 C. overnight. Multiple transformants for each reaction were inoculated into LB medium containing 100 g/ml ampicillin and incubated at 37 C. with shaking at 225 rpm. Plasmid DNA was isolated from the cells with the QIAprep Spin Miniprep Kit (Catalog #2706; Qiagen, Valencia, Calif.) according to the protocol provided by the manufacturer. Sequencing of the complete DHAD genes were performed with primers Dseq1 (aacgcgtgaagcttttgaagatg; SEQ ID NO:690), Dseq2 (tcagttcggaacaatcacgg; SEQ. ID NO:691), Dseq3 (tgctttccctttcatcaatgattgttg, SEQ ID NO:692), Dseq4 (tccatgttagccatagcgataac SEQ ID NO:693), Dseq5 (ttgtgcttcaggagcgatatg; SEQ ID NO:694), N885 (ctgctaatgtggaattgacac, SEQ ID NO:695), and N929 (gtctgttacggctcccctag, SEQ ID NO:696). Two clones were prepared for each variant listed in Table 12, with the exception of delta9-L217, for which only a single clone was prepared.

    TABLE-US-00011 TABLE 12 Prepared Streptococcus mutans DHAD delta9 (9) Variants Nucleotide Amino Acid Variant SEQ ID NO: SEQ ID NO: Substitution delta9-P2A1 551 552 P378A delta9-G2S2 556 557 G383S delta9-L2F3 561 562 L385F delta9-L2V4 566 567 L385V delta9-I2V5 571 572 I387V delta9-I2M6 576 577 I387M delta9-L2I7 581 582 L388I delta9-L2M8 586 587 L388M

    Example 3: Site Directed Mutagenesis of Full Length Streptococcus mutans (S. mutans) DHAD

    [0248] Full length versions of 9-L2V4 (substitution L385V), 9-I2V5 (substitution I387V), and 9-L217 (substitution L387I) were prepared by site directed mutagenesis of the wild type S. mutans DHAD. Site directed mutagenesis was performed as described in Example 2, with modifications.

    [0249] For the L385V substitution, the mutagenesis reaction contained 1 ul pLH804 (50 ng)(SEQ ID NO:591), 1 ul L2V4mix (10 uM each primer), 1 ul dNTP mix, 1.5 ul Quiksolution, 5 ul of 10 buffer, 1 ul QuikChange Lightning Enzyme, and 39.5 ul of distilled water (ddH.sub.2O).

    [0250] For the I387V substitution, the mutagenesis reaction contained 1 ul pLH804 (50 ng)(SEQ ID NO:591), 1 ul I2V5 mix (10 uM each primer), 1 ul dNTP mix, 1.5 ul Quiksolution, 5 ul of 10 buffer, 1 ul QuikChange Lightning Enzyme, and 39.5 ul of ddH.sub.2O.

    [0251] For the L388I substitution, the mutagenesis reaction contained 1 ul pLH804 (50 ng)(SEQ ID NO:591), 1 ul L2I8 mix (10 uM each primer), 1 ul dNTP mix, 1.5 ul Quiksolution, 5 ul of 10 buffer, 1 ul QuikChange Lightning Enzyme, and 39.5 ul of ddH.sub.2O.

    [0252] The following conditions were used for the reactions: The starting temperature was 95 C. for 2 min followed by 18 heating/cooling cycles. Each cycle consisted of 95 C. for 20 sec, 60 C. for 10 sec, and 68 C. for 10 min. At the completion of the temperature cycling, the samples were incubated at 68 C. for 5 min and then held awaiting sample recovery at 4 C. 2 l of DpnI restriction enzyme was added to each reaction and the mixtures were incubated for 30 min at 37 C.

    [0253] Three clones were prepared for variants L2V4 and I2V5 listed in Table 13, while two clones were prepared for variant L217.

    TABLE-US-00012 TABLE 13 Prepared Variants of Full Length S. mutans DHAD Nucleotide Amino Acid Variant SEQ ID NO: SEQ ID NO: Substitution L2V4 564 565 L385V I2V5 569 570 I387V L2I7 579 580 L388I

    Example 4: Isobutanol Production of S. mutans DHAD Derivatives in PNY2115

    [0254] Variants prepared in Examples 2 and Example 3 were analyzed for isobutanol production in yeast strain PNY2115, described in Example 1 (MATa ura3::loxP his3 pdc5::loxP66/71 fra2 2-micron plasmid (CEN.PK2) pdc1::P[PDC1]-ALS|alsS_Bs-CYC1t-loxP71/66 pdc6::(UAS)PGK1-P[FBA1]-KIVD|Lg(y)-TDH3t-loxP71/66 adh1::P[ADH1]-ADH|Bi(y)-ADHt-loxP71/66 fra2::P[ILV5]-ADH|Bi(y)-ADHt-loxP71/66 gpd2::loxP71/66).

    Growth Media

    [0255] Four types of media were used during the growth procedure of yeast strains: SE-ura agar plate, SAG-2-ura agar plate, an aerobic pre-culture media and an anaerobic culture media. All chemicals were obtained from Sigma-Aldrich (St. Louis, Mo.) unless otherwise noted.

    [0256] Yeast transformation recovery plate (SE-ura): 50 mM 2-(N-morpholino)ethanesulfonic acid (MES)(pH 5.5), 6.7 g/L yeast nitrogen base without amino acids (Difco, 291940, Sparks, Md.), 1.4 g/L yeast synthetic drop-out medium supplement without histidine, leucine, tryptophan and uracil, 0.2% ethanol, 0.01% weight per volume (w/v) leucine, 0.01% w/v histidine, and 0.002% w/v tryptophan.

    [0257] Glucose adaptation plate (SAG-2-Ura): 50 mM MES (pH 5.5, 6.7 g/L yeast nitrogen base without amino acids (Difco, 291940, Sparks, Md.), 1.4 g/L yeast synthetic drop-out medium supplement without histidine, leucine, tryptophan and uracil, 3 mM sodium acetate (pH 7.0), 2% w/v glucose, 0.01% w/v leucine, 0.01% w/v histidine, and 0.002% w/v tryptophan.

    [0258] Aerobic pre-culture media (SAG-0.2-Ura): 6.7 g/L yeast nitrogen base without amino acids (Difco, 291940, Sparks, Md.), 1.4 g/L yeast synthetic drop-out medium supplement without histidine, leucine, tryptophan and uracil, 3 mM sodium acetate (pH 7.0), 0.2% w/v glucose, 0.01% w/v leucine, 0.01% w/v histidine, and 0.002% w/v tryptophan.

    [0259] Anaerobic culture media (SAG-3-Ura): 50 mM MES (pH 5.5, 6.7 g/L yeast nitrogen base without amino acids (Difco, 291940, Sparks, Md.), 1.4 g/L yeast synthetic drop-out medium supplement without histidine, leucine, tryptophan and uracil, 3 mM sodium acetate (pH 7.0), 3% w/v glucose, 0.01% w/v leucine, 0.01% w/v histidine, 0.002% w/v tryptophan, 30 mg/L nicotinic acid, 30 mg/L thiamine and 10 mg/L ergosterol made up in 50/50 volume per volume (v/v) Tween/ethanol solution.

    Transformation and Glucose Adaptation

    [0260] Competent cells of the PNY2115 (MATa ura3::loxP his3 pdc5::loxP66/71 fra2 2-micron plasmid (CEN.PK2) pdc1::P[PDC1]-ALS|alsS_Bs-CYC1t-loxP71/66 pdc6::(UAS)PGK1-P[FBA1]-KIVD|Lg(y)-TDH3t-loxP71/66 adh1::P[ADH1]-ADH|Bi(y)-ADHt-loxP71/66 fra2::P[ILV5]-ADH|Bi(y)-ADHt-loxP71/66 gpd2::loxP71/66) were prepared and transformed with 1 L of purified plasmid (0.4 to 0.8 g total DNA) using a Frozen-EZ Yeast Transformation II Kit (Zymo Research Corp.; Irvine, Calif.). Transformation mixtures were plated on SE-ura plates and incubated at 30 C. for 4 days. Three or four colonies for each transformant were selected and patched onto SE-ura plates and incubated at 30 C. for 2 days. The variants then underwent glucose adaptation by patching onto SAG-2-Ura plates and growing for 2 days at 30 C.

    Deep-Well Plate Growth Procedure

    [0261] 1.5 mL aliquots of the aerobic pre-culture media were dispensed into each well of a VWR 48 deep-well plate (#82004-674, VWR, Radnor, Pa.) and inoculated with cells grown on a SAG-2-Ura agar plate, as described above. A sterile air permeable cover (#60941-086, VWR, Radnor, Pa.) was used to seal the culture plate. The plate was placed in a 30 C. incubator and was grown for 20 to 24 hours with shaking, and an OD600 value (optical density at 600 nm) was obtained using Spectra Max384 Plus plate reader (Molecular Devices, Sunnyvale, Calif.). OD600 values were converted to equivalent OD600 values on a Cary 300 (Agilent Technologies, Wilmington, Del.) calibration value. A dilution 48 deep-well plate was set with a target Cary OD600 value of 0.35 for each well in a total volume of 1.5 mL. Wells with Cary OD600 values of 0.35 to 0.40 were transferred directly from the original plate to the dilution plate. For all other wells, a volume of turbid culture was transferred the volume was brought up to 1.5 mL with aerobic pre-culture media. The 48 deep-well plate was returned to the 30 C. shaking incubator and grown for an additional 20 to 24 hours. OD600 values were obtained as described above.

    Serum Vial Growth Procedure

    [0262] The final volume of medium in each 15 mL serum vial was 10 mL of medium. Target inoculation OD600 value of 0.1 was set for each vial. Turbid culture volume was based on the equivalent Cary 300 OD600 values obtained from each well of the dilution 48 deep-well plate described in the previous section. Anaerobic culture media was added to bring the final volume up to 10 mL. Serum vials were then capped and crimped. Vials were placed in a 30 C. shaking incubator and grown for 40-50 hours. Inoculation of the serum vials were performed under aerobic conditions. Wells that did not have and OD600 value of at least 0.3 were not inoculated into serum vials.

    High-Performance Liquid Chromatography (HPLC) Analysis

    [0263] Samples were taken for HPLC analysis and to obtain OD600 values at the end of the anaerobic growth period. Serum vials were opened and an aliquot of turbid culture was removed and filtered in preparation for HPLC analysis. Another aliquot was removed for OD600 determination (described above). The remaining turbid culture was centrifuged. The resulting supernatant was discarded and the cell pellet was saved by freezing at 80 C. in the event additional analysis was required.

    [0264] HPLC analysis was performed using a Waters 2695 separations unit, 2996 photodiode array detector, and 2414 refractive index detector (Waters, Milford, Mass.) with a Shodex Sugar SH-G pre-column and Shodex Sugar SH1011 separations column (Shodex, J M Science, Grand Island, N.Y.). Compounds were separated by isocratic elution at 0.01 N sulfuric acid with a flow rate of 0.5 mL/min. Chromatograms were analyzed using the Waters Empower Pro software. Isobutanol titer and molar yield for Streptococcus mutans (S. mutans) delta9 (9) DHAD variants clones 1 and 2

    [0265] PNY2115 with S. mutans variants described in Example 2 were grown and analyzed as described above. Isobutanol titer and molar yield are listed in Tables 14 and 11 below.

    TABLE-US-00013 TABLE 14 S. mutans 9 DHAD variants (clone 1 set) in PNY2115 Isobutanol mM at 46 hr Molar Yield Clone Mean SD Mean SD delta9 control 45 4.4 0.40 0.02 (pLH691)(SEQ ID NO: 590) delta9-P2A1 #1 0 0 0 0 delta9-G2S2 #1 0.2 0.3 0.01 0.002 delta9-L2F3 #1 10 1.4 0.31 0.02 delta9-L2V4 #1 18 21 0.3 0.2 delta9-I2V5 #1 51 1.4 0.53 0.01 delta9-I2M6 #1 0 0 0.42 0.04 delta9-L2I7 #1 25 5.3 0.44 0.02 delta9-L2M8 #1 30 1.7 0.51 0.02

    TABLE-US-00014 TABLE 15 S. mutans 9 DHAD variants (clone 2 set) in PNY2115 Isobutanol mM at 46 hr Molar Yield Clone Mean SD Mean SD delta9 control 55 15 0.42 0.02 (pLH691)(SEQ ID NO: 590) delta9-L2F3 #2 13 0.5 0.24 0.02 delta9-L2V4 #2 55 15 0.20 0.09 delta9-I2V5 #2 49 9 0.40 0.03 delta9-L2M8 #2 35 7 0.36 0.04
    Isobutanol Titer and Molar Yield for Streptococcus mutans (S. mutans) DHAD Variants

    [0266] PNY2115 with S. mutans variants described in Example 3 were grown and analyzed as described above. Isobutanol titers and molar yield are listed in Table 16 below.

    TABLE-US-00015 TABLE 16 S. mutans DHAD variants (full length) in PNY2115 Isobutanol mM 50 hr Molar Yield Clone Mean SD Mean SD WT Control 51 3 0.54 0.01 (pLH804)(SEQ ID NO: 591) 804-L2V4 82 10 0.63 0.01 Clone #1 804-I2V5 49 5 0.55 0.02 Clone#1 804-I2V5 41 14 0.51 0.04 Clone#2

    [0267] FIG. 3 is a graph illustrating the isobutanol production in yeast strain PNY2115 transformants harboring 9 (Delta 9) S. mutans DHAD variants (P2A1, G2S2, L2F3, L2V4, I2V5, I2M6, L2I7, and L2M8) and the parental 9 S. mutans DHAD (control).

    [0268] FIG. 4 is a graph illustrating the isobutanol production in yeast strain PNY2115 transformants harboring 9 S. mutans DHAD variants (I2V5, L2F3, L2M8, and L2V4) and the parental 9 S. mutans DHAD (control).

    [0269] FIG. 5 is a graph illustrating the isobutanol production in yeast strain PNY2115 transformants harboring full length S. mutans DHAD variants (I2V5 clones 1 and 2 and L2V4) and the parental full length S. mutans DHAD (WT).

    [0270] FIG. 6 is a graph illustrating DHAD activity in yeast strain PNY2115 harboring full length S. mutans DHAD variants (I2V5 clone 1, I2V5 clone 2, and L2V4) and the parental full length S. mutans DHAD (WT).

    Example 5: DHAD Specific Activities for Streptococcus mutans (S. mutans) DHAD Derivatives in Crude Extracts of PNY2115

    [0271] DHAD specific activities were measured in crude extracts of yeast strain PNY2115 transformed with either the wild type S. mutans DHAD or variants of the full length enzyme containing a single amino acid change at position 385, position 387, or position 388.

    [0272] Following 40-50 hr of growth in serum vials as described in Example 3, yeast cells were centrifuged and resultant pellets stored at 80 C. Frozen yeast cells were later thawed, resuspended in 0.1 M K-Hepes pH 6.8 containing 10 mM MgCl.sub.2 and a protease inhibitor cocktail (Roche, Catalog #11873580001), and then broken by bead beating. The broken cells were centrifuged to remove the cell debris and generate the yeast crude extract. Protein concentrations (mg/ml) of extracts were measured with the Pierce Coomassie Plus (Bradford) Protein Assay (Catalog #23236, Thermoscientific). DHAD enzyme activities were measured spectrophotometrically in an end point assay using the 2,4-dinitrophenylhydrazine (2,4-DNPH) method as described in Flint, D. H. and M. H. Emptage, J. Biol. Chem. 263:3558-64 (1988), with modifications. The assay buffer contained 0.1 M K-Hepes pH 6.8 and 10 mM MgCl.sub.2. Yeast extracts were diluted in assay buffer. Sufficient (R)-2,3-dihydroxyisovaleric acid was added to assay buffer so that the final concentration in the assay is 10 mM. In each assay, an enzyme containing solution and sufficient substrate containing buffer are mixed so that the final volume is 300 ul. Assay mixtures were incubated at 30 C. for 20 minutes. At five minute intervals, a 60 ul aliquot of each reaction was mixed with 70 ul of a saturated solution of 2,4-DNPH in 1 N HCl. Following a 30 minute incubation at room temperature, 70 ul of 4 N KOH in ethanol was then added to the solution, followed by brief mixing. The absorbance of the mixture was read at 540 nm with a Spectra Max384 Plus plate reader (Molecular Devices, Sunnyvale, Calif.). A standard curve containing 0 to 1.33 mM -ketoisovalerate was employed to calculate enzyme activities (U/ml) for the conversion of (R)-2,3-dihydroxyvalerate to -ketoisovalerate in the assays. DHAD specific activities (U/mg) were determined from enzyme activities (U/ml) and protein concentrations (mg/ml) measured for each sample. Averages for each clone evaluated are provided in Table 17.

    TABLE-US-00016 TABLE 17 DHAD specific activities in PNY2115 extracts DHAD SA U/mg Clone Mean SD WT Control 0.14 0.05 (pLH804) (SEQ ID NO: 591) 804-L2V4 0.16 0.06 Clone #1 804-I2V5 0.19 0.08 Clone #1 804-I2V5 0.08 0.08 Clone #2

    Example 6: DHIV Accumulation Levels for S. mutans DHAD Derivatives in PNY2115

    [0273] Wild type S. mutans DHAD and the full length variants prepared in Example 2 were transformed into yeast strain PNY2115 and analyzed for levels of DHIV accumulation and isobutanol production. Cultures were grown as described in Example 4, with the modification that samples were removed for analysis following 26 hr and 48 hr of growth. In addition to the analyses described in Example 4, samples were subjected to liquid chromatography-mass spectrometry (LC/MS) to measure levels of DHIV. LC/MS quantitation was performed as described in U.S. Patent Appl. Pub. No. 2012/0258873, incorporated by reference herein. As shown in Tables 18 and 19, replacement of wild type DHAD with the variants results in DHIV accumulation levels and DHIV/isobutanol ratios that are equivalent to or lower than the wild type control.

    TABLE-US-00017 TABLE 18 Isobutanol and DHIV levels at 26 hr growth in serum vials Isobutanol mM DHIV mM DHIV/Isobutanol Clone Mean SD Mean SD Mean SD WT Control 7 1 0.3 0.2 0.043 0.017 (pLH804) (SEQ ID NO: 591) 804-L2V4 9 4 0.1 0.05 0.011 0.001 Clone #1 804-I2V5 4 3 0.2 0.1 0.050 0.012 Clone#1

    TABLE-US-00018 TABLE 19 Isobutanol and DHIV levels at 48 hr growth in serum vials Isobutanol DHIV/ mM DHIV mM Isobutanol Clone Mean SD Mean SD Mean SD WT Control 35 2 1.3 0.5 0.038 0.011 (pLH804) (SEQ ID NO: 591) 804-L2V4 57 18 0.8 0.4 0.012 0.005 Clone #1 804-I2V5 24 14 0.6 0.4 0.026 0.004 Clone#1

    [0274] FIG. 7 is a graph illustrating DHIV accumulation in yeast strain PNY2115 harboring full length S. mutans DHAD variants (804-L2V4 and 804-I2V5) and the parental full length S. mutans DHAD (WT control).

    Example 7: Isobutanol Production with I2V5 IlvD Variant

    [0275]

    TABLE-US-00019 TABLE 20 Strain referenced in Example 7 Strain Name Genotype Description PNY1665 MATa ura3::loxP pdc5::loxP66/71 herein fra2::P[ILV5]-ADH|Bi(y)-ADHt-loxP71/66 2- micron plasmid (CEN.PK2) pdc1::P[PDC1]- ALS|alsS_Bs-CYC1t-loxP71/66 pdc6::(UAS)PGK1-P[FBA1]-KIVD|Lg(y)- TDH3t-loxP71/66 adh1::P[ADH1]- ADH|Bi(y)-ADHt-loxP71/66 gpd2::loxP71/66 amn1::AMN1

    [0276] Plasmid Construction

    [0277] Plasmids were constructed in a 2-micron based Saccharomyces cerevisiae-Escherichia coli shuttle vector.

    pBP3765C-Terminal Tagged I2V5 IlvD_Sm

    [0278] pBP3765 (SEQ ID NO:699) was constructed to contain a chimeric gene having the coding region of the I2V5 mutant ilvD gene from Streptococcus mutans (nt position 5377-3665) followed by a Lumio tag sequence (nt 3664-3647; Invitrogen, Carlsbad, Calif.; Adams et al. J. Am. Chem. Soc., 124:6063, 2002) expressed from the yeast TEF1 mutant 7 promoter (nt 5787-5387; Nevoigt et al. Applied and Environmental Microbiology, 72:5266, 2006), and followed by the FBA1 terminator (nt 3632-3320) for expression of DHAD, and a chimeric gene having the coding region of the K9JB4P mutant ilvC gene from Anaeropstipes cacae (nt 1628-2659; described in Int'l Pub. No. WO2012/12955, which is incorporated by reference herein) expressed from the yeast ILV5 promoter (nt 434-1614) and followed by the ILV5 terminator (nt 2673-3307) for expression of KARI.

    Strain Construction

    [0279] Following conversion of PNY2115 to PNY2121 by replacing the endogenous copy of AMN1 with a codon-optimized version of the AMN1 gene from CEN.PK2 (SEQ ID NO:722), PNY2121 was restored back to a histidine prototroph. The HISS coding sequence and 500 bp upstream and downstream of the coding sequence were amplified from a haploid (PNY0865) obtained from sporulation of PNY0827. PNY2121 was transformed with the resulting PCR product and transformants were selected on agar plates containing synthetic complete media lacking histidine supplemented with 1% ethanol at 30 C. A PNY2121 HIS3.sup.+ isolate was designated PNY1665.

    [0280] PNY1665 was transformed with the plasmids described above and transformants were selected on agar plates containing synthetic complete media lacking uracil supplemented with 1% ethanol at 30 C. Three transformants were selected for each plasmid construct.

    Isobutanol Production

    [0281] Isobutanol production was tested for the isobutanologen strains described above. Strains were grown overnight in 10 ml of low glucose medium in 125 ml VWR vent cap shake flasks at 30 C. at 250 RPM in a New Brunswick I24 incubated shaker. The low glucose medium consisted of: 6.7 g/L Difco Yeast Nitrogen Base without amino acids (Becton Dickinson; Sparks, Md.), 1.92 g/L Synthetic Drop-out Medium Supplement without Uracil (Sigma; St. Louis, Mo.), 0.2% w/v ethanol, 0.3% w/v glucose, and 100 mM 2-Morpholinoethanesulphonic acid (MES) buffer, adjusted to pH 5.5 with KOH. Overnight cultures were sub-cultured into the same medium to an OD600 of 0.4, and glucose was added to a final concentration of 3% w/v 15 ml of culture in 125 ml VWR vent cap shake flasks were grown for 4 hours at 30 C. at 250 RPM in a New Brunswick I24 incubated shaker. Cells were centrifuged at 3800g for 5 minutes at room temperature and cell pellets were resuspended in high glucose medium to an OD600 of 0.2. High glucose medium consisted of: 6.7 g/L Difco Yeast Nitrogen Base without amino acids (Becton Dickinson; Sparks, Md.), 1.92 g/L Synthetic Drop-out Medium Supplement without Uracil (Sigma; St. Louis, Mo.), 0.1% w/v ethanol, 3.0% w/v glucose, and 100 mM 2-Morpholinoethanesulphonic acid (MES) buffer, adjusted to pH 5.5 with KOH. 10 ml of the culture in high glucose medium was transferred to a 20 ml serum vial (Kimble Chase; Vineland, N.J.). Serum vials were sealed and cultures were grown at 30 C. at 250 RPM in a New Brunswick I24 incubated shaker for 44 hours.

    [0282] After 44 hours, the cultures were sampled for OD600 and culture supernatants (collected using Spin-X centrifuge tube filter units, Costar Cat. No. 8169) were analyzed by HPLC (Example 4). OD600, isobutanol concentration, and isobutanol molar yield are presented in Table 21.

    TABLE-US-00020 TABLE 21 Average OD600, isobutanol concentration, and isobutanol molar yield and standard deviations. Isobutanol Yield OD600 Isobutanol (mM) (mol/mol) PNY1665/pLH689 2.1 0.1 112.0 3.0 0.69 0.01 PNY1665/pBP3765 2.2 0.0 96.2 5.1 0.67 0.02

    Example 8: Construction of Additional Yeast Strains

    [0283] The following table provides the genotypes of the various yeast strains referenced in the following Examples.

    TABLE-US-00021 TABLE 22 Strains referenced in the following Examples Strain Name Genotype PNY2115 MATa ura3::loxP his3 pdc5::loxP66/71 2-micron plasmid (CEN.PK2) pdc1::P[PDC1]-ALS|alsS_Bs- CYC1t-loxP71/66 pdc6::(UAS)PGK1-P[FBA1]- KIVD|Lg(y)-TDH3t-loxP71/66 adh1::P[ADH1]- ADH|Bi(y)-ADHt-loxP71/66 fra2::P[ILV5]-ADH|Bi(y)- ADHt-loxP71/66 gpd2::loxP71/66 PNY1566 MATa ura3::loxP pdc5::loxP66/71 2-micron plasmid (CEN.PK2) pdc1::P[PDC1]-ALS|alsS_Bs-CYC1t- loxP71/66 pdc6::(UAS)PGK1-P[FBA1]-KIVD|Lg(y)- TDH3t-loxP71/66 adh1::P[ADH1]-ADH|Bi(y)-ADHt- loxP71/66 fra2::P[ILV5]-ADH|Bi(y)-ADHt-loxP71/66 gpd2::loxP71/66 PNY1602 and PNY1566 with plasmid pLH689 containing (P[ILV5]- PNY1612 KARI|ilvC_Ll-ILV5t P[TEF1(M7)]-DHAD|ilvD_Sm- lum-FBA1t) PNY1604 and PNY1566 with plasmid pLH804 containing (P[ILV5]- PNY1614 KARI|ilvC_Ll-ILV5t P[TEF1(M7)]-DHAD|ilvD_Sm- FBA1t)

    [0284] To obtain PNY0865, PNY0827 was sporulated using standard methods (Codn A C, Gasent-Ramrez J M, Bentez T. Factors which affect the frequency of sporulation and tetrad formation in Saccharomyces cerevisiae baker's yeast. Appl. Environ. Microbiol. 1995). After the formation of asci (as observed by microscopy), a 100 ul aliquot of cells was resuspended in 100 ul of 1 M sorbitol and treated with 5 U of zymolyase (Zymo Research, Orange Calif.) at 37 C. for 15 min. Resulting tetrads were spread on YPD medium and dissected using a micromanipulator (Singer Instruments, Somerset UK), and the single-spore isolates were grown at 30 C. for 3 d to form colonies. One tetrad with four viable spores was characterized further. The mating type of the single-spore isolates was determined by PCR as described (Huxley, C., E. D. Green and I. Dunham (1990). Rapid assessment of S. cerevisiae mating type by PCR. Trends Genet 6(8): 236). One spore isolate, of mating type MAT, was designated PNY0865.

    [0285] PNY2115 was restored back to a histidine prototroph. The HIS3 coding sequence and 500 base pairs (bp) upstream and downstream of the coding sequence were amplified from the haploid PNY0865. PNY2115 was transformed with the resulting PCR product and transformants were selected on agar plates containing synthetic complete media lacking histidine supplemented with 1% ethanol at 30 C. A PNY2115 HIS3+ isolate was designated PNY1566.

    [0286] PNY1566 was transformed with pLH804 (ilvD_Sm; SEQ ID NO:591) and transformants were selected on agar plates containing synthetic complete media lacking uracil supplemented with 1% ethanol at 30 C. Two transformants were selected and designated PNY1604 and PNY1614. PNY1566 was transformed with pLH689 (tagged ilvD_Sm) and transformants were selected on agar plates containing synthetic complete media lacking uracil supplemented with 1% ethanol at 30 C. Two transformants were selected and designated PNY1602 and PNY1612.

    Example 9: DHAD Activity of Variant DHADs

    [0287] PNY1604, PNY1614, PNY1602, and PNY1612 were grown overnight in 12 ml of low glucose medium in 125 ml VWR vent cap shake flasks at 30 C. at 250 RPM in a New Brunswick I24 incubated shaker. The low glucose medium consisted of: 6.7 g/L Difco Yeast Nitrogen Base without amino acids (Becton Dickinson; Sparks, Md.), 1.92 g/L Synthetic Drop-out Medium Supplement without Uracil (Sigma; St. Louis, Mo.), 0.2% weight per volume (w/v) ethanol, 0.3% w/v glucose, 100 mM 2-Morpholinoethanesulphonic acid (MES) buffer, adjusted to pH 5.5 with KOH. Overnight cultures were centrifuged at 3800g for 5 minutes at room temperature and cell pellets were resuspended in 1 ml of high glucose medium. High glucose medium consisted of: 6.7 g/L Difco Yeast Nitrogen Base without amino acids (Becton Dickinson; Sparks, Md.), 1.92 g/L Synthetic Drop-out Medium Supplement without Uracil (Sigma; St. Louis, Mo.), 0.1% w/v ethanol, 3.0% w/v glucose, 100 mM 2-Morpholinoethanesulphonic acid (MES) buffer, adjusted to pH 5.5 with KOH. 15 ml of high glucose medium in 125 ml VWR vent cap shake flasks was inoculated with cells to a final OD600 0.4 and grown for 5 hours at 30 C. at 250 RPM in a New Brunswick I24 incubated shaker. Cells were again centrifuged at 3800g for 5 minutes at room temperature and cell pellets were resuspended in 2 ml of high glucose medium. 30 ml of high glucose medium in 60 ml serum vials (Kimble Chase; Vineland, N.J.) was inoculated with resuspended cells to a final OD600 of 0.15. Serum vials were sealed and cultures were grown at 30 C. at 250 RPM in a New Brunswick I24 incubated shaker for 20 hours. Cultures were centrifuged at 3800g for 5 minutes at 4 C. The pellets were washed with cold 50 mM HEPES pH 6.8 and then centrifuged at 3800g for 5 minutes at 4 C. Cell pellets were frozen on dry ice and stored at 80 C. until they were assayed for DHAD activity.

    [0288] For DHAD activity measurements the frozen yeast cells were thawed, resuspended in 0.1 M K-Hepes pH 6.8 containing 10 mM MgCl.sub.2 and a protease inhibitor cocktail (Roche, Catalog #11873580001), and then broken by bead beating. The broken cells were centrifuged to remove the cell debris and generate the yeast crude extract. Protein concentrations (mg/ml) of extracts were measured with the Pierce Coomassie Plus (Bradford) Protein Assay (Catalog #23236, Thermoscientific). DHAD enzyme activities were measured spectrophotometrically in an end point assay using the 2,4-dinitrophenylhydrazine (2,4-DNPH) method as described in Flint, D. H. and M. H. Emptage, J. Biol. Chem. 263:3558-64, 1988, with modifications. The assay buffer contained 0.1 M K-Hepes pH 6.8 and 10 mM MgCl.sub.2. Yeast extracts were diluted in assay buffer. Sufficient (R)-2,3-dihydroxyisovaleric acid was added to assay buffer so that the final concentration in the assay is 10 mM. In each assay, an enzyme containing solution and sufficient substrate containing buffer are mixed so that the final volume is 300 ul. Assay mixtures were incubated at 30 C. for 20 minutes. At five minute intervals, a 60 ul aliquot of each reaction was mixed with 70 ul of a saturated solution of 2,4-DNPH in 1 N HCl. Following a 30 minute incubation at room temperature, 70 ul of 4 N KOH in ethanol was then added to the solution, followed by brief mixing. The absorbance of the mixture was read at 540 nm with a Spectra Max384 Plus plate reader (Molecular Devices, Sunnyvale, Calif.). A standard curve containing 0 mM to 1.33 mM -ketoisovalerate was employed to calculate enzyme activities (units per milliliter, U/ml) for the conversion of (R)-2,3-dihydroxyvalerate to -ketoisovalerate in the assays. DHAD specific activities (units per milligram, U/mg) were determined from enzyme activities (U/ml) and protein concentrations (mg/ml) measured for each sample.

    [0289] Strains PNY1604 and PNY1614 containing the control ilvD_Sm had an average DHAD activity of 0.32 U/mg. See FIG. 8. Strains PNY1602 and PNY1612 containing the tagged ilvD_Sm had an average DHAD activity of 1.25 U/mg. See FIG. 8.

    Example 10: Constructs for Expressing Variant DHAD in Yeast Strain BY4741

    [0290] Vector derived from pHR81 (ATCC 87541) was used for expressing the wild type and mutant DHAD from S. mutans under the control of FBA promoter. Vector pHR81 FBA-IlvD(Sm) contained wild-type (WT) DHAD. In this-vector, the FBA promoter is in the region from nucleotides (nt) 7626 to 8623. The IlvD gene is from nt 8631 to 10343 flanked by restriction sites SpeI and NotI. For the expression of the IlvD protein containing a C-terminal tag, vector pHR81 FBA-IlvD(Sm)-lum was used. In this vector, the IlvD gene was located between nt 8631 to 10343 and a C-terminal tag sequence (SEQ ID NO:785) was added in frame from 10344 to 10364.

    Example 11: DHAD Activity Measurement in Yeast Strain BY4741

    [0291] Vectors pHR81 FBA-IlvD(Sm) (SEQ ID NO:788) and pHR81 FBA-IlvD (Sm)-lum (SEQ ID NO:789) were transformed into yeast strain BY4741. Competent cells were prepared with a Frozen Yeast Transformation kit (Zymo Research). The transformants were selected on plates with complete synthetic yeast growth medium minus Ura (Teknova). Growth on liquid medium was carried out by adding 5 ml of an overnight culture into 100 ml medium in a 250 ml flask. Cells from 80 ml culture were harvested by centrifugation (4,000 rpm for 10 min at 4 C.) and washed with 10 ml TM8 buffer (50 mM Tris, pH 8.0, 10 mM MgSO.sub.4) stored at 4 C. The cells were resuspended in 1 ml of TM8 and transferred to a lysing matrix tubes with 0.1 mm silica spheres (MP Biomedicals, Solon, Ohio). The cells were broken with a beads beater (4 with 30 seconds each). The crude extract was obtained by centrifugation with a table top microfuge at 12,000 rpm at 4 C. for 30 min. The supernatants were removed and stored on ice until assayed as described above.

    [0292] It was found that the DHADs assayed herein were stable in crude extracts kept on ice for a few hours. The activity was also preserved when samples were frozen in liquid N.sub.2 and stored at 80 C. Unexpectedly, results from enzymatic measurement (FIG. 9) showed that about 50% increase in activity with the IlvD enzyme containing a tag at the C-terminus as compared to the activity obtained with the wild-type (WT) enzyme.

    Example 12: C-Terminal-Tagged DHAD Expression Strains

    [0293] Plasmid and Strain Construction

    [0294] Plasmids were constructed in a pRS423-based 2-micron Saccharomyces cerevisiae-Escherichia coli shuttle vector. Genes encoding the DHAD sequence or the C-terminal-tagged DHAD sequence were cloned into the PmlI and NotI restriction sites of the plasmid, such that the gene was expressed from the yeast FBA1 promoter and followed by the yeast FBA1 terminator. All genes, except the Streptococcus mutans ilvD gene, were synthesized codon optimized for expression in Saccharomyces cerevisiae (Genscript, Piscataway, N.J.). The native sequence was utilized for the Streptococcus mutans ilvD gene. The predicted Zea mays chloroplast targeting peptide sequence was not included in the synthesized gene. The sequence encoding the first 33 amino acids was removed and replaced with a methionine codon. The predicted Neurospora crassa mitochondrial targeting peptide sequence was not included in the synthesized gene. Two start sites were tested. Construct Neurospora crassa DHAD(1) had the sequence encoding the first 32 amino acids removed and replaced with a methionine codon. Construct Neurospora crassa DHAD(2) had the sequence encoding the first 36 amino acids removed and replaced with a methionine codon.

    [0295] pBP4582 (SEQ ID NO:790) was constructed to contain a chimeric gene having the coding region of the ilvD gene from Streptococcus mutans (nt position 2260-3972) expressed from the yeast FBA1 promoter (nt 1661-2250) and followed by the FBA1 terminator (nt 3984-4296) for expression of the Streptococcus mutans DHAD with no C-terminal tag.

    [0296] pBP1296 (SEQ ID NO:791) was constructed to contain a chimeric gene having the coding region of the ilvD gene from Streptococcus mutans (nt position 2260-3972) followed by a C-terminal tag sequence (nt 3973-3993; Adams et al., 2002. J. Am. Chem. Soc., v124 p 6063) expressed from the yeast FBA1 promoter (nt 1661-2250) and followed by the FBA1 terminator (nt 4005-4317) for expression of the Streptococcus mutans C-terminal-tagged DHAD.

    [0297] pBP4578 (SEQ ID NO:792) was constructed to contain a chimeric gene having the coding region of the ilvD gene from Streptococcus downei (nt position 2260-3954) expressed from the yeast FBA1 promoter (nt 1661-2250) and followed by the FBA1 terminator (nt 3966-4278) for expression of the Streptococcus downei DHAD with no C-terminal tag.

    [0298] pBP4579 (SEQ ID NO:793) was constructed to contain a chimeric gene having the coding region of the ilvD gene from Streptococcus downei (nt position 2260-3954) followed by a C-terminal tag sequence (nt 3955-3975; Adams et al., 2002. J. Am. Chem. Soc., v124 p 6063) expressed from the yeast FBA1 promoter (nt 1661-2250) and followed by the FBA1 terminator (nt 3987-4299) for expression of the Streptococcus downei C-terminal-tagged DHAD.

    [0299] pBP4580 (SEQ ID NO:794) was constructed to contain a chimeric gene having the coding region of the ilvD gene from Oscillatoria species PCC 6506 (nt position 2260-3942) expressed from the yeast FBA1 promoter (nt 1661-2250) and followed by the FBA1 terminator (nt 3954-4266) for expression of the Oscillatoria species PCC 6506 DHAD with no C-terminal tag.

    [0300] pBP4581 (SEQ ID NO:795) was constructed to contain a chimeric gene having the coding region of the ilvD gene from Oscillatoria species PCC 6506 (nt position 2260-3942) followed by a C-terminal tag sequence (nt 3943-3963; Adams et al., 2002. J. Am. Chem. Soc., v124 p 6063) expressed from the yeast FBA1 promoter (nt 1661-2250) and followed by the FBA1 terminator (nt 3975-4287) for expression of the Oscillatoria species PCC 6506 C-terminal-tagged DHAD.

    [0301] pBP4585 (SEQ ID NO:796) was constructed to contain a chimeric gene having the coding region of the ilvD gene from Zea mays (nt position 2260-3936) expressed from the yeast FBA1 promoter (nt 1661-2250) and followed by the FBA1 terminator (nt 3948-4260) for expression of the Zea mays DHAD with no C-terminal tag.

    [0302] pBP4586 (SEQ ID NO:797) was constructed to contain a chimeric gene having the coding region of the ilvD gene from Zea mays (nt position 2260-3936) followed by a C-terminal tag sequence (nt 3937-3957; Adams et al., 2002. J. Am. Chem. Soc., v124 p 6063) expressed from the yeast FBA1 promoter (nt 1661-2250) and followed by the FBA1 terminator (nt 3969-4281) for expression of the Zea mays C-terminal-tagged DHAD.

    [0303] pBP4587 (SEQ ID NO:798) was constructed to contain a chimeric gene having the coding region of the ilvD gene from Lactococcus lactis (nt position 2260-3969) expressed from the yeast FBA1 promoter (nt 1661-2250) and followed by the FBA1 terminator (nt 3981-4293) for expression of the Lactococcus lactis DHAD with no C-terminal tag.

    [0304] pBP4588 (SEQ ID NO:799) was constructed to contain a chimeric gene having the coding region of the ilvD gene from Lactococcus lactis (nt position 2260-3969) followed by a C-terminal tag sequence (nt 3970-3990; Adams et al., 2002. J. Am. Chem. Soc., v124 p 6063) expressed from the yeast FBA1 promoter (nt 1661-2250) and followed by the FBA1 terminator (nt 4002-4314) for expression of the Lactococcus lactis C-terminal-tagged DHAD.

    [0305] pBP4642 (SEQ ID NO:800) was constructed to contain a chimeric gene having the coding region of the ilvD gene from Neurospora crassa (nt position 2260-3954) expressed from the yeast FBA1 promoter (nt 1661-2250) and followed by the FBA1 terminator (nt 3966-4278) for expression of the Neurospora crassa DHAD(1) with no C-terminal tag.

    [0306] pBP4644 (SEQ ID NO:801) was constructed to contain a chimeric gene having the coding region of the ilvD gene from Neurospora crassa (nt position 2260-3954) followed by a C-terminal tag sequence (nt 3955-3975; Adams et al., 2002. J. Am. Chem. Soc., v124 p 6063) expressed from the yeast FBA1 promoter (nt 1661-2250) and followed by the FBA1 terminator (nt 3987-4299) for expression of the Neurospora crassa C-terminal-tagged DHAD(1).

    [0307] pBP4643 (SEQ ID NO:802) was constructed to contain a chimeric gene having the coding region of the ilvD gene from Neurospora crassa (nt position 2260-3942) expressed from the yeast FBA1 promoter (nt 1661-2250) and followed by the FBA1 terminator (nt 3954-4266) for expression of the Neurospora crassa DHAD(2) with no C-terminal tag.

    [0308] pBP4645 (SEQ ID NO:803) was constructed to contain a chimeric gene having the coding region of the ilvD gene from Neurospora crassa (nt position 2260-3942) followed by a C-terminal tag sequence (nt 3943-3963; Adams et al., 2002. J. Am. Chem. Soc., v124 p 6063) expressed from the yeast FBA1 promoter (nt 1661-2250) and followed by the FBA1 terminator (nt 3975-4287) for expression of the Neurospora crassa C-terminal-tagged DHAD(2).

    [0309] pBP4577 (SEQ ID NO:804) was constructed as a negative control (no heterologous DHAD expression). The Streptococcus mutans ilvD gene and C-terminal tag sequence in pBP1296 were removed by restriction digestion and the remaining vector was re-ligated to create pBP4577.

    [0310] BY4741 fra2 (Thermo Scientific Open Biosystems Yeast Knock Out Clone) was transformed using a Frozen-EZ Yeast Transformation II kit (Zymo Research) and the resulting plasmids and transformants were selected on agar plates containing synthetic complete media lacking histidine supplemented with 2% glucose at 30 C. Three transformants were selected for each plasmid transformation.

    DHAD Activity

    [0311] Strains were grown overnight in synthetic complete media lacking histidine supplemented with 2% glucose (Teknova). Overnight cultures were sub-cultured to an optical density at a wavelength of 600 nm (OD600) of 0.25 and grown in 25 ml synthetic complete media lacking histidine supplemented with 2% glucose (Teknova) in 125 ml Erlenmeyer flat cap flasks (VWR) at 30 C. 250 revolutions per minute (RPM) in a New Brunswick I24 incubated shaker for 7.5 hours. Cultures were centrifuged at 3800g for 5 minutes at 4 C. The pellets were washed with cold 50 mM HEPES ((4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid)) pH 6.8 and then centrifuged at 3800g for 5 minutes at 4 C. Cell pellets were frozen on dry ice and stored at 80 C. until they were assayed for DHAD activity. DHAD activity was measured as described above. All samples, except pBP1296 transformant #2, were assayed with three different volumes of cell extract; 20 l, 40 l, and 150 l. pBP1296 transformant #2 was measured with 20 l and 40 l of cell extract.

    [0312] DHAD activity is shown in FIG. 10 as units of enzyme activity per mg of total protein, with error bars reflecting the standard deviation. The DHAD activity for each DHAD construct is the average of the activities for the cell extract volumes tested and the average of the three transformants for each plasmid. The C-terminal-tagged constructs for the Streptococcus mutans DHAD, Streptococcus downei DHAD, and Lactococcus lactis DHAD (pBP1296, pBP4579, and pBP4588, respectively) all demonstrated higher DHAD activity than their non-C-terminal-tagged equivalents (pBP4582, pBP4578, and pBP4587, respectively). The activities for the other DHAD enzymes were too low to determine the effect of the C-terminal tag on their enzyme activities.

    Example 13: Site Directed Mutagenesis to Replace Cysteines with Methionines in the C-Terminal Tag of the S. mutans DHAD 689-I2V5 Variant

    [0313] The four cysteines in the C-terminal tag of the 689-I2V5 variant of the S. mutans DHAD (DNA SEQ ID NO:786; protein SEQ ID NO:787) were replaced with methionines, individually and in every combination. Fifteen variants and a control were prepared via site directed mutagenesis. Mutagenesis was performed in a two-step process with the yeast shuttle plasmid pBP376. The first step entailed PCR with mutagenic primers. Primer ilvD_F1 (SEQ ID NO:805; GTG AGT ATG ACT GAC AAA AAA ACT CTT AAA GAC) and the primers listed in Table 23 were commercially synthesized by Integrated DNA Technologies, Inc. (Coralville, Iowa).

    TABLE-US-00022 TABLE23 PrimersEmployedforSiteDirectedMutagenesis SEQID Primer NO: Sequence Lum_R1 806 ATTAATCAACCACAGCAACCAGGACAACAT TTTTTGCCAG Lum_R2 807 ATTAATCAACCACAGCAACCAGGACACATT TTTTTGCCAG Lum_R3 808 ATTAATCAACCACAGCAACCAGGCATACAT TTTTTGCCAG Lum_R4 809 ATTAATCAACCACACATACCAGGACAACAT TTTTTGCCAG Lum_R5 810 ATTAATCAACCCATGCAACCAGGACAACAT TTTTTGCCAG Lum_R6 811 ATTAATCAACCACACATACCAGGACACATT TTTTTGCCAG Lum_R7 812 ATTAATCAACCACAGCAACCAGGCATCATT TTTTTGCCAG Lum_R8 813 ATTAATCAACCACACATACCAGGCATACAT TTTTTGCCAG Lum_R9 814 ATTAATCAACCCATGCAACCAGGCATACAT TTTTTGCCAG Lum_R10 815 ATTAATCAACCCATCATACCAGGACAACAT TITTTGCCAG Lum_R11 816 ATTAATCAACCCATGCAACCAGGACACATT TTTTTGCCAG Lum_R12 817 ATTAATCAACCACACATACCAGGCATCATT TTTTTGCCAG Lum_R13 818 ATTAATCAACCCATCATACCAGGCATACAT TTTTTGCCAG Lum_R14 819 ATTAATCAACCCATCATACCAGGACACATT TITTTGCCAG Lum_R15 820 ATTAATCAACCCATGCAACCAGGCATCATT TTTTTGCCAG Lum_R16 821 ATTAATCAACCCATCATACCAGGCATCATT TTTTTGCCAG

    [0314] Sixteen PCR reactions were performed with PFUultra polymerase (Catalog #600380; Agilent Technologies, Stratagene Products Division, La Jolla, Calif.). Each reaction consisted of 1 l of pBP3765 (10 ng/l), 1 l of primer ilvD_F1 (10 uM), 1 ul of a primer listed in Table 23 (10 uM), 5 ul of 10 PFUultra buffer, 1 l of 10 mM dNTP mix, 1 l of PFUultra DNA polymerase, and 40 l of ddH.sub.2O. The following conditions were used for the PCR reactions: The starting temperature was 95 C. for 2.0 min followed by 30 heating/cooling cycles. Each cycle consisted of 95 C. for 30 sec, 55 C. for 30 sec, and 68 C. for 120 sec. At the completion of the temperature cycling, the sample was kept at 72 C. for 10.0 min more, and then held awaiting sample recovery at 4 C. The reaction products were separated from the template via agarose gel electrophoresis (1% agarose, 1TBE buffer) and recovered using the illustra GFX PCR DNA and Gel Band Purification kit (Cat#28-9034-70, GE Healthcare Life Sciences, Piscataway, N.J.) as recommended by the manufacturer.

    [0315] In the second step, the purified PCR products were employed as a megaprimers for reactions with the QuikChange Lightning Site-Directed Mutagenesis Kit (Catalog #200523; Agilent Technologies, Stratagene Products Division, La Jolla, Calif.). Except for the primers, templates, and ddH.sub.2O, all reagents used here were supplied with the kit. The reaction mixtures contained 1 l of pBP3765 (50 ng/l), 2.5 l of each megaprimer (100 ng/ul), 2.5 l of 10 reaction buffer, 0.5 l of dNTP mix, 0.75 ul QuikSolution, 0.5 ul QuikChange Lightning Enzyme, and 17.5 l of ddH.sub.2O. The following conditions were used for the reactions: The starting temperature was 95 C. for 2 min followed by 18 heating/cooling cycles. Each cycle consisted of 95 C. for 20 sec, 60 C. for 10 sec, and 68 C. for 7 min. At the completion of the temperature cycling, the samples incubated at 68 C. for 5 min and then held awaiting sample recovery at 4 C. 1 l of the Dpn I (10 U/l) was added to each reaction and the mixtures were incubated for 30 min at 37 C. Reaction products were isolated and concentrated to 6 ul with the DNA Clean & Concentrator-5 kit (D4013; Zymo Research; Irvine, Calif.).

    [0316] 2.5 l of each mutagenic reaction was transformed into One Shot TOP10 Chemically Competent E. coli (Invitrogen, Catalog #C404003) according to the manufacturer's instructions. The transformants were spread on agar plates containing the LB medium and 100 g/ml ampicillin (Catalog #L1004, Teknova Inc. Hollister, Calif.) and incubated at 37 C. overnight. Multiple transformants for each reaction were inoculated into LB medium containing 100 g/ml ampicillin and incubated at 37 C. with shaking at 225 rpm. Plasmid DNA was isolated from the cells with the QIAprep Spin Miniprep Kit (Catalog #2706; Qiagen, Valencia, Calif.) according to the protocol provided by the manufacturer. Sequencing of the complete DHAD genes were performed with primers Dseq1 (aacgcgtgaagcttttgaagatg; SEQ ID NO:822), Dseq2 (tcagttcggaacaatcacgg; SEQ ID NO:823), Dseq3 (tgctttccctttcatcaatgattgttg, SEQ ID NO:824), Dseq4 (tccatgttagccatagcgataac SEQ ID NO:825), Dseq5 (ttgtgcttcaggagcgatatg; SEQ ID NO:826), and N885 (ctgctaatgtggaattgacac, SEQ ID NO:827).

    TABLE-US-00023 TABLE24 PreparedVersionsoftheC-terminalTag intheI2V5Variant AminoAcid Variant SEQIDNO: C-terminalTag YW1(689-I2V5) 749 CCPGCCG YW2 750 MCPGCCG YW3 751 CMPGCCG YW4 752 CCPGMCG YW5 753 CCPGCMG YW6 754 MCPGMCG YW7 755 MMPGCCG YW8 756 CMPGMCG YW9 757 CMPGCMG YW10 758 CCPGMMG YW11 759 MCPGCMG YW12 760 MMPGMCG YW13 761 CMPGMMG YW14 762 MCPGMMG YW15 763 MMPGCMG YW16 764 MMPGMMG

    [0317] The variants listed in Table 24 together with 804-I2V5 variant lacking a C-terminal tag were transformed in yeast strain PNY2145 (MATa ura3::loxP his3 pdc5::P[FBA(L8)]-XPK|xpk1_Lp-CYCt-loxP66/71 fra2 2-micron plasmid (CEN.PK2) pdc1::P[PDC1]-ALS|alsS_Bs-CYC1t-loxP71/66 pdc6::(UAS)PGK1-P[FBA1]-KIVD|Lg(y)-TDH3t-loxP71/66 adh1::P[ADH1]-ADH|Bi(y)-ADHt-loxP71/66 fra2::P[ILV5]-ADH|Bi(y)-ADHt-loxP71/66 gpd2::loxP71/66 amn1::AMN1(y); described, for example, in Int'l Appl. No. PCT/US2012/072186, filed Dec. 28, 2012, which is incorporated by reference herein) and analyzed for isobutanol production and DHAD activity.

    Growth Media

    [0318] Four types of media were used during the growth procedure of yeast strains: SE-ura agar plate, SAG-2-ura agar plate, an aerobic pre-culture media and an anaerobic culture media. All chemicals were obtained from Sigma-Aldrich (St. Louis, Mo.) unless otherwise noted.

    [0319] Yeast transformation recovery plate (SE-ura): 50 mM 2-(N-morpholino)ethanesulfonic acid (MES)(pH 5.5), 6.7 g/L yeast nitrogen base without amino acids (Difco, 291940, Sparks, Md.), 1.4 g/L yeast synthetic drop-out medium supplement without histidine, leucine, tryptophan and uracil, 0.2% ethanol, 0.01% weight per volume (w/v) leucine, 0.01% w/v histidine, and 0.002% w/v tryptophan.

    [0320] Glucose adaptation plate (SAG-2-Ura): 50 mM MES (pH 5.5, 6.7 g/L yeast nitrogen base without amino acids (Difco, 291940, Sparks, Md.), 1.4 g/L yeast synthetic drop-out medium supplement without histidine, leucine, tryptophan and uracil, 3 mM sodium acetate (pH 7.0), 2% w/v glucose, 0.01% w/v leucine, 0.01% w/v histidine, and 0.002% w/v tryptophan.

    [0321] Aerobic pre-culture media (SAG-0.2-Ura): 6.7 g/L yeast nitrogen base without amino acids (Difco, 291940, Sparks, Md.), 1.4 g/L yeast synthetic drop-out medium supplement without histidine, leucine, tryptophan and uracil, 3 mM sodium acetate (pH 7.0), 0.2% w/v glucose, 0.01% w/v leucine, 0.01% w/v histidine, and 0.002% w/v tryptophan.

    [0322] Anaerobic culture media (SAG-3-Ura): 50 mM MES (pH 5.5, 6.7 g/L yeast nitrogen base without amino acids (Difco, 291940, Sparks, Md.), 1.4 g/L yeast synthetic drop-out medium supplement without histidine, leucine, tryptophan and uracil, 3 mM sodium acetate (pH 7.0), 3% w/v glucose, 0.01% w/v leucine, 0.01% w/v histidine, 0.002% w/v tryptophan, 30 mg/L nicotinic acid, 30 mg/L thiamine and 10 mg/L ergosterol made up in 50/50 volume per volume (v/v) Tween/ethanol solution.

    Transformation and Glucose Adaptation

    [0323] Competent cells of the PNY2145 were prepared and transformed with 1 L of purified plasmid (0.4 to 0.8 g total DNA) using a Frozen-EZ Yeast Transformation II Kit (Zymo Research Corp.; Irvine, Calif.). Transformation mixtures were plated on SE-ura plates and incubated at 30 C. for 4 days. Three or four colonies for each transformant were selected and patched onto SE-ura plates and incubated at 30 C. for 2 days. The variants then underwent glucose adaptation by patching onto SAG-2-Ura plates and growing for 2 days at 30 C.

    Deep-Well Plate Growth Procedure

    [0324] 1.5 mL aliquots of the aerobic pre-culture media were dispensed into each well of a VWR 48 deep-well plate (#82004-674, VWR, Radnor, Pa.) and inoculated with cells grown on a SAG-2-Ura agar plate, as described above. A sterile air permeable cover (#60941-086, VWR, Radnor, Pa.) was used to seal the culture plate. The plate was placed in a 30 C. incubator and was grown for 20 to 24 hours with shaking, and an OD600 value (optical density at 600 nm) was obtained using Spectra Max384 Plus plate reader (Molecular Devices, Sunnyvale, Calif.). OD600 values were converted to equivalent OD600 values on a Cary 300 (Agilent Technologies, Wilmington, Del.) calibration value. A dilution 48 deep-well plate was set with a target Cary OD600 value of 0.35 for each well in a total volume of 1.5 mL. Wells with Cary OD600 values of 0.35 to 0.40 were transferred directly from the original plate to the dilution plate. For all other wells, a volume of turbid culture was transferred the volume was brought up to 1.5 mL with aerobic pre-culture media. The 48 deep-well plate was returned to the 30 C. shaking incubator and grown for an additional 20 to 24 hours. OD600 values were obtained as described above.

    Isobutanol Titers and DHAD Activities

    [0325] PNY2145 with S. mutans DHAD variants were grown and analyzed as described above. Additionally, the resultant cells were pelleted via centrifugation and the DHAD activities were measured as described above. Isobutanol titers and DHAD specific activities are listed in Table 25 below. FIG. 11 shows gel analysis for selected variants to determine whether these proteins are detected with the Lumio reagent. The gel was prepared was prepared as described in Example 14. Only lanes for variants YW1, YW4, and YW7 contain bands consistent with detected DHAD protein. The lane 804-I2V5 represents the negative control lacking a c-terminal tag.

    TABLE-US-00024 TABLE 25 Isobutanol titers and DHAD specific activities for S. mutans DHAD variants in PNY2145 Isobutanol mM at DHAD SA 44 hr (U/mg) Variant C-terminal Tag Mean SD Mean SD YW1 CCPGCCG 82.1 3.9 1.06 0.09 (689- I2V5) YW2 MCPGCCG 73.5 5.7 0.81 0.09 YW3 CMPGCCG 78.0 4.5 0.76 0.04 YW4 CCPGMCG 76.6 5.3 0.39 0.33 YW5 CCPGCMG 74.6 4.3 0.99 0.13 YW6 MCPGMCG 59.1 5.0 0.16 0.19 YW7 MMPGCCG 65.9 6.6 0.41 0.07 YW8 CMPGMCG 57.0 4.7 0.29 0.10 YW9 CMPGCMG 50.5 3.4 0.33 0.04 YW10 CCPGMMG 57.9 1.1 0.30 0.06 YW11 MCPGCMG 70.0 3.2 0.47 0.17 YW12 MMPGMCG 39.3 2.0 0.28 0.13 YW13 CMPGMMG 43.0 3.4 0.22 0.13 YW14 MCPGMMG 44.9 4.5 0.19 0.07 YW15 MMPGCMG 44.7 3.7 0.21 0.02 YW16 MMPGMMG 39.1 1.6 0.22 0.02 804-I2V5 No tag 38.3 6.6 0.14 0.06

    Example 14: Construction of DHAD-C-Terminal Tag Variants

    [0326] Eight C-terminal tag variants containing either amino acid changes or additions were constructed by PCR amplification of the native sequence from the plasmid pBP3765 (SEQ ID NO:828). One forward primer N1560 was used with eight reverse primers N1561, N1562, N1563, N1564, N1565, N1566, N1567 and N1568. The resulting PCR products were cloned into a TOPO vector (Invitrogen Cat. No. K288020) and sequenced to verify the engineered nucleotide changes.

    Construction of IlvD-I2V5-C-Terminal Tag Plasmids

    [0327] The TOPO-clones containing the PCR products described above were restriction digested with AscI and PacI and ligated to the AscI and PacI digested plasmid pBP3765 thus replacing the 3 end of the ilvD-I2V5-Lum. The ligation reaction was transformed into. E. coli Stbl3 cells (Invitrogen Cat. No. C737303) which were incubated on LB ampicillin plates to select for transformants. Successful insertion was identified by PCR colony screen using PCR primers N1576 and N1577. Colonies screening positive for an insertion were cultivated, plasmids isolated and the C-terminal tag locus sequenced for final verification of engineered nucleotide changes. The plasmids were designated, respectively: pJT386, pJT387, pJT388, pJT389, pJT390, pJT391, pJT392, and pJT39.

    TABLE-US-00025 TABLE26 C-terminaltagaminoacidsequencesand correspondingexpressionplasmids Control CCPGCCG(SEQIDNO:748) pBP3765 Variant1 CSCPGCCG(SEQIDNO:739) pJT386 Variant2 CPCPGCCG(SEQIDNO:740) pJT387 Variant3 CECPGCCG(SEQIDNO:741) pJT388 Variant4 CCPGCSCG(SEQIDNO:742) pJT389 Variant5 CCPGCPCG(SEQIDNO:743) pJT390 Variant6 CCPGCECG(SEQIDNO:744) pJT391 Variant7 CCPEGCCG(SEQIDNO:745) pJT392 Variant8 CCPAGCCG(SEQIDNO:746) pJT393
    Construction of Isobutanologen Strains with C-Terminal Tag Variant DHAD Enzymes

    [0328] The plasmids above (plus control) were each transformed along with pRS413::BiADH-kivD into strain PNY2145. Transformation mixtures were plated on synthetic complete medium without uracil or histidine containing 1% ethanol as carbon source. Cells from transformant colonies were patched to fresh plates. After two days, cells from patches were transferred to plates containing 2% glucose instead of ethanol as carbon source. After two days, cells from patches were used to inoculate liquid medium (synthetic complete without uracil or histidine with 0.3% glucose). The next morning, the optical density of each culture was adjusted with fresh medium. After approximately 4 hours, cultures were used to inoculate 15 mL serum vials containing synthetic complete medium minus uracil and histidine with 2% glucose as carbon source and supplemented with 1BME vitamins (Sigma Cat. No. B6891). The starting OD for each culture was 0.1 and the final volume was 10 mL. Vials were stoppered, crimped and incubated at 30 C. in an Infors Multitron platform shaker (220 rpm). After 38.5 hours, stoppers were removed for sampling. Culture supernatant obtained from Costar Spin-X columns (3,000 rpm, 3 minutes) was analyzed by HPLC, as described in Example 4. Concentration of isobutanol was determined using a standard curve. Glucose consumption was also calculated by standard curve. A second series of serum vial cultures was set up as described above with one clone from each genotype. This time cells were collected from the cultures 24 hours after inoculation (3 minutes, 500g). Cell pellets were then stored at 80 C. DHAD assay as described in the Examples herein or as described by Flint and Emptage (J. Biol. Chem., 263(8):3558-64, 1988) using dinitrophenylhydrazine.

    [0329] Table 27 shows the glucose consumption and isobutanol concentration from 39 hour serum vial incubation. For all variants except variant #6, there were n=3 biological replicates. For variant #6, there were n=2 biological replicates and for the control, n=2 technical replicates. The DHAD specific activity from 24 hour serum vial incubation is one individual clone of each variant.

    TABLE-US-00026 TABLE 27 Glucose consumption and isobutanol concentration from 39 hour serum vial incubation C-terminal Isobutanol Representative DHAD Tag Glucose Consumed concentration Specific Activity Variant (mM) (mM) (mole/min/mg) 1 81.2 1.8 53.7 1.7 0.85 2 88.4 6.0 59.4 3.3 0.89 3 88.9 1.9 60.0 1.0 1.06 4 86.3 7.8 57.2 3.7 1.2 5 81.4 1.6 54.2 1.0 1.2 6 87.2 0.4 57.9 0.4 1.1 7 86.4 2.3 57.2 1.4 1.51 8 84.4 6.9 55.8 4.4 1.93 Control 95.8 0.5 64.4 0.7 1.47

    [0330] Sequences were detected using the Lumio Green Detection kit (LC6090, Invitrogen Life Technologies, Carlsbad, Calif.) according to the manufacturer's instructions, with the following modifications. The buffer used to lyse the cells was a HEPES buffer, pH 6.8. A master mix combining 60 L of 4 Lumio Gel Sample buffer and 2.4 L of Lumio Green Detection reagent was made; each sample received a 5.2 L aliquot of this master mix. Cell lysates were concentrated approximately 3 to 4 fold using a YM-10 spin filter prior to the addition of the master mix.

    [0331] A 10% Bis-Tris gel (NP0303, Invitrogen, Carlsbad, Calif.) was run in 1MOPS buffer (NP000102, Invitrogen, Carlsbad, Calif.) at 185V for 50 minutes. A BioRad Gel Doc (BioRad, Hercules, Calif.) system was used to visualize and image the gel, according to the Lumio Green Detection kit instructions (FIG. 12). The lanes of the gel in FIG. 12 are as follows: 1. Lumio Molecular Weight Marker; 2. pJT386; 3. pJT387; 4. pJT388; 5. pJT389; 6. pJT390; 7. pJT391; 8. pJT392; 9. pJT393; and 10. PNY2312 (positive control). After the gel image was acquired, the gel was stained following the Simple Blue (LC6060, Invitrogen, Carlsbad, Calif.) protocol in order to visualize total protein (FIG. 13). The lanes of the gel in FIG. 13 are as follows: 1. Lumio Molecular Weight Marker; 2. pJT386; 3. pJT387; 4. pJT388; 5. pJT389; 6. pJT390; 7. pJT391; 8. pJT392; 9. pJT393; 10. PNY2312 (positive control); 11. PNY2145+pLH804; and 12. PNY2145+PLH804 L2V4 #1. Analysis of gel image was performed using Image Lab 4.0 (BioRad, Hercules, Calif.) to quantitate the signal, with the arrow indicating the DHAD reference band (Table 28).

    TABLE-US-00027 TABLE 28 Relative Quantity of signal Relative Lane Quantity 1 n/d 2 n/d 3 n/d 4 0.24 5 0.38 6 0.25 7 0.28 8 0.16 C 1.00

    Example 15: ilvD_Sm with C-Terminal Tag Variants in Isobutanologen Plasmid Construction

    [0332] Plasmids were constructed in a 2-micron based Saccharomyces cerevisiae-Escherichia coli shuttle vector.

    TABLE-US-00028 TABLE 29 Plasmids referenced in Example 15 DHAD Plasmid description C-terminal Amino Acid Sequence pBP3763 Full-length Lys-Lys-Cterm pBP3765 tag Lys-Lys-Cys-Cys-Pro-Gly-Cys-Cys-Gly-Cterm pBP3767 tag 2C-2A Lys-Lys-Cys-Ala-Pro-Gly-Ala-Cys-Gly-Cterm pBP3769 tag 2C-2S Lys-Lys-Cys-Ser-Pro-Gly-Ser-Cys-Gly-Cterm pBP3771 Tag 4C- Lys-Lys-Ser-Ala-Pro-Gly-Ala-Ser-Gly-Cterm 2A2S
    pBP3763Native Length IlvD_Sm

    [0333] pBP3763 (SEQ ID NO:850) was constructed to contain a chimeric gene having the coding region of the Streptococcus mutans ilvD variant I2V5 (nucleotide (nt) position 5356-3644) expressed from the yeast TEF1 mutant 7 promoter (nt 5766-5366; Nevoigt et al., Applied and Environmental Microbiology, 72:5266, 2006) and followed by the FBA1 terminator (nt 3632-3320) for expression of DHAD, and a chimeric gene having the coding region of Anaerostipes cacae ilvC variant K9JB4P (nt 1628-2659; described in WO2012/12955, incorporated herein by reference) expressed from the yeast ILV5 promoter (nt 434-1614) and followed by the ILV5 terminator (nt 2673-3307) for expression of ketol-acid reductoisomerase (KARI).

    pBP3765C-Terminal Tagged IlvD_Sm

    [0334] pBP3765 (SEQ ID NO:828) was constructed to contain a chimeric gene having the coding region of the Streptococcus mutans ilvD variant I2V5 (nt position 5377-3665) followed by a C-terminal tag sequence (nt 3664-3647; Adams et al., J. Am. Chem. Soc., 124:6063, 2002) expressed from the yeast TEF1 mutant 7 promoter (nt 5787-5387; Nevoigt et al., Applied and Environmental Microbiology, 72:5266, 2006), and followed by the FBA1 terminator (nt 3632-3320) for expression of DHAD, and a chimeric gene having the coding region of the Anaerostipes cacae ilvC variant K9JB4P (nt 1628-2659; described in, for example, Int'l Publ. No. WO2012/12955, which is incorporated by reference herein) expressed from the yeast ILV5 promoter (nt 434-1614) and followed by the ILV5 terminator (nt 2673-3307) for expression of KARI.

    pBP37672C-2A Variant C-Terminal Tagged IlvD_Sm

    [0335] pBP3767 (SEQ ID NO:851) was constructed to contain a chimeric gene having the coding region of the Streptococcus mutans ilvD variant I2V5 (nt position 5377-3665) followed by the 2C-2A C-terminal tag sequence (nt 3664-3647) expressed from the yeast TEF1 mutant 7 promoter (nt 5787-5387; Nevoigt et al., Applied and Environmental Microbiology, 72:5266, 2006), and followed by the FBA1 terminator (nt 3632-3320) for expression of DHAD, and a chimeric gene having the coding region of the Anaerostipes cacae ilvC variant K9JB4P (nt 1628-2659; described in, for example, Int'l Pub. No. WO2012/12955, which is incorporated by reference herein) expressed from the yeast ILV5 promoter (nt 434-1614) and followed by the ILV5 terminator (nt 2673-3307) for expression of KARI.

    pBP37692C-2S Variant C-Terminal Tagged IlvD_Sm

    [0336] pBP3769 (SEQ ID NO:852) was constructed to contain a chimeric gene having the coding region of the Streptococcus mutans ilvD variant I2V5 (nt position 5377-3665) followed by the 2C-2S C-terminal tag sequence (nt 3664-3647) expressed from the yeast TEF1 mutant 7 promoter (nt 5787-5387; Nevoigt et al., Applied and Environmental Microbiology, 72:5266, 2006), and followed by the FBA1 terminator (nt 3632-3320) for expression of DHAD, and a chimeric gene having the coding region of the Anaerostipes cacae ilvC variant K9JB4P (nt 1628-2659; described in, for example, Int'l Pub. No. WO2012/12955, which is incorporated by reference herein) expressed from the yeast ILV5 promoter (nt 434-1614) and followed by the ILV5 terminator (nt 2673-3307) for expression of KARI.

    pBP37714C-2A2S Variant C-Terminal Tagged IlvD_Sm

    [0337] pBP3771 (SEQ ID NO:853) was constructed to contain a chimeric gene having the coding region of the Streptococcus mutans ilvD variant I2V5 (nt position 5377-3665) followed by the 4C-2A2S C-terminal tag sequence (nt 3664-3647) expressed from the yeast TEF1 mutant 7 promoter (nt 5787-5387; Nevoigt et al., Applied and Environmental Microbiology, 72:5266, 2006), and followed by the FBA1 terminator (nt 3632-3320) for expression of DHAD, and a chimeric gene having the coding region of the Anaerostipes cacae ilvC variant K9JB4P (nt 1628-2659; described in, for example, Int'l Pub. No. WO2012/12955, which is incorporated by reference herein) expressed from the yeast ILV5 promoter (nt 434-1614) and followed by the ILV5 terminator (nt 2673-3307) for expression of KARI.

    Strain Construction

    [0338] Following conversion of PNY2115 to PNY2121 by replacing the endogenous copy of AMN1 with a codon-optimized version of the AMN1 gene from CEN.PK2 (SEQ ID NO:854), PNY2121 was restored back to a histidine prototroph. The HIS3 coding sequence and 500 bp upstream and downstream of the coding sequence were amplified from a haploid (PNY0865) obtained from sporulation of PNY0827. PNY2121 was transformed with the resulting PCR product and transformants were selected on agar plates containing synthetic complete media lacking histidine supplemented with 1% ethanol at 30 C. A PNY2121 HIS3.sup.+ isolate was designated PNY1665.

    [0339] PNY1665 was transformed with the plasmids described above and transformants were selected on agar plates containing synthetic complete media lacking uracil supplemented with 1% ethanol at 30 C. Three transformants were selected for each plasmid construct.

    DHAD Activity

    [0340] Strains were grown overnight in 12 ml of low glucose medium in 125 ml VWR vent cap shake flasks at 30 C. at 250 RPM in a New Brunswick I24 incubated shaker. The low glucose medium consisted of: 6.7 g/L Difco Yeast Nitrogen Base without amino acids (Becton Dickinson; Sparks, Md.), 1.92 g/L Synthetic Drop-out Medium Supplement without Uracil (Sigma; St. Louis, Mo.), 0.2% w/v ethanol, 0.3% w/v glucose, 100 mM 2-Morpholinoethanesulphonic acid (MES) buffer, adjusted to pH 5.5 with KOH. Overnight cultures were sub-cultured into 15 ml of high glucose medium in 125 ml VWR vent cap shake flasks to a final OD600 0.4 and grown for 4 hours at 30 C. at 250 RPM in a New Brunswick I24 incubated shaker. The high glucose medium consisted of: 6.7 g/L Difco Yeast Nitrogen Base without amino acids (Becton Dickinson; Sparks, Md.), 1.92 g/L Synthetic Drop-out Medium Supplement without Uracil (Sigma; St. Louis, Mo.), 0.2% w/v ethanol, 3.0% w/v glucose, 100 mM 2-Morpholinoethanesulphonic acid (MES) buffer, adjusted to pH 5.5 with KOH. Cells were centrifuged at 3800g for 5 minutes at room temperature and cell pellets were resuspended in 2 ml of high glucose medium. 30 ml of high glucose medium in 60 ml serum vials (Kimble Chase; Vineland, N.J.) was inoculated with resuspended cells to a final OD600 of 0.2. Serum vials were sealed and cultures were grown at 30 C. at 250 RPM in a New Brunswick I24 incubated shaker for 24 hours. Cultures were centrifuged at 3800g for 5 minutes at 4 C. The pellets were washed with cold 50 mM HEPES pH 6.8 and then centrifuged at 3800g for 5 minutes at 4 C. Cell pellets were frozen on dry ice and stored at 80 C. until they were assayed for DHAD activity. DHAD activity was measured as described above.

    [0341] Strains containing the tagged ilvD_Sm plasmid (pBP3765) had an average DHAD activity of 0.68 (U/mg) (Table 30). Strains containing the plasmids with the C-terminal tag variants (pBP3767, pBP3769, pBP3771) had DHAD activities similar to the strains containing the native length ilvD_Sm plasmid (pBP3763); average DHAD activities ranging from of 0.11 to 0.16 (U/mg).

    TABLE-US-00029 TABLE 30 Average DHAD activity and standard deviation for three transformants DHAD DHAD Activity Plasmid description (U/mg) pBP3763 Full-length 0.14 0.02 pBP3765 tag 0.68 0.05 pBP3767 tag 2C-2A 0.15 0.04 pBP3769 tag 2C-2S 0.16 0.03 pBP3771 tag 4C-2A2S 0.11 0.04

    Example 16: C-Terminal-Tagged ilvD_Sm in Isobutanol Production

    [0342] Isobutanol production was tested for isobutanologen strains. PNY1604, PNY1614, PNY1602, and PNY1612 were grown overnight in 10 ml of low glucose medium in 125 ml VWR vent cap shake flasks at 30 C. at 250 RPM in a New Brunswick I24 incubated shaker. The low glucose medium consisted of: 6.7 g/L Difco Yeast Nitrogen Base without amino acids (Becton Dickinson; Sparks, Md.), 1.92 g/L Synthetic Drop-out Medium Supplement without Uracil (Sigma; St. Louis, Mo.), 0.2% w/v ethanol, 0.3% w/v glucose, 100 mM 2-Morpholinoethanesulphonic acid (MES) buffer, adjusted to pH 5.5 with KOH. Overnight cultures were centrifuged at 3800g for 5 minutes at room temperature and cell pellets were resuspended in 2 ml of high glucose medium. High glucose medium consisted of: 6.7 g/L Difco Yeast Nitrogen Base without amino acids (Becton Dickinson; Sparks, Md.), 1.92 g/L Synthetic Drop-out Medium Supplement without Uracil (Sigma; St. Louis, Mo.), 0.1% w/v ethanol, 3.0% w/v glucose, 100 mM 2-Morpholinoethanesulphonic acid (MES) buffer, adjusted to pH 5.5 with KOH. 10 ml of high glucose medium in 125 ml VWR vent cap shake flasks was inoculated with cells to a final OD600 0.4 and grown for 5 hours at 30 C. at 250 RPM in a New Brunswick I24 incubated shaker. Cells were centrifuged at 3800g for 5 minutes at room temperature and cell pellets were resuspended in high glucose medium to an OD600 0.2. 10 ml of the culture in high glucose medium was transferred to a 20 ml serum vial (Kimble Chase; Vineland, N.J.). Serum vials were sealed and cultures were grown at 30 C. at 250 RPM in a New Brunswick I24 incubated shaker for 42 hours.

    [0343] After 42 hours, the cultures were sampled for OD600 and culture supernatants (collected using Spin-X centrifuge tube filter units, Costar Cat. No. 8169) were analyzed by HPLC (as described in Example 4). OD600, isobutanol concentration, and isobutanol molar yield are presented in Table 31.

    TABLE-US-00030 TABLE 31 Average OD600, isobutanol concentration, and isobutanol molar yield and standard deviations Isobutanol Isobutanol yield Strain OD600 (mM) (mol/mol) PNY1604/PNY1614 1.5 0.1 81.8 1.9 0.60 0.00 (control) PNY1602/PNY1612 2.1 0.1 102.5 3.1 0.62 0.02 (tagged)

    Example 17: S. mutans DHAD and S. macacae DHAD

    [0344] Plasmid and Strain Construction

    [0345] Plasmids were constructed in the 2-micron Saccharomyces cerevisiae-Escherichia coli shuttle vector pHR81 (SEQ ID NO:855; ATCC 87541).

    [0346] pBP5062 (SEQ ID NO:856) was constructed to contain a chimeric gene having the coding region of the ilvD gene from Streptococcus mutans (nt position 9644-11356) expressed from the yeast FBA1 promoter (nt 8639-9636) and followed by the FBA1 terminator (nt 7-1006) for expression of the Streptococcus mutans DHAD.

    [0347] pBP5063 (SEQ ID NO:857) was constructed to contain a chimeric gene having the coding region of the ilvD gene from Streptococcus macacae codon optimized for expression in Saccharomyces cerevisiae (nt position 9644-11356) expressed from the yeast FBA1 promoter (nt 8639-9636) and followed by the FBA1 terminator (nt 7-1006) for expression of the Streptococcus macacae DHAD.

    [0348] BY4741 (ATCC 201388) and BY4741 fra2 (Thermo Scientific Open Biosystems Yeast Knock Out Clone) were transformed using a Frozen-EZ Yeast Transformation II kit (Zymo Research) with pHR81, pBP5062, and pBP5063 and transformants were selected on agar plates containing synthetic complete media lacking uracil supplemented with 2% glucose at 30 C. Three transformants were selected for each plasmid transformation.

    DHAD Activity

    [0349] Strains were grown overnight in synthetic complete media lacking uracil supplemented with 2% glucose (Teknova). Overnight cultures were sub-cultured to an OD600 0.4 and grown in 25 ml synthetic complete media lacking uracil supplemented with 2% glucose (Teknova) in 250 ml Erlenmeyer vent cap flasks (VWR) at 30 C. 250 RPM in a New Brunswick I24 incubated shaker for 5.5 hours. Cultures were centrifuged at 3800g for 5 minutes at 4 C. The pellets were washed with cold 50 mM HEPES pH 6.8 and then centrifuged at 3800g for 5 minutes at 4 C. Cell pellets were frozen on dry ice and stored at 80 C. until they were assayed for DHAD activity.

    [0350] For DHAD activity measurements the frozen yeast cells were thawed, resuspended in 0.1 M K-Hepes pH 6.8 containing 10 mM MgCl2 and a protease inhibitor cocktail (Roche, Catalog #11873580001), and then broken by bead beating. The broken cells were centrifuged to remove the cell debris and generate the yeast crude extract. Protein concentrations (mg/ml) of extracts were measured with the Pierce Coomassie Plus (Bradford) Protein Assay (Catalog #23236, Thermoscientific). DHAD enzyme activities were measured spectrophotometrically in an end point assay using the 2,4-dinitrophenylhydrazine (2,4-DNPH) method as described in Flint, D. H. and M. H. Emptage, J. Biol. Chem. 263:3558-64, 1988, with modifications. The assay buffer contained 0.1 M Tris pH 8.0, 10 mM MgCl2, and 0.5 mM TPP. Yeast extracts were diluted in assay buffer. Sufficient (R)-2,3-dihydroxyisovaleric acid was added to assay buffer so that the final concentration in the assay was 10 mM. In each assay, an enzyme containing solution and sufficient substrate containing buffer were mixed so that the final volume was 300 ul. Assay mixtures were incubated at 37 C. for 20 minutes. At five minute intervals, a 60 ul aliquot of each reaction was mixed with 70 ul of a saturated solution of 2,4-DNPH in 1 N HCl. Following a 30 minute incubation at room temperature, 70 ul of 4 N KOH in ethanol was then added to the solution, followed by brief mixing. The absorbance of the mixture was read at 540 nm with a Spectra Max384 Plus plate reader (Molecular Devices, Sunnyvale, Calif.). A standard curve containing 0 mM to 1.33 mM -ketoisovalerate was employed to calculate enzyme activities (units per milliliter, U/ml) for the conversion of (R)-2,3-dihydroxyvalerate to -ketoisovalerate in the assays. DHAD specific activities (units per milligram, U/mg) were determined from enzyme activities (U/ml) and protein concentrations (mg/ml) measured for each sample.

    [0351] DHAD activities are shown in FIG. 14 for the BY4741 strain background and in FIG. 15 for the BY4741fra2 strain background for control vector-transformations (vector), for S. mutans ilvD (ilvD_S. mutans), and S. macacae ilvD (ilvD_S. macacae). The DHAD activity for each construct is the average of the activities for the three transformants for each plasmid.

    Example 18: Plasmid Construction for Expression of C-Terminal Deletion Variants of Dehydroxy-Acid Dehydratase (DHAD)

    [0352] The following table provides the genotypes of the various yeast strains referenced in the following Examples.

    TABLE-US-00031 TABLE 32 Strain names and genotypes Strain Name Genotype PNY2115 MATa ura3::loxP his3 pdc5::loxP66/71 2- micron plasmid (CEN.PK2) pdc1::P[PDC1]- ALS|alsS_Bs-CYC1t-loxP71/66 pdc6::(UAS)PGK1-P[FBA1]-KIVD|Lg(y)- TDH3t-loxP71/66 adh1::P[ADH1]-ADH|Bi(y)- ADHt-loxP71/66 fra2::P[ILV5]-ADH|Bi(y)- ADHt-loxP71/66 gpd2::loxP71/66 PNY1566 MATa ura3::loxP pdc5::loxP66/71 2-micron plasmid (CEN.PK2) pdc1::P[PDC1]- ALS|alsS_Bs-CYC1t-loxP71/66 pdc6::(UAS)PGK1-P[FBA1]-KIVD|Lg(y)- TDH3t-loxP71/66 adh1::P[ADH1]-ADH|Bi(y)- ADHt-loxP71/66 fra2::P[ILV5]-ADH|Bi(y)- ADHt-loxP71/66 gpd2::loxP71/66 PNY1603 and PNY1566 with plasmid pLH691 containing PNY1613 (P[ILV5]-KARI|ilvC_Ll-ILV5t P[TEF1(M7)]- DHAD|ilvD_Sm_9-FBA1t) PNY1604 and PNY1566 with plasmid pLH804 containing PNY1614 (P[ILV5]-KARI|ilvC_Ll-ILV5t P[TEF1(M7)]- DHAD|ilvD_Sm-FBA1t)

    [0353] Plasmids were constructed in a 2-micron based Saccharomyces cerevisiae-Escherichia coli shuttle vector.

    pLH804IlvD_Sm

    [0354] pLH804 (SEQ ID NO:591) was constructed to contain a chimeric gene having the coding region of the ilvD gene from Streptococcus mutans (nucleotide (nt) position 5356-3644) expressed from the yeast TEF1 mutant 7 promoter (nt 5766-5366; Nevoigt et al., Applied and Environmental Microbiology, 72:5266, 2006) and followed by the FBA1 terminator (nt 3632-3320) for expression of DHAD, and a chimeric gene having the coding region of the K9JB4P mutant ilvC gene from Anaeropstipes cacae (nt 1628-2659) expressed from the yeast ILV5 promoter (nt 434-1614) and followed by the ILV5 terminator (nt 2673-3307) for expression of ketol-acid reductoisomerase (KARI), described, for example, in PCT App. Pub. No. WO2012/12955, which is incorporated by reference herein.

    pLH691IlvD_Sm 9

    [0355] pLH691 (SEQ ID NO:590) was constructed to contain a chimeric gene having the coding region of the ilvD gene from Streptococcus mutans (nt position 5329-3644) with the C-terminal 9 amino acids deleted, expressed from the yeast TEF1 mutant 7 promoter (nt 5739-5339; Nevoigt et al., Applied and Environmental Microbiology, 72:5266, 2006), and followed by the FBA1 terminator (nt 3632-3320) for expression of DHAD, and a chimeric gene having the coding region of the Anaerostipes caccae ilvC variant K9JB4P (nt 1628-2659) expressed from the yeast ILV5 promoter (nt 434-1614) and followed by the ILV5 terminator (nt 2673-3307) for expression of KARI.

    Example 19: Construction of Yeast Strains PNY1566, PNY1603, PNY1604, PNY1613, and PNY1614

    [0356] To obtain PNY0865, PNY0827 was sporulated using standard methods (Codn A C, Gasent-Ramrez J M, Bentez T. Factors which affect the frequency of sporulation and tetrad formation in Saccharomyces cerevisiae baker's yeast. Appl Environ Microbiol. 1995). After the formation of asci (as observed by microscopy), a 100 ul aliquot of cells was resuspended in 100 ul of 1 M sorbitol and treated with 5 U of zymolyase (Zymo Research, Orange Calif.) at 37 C. for 15 min. Resulting tetrads were spread on YPD medium and dissected using a micromanipulator (Singer Instruments, Somerset UK), and the single-spore isolates were grown at 30 C. for 3 d to form colonies. One tetrad with four viable spores was characterized further. The mating type of the single-spore isolates was determined by PCR as described (Huxley, C., E. D. Green and I. Dunham (1990). Rapid assessment of S. cerevisiae mating type by PCR. Trends Genet 6(8): 236). One spore isolate, of mating type MAT, was designated PNY0865.

    [0357] PNY2115 was restored back to a histidine prototroph. The HIS3 coding sequence and 500 base pairs (bp) upstream and downstream of the coding sequence were amplified from the haploid PNY0865. PNY2115 was transformed with the resulting PCR product and transformants were selected on agar plates containing synthetic complete media lacking histidine supplemented with 1% ethanol at 30 C. A PNY2115 HIS3+ isolate was designated PNY1566.

    [0358] PNY1566 was transformed with pLH804 (control ilvD_Sm) (SEQ ID NO:591) and transformants were selected on agar plates containing synthetic complete media lacking uracil supplemented with 1% ethanol at 30 C. Two transformants were selected and designated PNY1604 and PNY1614. PNY1566 was transformed with pLH691 (9 ilvD_Sm)(SEQ ID NO:590) and transformants were selected on agar plates containing synthetic complete media lacking uracil supplemented with 1% ethanol at 30 C. Two transformants were selected and designated PNY1603 and PNY1613.

    Example 20: DHAD Activity of C-Terminal Deletion Strains

    [0359] PNY1603, PNY1613, PNY1604, and PNY1614 were grown overnight in 12 ml of low glucose medium in 125 ml VWR vent cap shake flasks at 30 C. at 250 RPM in a New Brunswick I24 incubated shaker. The low glucose medium consisted of: 6.7 g/L Difco Yeast Nitrogen Base without amino acids (Becton Dickinson; Sparks, Md.), 1.92 g/L Synthetic Drop-out Medium Supplement without Uracil (Sigma; St. Louis, Mo.), 0.2% weight per volume (w/v) ethanol, 0.3% w/v glucose, 100 mM 2-Morpholinoethanesulphonic acid (MES) buffer, adjusted to pH 5.5 with KOH. Overnight cultures were centrifuged at 3800g for 5 minutes at room temperature and cell pellets were resuspended in 1 ml of high glucose medium. High glucose medium consisted of: 6.7 g/L Difco Yeast Nitrogen Base without amino acids (Becton Dickinson; Sparks, Md.), 1.92 g/L Synthetic Drop-out Medium Supplement without Uracil (Sigma; St. Louis, Mo.), 0.1% w/v ethanol, 3.0% w/v glucose, 100 mM 2-Morpholinoethanesulphonic acid (MES) buffer, adjusted to pH 5.5 with KOH. 15 ml of high glucose medium in 125 ml VWR vent cap shake flasks was inoculated with cells to a final OD600 0.4 and grown for 5 hours at 30 C. at 250 RPM in a New Brunswick I24 incubated shaker. Cells were again centrifuged at 3800g for 5 minutes at room temperature and cell pellets were resuspended in 2 ml of high glucose medium. 30 ml of high glucose medium in 60 ml serum vials (Kimble Chase; Vineland, N.J.) was inoculated with resuspended cells to a final OD600 of 0.15. Serum vials were sealed and cultures were grown at 30 C. at 250 RPM in a New Brunswick I24 incubated shaker for 20 hours. Cultures were centrifuged at 3800g for 5 minutes at 4 C. The pellets were washed with cold 50 mM HEPES pH 6.8 and then centrifuged at 3800g for 5 minutes at 4 C. Cell pellets were frozen on dry ice and stored at 80 C. until they were assayed for DHAD activity.

    [0360] To assay for DHAD activity, frozen yeast cells were thawed, resuspended in 0.1 M K-Hepes pH 6.8 containing 10 mM MgCl.sub.2 and a protease inhibitor cocktail (Roche, Catalog #11873580001), and then broken by bead beating. The broken cells were centrifuged to remove the cell debris and generate the yeast crude extract. Protein concentrations (mg/ml) of extracts were measured with the Pierce Coomassie Plus (Bradford) Protein Assay (Catalog #23236, Thermo Scientific). DHAD enzyme activities were measured spectrophotometrically in an end point assay using the 2,4-dinitrophenylhydrazine (2,4-DNPH) method as described in Flint, D. H. and M. H. Emptage, J. Biol. Chem. 263:3558-64, 1988, with modifications. The assay buffer contained 0.1 M K-Hepes pH 6.8 and 10 mM MgCl.sub.2. Yeast extracts were diluted in assay buffer. Sufficient (R)-2,3-dihydroxyisovaleric acid was added to assay buffer so that the final concentration in the assay is 10 mM. In each assay, an enzyme containing solution and sufficient substrate containing buffer are mixed so that the final volume is 300 ul. Assay mixtures were incubated at 30 C. for 20 minutes. At five minute intervals, a 60 ul aliquot of each reaction was mixed with 70 ul of a saturated solution of 2,4-DNPH in 1 N HCl. Following a 30 minute incubation at room temperature, 70 ul of 4 N KOH in ethanol was then added to the solution, followed by brief mixing. The absorbance of the mixture was read at 540 nm with a Spectra Max384 Plus plate reader (Molecular Devices, Sunnyvale, Calif.). A standard curve containing 0 mM to 1.33 mM -ketoisovalerate was employed to calculate enzyme activities (units per ml, or U/ml) for the conversion of (R)-2,3-dihydroxyvalerate to -ketoisovalerate in the assays. DHAD specific activities (units per mg, or U/mg) were determined from enzyme activities (U/ml) and protein concentrations (mg/ml) measured for each sample.

    [0361] Strains PNY1604 and PNY1614 containing the control ilvD_Sm had an average DHAD activity of 0.32 (U/mg). See FIG. 16. Strains PNY1603 and PNY1613 containing the 9 ilvD_Sm had an average DHAD activity of 0.43 (U/mg). See FIG. 16.

    Example 21: Isobutanol Production with ilvD_Sm 9

    [0362] Isobutanol production was tested for isobutanologen strains. PNY1604, PNY1614, PNY1603, and PNY1613 were grown overnight in 10 ml of low glucose medium in 125 ml VWR vent cap shake flasks at 30 C. at 250 RPM in a New Brunswick I24 incubated shaker. The low glucose medium consisted of: 6.7 g/L Difco Yeast Nitrogen Base without amino acids (Becton Dickinson; Sparks, Md.), 1.92 g/L Synthetic Drop-out Medium Supplement without Uracil (Sigma; St. Louis, Mo.), 0.2% w/v ethanol, 0.3% w/v glucose, 100 mM 2-Morpholinoethanesulphonic acid (MES) buffer, adjusted to pH 5.5 with KOH. Overnight cultures were centrifuged at 3800g for 5 minutes at room temperature and cell pellets were resuspended in 2 ml of high glucose medium. High glucose medium consisted of: 6.7 g/L Difco Yeast Nitrogen Base without amino acids (Becton Dickinson; Sparks, Md.), 1.92 g/L Synthetic Drop-out Medium Supplement without Uracil (Sigma; St. Louis, Mo.), 0.1% w/v ethanol, 3.0% w/v glucose, 100 mM 2-Morpholinoethanesulphonic acid (MES) buffer, adjusted to pH 5.5 with KOH. 10 ml of high glucose medium in 125 ml VWR vent cap shake flasks was inoculated with cells to a final OD600 0.4 and grown for 5 hours at 30 C. at 250 RPM in a New Brunswick I24 incubated shaker. Cells were centrifuged at 3800g for 5 minutes at room temperature and cell pellets were resuspended in high glucose medium to an OD600 0.2. 10 ml of the culture in high glucose medium was transferred to a 20 ml serum vial (Kimble Chase; Vineland, N.J.). Serum vials were sealed and cultures were grown at 30 C. at 250 RPM in a New Brunswick I24 incubated shaker for 42 hours.

    [0363] After 42 hours, the cultures were sampled for OD600 and culture supernatants (collected using Spin-X centrifuge tube filter units, Costar Cat. No. 8169) were analyzed by HPLC (as described in Example 4). OD600, isobutanol concentration, and isobutanol molar yield are presented in Table 33.

    TABLE-US-00032 TABLE 33 Average OD600, isobutanol concentration, and isobutanol molar yield and standard deviations Isobutanol Isobutanol Strain OD600 (mM) yield (mol/mol) PNY1604/PNY1614 1.5 0.1 81.8 1.9 0.60 0.00 (control) PNY1603/PNY1613 2.0 0.1 81.9 4.9 0.60 0.01 (9)

    Example 22: Plasmid Construction for Expression of C-Terminal Deletion Variants of Dehydroxy-Acid Dehydratase (DHAD)

    [0364] Vector derived from pHR81 (ATCC 87541) was used for expressing wild type (WT) and mutant DHAD from S. mutans under the control of FBA promoter. Vector pHR81 FBA-IlvD(Sm) (SEQ ID NO:858) contained WT DHAD. In this vector, the FBA promoter was located in the region from nucleotides (nt) 7626 to 8623. The IlvD gene was located from nt 8631 to 10343, flanked by the restriction enzyme sites for SpeI and NotI. For the expression of the IlvD protein containing a nine amino acid deletion from the C-terminus, vector pHR81 FBA-IlvD(Sm)9 was used (SEQ ID NO:859). In this vector, the IlvD gene with deletion was located in the region from nt 9644 to 11332, flanked by the restriction enzyme sites for SpeI and NotI. The FBA promoter was located from nt 8639 to 9636.

    Example 23: DHAD Activity of C-Terminal Deletion Strains

    [0365] Vectors pHR81 FBA-IlvD(Sm) and pHR81 FBA-IlvD(Sm)9 were transformed into yeast strain BY4741 (ATCC 201388). Competent cells were prepared with a Frozen Yeast Transformation kit (Zymo Research, Irvine, Calif.). The transformants were selected on plates with complete synthetic yeast growth medium minus Ura (Teknova, Hollister, Calif.). Growth on liquid medium was carried out by adding 5 ml of an overnight culture into 100 ml medium in a 250 ml flask. Cells from 80 ml culture were harvested by centrifugation (4,000 rpm for 10 min at 4 C.) and washed with 10 ml TM8 buffer (50 mM Tris, pH 8.0, 10 mM MgSO.sub.4) stored at 4 C. The cells were resuspended in 1 ml of TM8 and transferred to lysing matrix tubes with 0.1 mm silica spheres (MP Biomedicals, Solon, Ohio). The cells were broken with a beads beater (4 with 30 seconds each). The crude extract was obtained by centrifugation with a table top microfuge at 12,000 rpm at 4 C. for 30 minutes. The supernatants were removed and stored on ice until assayed for DHAD activity as described above. It was found that the DHADs assayed herein were stable in crude extracts kept on ice for a few hours. DHAD activity was also preserved when samples were frozen in liquid N.sub.2 and stored at 80 C. Results from enzymatic measurement (FIG. 17) showed an about 60% increase in DHAD activity with the IlvD enzyme having a nine amino acid deletion at the C-terminus (pHR81 FBA-IlvD(Sm)9) as compared to DHAD activity obtained with the control DHAD enzyme (pHR81 FBA-IlvD(Sm)).

    Example 24: Site Directed Mutagenesis of C-Terminal Tagged S. mutans DHAD

    [0366] C-terminal-tagged versions of variants in Example 2 were prepared by site directed mutagenesis of C-terminal tagged S. mutans DHAD. Site directed mutagenesis of performed as described in Example 2, with modifications.

    [0367] For the P378A substitution, the mutagenesis reaction contained 1 ul pLH689 (50 ng), 1 ul P2A1 mix (10 uM each primer), 1 ul dNTP mix, 1.5 ul Quiksolution, 5 ul of 10 buffer, 1 ul QuikChange Lightning Enzyme, and 39.5 ul of ddH.sub.2O.

    [0368] For the G383S substitution, the mutagenesis reaction contained 1 ul pLH689 (50 ng), 1 ul G2S2mix (10 uM each primer), 1 ul dNTP mix, 1.5 ul Quiksolution, 5 ul of 10 buffer, 1 ul QuikChange Lightning Enzyme, and 39.5 ul of ddH.sub.2O.

    [0369] For the L385F substitution, the mutagenesis reaction contained 1 ul pLH689 (50 ng), 1 ul L2F3mix (10 uM each primer), 1 ul dNTP mix, 1.5 ul Quiksolution, 5 ul of 10 buffer, 1 ul QuikChange Lightning Enzyme, and 39.5 ul of ddH.sub.2O.

    [0370] For the L385V substitution, the mutagenesis reaction contained 1 ul pLH689 (50 ng), 1 ul L2V4mix (10 uM each primer), 1 ul dNTP mix, 1.5 ul Quiksolution, 5 ul of 10 buffer, 1 ul QuikChange Lightning Enzyme, and 39.5 ul of ddH.sub.2O.

    [0371] For the I387V substitution, the mutagenesis reaction contained 1 ul pLH689 (50 ng), 1 ul I2V5mix (10 uM each primer), 1 ul dNTP mix, 1.5 ul Quiksolution, 5 ul of 10 buffer, 1 ul QuikChange Lightning Enzyme, and 39.5 ul of ddH.sub.2O.

    [0372] For the I387M substitution, the mutagenesis reaction contained 1 ul pLH689 (50 ng), 1 ul I2M6 mix (10 uM each primer), 1 ul dNTP mix, 1.5 ul Quiksolution, 5 ul of 10 buffer, 1 ul QuikChange Lightning Enzyme, and 39.5 ul of ddH.sub.2O.

    [0373] For the L388I substitution, the mutagenesis reaction contained 1 ul pLH689 (50 ng), 1 ul L2I7mix (10 uM each primer), 1 ul dNTP mix, 1.5 ul Quiksolution, 5 ul of 10 buffer, 1 ul QuikChange Lightning Enzyme, and 39.5 ul of ddH.sub.2O.

    [0374] For the L388M substitution, the mutagenesis reaction contained 1 ul pLH689 (50 ng), 1 ul L2M8mix (10 uM each primer), 1 ul dNTP mix, 1.5 ul Quiksolution, 5 ul of 10 buffer, 1 ul QuikChange Lightning Enzyme, and 39.5 ul of ddH.sub.2O.

    [0375] The following conditions were used for the reactions: The starting temperature was 95 C. for 2 min followed by 18 heating/cooling cycles. Each cycle consisted of 95 C. for 20 sec, 60 C. for 10 sec, and 68 C. for 10 min. At the completion of the temperature cycling, the samples were incubated at 68 C. for 5.0 min and then held awaiting sample recovery at 4 C. 2 l of the Dpn I was added to each reaction and the mixtures were incubated for 30 min at 37 C.

    TABLE-US-00033 TABLE 34 Prepared Variants of C-terminal Tagged S. mutans DHAD Variant Nuc Seq ID AA Seq ID Substitution 689-P2A1 860 861 P378A 689-G2S2 862 863 G383S 689-L2F3 864 865 L385F 689-L2V4 866 867 L385V 689-I2V5 786 787 I387V 689-I2M6 868 869 I387M 689-L2I7 870 871 L388I 689-L2M8 872 873 L388M

    Example 25: Comparison of DHAD Variant L2V4 (L385V) and L2I7 (L388I) with and without C-Terminal Tag

    [0376] Isobutanol-producing strains containing DHAD variant L2V4 (L385V) with and without a C-terminal tag were constructed and evaluated for isobutanol production using the serum vial procedure described in Example 14. These strains were designated PNY2318 (with tag) and PNY2310 (without tag) and are further described below.

    [0377] PNY2310 was generated by transforming strain PNY2145 (Example 1) with plasmids pLH804-L2V4 (Example 3) and pRS413::BiADH-kivD (Example 1). Plasmid transformants were selected by plating on synthetic complete medium lacking uracil and histidine with 1% (v/v) ethanol as the carbon source. Colonies were transferred to fresh plates by patching. After two days, cells from the patches were transferred to plates containing synthetic complete medium (minus uracil and histidine) with 2% (w/v) glucose as the carbon source. The resulting strain was designated PNY2310. PNY2318 was constructed analogously to PNY2310 except that it was transformed with pLH689-L2V4 (Example 24) instead of pLH804-L2V4. Isobutanol titer (mM) and yield (mole/mole glucose) from 38 hour samples are indicated in Table 35.

    TABLE-US-00034 TABLE 35 Comparison of isobutanol production by strains containing DHAD variant L2V4 with (PNY2318) and without (PNY2310) a C-terminal tag. For each strain, n = 2. 38 h serum vial 38 h serum vial molar titer (mM) +/ yield +/ Strain standard deviation standard deviation PNY2318 (with 68.37 +/ 0.07 0.695 +/ 0.004 C-terminal Tag) PNY2310 (without 62 +/ 2 0.674 +/ 0.003 C-terminal Tag)

    [0378] Isobutanol-producing strains containing DHAD variant L2I7 (L388I) with and without the C-terminal tag were also constructed and evaluated for isobutanol production using the serum vial procedure described in Example 14. Strains were prepared by transforming PNY2145 (Example 1) with plasmid pRS413::BiADH-kivD (Example 1) and either pLH689-L2I7 (Example 24) or pLH804-L217 (Example 3). Transformants were obtained as described above and three independent clones of each were tested. Isobutanol titer (mM) and yield (mole/mole glucose) from 40 hour samples are indicated in Table 36.

    TABLE-US-00035 TABLE 36 Comparison of isobutanol production by strains containing DHAD variant L2I7 with and without a C-terminal tag. For each genotype, n = 3. 40 h serum vial 40 h serum vial titer (mM) +/ molar yield +/ Strain Genotype standard deviation standard deviation PNY2145/pRS413::BiADH- 60 +/ 2 0.693 +/ 0.005 kivD/pLH689-L2I7 (i.e. with C- terminal Tag) PNY2145/pRS413::BiADH- 51 +/ 2 0.637 +/ 0.007 kivD/pLH804-L2I7 (i.e. without C-terminal Tag)

    [0379] While various embodiments of the present invention have been described above, it should be understood that they have been presented by way of example only, and not limitation. It will be apparent to persons skilled in the relevant art that various changes in form and detail can be made therein without departing from the spirit and scope of the invention. Thus, the breadth and scope of the present invention should not be limited by any of the above-described exemplary embodiments, but should be defined only in accordance with the following claims and their equivalents.

    [0380] All publications, patents and patent applications mentioned in this specification are indicative of the level of skill of those skilled in the art to which this invention pertains, and are herein incorporated by reference to the same extent as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated by reference.

    TABLE-US-00036 TABLE 6 HMMER2.0 [2.2 g] Program name and version NAME dhad_for_hmm Name of the input sequence alignment file LENG 564 Length of the alignment: include indels ALPH Amino Type of residues MAP yes Map of the match states to the columns of the alignment COM /app/public/hmmer/current/bin/hmmbuild -F dhad-exp_hmm dhad_for_hmm.aln Commands used to generate the file: this one means that hmmbuild (default patrameters) was applied to the alignment file COM /app/public/hmmer/current/bin/hmmcalibrate dhad-exp_hmm Commands used to generate the file: this one means that hmmcalibrate (default parametrs) was applied to the hmm profile NSEQ 8 Number of sequences in the alignment file DATE Tue Jun 3 10:48:24 2008 When was the file generated XT 8455 4 1000 1000 8455 4 8455 4 NULT 4 8455 The transition probability distribution for the null model (single G state). NULE 595 1558 85 338 294 453 1158 197 249 902 1085 142 21 313 45 531 201 The symbol emission probability distribution for the null model (G state); consists 384 1998 644 20) of K (e.g. 4 or integers. The null probability used to convert these back to model probabilities is 1/K. EVD 499.650970 0.086142 The extreme value distribution parameters and lambda respectively; both floating point values. Lambda is positive and nonzero. These values are set when the model is calibrated with hmmcalibrate. A C D E F G H I K Position in m->m m->i m->d i->m i->i d->m d->d b->m m->e L M N P Q R S T V W Y alignment 538 * 1684 1(M) 233 1296 99 1223 1477 1132 89 1122 420 1248 1757 1553 1296 464 24 190 188 838 1578 985 6 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 29 6203 7245 894 1115 701 1378 538 * 2(E) 220 1288 232 1356 1807 1016 70 1474 190 1584 775 132 1298 300 282 183 1140 1092 1872 1262 7 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 29 6203 7245 894 1115 701 1378 * * 3(K) 448 1932 1558 658 2220 1048 40 1983 1569 1938 1091 1558 1319 450 193 278 419 1552 2121 1397 8 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 29 6203 7245 894 1115 701 1378 * * 4(V) 404 498 1497 939 588 1810 640 1591 914 127 335 962 1866 562 767 868 357 1720 1169 763 9 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 29 6203 7245 894 1115 701 1378 * * 5(E) 265 1340 52 1376 1572 1189 113 1125 1345 1287 496 99 1321 505 198 218 205 597 1598 1032 10 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 29 6203 7245 894 1115 701 1378 * * 6(S) 256 397 1014 830 1841 646 862 1443 767 1740 963 568 1249 651 1007 2267 1586 862 2080 1672 11 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 29 6203 7245 894 1115 701 1378 * * 7(M) 990 889 2630 157 513 2514 1346 1309 1767 820 3683 1898 2491 1496 1799 1589 925 150 1336 1041 12 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 8(E) 588 1875 194 1536 2188 1373 59 1931 957 1890 977 904 292 393 162 483 372 1495 2070 1391 13 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 9(N) 514 1116 1207 315 447 1650 304 778 224 825 277 1457 1738 123 618 627 454 603 1186 763 14 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 10(N) 815 1190 1360 922 904 1967 797 442 670 381 1700 3009 2099 654 934 1051 791 445 1490 979 15 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 11(K) 1530 2498 1722 855 3141 2246 428 2627 2828 2404 1656 927 662 2 2047 1421 1337 2324 2357 2081 16 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 12(Y) 872 1887 861 290 1369 1801 1662 1797 325 1793 1031 893 1876 56 2219 812 780 1514 1565 2287 17 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 13(S) 830 1586 1471 1099 2717 1642 1010 2479 266 2518 1746 1065 2069 676 1822 2748 1000 1950 2597 2189 18 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 14(Q) 851 2131 775 153 2554 1735 211 2205 1908 2094 1244 386 1802 2254 974 1001 747 1819 2181 1667 19 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 15(T) 405 1258 618 100 1490 1466 1158 1121 1 1299 514 578 1607 65 433 960 1849 343 1677 1143 20 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 16(I) 1772 1325 4307 3877 1405 3993 3383 2935 3705 820 217 3632 3761 3400 3682 3260 1742 2033 2838 2525 21 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 17(T) 1018 1329 2004 1771 409 1993 1000 1256 1512 1464 966 1543 2367 1428 1638 1257 3050 1090 1012 2448 22 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 18(Q) 1509 3056 1970 44 3310 1666 896 3242 877 3158 2439 322 2123 3562 1493 1259 1550 2779 3260 2446 23 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 19(D) 1006 2199 2178 88 3159 1997 936 2974 948 2977 2174 382 1960 589 1571 1295 1157 2369 3178 2430 24 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 20(M) 445 796 1082 521 841 1643 412 403 370 692 2213 646 536 1166 698 630 660 831 1204 767 25 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 21(Q) 741 990 1025 507 1249 1551 519 720 357 1062 345 635 1739 1770 713 589 1576 1129 1559 1097 26 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 22(R) 1753 2648 2072 1047 3365 2405 452 2782 1989 2495 1773 1062 2379 2402 2643 1629 1506 2504 2397 2190 27 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 23(S) 330 1010 1820 1628 2778 1229 1652 2481 1592 2691 1841 1273 2130 1426 1834 2449 1034 1716 2961 2594 28 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 24(P) 1882 1119 2231 2302 3062 1360 2209 2710 2339 3013 2243 1676 3304 2117 2409 742 918 1916 3263 3022 29 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 25(N) 969 1230 1066 915 2593 1313 1196 2242 1033 2447 1626 3197 1850 898 1392 582 1155 1644 2736 2256 30 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 26(R) 1847 2640 2014 1161 3282 2428 579 2818 687 2553 1869 1165 2462 2447 3181 1746 1630 2555 2447 2228 31 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 27(A) 3048 932 2480 2533 3075 1200 2274 2765 2501 3071 2221 1658 1948 2205 2512 1225 739 1842 3322 3078 32 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 28(M) 2406 2296 3638 3594 1525 3105 2824 1047 3121 596 5043 3293 3425 3046 2996 2911 2552 1398 2513 2207 33 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 29(Y) 1674 1506 2863 2464 596 2872 2251 972 2024 2197 552 1986 2876 1739 1988 1987 1601 1002 95 2332 34 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 30(Y) 2013 2305 2428 1781 328 2709 654 2240 258 2064 1626 1631 2788 899 2789 2017 1896 2130 857 3434 35 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 31(A) 2822 1031 2418 2539 3226 1898 2364 2941 2626 3229 2379 1722 2026 2302 2634 654 848 1983 3415 3226 36 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 32(I) 1247 941 3569 3039 1082 3101 2185 2227 2763 766 76 2700 3050 2469 2697 2253 1322 1974 1988 1633 37 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 33(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 38 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 34(F) 1511 1236 3511 3017 2747 2982 1069 260 2651 992 2737 2407 2904 2088 2418 2099 1434 489 537 2056 39 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 35(Q) 576 1869 401 92 2232 831 173 1930 1505 1913 1042 186 1620 1653 51 482 1346 1534 2098 1490 40 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 36(D) 1352 3066 3028 1349 3303 1566 724 3141 1155 3043 2267 165 1991 354 1350 1086 1368 2659 3221 2356 41 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 37(E) 1507 3288 2042 2762 3520 515 853 3401 981 3296 2566 182 2064 503 1753 1209 1553 2895 3486 2547 42 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 38(D) 1445 2778 3529 53 3524 1590 1129 3476 1367 3459 2774 396 2156 825 2122 554 1609 2880 3582 2717 43 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 39(F) 2658 2176 4213 4000 3815 3933 1352 531 3638 1121 19 3184 3709 2820 3296 3219 2579 1037 601 403 44 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 40(D) 684 2193 1738 1460 2494 1437 249 2257 1694 2199 1308 62 1637 185 450 531 633 1808 2374 1657 45 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 41(K) 2620 2961 2461 2046 3743 2791 1570 3603 3784 3387 2839 2048 3039 1260 465 2604 2536 3331 3001 2988 46 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 42(P) 1882 1119 2231 2302 3062 1360 2209 2710 2339 3013 2243 1676 3304 2117 2409 742 918 1916 3263 3022 47 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 43(I) 1006 992 2347 1784 650 2452 1256 2372 1386 77 2213 1720 2455 2030 1490 1528 946 106 1441 1111 48 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 44(V) 1771 1603 3750 3689 2037 3050 3231 403 3479 1154 1076 3246 3399 3383 3437 2628 1917 3536 3074 2677 49 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 45(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 50 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 46(I) 1759 1303 4330 3968 1751 4051 3743 3027 3837 597 528 3729 3875 3688 3910 3369 1751 2438 3259 2819 51 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 47(V) 1736 1012 3546 3078 1377 3073 2434 2052 2843 608 331 2754 3122 2619 2855 2270 1277 2193 2333 1941 52 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 48(N) 686 1511 702 806 2927 1386 1339 2841 1264 2950 2137 2702 1979 1062 1648 2444 971 2105 3054 2475 53 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 49(M) 411 857 1800 1434 1528 1914 1202 1029 1247 1347 2989 1217 1912 1119 1444 676 1550 767 1922 1539 54 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 50(W) 782 1258 793 683 1193 346 2051 932 556 1092 441 798 1993 426 909 904 720 779 3163 1546 55 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 51(W) 1009 798 1470 935 463 1773 545 460 751 736 66 943 1904 606 1002 1604 507 322 2535 1521 56 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 52(D) 1137 2711 2125 1647 2995 1523 617 2786 528 2743 1933 150 1897 234 1165 924 2117 2331 2948 2141 57 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 53(I) 599 1102 1031 829 1522 1429 927 2119 880 1369 699 1692 1938 759 1188 799 698 689 1887 1419 58 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 54(T) 666 1412 954 984 2702 1428 1357 2418 1208 2650 1886 2293 2000 1101 1519 787 2967 1835 2866 2360 59 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 55(P) 632 1230 2074 2144 2996 1453 2116 2631 2128 2928 2213 1658 3610 2006 2221 852 1302 1931 3185 2917 60 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 56(C) 2476 5735 4102 4358 3712 2763 3545 3518 4167 3859 3569 3631 3363 4030 3832 2793 2860 3158 3464 3718 61 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 57(N) 2171 2655 1458 1748 3334 2364 2267 3943 2365 3936 3437 4205 2932 2205 2608 2224 2439 3392 3253 2909 62 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 58(M) 672 918 3119 2578 742 2668 1734 1807 2263 16 3713 2271 2704 1960 2216 1806 1058 493 1612 1306 63 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 59(H) 1525 2164 1235 1346 2509 2296 4235 3172 1516 3178 2523 1448 2541 1520 1760 1591 1741 2656 2681 2065 64 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 60(L) 2478 2009 4717 4196 568 4424 3262 1334 3887 2824 604 4085 3872 3088 3590 3717 2380 199 2217 2207 65 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 61(H) 682 2191 1015 275 2485 396 2379 2251 62 2197 1307 1826 1636 1527 480 529 641 1803 2375 1654 66 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 62(D) 575 1920 1979 184 2299 94 242 2029 114 2023 1144 120 1608 186 1063 469 1413 1605 2229 1561 67 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 63(L) 2618 2139 4597 4163 2144 4285 2334 83 3854 2690 538 3771 3806 2950 3488 3563 2505 751 1442 808 68 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 64(A) 2657 1033 2408 2532 3233 2193 2364 2950 2626 3237 2386 1719 2027 2301 2635 655 850 1988 3420 3231 69 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 65(K) 443 1857 958 270 2158 1393 66 1890 1839 442 957 36 1499 1204 132 616 382 1469 2048 1383 70 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 66(C) 605 1553 739 17 1374 1488 182 260 969 203 397 263 1573 159 691 426 331 761 1567 1032 71 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 67(A) 2327 956 3193 2728 1289 2677 2114 1664 2485 601 288 2403 2839 2263 2523 1871 1126 1617 2143 1765 72 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 68(K) 532 1656 490 1321 1891 1527 172 124 2206 1591 782 223 1619 237 106 482 464 98 1904 1326 73 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 69(H) 384 1854 936 889 2165 1363 1498 1909 1111 1866 948 1091 1464 421 131 284 342 69 2043 1364 74 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 70(G) 1823 932 2330 2313 3120 2511 2158 2865 2331 3098 2209 1563 1912 2032 2419 1138 706 1883 3328 3077 75 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 71(V) 1760 1333 4244 3789 1262 3902 3190 1495 3588 1270 96 3536 3677 3238 3534 3148 1725 2865 2654 2373 76 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 72(W) 1054 2172 1112 403 2566 1917 286 2196 2516 2095 1292 1183 1958 140 1333 959 922 1867 2591 1720 77 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 73(D) 611 1995 1525 937 2295 1400 148 2043 211 2006 1106 37 1553 1420 312 408 1235 1609 2193 1499 78 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 74(A) 2716 902 2380 2205 2799 1197 1975 2459 2081 2736 1895 1520 1895 1844 2201 1191 1299 1669 3045 2758 79 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 75(G) 1709 2833 2424 409 3781 2819 1457 3777 1728 3733 3076 739 2389 1180 2441 1557 1893 3158 3660 3038 80 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 212 2909 8150 273 2534 701 1378 * * 76(A) 2529 1119 2614 2330 1245 1983 1829 377 2042 1435 341 1937 2411 1873 2088 1266 1059 397 2063 1713 82 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 77(W) 472 361 2421 1812 298 1979 826 1164 1486 143 2485 873 2028 1185 1426 1048 412 1116 2999 454 83 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 78(P) 1198 1737 2187 2394 3665 2006 2550 3630 2743 3756 3008 2052 3474 2495 2835 1401 1593 2736 3511 3519 84 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 79(Q) 999 1075 2106 1568 726 2370 1175 83 1185 1373 218 1566 2400 2445 1340 1445 946 1441 1501 1146 85 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 80(Q) 885 779 2609 2018 481 2414 1253 1645 1736 799 1924 1827 2405 2262 1752 1484 821 802 1240 935 86 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 81(F) 3342 2776 4026 4232 4354 3545 1431 2315 4038 1801 1900 3299 3780 3350 3645 3490 3420 2566 739 349 87 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 82(G) 998 2100 120 175 2567 2528 2174 2558 587 2583 1806 1422 1966 461 1038 925 1088 2095 2657 1948 88 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 83(T) 1213 1674 2755 2906 3163 1922 2659 2698 2788 3105 2612 2311 2600 2708 2753 1463 3819 2197 3286 3156 89 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 84(I) 1286 1279 2907 2683 1446 2549 2198 3290 2407 726 534 2386 1172 2299 2437 1895 1392 283 2302 1913 90 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 85(T) 493 1105 2189 2267 3101 1880 2196 2791 2334 3081 2269 1649 2058 2099 2410 719 3135 1948 3282 3046 91 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 86(V) 1750 1296 4319 3957 1765 4038 3733 2364 3826 619 543 3716 3869 3685 3902 3354 1743 3012 3265 2817 92 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 87(S) 923 962 2348 2422 3132 1207 2248 2850 2440 3140 2285 1624 1954 2158 2477 3171 758 1896 3362 3103 93 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 88(D) 2784 3432 4016 1200 4140 2466 2197 4505 2621 4365 3956 1551 3014 2039 3232 2593 2938 4046 3710 3552 94 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 89(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 95 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 90(I) 1880 1493 4193 3724 953 3837 2980 3251 3420 257 2372 3485 3608 3005 3310 3087 1840 617 2373 2155 96 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 91(S) 2150 939 2407 2415 3075 1197 2205 2781 2384 3065 2205 1613 1936 2105 2436 2652 729 1850 3306 3049 97 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 92(M) 979 1455 1242 1122 1434 1860 1131 1171 974 1285 4091 2176 2226 1017 1187 1166 1086 1063 1929 1345 98 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 93(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 99 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 94(T) 959 1691 1249 949 2563 1747 929 2093 1282 2263 1554 995 2115 600 354 1037 3152 1726 2494 2098 100 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 95(E) 572 1860 208 2213 2107 1461 191 1808 199 116 983 127 318 1199 269 475 517 1448 2078 1441 101 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 96(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 102 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 97(M) 2406 2296 3638 3594 1525 3105 2824 1047 3121 596 5043 3293 3425 3046 2996 2911 2552 1398 2513 2207 103 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 98(R) 2097 2786 2688 1415 3622 2625 555 2964 2585 2627 1957 1318 2577 137 3015 1979 1791 2732 2469 2363 104 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 99(Y) 3615 2706 4169 4413 2626 4044 396 2535 3993 1939 1985 2747 3930 2852 3446 3296 3494 2686 347 4252 105 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 100(S) 897 1462 2333 2543 3185 1640 2474 3294 2686 3497 2780 1973 2360 2483 2703 3465 1316 2413 3310 3025 106 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 101(L) 2871 2457 4231 4103 1033 3803 3165 541 3734 3130 31 3935 3797 3286 3484 3713 2869 1136 2394 2220 107 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 102(V) 1381 1065 3714 3252 1453 3300 2646 1872 3023 615 373 2949 3287 2816 3039 2506 1346 2750 2489 2087 108 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 103(S) 897 1462 2333 2543 3185 1640 2474 3294 2686 3497 2780 1973 2360 2483 2703 3465 1316 2413 3310 3025 109 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 104(R) 2957 3022 3318 2735 3796 2998 1968 3912 846 3631 3157 2611 3280 1724 4056 3026 2913 3650 3096 3185 110 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 105(E) 1719 3572 2596 2779 3767 1632 993 3700 1241 3578 2920 234 2167 666 2090 1380 1789 3182 3742 2756 111 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 106(V) 1746 1296 4308 3946 1757 4020 3712 2190 3811 614 539 3702 3858 3667 3884 3336 1740 3098 3250 2803 112 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 107(I) 2091 1746 3971 3840 1676 3532 3289 3684 3581 659 693 3562 3674 3445 3521 3194 2146 449 2877 2493 113 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 108(A) 3438 1472 2846 3040 3287 1726 2735 2840 3028 3257 2662 2236 2447 2798 2944 1216 1387 2183 3405 3320 114 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 109(D) 2784 3432 4016 1200 4140 2466 2197 4505 2621 4365 3956 1551 3014 2039 3232 2593 2938 4046 3710 3552 115 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 110(S) 352 2942 2955 2957 2876 1254 2382 2573 2692 2927 2128 1827 2001 2405 2607 3103 778 1757 3171 2911 116 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 111(I) 2091 1746 3971 3840 1676 3532 3289 3684 3581 659 693 3562 3674 3445 3521 3194 2146 449 2877 2493 117 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 112(E) 2641 3308 896 3732 3966 2458 2043 4105 2128 4016 3555 1531 2959 1842 2560 2479 2750 3722 3563 3385 118 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 113(T) 1556 936 2493 2457 2805 1256 2159 2210 2319 2681 1932 1656 1974 2089 2352 598 3235 1547 3111 2847 119 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 114(C) 1784 2119 2013 1532 1093 1580 1089 436 1322 937 273 1093 1932 1127 1472 748 515 1585 1536 1163 120 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 115(M) 1831 2019 2596 2038 605 1979 1126 244 1727 359 2501 1655 2145 1435 1683 1106 557 1087 1153 804 121 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 116(Q) 987 2211 43 62 2833 2229 691 2616 407 2604 1797 1197 1917 2260 858 880 1045 2139 2772 2099 122 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 117(G) 2313 1042 2391 2526 3250 2601 2372 2972 2637 3257 2407 1721 2032 2310 2646 662 859 2003 3434 3247 123 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 118(Q) 914 2350 48 1661 2621 1571 2504 2400 68 2331 1486 201 1796 2646 351 754 865 1984 2463 1787 124 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 119(W) 517 1294 733 183 1062 1605 234 1037 19 1207 456 1435 1690 33 756 411 454 819 3340 1286 125 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 120(M) 410 469 2417 1828 341 2041 897 195 1513 156 3130 1534 2102 1230 1484 1117 507 954 894 2253 126 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 121(D) 2784 3432 4016 1200 4140 2466 2197 4505 2621 4365 3956 1551 3014 2039 3232 2593 2938 4046 3710 3552 127 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 122(G) 2142 930 2334 2298 3100 2237 2139 2842 2302 3074 2187 1557 1909 2010 2397 1136 701 1871 3308 3053 128 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 123(V) 1514 1144 3950 3459 1821 3487 2577 2274 3208 209 87 3112 3362 2864 3118 2680 1476 2426 2194 1786 129 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 124(V) 1743 1294 4292 3873 1511 3988 3433 2287 3712 598 319 3626 3774 3456 3716 3260 1717 2790 2931 2577 130 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 125(A) 2911 954 2808 2665 2115 1577 2196 575 2445 1646 1202 1906 2208 2218 2451 901 876 1294 2727 2394 131 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 126(I) 1764 1323 4298 3936 1668 3994 3655 3337 3783 508 462 3689 3838 3608 3835 3311 1759 1847 3164 2747 132 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 127(G) 1157 1705 2169 2375 3654 3021 2534 3611 2730 3741 2984 2024 2418 2475 2826 1361 1555 2705 3513 3509 133 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 128(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 134 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 129(C) 2476 5735 4102 4358 3712 2763 3545 3518 4167 3859 3569 3631 3363 4030 3832 2793 2860 3158 3464 3718 135 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 130(D) 2784 3432 4016 1200 4140 2466 2197 4505 2621 4365 3956 1551 3014 2039 3232 2593 2938 4046 3710 3552 136 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 131(K) 2620 2961 2461 2046 3743 2791 1570 3603 3784 3387 2839 2048 3039 1260 465 2604 2536 3331 3001 2988 137 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 132(N) 2171 2655 1458 1748 3334 2364 2267 3943 2365 3936 3437 4205 2932 2205 2608 2224 2439 3392 3253 2909 138 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 133(M) 2406 2296 3638 3594 1525 3105 2824 1047 3121 596 5043 3293 3425 3046 2996 2911 2552 1398 2513 2207 139 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 134(P) 2931 2878 3420 3706 4181 2925 3468 4621 3859 4490 4165 3491 4225 3781 3695 3182 3279 4087 3594 4064 140 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 135(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 141 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 136(A) 2180 935 2286 2196 3057 1098 2058 2796 2174 3021 2134 1516 1898 1906 2302 2146 689 1849 3256 2983 142 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 137(M) 1799 1433 4142 3579 669 3668 2608 1558 3293 1235 3799 3296 3401 2717 3088 2843 1726 1156 2002 1868 143 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 138(I) 2091 1746 3971 3840 1676 3532 3289 3684 3581 659 693 3562 3674 3445 3521 3194 2146 449 2877 2493 144 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 139(A) 3103 1036 2445 2572 3222 1051 2380 2930 2650 3226 2381 1739 2034 2327 2648 664 857 1981 3412 3228 145 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 140(M) 2325 1891 4598 4012 498 4222 3013 1242 3722 1864 3929 3855 3711 2910 3414 3439 2215 299 2076 2098 146 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 141(A) 3103 1036 2445 2572 3222 1051 2380 2930 2650 3226 2381 1739 2034 2327 2648 664 857 1981 3412 3228 147 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 142(R) 1588 2442 1399 953 3069 2171 708 2795 373 2625 1916 1858 2357 324 3294 1520 1505 2453 2523 2186 148 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 143(M) 1448 1256 3396 2819 474 3024 1923 175 2473 2225 2756 2574 2922 2063 2375 2153 952 151 1599 1410 149 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 144(N) 1662 3306 2055 78 3621 1643 1040 3622 1272 3531 2870 3477 2182 724 2071 1371 1757 3092 3633 2700 150 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 145(I) 1066 921 2828 2239 1041 2675 1601 2235 1668 455 92 2067 2692 1688 1701 1795 1024 1960 1771 1396 151 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 146(P) 2931 2878 3420 3706 4181 2925 3468 4621 3859 4490 4165 3491 4225 3781 3695 3182 3279 4087 3594 4064 152 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 147(S) 1568 940 2267 2192 3082 1101 2068 2826 2185 3049 2159 1515 1901 1915 2313 2603 694 1866 3279 3006 153 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 148(I) 1880 1492 4195 3728 963 3841 2991 3272 3425 246 2277 3490 3613 3014 3317 3092 1841 628 2385 2163 154 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 149(F) 2204 1797 3724 3473 3206 3383 628 1077 3092 746 3167 2502 3309 2372 2792 2535 2120 1245 28 2460 155 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 150(V) 1265 1028 3200 2994 1833 2150 2480 417 2771 1122 818 2349 2640 2559 2766 1464 1118 3028 2700 2325 156 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 151(Y) 3482 2868 3701 3919 238 3552 1112 3000 3638 2516 2526 3027 3772 3101 3341 3418 3527 3071 441 4711 157 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 152(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 158 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 153(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 159 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 154(T) 359 976 2225 2229 2900 1242 2074 2560 2170 2875 2064 1561 1958 1969 2247 1110 3375 1760 3152 2850 160 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 155(I) 2091 1746 3971 3840 1676 3532 3289 3684 3581 659 693 3562 3674 3445 3521 3194 2146 449 2877 2493 161 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 156(H) 861 1924 384 1010 2260 1477 1787 1974 1769 1918 1022 120 1566 362 697 417 459 1557 2073 1446 162 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 157(P) 655 1502 711 557 2204 1463 2143 2122 586 2233 1445 688 2941 560 941 855 805 1657 2369 1763 163 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 158(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 164 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 159(H) 744 2193 114 1118 2513 1512 2486 2252 1178 2183 1308 2230 1689 180 233 598 687 1823 2335 1670 165 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 160(W) 2672 2139 3850 3748 941 3611 469 1691 3306 1047 1217 2551 3534 2514 2960 2788 2577 1799 4205 3466 166 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 161(K) 386 1981 779 279 2295 1403 114 2043 2059 1991 1082 941 1536 1263 211 384 457 1602 2161 1476 167 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 162(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 168 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 163(K) 1144 2365 912 2048 2856 1912 326 2459 2267 2295 1482 556 1989 108 1334 1013 1014 2093 2324 1881 169 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 164(D) 1091 2610 2941 174 2957 1527 595 2750 1084 2696 1877 176 1885 206 1006 740 1098 2288 2880 2105 170 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 165(L) 2387 1922 4674 4155 617 4366 3250 1889 3865 2650 558 4023 3847 3098 3586 3647 2296 38 2247 2224 171 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 166(N) 1021 2427 1806 133 2870 1499 635 2647 521 2640 1825 2171 1874 255 1124 860 2122 2184 2853 2090 172 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 167(I) 1830 1390 4327 3873 1210 3994 3274 2967 3678 1259 30 3633 3730 3283 3604 3249 1791 1570 2661 2417 173 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 168(V) 1771 1603 3750 3689 2037 3050 3231 403 3479 1154 1076 3246 3399 3383 3437 2628 1917 3536 3074 2677 174 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 169(S) 897 1462 2333 2543 3185 1640 2474 3294 2686 3497 2780 1973 2360 2483 2703 3465 1316 2413 3310 3025 175 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 170(A) 2440 824 2371 2082 1993 1344 1704 1264 1899 1832 1137 1517 1946 1674 2005 1075 641 1474 2390 2055 176 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 171(F) 3342 2776 4026 4232 4354 3545 1431 2315 4038 1801 1900 3299 3780 3350 3645 3490 3420 2566 739 349 177 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 172(E) 2641 3308 896 3732 3966 2458 2043 4105 2128 4016 3555 1531 2959 1842 2560 2479 2750 3722 3563 3385 178 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 173(A) 2966 1031 2429 2551 3222 1544 2368 2934 2633 3225 2377 1727 2028 2309 2637 656 850 1980 3412 3224 179 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 174(V) 1769 1342 4255 3793 1216 3901 3162 1633 3589 1486 51 3537 3667 3214 3518 3143 1731 2692 2609 2345 180 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 175(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 181 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 176(Q) 729 2116 413 1096 2484 1587 1599 2186 1695 2094 1219 223 1698 2418 90 599 649 1770 2213 1615 182 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 177(W) 1652 1707 2340 1879 1996 2733 2013 1398 1758 1386 938 1641 2751 1364 1762 1780 1577 1325 3577 2136 183 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 178(T) 421 753 1251 704 846 1670 535 894 548 690 1 1376 1791 421 846 373 1461 858 1236 812 184 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 179(H) 1498 1593 504 15 1895 1484 2279 1559 1119 1640 810 242 1611 194 171 462 815 1231 1914 1340 185 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 180(G) 1515 2130 1298 1450 2658 3285 2212 3276 1691 3291 2638 1524 2562 1662 1925 1600 1764 2713 2804 2234 186 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 181(K) 528 2010 1346 1082 2329 1408 118 2080 1475 2018 1108 1161 1543 331 1052 394 471 1632 2181 1494 187 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 182(M) 1894 1521 4170 3679 840 3793 2866 2827 3360 375 3445 3437 3555 2902 3223 3028 1846 470 2249 2059 188 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 183(T) 670 1758 1731 141 2591 1399 691 2319 499 2384 1543 387 1786 316 1016 1576 2044 1811 2624 1981 189 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 184(E) 345 2074 925 1994 2378 1408 177 2135 922 2084 1183 38 641 264 356 444 536 1690 2261 1556 190 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 185(E) 1493 2900 93 3174 2903 1743 1987 3042 646 2957 2238 411 2146 506 1121 1272 1503 2629 2905 2134 191 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 186(D) 1293 2959 2673 2121 3219 1546 713 3043 707 2974 2191 158 1967 342 1394 1043 701 2567 3172 2311 192 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 187(F) 1137 905 3250 2707 2365 2647 1016 34 2336 1239 267 2150 2626 1861 2133 1752 1069 1461 599 1844 193 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 188(K) 479 1713 409 1031 1925 1467 1755 1650 1844 349 827 140 1556 319 75 403 411 1301 1900 843 194 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 189(G) 433 2144 52 1047 2717 2303 615 2467 442 2482 1655 1123 1828 233 995 763 923 2000 2710 2005 195 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 190(V) 1752 1320 4254 3806 1311 3916 3232 1701 3614 1188 140 3551 3693 3280 3568 3166 1718 2833 2703 2409 196 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 191(E) 1199 1750 734 2668 1820 2038 1068 1892 867 1273 897 922 2295 797 1238 1340 1197 426 2325 1789 197 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 192(C) 1182 3528 1398 620 2541 2038 358 2093 1181 2037 1272 747 2070 1553 2213 1123 1038 1817 2142 1774 198 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 193(N) 1478 2527 261 403 2011 1837 2032 2925 735 2845 2195 3635 2259 721 1085 1352 1546 2522 2307 1431 199 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 194(A) 3438 1472 2846 3040 3287 1726 2735 2840 3028 3257 2662 2236 2447 2798 2944 1216 1387 2183 3405 3320 200 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 195(C) 1220 4911 3609 3314 1440 2525 2482 1565 2922 706 544 2678 2896 2710 2836 1869 1375 379 2371 1957 201 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 196(P) 2931 2878 3420 3706 4181 2925 3468 4621 3859 4490 4165 3491 4225 3781 3695 3182 3279 4087 3594 4064 202 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 197(G) 477 1115 1983 2189 3315 3154 2272 3172 2506 3387 2522 1599 2042 2177 2583 1217 905 2130 3477 3225 203 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 198(A) 1653 1347 705 249 1969 1385 477 1629 159 1759 935 434 1285 1404 586 450 1019 1243 2070 1522 204 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 199(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 205 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 200(S) 1870 938 2270 2183 3068 1488 2056 2810 2168 3032 2144 1511 1898 1901 2300 2236 690 1857 3265 2990 206 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 201(C) 2476 custom-character 4102 4358 3712 2763 3545 3518 4167 3859 3569 3631 3363 4030 3832 2793 2860 3158 3464 3718 207 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 202(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 208 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 203(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 209 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 204(M) 2406 2296 3638 3594 1525 3105 2824 1047 3121 596 5043 3293 3425 3046 2996 2911 2552 1398 2513 2207 210 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 205(Y) 3590 2700 4146 4379 2092 4028 404 2517 3963 1928 1973 2744 3921 2845 3431 3284 3474 2669 336 4423 211 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 206(T) 1213 1674 2755 2906 3163 1922 2659 2698 2788 3105 2612 2311 2600 2708 2753 1463 3819 2197 3286 3156 212 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 207(A) 3438 1472 2846 3040 3287 1726 2735 2840 3028 3257 2662 2236 2447 2798 2944 1216 1387 2183 3405 3320 213 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 208(N) 2171 2655 1458 1748 3334 2364 2267 3943 2365 3936 3437 4205 2932 2205 2608 2224 2439 3392 3253 2909 214 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 209(T) 1213 1674 2755 2906 3163 1922 2659 2698 2788 3105 2612 2311 2600 2708 2753 1463 3819 2197 3286 3156 215 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 210(M) 2355 1988 4343 3834 504 4051 2868 105 3385 1451 4460 3680 3671 2806 3171 3327 2274 474 2039 1925 216 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 211(S) 2150 939 2407 2415 3075 1197 2205 2781 2384 3065 2205 1613 1936 2105 2436 2652 729 1850 3306 3049 217 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 212(S) 344 979 2190 2162 2959 1227 2042 2651 2116 2934 2100 1526 1941 1909 2222 2940 1775 1804 3187 2882 218 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 213(A) 3048 932 2480 2533 3075 1200 2274 2765 2501 3071 2221 1658 1948 2205 2512 1225 739 1842 3322 3078 219 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 214(I) 1924 1546 4067 3658 2312 3663 2081 3030 3367 150 99 3197 3492 2821 3179 2894 1877 293 1445 692 220 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 215(E) 2641 3308 896 3732 3966 2458 2043 4105 2128 4016 3555 1531 2959 1842 2560 2479 2750 3722 3563 3385 221 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 216(A) 2389 814 2506 2162 1696 1545 1698 499 1942 1398 813 1640 2076 1723 2027 806 1148 1559 2200 1856 222 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 217(M) 2576 2118 4725 4165 461 4430 3165 99 3811 2513 3454 4075 3839 2978 3488 3704 2457 591 2111 2145 223 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 218(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 224 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 219(M) 2313 1968 4258 3765 518 3966 2806 98 3289 1292 4523 3599 3636 2769 3097 3249 2243 457 2026 1874 225 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 220(S) 897 1462 2333 2543 3185 1640 2474 3294 2686 3497 2780 1973 2360 2483 2703 3465 1316 2413 3310 3025 226 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 221(L) 2631 2159 4786 4228 462 4506 3231 96 3878 2828 2482 4157 3880 3016 3541 3793 2509 608 2134 2182 227 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 222(P) 1501 1778 2473 2371 1710 2311 2045 1321 2060 827 1068 2173 3594 2082 2130 1799 1699 1373 2373 1942 228 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 223(Y) 1068 1670 865 836 631 1198 767 1828 1059 1914 1304 692 2203 906 1387 1136 1163 1566 1185 3670 229 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 224(S) 897 1462 2333 2543 3185 1640 2474 3294 2686 3497 2780 1973 2360 2483 2703 3465 1316 2413 3310 3025 230 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 225(S) 1172 954 2367 2422 3120 1204 2237 2835 2426 3122 2265 1621 1948 2145 2467 3107 749 1884 3349 3092 231 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 226(S) 342 975 2176 2124 2912 1229 2003 2594 2067 2878 2048 1510 1936 1866 2184 2553 2492 1773 3143 2833 232 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 227(M) 720 1440 710 343 1228 1693 2436 1209 132 1364 3099 1904 1852 183 458 776 680 1004 1540 890 233 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 228(P) 2240 1100 2241 2293 3037 1346 2188 2683 2317 2986 2210 1663 3041 2093 2391 722 895 1893 3243 2998 234 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 229(A) 2958 1235 1299 1377 2868 1345 1673 2580 1661 2843 2054 1555 1995 1468 1921 715 888 1871 3064 2630 235 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 230(E) 509 1046 884 1564 1116 1669 441 485 283 250 206 577 689 200 656 670 459 1290 1467 995 236 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 231(D) 1203 2412 2595 117 3286 1536 1057 3176 1165 3186 2436 428 2068 736 1824 2377 1366 2578 3334 2552 237 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 232(Q) 954 1983 100 971 2337 177 267 2067 81 2060 1189 125 1637 2600 418 514 597 1649 2268 1597 238 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 233(E) 2641 3308 896 3732 3966 2458 2043 4105 2128 4016 3555 1531 2959 1842 2560 2479 2750 3722 3563 3385 239 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 234(K) 2620 2961 2461 2046 3743 2791 1570 3603 3784 3387 2839 2048 3039 1260 465 2604 2536 3331 3001 2988 240 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 235(R) 377 1802 415 988 2095 1474 95 1786 1452 1785 911 135 1560 343 1555 409 431 376 1986 1375 241 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 236(D) 1083 1565 2662 244 1941 1573 679 612 527 1651 980 490 1869 358 1003 771 766 903 2208 1633 242 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 237(E) 1225 2868 1894 1948 3149 1532 671 2975 630 2902 2101 150 1935 293 1299 1884 1241 2496 3093 2248 243 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 238(C) 1375 3262 2620 2108 827 1866 1267 1631 1811 599 10 1674 2137 1531 1786 1034 790 249 1361 1010 244 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 239(E) 635 1796 1055 1761 2018 1464 263 1191 28 1767 946 148 1637 135 481 520 553 1300 2077 1441 245 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 240(E) 593 2044 252 2548 2437 1542 329 2133 151 2120 1274 244 1738 89 946 646 717 1734 2305 1686 246 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 241(S) 1884 835 1962 1576 1634 1436 1320 1041 1409 1453 781 1293 1922 1241 1606 1973 597 669 2036 1656 247 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 242(G) 2267 1043 2388 2526 3253 2642 2373 2975 2639 3260 2410 1722 2033 2311 2648 663 860 2005 3436 3250 248 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 243(R) 876 2087 829 1490 2474 1766 229 2106 1269 44 1198 424 1829 205 2225 775 768 1753 2143 1647 249 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 244(V) 2339 967 2970 2766 1878 1847 2252 32 2541 1299 918 2087 2399 2316 2545 1157 971 2345 2605 2251 250 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 245(I) 1827 1398 4307 3831 1099 3939 3142 2286 3619 1835 69 3579 3671 3177 3511 3178 1781 1918 2524 2310 251 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 246(V) 1178 1448 1943 1452 1776 2261 1140 227 1866 1260 816 1444 2448 902 540 1496 1176 2697 2161 1764 252 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 247(E) 508 1976 840 1547 2280 1393 117 2029 1400 1984 1077 1158 1531 330 253 378 454 262 2163 1471 253 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 248(M) 1703 991 2901 2342 528 2567 1550 166 2031 1544 2668 2104 2591 1715 2010 1685 1052 12 1442 1177 254 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 249(I) 1947 1516 4385 3885 916 4013 3118 2193 3656 2186 257 3656 3687 3109 3494 3250 1889 1383 2397 2258 255 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 250(E) 1322 2647 272 2491 3071 1811 576 2759 2306 2633 1854 464 2066 175 177 1144 1256 2368 2692 2140 256 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 251(K) 1395 2059 1711 1014 2215 2218 641 1709 3021 1652 2578 1075 2303 282 287 1423 1283 1603 2159 1803 257 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 252(D) 1285 2888 2677 176 3210 1189 737 3047 715 2977 2195 190 1979 2106 1379 1050 1315 2564 3161 2320 258 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 253(I) 2073 1632 4434 3975 911 4130 3238 3164 3706 1451 244 3779 3785 3187 3557 3413 2021 546 2449 2273 259 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 254(K) 1570 2144 1887 1191 2098 2363 750 1603 3034 938 1112 1231 2436 408 215 1616 1443 1580 2166 1804 260 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 255(P) 2931 2878 3420 3706 4181 2925 3468 4621 3859 4490 4165 3491 4225 3781 3695 3182 3279 4087 3594 4064 261 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 256(R) 928 1705 1507 1055 2761 1730 896 2490 44 2489 1723 1042 2102 543 2614 2258 1053 1998 2546 2158 262 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 257(D) 1280 2865 3154 175 3194 1547 743 3034 728 2971 2194 190 1979 1342 1391 553 1316 2552 3161 2317 263 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 258(I) 1997 1562 4355 3927 1042 4066 3261 3343 3654 937 97 3718 3783 3239 3555 3364 1959 702 2549 2295 264 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 259(M) 2252 1821 4572 3991 530 4164 2990 2068 3709 1993 3197 3808 3685 2916 3406 3378 2149 172 2084 2091 265 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 260(T) 1213 1674 2755 2906 3163 1922 2659 2698 2788 3105 2612 2311 2600 2708 2753 1463 3819 2197 3286 3156 266 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 261(R) 2131 2786 2704 1460 3618 2638 587 2976 1735 2645 1985 1353 2603 173 3492 2020 1828 2748 2484 2384 267 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 262(K) 1349 2635 381 2083 3083 1857 565 2750 2690 2612 1837 514 2090 161 61 1178 1271 2369 2655 2138 268 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 263(A) 2821 932 2451 2472 3065 1198 2233 2763 2434 3056 2201 1633 1940 2147 2468 1831 730 1840 3305 3055 269 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 264(F) 2063 1686 4037 3677 3437 3644 1706 2063 3359 135 67 3095 3486 2739 3127 2876 2012 83 1038 158 270 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 265(E) 2641 3308 896 3732 3966 2458 2043 4105 2128 4016 3555 1531 2959 1842 2560 2479 2750 3722 3563 3385 271 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 266(N) 1662 3306 2055 78 3621 1643 1040 3622 1272 3531 2870 3477 2182 724 2071 1371 1757 3092 3633 2700 272 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 267(A) 3438 1472 2846 3040 3287 1726 2735 2840 3028 3257 2662 2236 2447 2798 2944 1216 1387 2183 3405 3320 273 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 268(I) 1760 1307 4325 3962 1735 4042 3726 3135 3828 579 515 3722 3869 3673 3896 3359 1752 2276 3240 2806 274 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 269(T) 1428 904 2334 2158 2747 1206 1940 2392 2037 2678 1846 1504 1896 1809 2163 902 3001 1635 2999 2705 275 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 270(V) 1745 1300 4286 3858 1446 3967 3370 2358 3688 852 261 3606 3749 3403 3673 3232 1717 2643 2856 2524 276 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 271(V) 1404 1072 3766 3305 1464 3356 2696 2276 3080 616 379 3001 3325 2870 3091 2563 1344 2521 2516 2113 277 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 272(M) 866 1113 2656 2412 1322 1920 1883 487 2061 587 4451 1950 2387 1928 2078 1220 1053 498 2134 1803 278 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 273(A) 2601 957 2898 2711 1943 1740 2211 165 2487 1406 1001 2008 2320 2260 2494 1053 929 1990 2626 2279 279 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 274(L) 1171 983 3266 2733 796 2795 1888 590 2418 2001 198 2418 2816 2106 2362 1944 965 1777 1724 1426 280 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 275(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 281 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 276(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 282 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 277(S) 897 1462 2333 2543 3185 1640 2474 3294 2686 3497 2780 1973 2360 2483 2703 3465 1316 2413 3310 3025 283 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 278(T) 1213 1674 2755 2906 3163 1922 2659 2698 2788 3105 2612 2311 2600 2708 2753 1463 3819 2197 3286 3156 284 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 279(N) 2171 2655 1458 1748 3334 2364 2267 3943 2365 3936 3437 4205 2932 2205 2608 2224 2439 3392 3253 2909 285 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 280(A) 3134 934 2491 2567 3083 1203 2300 2766 2540 3082 2237 1672 1954 2240 2537 874 747 1844 3333 3093 286 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 281(V) 984 1045 3169 2909 1709 2304 2404 531 2643 988 697 2378 2722 2480 2661 1601 1504 3014 2588 2201 287 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 282(L) 2631 2159 4786 4228 462 4506 3231 96 3878 2828 2482 4157 3880 3016 3541 3793 2509 608 2134 2182 288 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 283(H) 3205 3079 2723 2890 2110 3046 5295 4135 2617 3813 3561 2886 3482 2833 2620 3291 3356 3895 2397 1681 289 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 284(L) 1623 1338 3726 3164 251 3255 1820 1373 2808 2371 514 2785 3086 2281 2613 2389 1543 161 1311 1782 290 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 285(L) 2333 1873 4640 4127 650 4326 3241 2176 3843 2519 523 3982 3833 3105 3579 3604 2247 56 2268 2230 291 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 286(A) 3438 1472 2846 3040 3287 1726 2735 2840 3028 3257 2662 2236 2447 2798 2944 1216 1387 2183 3405 3320 292 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 287(M) 1886 1507 4178 3693 877 3806 2901 3008 3380 335 3109 3451 3570 2934 3251 3044 1840 524 2288 2089 293 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 288(A) 3438 1472 2846 3040 3287 1726 2735 2840 3028 3257 2662 2236 2447 2798 2944 1216 1387 2183 3405 3320 294 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 289(H) 1490 2484 362 476 1816 1880 4320 2854 684 2770 2133 2185 2285 728 1000 1377 1550 2475 2146 1255 295 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 290(A) 2439 911 2326 2131 2811 1197 1934 2480 2011 2745 1898 1490 1888 1785 2153 1898 1073 1682 3044 2749 296 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 291(I) 2038 985 3388 2919 1320 2893 2277 2155 2677 587 297 2593 2992 2450 2697 2087 1208 1681 2229 1846 297 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 292(G) 1243 2769 311 1902 3172 1980 744 2992 697 2936 2152 1923 1974 377 1331 1030 1284 2506 3125 2308 298 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 293(V) 1738 1298 4281 3921 1737 3979 3665 1917 3774 601 528 3671 3834 3628 3843 3293 1735 3205 3215 2770 299 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 294(E) 833 2344 1092 2412 2643 1464 386 2413 146 2369 1505 96 562 29 717 666 862 1966 2562 1818 300 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 295(W) 1380 1116 3614 3026 1322 2981 1582 1966 2661 1775 556 2562 2865 2117 2424 2098 1302 187 2908 629 301 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 296(T) 350 973 2204 2178 2893 1236 2035 2561 2117 2862 2043 1536 1946 1916 2214 1618 3198 1758 3137 2831 302 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 297(L) 1443 1269 3144 2576 528 3014 1816 1945 2155 2102 508 2422 2899 1193 2133 2129 1369 50 1616 1384 303 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 298(D) 1826 3682 3559 1199 3883 1662 1073 3846 1391 3720 3110 272 2222 760 2283 1471 1913 3321 3864 2864 304 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 299(D) 2784 3432 4016 1200 4140 2466 2197 4505 2621 4365 3956 1551 3014 2039 3232 2593 2938 4046 3710 3552 305 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 300(F) 3342 2776 4026 4232 4354 3545 1431 2315 4038 1801 1900 3299 3780 3350 3645 3490 3420 2566 739 349 306 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 301(Q) 1048 2608 205 2170 2893 1535 505 2680 255 2604 1769 1814 1849 2272 789 848 1028 2228 2770 2013 307 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 302(R) 1083 1687 691 135 2058 1406 178 1755 214 1793 924 145 1553 247 1670 383 1217 1367 2031 1404 308 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 303(I) 1915 1536 4077 3667 2027 3678 2155 3137 3381 144 94 3225 3506 2848 3202 2914 1871 345 1522 791 309 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 304(R) 689 2015 494 24 2395 1582 184 2087 444 2020 1151 1161 1687 1832 2131 626 614 1684 2156 1573 310 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 305(D) 387 1967 1600 1359 2275 1391 1561 2025 282 1976 1067 25 1525 342 1024 369 443 1584 2152 1462 311 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 306(R) 1460 2315 1793 887 2832 2237 431 2288 2193 2199 1473 946 2245 20 2706 1394 1275 591 2248 1961 312 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 307(V) 941 1027 3099 2832 1692 2234 2324 470 2565 1003 695 2305 2663 2399 2587 1527 1858 2876 2536 2152 313 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 308(P) 2931 2878 3420 3706 4181 2925 3468 4621 3859 4490 4165 3491 4225 3781 3695 3182 3279 4087 3594 4064 314 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 309(V) 1090 1215 2097 1824 819 2221 2699 287 1392 1027 591 1674 2482 1446 1482 1482 1143 2879 1420 707 315 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 310(L) 2439 1972 4702 4181 588 4401 3258 1582 3881 2757 587 4061 3862 3093 3590 3689 2344 130 2230 2217 316 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 311(C) 2157 4166 3012 2973 2780 1022 2337 2398 2724 2744 1930 1786 1943 2372 2623 540 692 1624 3091 2881 317 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 312(D) 1732 3453 3468 99 3733 1645 1066 3747 1356 3641 3008 1690 2201 755 2209 1416 1833 3208 3752 2776 318 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 313(L) 2477 2023 4713 4122 1592 4329 2920 72 3835 2593 2472 3948 3754 2914 3466 3550 2350 634 1927 1830 319 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 314(K) 2620 2961 2461 2046 3743 2791 1570 3603 3784 3387 2839 2048 3039 1260 465 2604 2536 3331 3001 2988 320 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 315(P) 2931 2878 3420 3706 4181 2925 3468 4621 3859 4490 4165 3491 4225 3781 3695 3182 3279 4087 3594 4064 321 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 316(S) 897 1462 2333 2543 3185 1640 2474 3294 2686 3497 2780 1973 2360 2483 2703 3465 1316 2413 3310 3025 322 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 317(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 323 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 318(K) 2 2257 1073 374 2740 1908 278 2339 2328 2192 1373 562 1953 2273 1344 952 933 1980 2234 1799 324 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 319(Y) 3482 2868 3701 3919 238 3552 1112 3000 3638 2516 2526 3027 3772 3101 3341 3418 3527 3071 441 4711 325 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 320(M) 1559 1267 3829 3380 1103 3357 2655 805 3067 64 3046 3065 3326 2779 3011 2591 1556 2855 2312 1998 326 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 321(M) 1225 469 2256 1679 1656 1926 870 90 1396 210 2763 1424 2028 1129 1411 1008 712 154 951 586 327 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 322(T) 738 2094 84 1704 2416 1495 317 2135 61 2127 1275 163 1704 1857 405 613 1930 1734 2331 1668 328 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 323(D) 1746 3458 3540 90 3744 1650 1081 3767 1381 3662 3036 1386 2211 772 2239 1429 1850 3226 3765 2789 329 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 324(L) 2451 1983 4707 4186 582 4409 3259 1510 3884 2778 592 4069 3865 3091 3590 3698 2355 150 2226 2214 330 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 325(H) 2923 2573 2959 2926 826 3449 4553 2508 2463 2054 1948 2279 3499 2191 2397 2761 2855 2540 123 2920 331 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 326(K) 373 1957 342 1025 2297 1472 98 2018 2111 1954 1056 906 1570 352 685 424 473 1592 2105 1469 332 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 327(V) 1739 1008 3509 3043 1376 3028 2406 1765 2807 615 334 2718 3093 2585 2823 2226 1263 2376 2322 1931 333 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 328(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 334 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 329(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 335 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 330(I) 1758 1302 4331 3970 1756 4054 3748 2976 3840 603 533 3731 3877 3693 3914 3372 1750 2505 3265 2824 336 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 331(P) 2931 2878 3420 3706 4181 2925 3468 4621 3859 4490 4165 3491 4225 3781 3695 3182 3279 4087 3594 4064 337 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 332(Q) 1795 1440 730 492 2453 682 812 2151 508 2256 1426 624 1796 2666 901 590 689 1636 2510 1971 338 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 333(V) 1771 1603 3750 3689 2037 3050 3231 403 3479 1154 1076 3246 3399 3383 3437 2628 1917 3536 3074 2677 339 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 334(M) 2355 1988 4343 3834 504 4051 2868 105 3385 1451 4460 3680 3671 2806 3171 3327 2274 474 2039 1925 340 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 335(K) 2620 2961 2461 2046 3743 2791 1570 3603 3784 3387 2839 2048 3039 1260 465 2604 2536 3331 3001 2988 341 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 336(Y) 1187 974 3186 2638 117 2732 1255 1905 2270 73 1977 2217 2699 1882 2144 1841 1124 71 907 3254 342 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 337(L) 2871 2457 4231 4103 1033 3803 3165 541 3734 3130 31 3935 3797 3286 3484 3713 2869 1136 2394 2220 343 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 338(L) 2871 2457 4231 4103 1033 3803 3165 541 3734 3130 31 3935 3797 3286 3484 3713 2869 1136 2394 2220 344 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 339(K) 864 1785 860 366 2128 1763 407 1612 2624 1800 1045 629 1900 28 62 851 805 1127 2064 1581 345 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 340(N) 602 1686 275 1008 1926 1415 1528 1618 244 1673 815 1897 1530 299 244 371 391 322 1934 1306 346 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 341(G) 1709 2639 1362 690 3785 3257 1671 3805 1946 3792 3137 980 2480 1424 2576 1630 1936 3150 3628 3155 347 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 342(F) 942 799 2828 2226 1797 2476 1269 1109 581 1793 516 1952 2453 1557 1815 1558 875 52 1138 794 348 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 343(L) 2451 1983 4707 4186 582 4409 3259 1510 3884 2778 592 4069 3865 3091 3590 3698 2355 150 2226 2214 349 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 344(H) 3205 3079 2723 2890 2110 3046 5295 4135 2617 3813 3561 2886 3482 2833 2620 3291 3356 3895 2397 1681 350 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 345(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 351 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 346(D) 2784 3432 4016 1200 4140 2466 2197 4505 2621 4365 3956 1551 3014 2039 3232 2593 2938 4046 3710 3552 352 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 347(C) 774 4452 2162 1688 1962 1478 1302 1474 944 1796 1088 1351 1979 1147 1684 732 719 1116 2225 1881 353 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 348(L) 2387 1922 4674 4155 617 4366 3250 1889 3865 2650 558 4023 3847 3098 3586 3647 2296 38 2247 2224 354 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 349(T) 1213 1674 2755 2906 3163 1922 2659 2698 2788 3105 2612 2311 2600 2708 2753 1463 3819 2197 3286 3156 355 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 350(C) 1489 2972 4007 3563 1524 3541 2939 2612 3350 617 413 3224 3470 3129 3335 2770 1475 2269 2657 2248 356 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 351(T) 364 979 2232 2250 2904 1245 2090 2559 2191 2881 2075 1571 1964 1991 2260 905 3428 1762 3159 2858 357 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 352(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 358 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 353(K) 1716 2632 2004 1008 3336 2379 444 2764 2775 2484 1756 1035 2357 2151 1811 1592 1477 2481 2391 2172 359 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 354(T) 1213 1674 2755 2906 3163 1922 2659 2698 2788 3105 2612 2311 2600 2708 2753 1463 3819 2197 3286 3156 360 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 355(V) 1771 1339 4275 3816 1235 3919 3194 2139 3617 1520 66 3558 3681 3244 3547 3164 1733 2390 2634 2369 361 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 356(A) 3438 1472 2846 3040 3287 1726 2735 2840 3028 3257 2662 2236 2447 2798 2944 1216 1387 2183 3405 3320 362 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 357(E) 2641 3308 896 3732 3966 2458 2043 4105 2128 4016 3555 1531 2959 1842 2560 2479 2750 3722 3563 3385 363 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 358(N) 823 1917 96 1188 2187 1547 506 1711 265 1955 1191 2711 1815 144 747 757 815 1140 2297 1666 364 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 359(L) 2153 1779 4360 3884 675 3965 3012 392 3561 2726 467 3673 3662 2955 3355 3239 2102 1281 2207 2099 365 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 360(E) 1136 2084 175 2027 2436 1510 274 2147 1525 2118 1254 175 1692 152 251 593 670 1736 2296 1650 366 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 361(H) 893 1761 1357 214 2092 1387 1862 1810 229 1825 942 83 1527 293 273 640 793 1409 2050 1397 367 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 362(I) 608 458 2776 2176 1666 2202 1113 1712 1836 222 338 1782 2245 1512 1731 1292 867 1366 1036 684 368 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 363(P) 922 1912 1681 141 2123 1604 687 1787 550 187 1245 427 2677 363 1049 882 947 1524 2338 1711 369 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 364(D) 1692 3605 3364 1256 3770 1599 957 3700 1216 3569 2909 1025 2138 628 2083 1346 1761 3174 3765 2738 370 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 365(Q) 877 1646 633 499 1610 1781 505 1210 63 1648 649 558 1931 2241 360 907 814 1097 1882 1385 371 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 366(P) 648 2019 1139 203 2354 1436 285 2089 29 2086 1217 114 1965 1445 492 529 1244 1672 2300 1616 372 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 571 7108 1646 894 1115 701 1378 * * 367(R) 422 1009 851 304 1406 1496 183 740 147 894 230 440 775 21 2009 539 381 568 1136 521 373 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 23 6560 7602 894 1115 341 2249 * * 368(D) 1472 1668 1835 70 2356 1385 511 2062 246 2128 1275 318 1353 118 746 526 425 1602 2380 1752 374 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 369(G) 1044 2230 2141 100 3222 2291 982 3045 1033 3050 2258 395 1985 644 1669 858 1207 2428 3250 2493 375 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 370(Q) 2562 2904 1886 1971 3251 2661 2079 3690 1565 3469 3081 2107 3091 4371 1665 2585 2674 3411 3077 2821 376 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 371(D) 1275 2955 2862 1330 3205 1556 670 3029 1509 2936 2141 158 1955 290 1213 1025 1281 2554 3111 2272 377 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 372(V) 1738 1298 4281 3921 1737 3979 3665 1917 3774 601 528 3671 3834 3628 3843 3293 1735 3205 3215 2770 378 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 373(I) 2091 1746 3971 3840 1676 3532 3289 3684 3581 659 693 3562 3674 3445 3521 3194 2146 449 2877 2493 379 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 374(M) 584 1354 847 246 1467 1659 2505 1087 212 374 2571 449 1729 1171 1074 634 507 876 1617 1128 380 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 375(P) 910 2031 73 1195 2792 1488 794 2539 629 2588 1788 401 3005 439 1131 612 1014 2050 2815 2151 381 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 376(W) 1588 1300 3783 3197 329 3245 1926 2071 2827 1901 558 2822 3072 2297 2616 2381 1508 111 3483 1042 382 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 377(E) 1024 2640 1844 2310 2908 1498 505 2711 344 2636 1791 107 1824 1521 957 207 1011 2243 2817 2021 383 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 378(N) 826 2349 1089 227 2651 1487 341 2416 1494 2346 1475 2601 1724 1005 522 657 787 1968 2511 1791 384 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 379(P) 1932 1116 2232 2301 3058 1358 2206 2706 2336 3009 2238 1674 3274 2114 2406 739 914 1913 3260 3019 385 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 380(V) 914 773 2713 2129 712 2505 1388 1452 1084 1324 204 1926 2507 1580 1808 1591 859 1713 1424 1081 386 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 381(Y) 1484 2331 1762 887 2436 2254 420 2325 2137 2195 1475 949 2258 39 1983 1411 1295 2075 2087 2868 387 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 382(E) 1256 1890 206 1353 2196 1401 89 1930 812 1898 996 45 547 1252 162 356 414 1507 2083 1416 388 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 383(Q) 752 2272 1586 1407 2561 1448 308 2329 23 2276 1396 71 1677 1749 577 590 1569 1881 2459 1727 389 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 384(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 390 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 385(H) 964 2089 200 136 2264 1600 3833 2320 296 2338 1558 1362 1479 276 699 881 992 1924 2364 1652 391 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 386(L) 2451 1983 4707 4186 582 4409 3259 1510 3884 2778 592 4069 3865 3091 3590 3698 2355 150 2226 2214 392 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 387(Q) 1643 1017 1196 721 1189 1714 668 1336 497 907 297 823 1893 2044 794 784 569 339 1579 1135 393 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 388(I) 1760 1308 4323 3961 1730 4039 3721 3156 3825 575 512 3720 3867 3669 3893 3356 1753 2241 3236 2802 394 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 389(L) 2871 2457 4231 4103 1033 3803 3165 541 3734 3130 31 3935 3797 3286 3484 3713 2869 1136 2394 2220 395 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 390(K) 1259 2115 1267 676 970 2105 1794 2040 2549 1955 1282 808 2165 167 114 1192 1140 1801 1301 2517 396 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 391(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 397 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 392(N) 2171 2655 1458 1748 3334 2364 2267 3943 2365 3936 3437 4205 2932 2205 2608 2224 2439 3392 3253 2909 398 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 393(L) 2871 2457 4231 4103 1033 3803 3165 541 3734 3130 31 3935 3797 3286 3484 3713 2869 1136 2394 2220 399 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 394(A) 3121 934 2489 2561 3081 1203 2295 2766 2533 3080 2234 1669 1953 2234 2533 936 746 1844 3331 3090 400 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 395(E) 522 1773 240 1676 2248 1396 289 1968 50 1989 1115 174 1198 131 448 1226 677 1538 2214 1565 401 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 396(E) 1481 3230 1425 2936 3481 751 843 3354 954 3256 2520 187 2057 492 1711 1193 1527 2852 3445 2523 402 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 397(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 403 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 398(A) 2847 932 2454 2477 3066 1198 2236 2763 2439 3057 2202 1635 1940 2152 2471 1777 731 1840 3306 3056 404 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 399(V) 1771 1603 3750 3689 2037 3050 3231 403 3479 1154 1076 3246 3399 3383 3437 2628 1917 3536 3074 2677 405 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 400(A) 3438 1472 2846 3040 3287 1726 2735 2840 3028 3257 2662 2236 2447 2798 2944 1216 1387 2183 3405 3320 406 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 401(K) 2620 2961 2461 2046 3743 2791 1570 3603 3784 3387 2839 2048 3039 1260 465 2604 2536 3331 3001 2988 407 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 402(I) 1761 1312 4317 3954 1713 4027 3703 3225 3814 556 498 3712 3859 3653 3877 3344 1754 2110 3216 2787 408 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 403(S) 348 981 2200 2194 2989 1227 2073 2686 2157 2970 2136 1541 1946 1946 2253 3060 1398 1824 3217 2916 409 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 404(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 410 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 405(V) 917 809 2556 1976 827 2491 1367 1339 1455 721 94 1841 2501 1487 1710 1570 863 2038 1514 1151 411 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 406(K) 1386 2643 447 1824 3108 1893 570 2762 2860 2616 1848 552 2117 166 3 1217 1300 2388 2647 2154 412 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 407(N) 537 1563 449 36 1889 1143 307 1529 932 1655 844 1794 1658 73 356 518 516 924 1962 1392 413 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 408(P) 894 2181 369 1705 2576 1650 357 2268 243 2210 1375 330 2093 63 1619 774 835 1876 2347 1769 414 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 409(V) 419 634 1376 807 1053 1737 499 198 623 505 178 600 1807 475 475 313 360 1389 1016 1303 415 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 410(I) 1282 1082 3022 2555 2426 2683 1767 2555 2191 443 88 2038 2692 1794 2075 1793 1220 317 361 552 416 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 411(T) 499 1595 431 966 1830 1487 185 1449 1092 1574 754 207 1601 213 206 458 2067 159 1877 1296 417 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 412(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 418 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 413(P) 632 1230 2074 2144 2996 1453 2116 2631 2128 2928 2213 1658 3610 2006 2221 852 1302 1931 3185 2917 419 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 414(A) 3438 1472 2846 3040 3287 1726 2735 2840 3028 3257 2662 2236 2447 2798 2944 1216 1387 2183 3405 3320 420 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 415(R) 1454 2316 1780 878 2834 2232 428 2292 2281 2200 1473 940 2240 17 2627 1386 1270 588 2249 1960 421 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 416(V) 1771 1603 3750 3689 2037 3050 3231 403 3479 1154 1076 3246 3399 3383 3437 2628 1917 3536 3074 2677 422 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 417(F) 3342 2776 4026 4232 4354 3545 1431 2315 4038 1801 1900 3299 3780 3350 3645 3490 3420 2566 739 349 423 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 418(D) 1572 3426 2573 2447 3613 1583 879 3513 1050 3393 2684 1292 2085 535 1855 1253 1623 3000 3585 2609 424 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 419(S) 879 1989 1498 177 3045 1600 939 2843 904 2867 2046 438 1922 591 1483 2171 1044 2226 3072 2372 425 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 420(E) 2641 3308 896 3732 3966 2458 2043 4105 2128 4016 3555 1531 2959 1842 2560 2479 2750 3722 3563 3385 426 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 421(Q) 705 1925 199 2112 917 1534 288 1824 42 1842 1054 210 1709 2163 420 611 656 1502 1997 1291 427 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 422(H) 569 2048 1450 1526 2349 1405 1830 2103 181 2058 1157 37 1569 272 349 713 620 1662 2240 1537 428 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 423(C) 1626 2878 2671 2107 1264 1968 1091 233 1777 334 250 1672 2128 1459 1691 1096 529 1209 1066 704 429 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 424(M) 2042 1634 4379 3826 659 3976 2899 2765 3546 1204 3085 3605 3604 2896 3318 3183 1961 195 2135 2058 430 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 425(E) 412 2447 1356 2379 2747 1477 445 2527 243 2477 1622 107 855 36 831 730 894 2073 2668 1906 431 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 426(A) 2822 1031 2418 2539 3226 1898 2364 2941 2626 3229 2379 1722 2026 2302 2634 654 848 1983 3415 3226 432 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 427(I) 1772 1325 4307 3877 1405 3993 3383 2935 3705 820 217 3632 3761 3400 3682 3260 1742 2033 2838 2525 433 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 428(L) 875 1634 575 959 1581 1769 525 1179 135 1884 625 547 1931 1405 450 909 816 1074 1883 1383 434 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 429(A) 1705 1826 180 949 2318 1410 359 2041 53 2067 1204 1001 1652 52 561 1232 595 1609 2298 1643 435 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 430(D) 1074 2458 2381 60 2921 1927 658 2710 463 2675 1860 271 1918 276 866 915 1100 2245 2845 2124 436 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 431(K) 688 2117 785 888 2469 1529 187 2189 2380 2106 1221 162 1661 256 1134 553 619 1760 2240 1607 437 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 432(I) 2019 1582 4380 3941 1000 4086 3253 3295 3671 1100 145 3736 3783 3222 3556 3378 1976 657 2517 2289 438 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 433(Q) 490 1797 369 171 2078 1457 1762 1779 1157 1780 905 1165 1550 1798 48 396 422 725 1986 1366 439 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 434(A) 1954 1836 1733 180 2714 1429 806 2438 679 2518 1698 430 1775 448 1211 736 894 1923 2765 2117 440 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 435(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 441 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 436(D) 1736 3455 3490 97 3737 1646 1070 3753 1363 3647 3016 1602 2204 760 2218 1420 1838 3213 3756 2780 442 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 437(V) 1721 1302 4229 3874 1705 3894 3582 1607 3706 582 513 3610 3786 3559 3767 3209 1725 3294 3158 2712 443 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 438(V) 594 988 3391 2911 1164 2888 2187 845 2637 765 154 2576 2962 2387 2622 2074 1205 2800 2084 1724 444 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 439(V) 1771 1603 3750 3689 2037 3050 3231 403 3479 1154 1076 3246 3399 3383 3437 2628 1917 3536 3074 2677 445 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 440(I) 1754 1308 4295 3867 1434 3978 3377 2661 3697 862 247 3617 3754 3406 3679 3243 1725 2373 2852 2526 446 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 441(R) 2957 3022 3318 2735 3796 2998 1968 3912 846 3631 3157 2611 3280 1724 4056 3026 2913 3650 3096 3185 447 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 442(Y) 1321 1438 1994 1608 2186 527 450 1117 1481 1211 693 1178 2522 1217 1665 1518 1275 1021 198 3178 448 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 443(C) 675 2205 2544 972 572 2236 1121 1373 1671 679 261 1700 2270 1403 1668 1311 621 1601 1150 790 449 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 444(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 450 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 445(P) 2931 2878 3420 3706 4181 2925 3468 4621 3859 4490 4165 3491 4225 3781 3695 3182 3279 4087 3594 4064 451 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 446(K) 1060 2058 1088 460 2432 1917 357 1970 2801 1978 1220 632 1990 1339 367 999 946 536 2145 1717 452 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 447(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 453 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 448(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 454 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 449(P) 2931 2878 3420 3706 4181 2925 3468 4621 3859 4490 4165 3491 4225 3781 3695 3182 3279 4087 3594 4064 455 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 450(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 456 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 451(M) 2406 2296 3638 3594 1525 3105 2824 1047 3121 596 5043 3293 3425 3046 2996 2911 2552 1398 2513 2207 457 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 452(P) 1659 2241 2022 1646 3185 2242 1373 3000 450 2936 2274 1624 3435 1065 2095 1730 1750 2593 2816 2613 458 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 453(E) 2641 3308 896 3732 3966 2458 2043 4105 2128 4016 3555 1531 2959 1842 2560 2479 2750 3722 3563 3385 459 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 454(M) 2406 2296 3638 3594 1525 3105 2824 1047 3121 596 5043 3293 3425 3046 2996 2911 2552 1398 2513 2207 460 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 455(L) 2871 2457 4231 4103 1033 3803 3165 541 3734 3130 31 3935 3797 3286 3484 3713 2869 1136 2394 2220 461 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 456(K) 1368 1491 763 332 2319 1417 551 1998 1786 2068 1221 500 1721 160 470 1631 587 1532 2299 1754 462 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 457(P) 1500 1738 2514 2380 1555 2358 2022 1126 2063 1224 841 2189 3436 2061 2129 1822 1674 1231 2290 1878 463 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 458(T) 351 974 2208 2185 2894 1237 2041 2561 2125 2863 2046 1539 1948 1923 2218 1543 3230 1758 3139 2834 464 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 459(S) 897 1462 2333 2543 3185 1640 2474 3294 2686 3497 2780 1973 2360 2483 2703 3465 1316 2413 3310 3025 465 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 460(M) 2706 986 2433 2144 1502 1684 1706 700 1858 968 2744 1705 2188 1713 1932 963 862 592 2145 1794 466 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 461(I) 2103 1659 4461 3992 869 4152 3233 3082 3723 1619 290 3801 3788 3171 3557 3432 2046 487 2418 2265 467 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 462(I) 1761 1312 4317 3954 1713 4027 3703 3225 3814 556 498 3712 3859 3653 3877 3344 1754 2110 3216 2787 468 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 463(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 469 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 464(K) 1641 2033 323 914 2415 1565 296 2097 2052 2080 1233 257 1736 125 133 646 702 1707 2258 1657 470 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 465(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 471 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 466(L) 1699 1807 2268 1925 830 2795 1551 455 1225 2510 90 1958 2845 1927 1308 2067 1651 846 1841 1454 472 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 467(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 473 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 468(D) 853 2415 2115 1717 2702 1468 378 2484 1085 2417 1546 84 1732 41 699 696 824 2025 2594 1839 474 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 469(S) 892 1780 931 688 2757 1643 830 2472 1671 2492 1708 799 2018 468 365 2676 1004 1981 2598 2130 475 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 470(C) 1135 3503 3700 3406 1670 2549 2675 653 3101 916 667 2727 2925 2870 3030 1868 1288 2927 2619 2222 476 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 471(A) 2590 1035 2404 2530 3236 2290 2365 2954 2627 3240 2389 1719 2027 2302 2637 656 851 1991 3423 3234 477 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 472(L) 2632 2152 4630 4185 1767 4324 2442 61 3879 2789 563 3833 3823 2970 3513 3609 2518 738 1527 945 478 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 473(I) 2073 1632 4434 3975 911 4130 3238 3164 3706 1451 244 3779 3785 3187 3557 3413 2021 546 2449 2273 479 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 474(T) 1213 1674 2755 2906 3163 1922 2659 2698 2788 3105 2612 2311 2600 2708 2753 1463 3819 2197 3286 3156 480 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 475(D) 2784 3432 4016 1200 4140 2466 2197 4505 2621 4365 3956 1551 3014 2039 3232 2593 2938 4046 3710 3552 481 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 476(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 482 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 477(R) 2957 3022 3318 2735 3796 2998 1968 3912 846 3631 3157 2611 3280 1724 4056 3026 2913 3650 3096 3185 483 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 478(F) 3342 2776 4026 4232 4354 3545 1431 2315 4038 1801 1900 3299 3780 3350 3645 3490 3420 2566 739 349 484 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 479(S) 897 1462 2333 2543 3185 1640 2474 3294 2686 3497 2780 1973 2360 2483 2703 3465 1316 2413 3310 3025 485 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 480(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 486 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 481(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 487 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 482(T) 359 976 2225 2229 2900 1242 2074 2560 2170 2875 2064 1561 1958 1969 2247 1110 3375 1760 3152 2850 488 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 483(Y) 3402 2632 3941 4011 1064 3924 3388 2526 3541 1996 1973 2625 3821 2664 3170 3135 3280 2619 3420 3756 489 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 484(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 490 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 485(M) 2322 1904 4536 3951 2387 4112 2676 67 3649 2034 3156 3710 3633 2803 3311 3309 2204 588 1794 1586 491 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 486(V) 1771 1603 3750 3689 2037 3050 3231 403 3479 1154 1076 3246 3399 3383 3437 2628 1917 3536 3074 2677 492 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 487(V) 1771 1603 3750 3689 2037 3050 3231 403 3479 1154 1076 3246 3399 3383 3437 2628 1917 3536 3074 2677 493 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 488(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 494 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 489(H) 3205 3079 2723 2890 2110 3046 5295 4135 2617 3813 3561 2886 3482 2833 2620 3291 3356 3895 2397 1681 495 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 490(V) 1754 1297 4329 3968 1770 4053 3752 2604 3840 621 545 3728 3878 3699 3917 3370 1746 2859 3276 2829 496 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 491(A) 2587 828 2477 2155 1837 1468 1728 743 1941 1564 954 1607 2033 1725 2034 738 1178 1108 2310 1972 497 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 492(P) 2931 2878 3420 3706 4181 2925 3468 4621 3859 4490 4165 3491 4225 3781 3695 3182 3279 4087 3594 4064 498 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 493(E) 2641 3308 896 3732 3966 2458 2043 4105 2128 4016 3555 1531 2959 1842 2560 2479 2750 3722 3563 3385 499 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 494(A) 3438 1472 2846 3040 3287 1726 2735 2840 3028 3257 2662 2236 2447 2798 2944 1216 1387 2183 3405 3320 500 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 495(Y) 866 976 1863 1331 1353 2145 1318 556 1116 777 173 1242 2197 1714 1301 1173 802 888 445 2749 501 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 496(D) 417 1831 1647 1094 2065 1488 353 1618 107 1820 1019 189 1698 30 623 603 643 1629 2154 1520 502 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 497(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 503 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 498(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 504 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 499(T) 492 1190 706 181 1475 311 333 1099 81 71 509 570 1113 6 509 450 1123 835 1680 1161 505 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 500(I) 2091 1746 3971 3840 1676 3532 3289 3684 3581 659 693 3562 3674 3445 3521 3194 2146 449 2877 2493 506 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 501(A) 3103 1036 2445 2572 3222 1051 2380 2930 2650 3226 2381 1739 2034 2327 2648 664 857 1981 3412 3228 507 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 502(L) 2239 1892 3711 3400 301 3520 1210 542 2948 2564 35 2786 3395 2438 2750 2747 2165 945 573 2562 508 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 503(V) 1757 1387 4101 3681 1174 3714 3031 880 3410 1254 60 3407 3585 3094 3354 2984 1743 3014 2536 2219 509 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 504(Q) 982 2251 866 971 2711 1822 252 2340 1444 2194 1356 464 1885 2646 1632 858 863 1958 2245 1765 510 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 505(E) 1162 2771 2137 2239 3046 1526 626 2849 546 2792 1983 145 1905 242 1192 940 1396 2385 2990 2169 511 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 506(G) 1707 2684 1591 614 3783 3190 1613 3795 1887 3775 3119 915 2456 1358 2539 1610 1924 3150 3636 3124 512 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 507(D) 2784 3432 4016 1200 4140 2466 2197 4505 2621 4365 3956 1551 3014 2039 3232 2593 2938 4046 3710 3552 513 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 508(M) 473 522 1819 1236 468 1879 687 1519 996 566 1677 1154 1937 836 1131 1079 413 102 957 585 514 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 509(I) 1761 1312 4317 3954 1713 4027 3703 3225 3814 556 498 3712 3859 3653 3877 3344 1754 2110 3216 2787 515 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 510(T) 782 1467 550 1029 2202 1425 709 1791 472 1993 1203 528 1787 368 902 617 2685 1400 2333 1783 516 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 511(I) 1766 1333 4283 3923 1635 3967 3619 3388 3759 473 437 3672 3822 3576 3804 3285 1764 1695 3126 2717 517 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 512(D) 2784 3432 4016 1200 4140 2466 2197 4505 2621 4365 3956 1551 3014 2039 3232 2593 2938 4046 3710 3552 518 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 513(A) 2705 1451 1036 913 2506 1504 1143 2174 794 2337 1613 946 1993 2040 1061 809 910 1703 2633 2156 519 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 514(H) 615 1680 1444 66 1883 168 2650 1558 86 1691 891 223 1680 31 577 571 585 1267 2007 1397 520 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 515(K) 654 2006 546 42 2376 1581 133 2066 1935 1987 1107 1132 1658 1043 1058 540 1180 1660 2113 1532 521 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 516(N) 933 2085 946 284 2472 1822 253 2090 1711 76 1204 1918 1876 175 1799 841 817 1755 2132 1663 522 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 517(E) 416 987 843 1107 1070 1583 338 623 183 879 172 489 1679 94 565 544 813 265 1379 905 523 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 518(I) 2258 1804 4588 4084 706 4269 3231 2527 3807 2292 465 3923 3814 3118 3570 3544 2181 190 2303 2237 524 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 519(Q) 477 1909 958 282 2211 1389 1484 1953 285 1921 1018 32 1517 2318 225 630 559 1525 2110 1430 525 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 520(L) 2127 1743 4402 3796 1257 3918 2674 149 3492 2527 2164 3553 3509 2714 3181 3095 2019 570 1870 1818 526 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 521(N) 723 2217 958 236 2518 1466 1611 2279 1719 2217 1334 2285 1666 166 401 570 677 1837 2382 1678 527 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 522(V) 1754 1297 4330 3968 1770 4053 3752 2623 3841 620 545 3729 3878 3699 3918 3371 1746 2846 3277 2830 528 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 523(S) 1545 974 2003 1825 2867 1206 1790 2580 1788 2795 1932 1362 1826 1586 1999 2362 672 1755 3057 2721 529 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 524(D) 1776 3649 3326 1869 3838 1642 1031 3788 1322 3660 3029 245 2192 711 2201 1425 1855 3264 3821 2816 530 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 525(E) 423 2950 1944 2696 3223 1545 718 3047 715 2979 2196 161 1968 347 1403 1043 1314 2569 3177 2316 531 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 526(E) 2641 3308 896 3732 3966 2458 2043 4105 2128 4016 3555 1531 2959 1842 2560 2479 2750 3722 3563 3385 532 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 527(L) 2339 1899 4618 4042 1570 4204 2849 1440 3758 2558 676 3825 3700 2902 3418 3418 2226 382 1924 1778 533 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 528(A) 2338 1990 241 938 2395 1557 423 2061 954 2103 1286 301 1791 26 375 717 784 1691 2330 1728 534 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 529(R) 524 2098 789 146 2504 1729 1632 2153 1229 2054 1204 379 1789 1328 2313 719 724 1774 2150 1637 535 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 530(R) 2957 3022 3318 2735 3796 2998 1968 3912 846 3631 3157 2611 3280 1724 4056 3026 2913 3650 3096 3185 536 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 531(R) 1895 2713 2327 1192 3484 2502 481 2856 2144 2544 1842 1161 2458 1393 3023 1770 1619 2599 2421 2259 537 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 532(A) 2935 1714 553 857 2769 1546 1218 2333 1106 2591 1873 809 2065 934 1502 954 1103 1872 2898 2374 538 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 533(A) 1291 1874 176 1227 2177 1392 109 1909 277 1891 995 1134 1522 1248 228 361 562 1492 2090 1419 539 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 534(W) 805 687 2581 2028 138 2236 697 897 1681 421 141 1645 2282 1369 1627 1315 636 90 4479 1809 540 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 535(H) 408 1801 274 1284 2096 1385 1500 1822 1168 1802 899 33 1479 1381 102 303 595 221 1996 1339 541 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 536(Q) 650 1737 627 72 1981 1615 209 1625 1223 392 866 318 1222 2120 50 598 572 1326 1932 1394 542 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 537(P) 2931 2878 3420 3706 4181 2925 3468 4621 3859 4490 4165 3491 4225 3781 3695 3182 3279 4087 3594 4064 543 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 324 7108 2368 894 1115 701 1378 * * 538(A) 2195 924 968 546 1397 1356 583 812 365 1167 487 618 1660 1324 684 483 404 462 1703 1242 544 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 19 6804 7846 894 1115 428 1961 * * 539(P) 411 1017 1886 1616 1600 1588 1411 962 1408 495 755 1384 3156 1323 1577 847 785 783 2111 1716 545 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 540(R) 1612 2397 2037 1033 2897 2352 458 2365 2184 665 1520 1051 2334 51 2602 1545 1395 2143 2262 2014 546 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 541(Y) 712 796 2334 1883 370 2028 986 143 1607 663 131 1587 2243 1383 1656 1178 771 1114 965 3479 547 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 542(T) 527 1669 1091 27 2315 1379 443 2033 151 2081 1218 282 557 41 650 1128 2077 1576 2321 1690 548 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 543(R) 2957 3022 3318 2735 3796 2998 1968 3912 846 3631 3157 2611 3280 1724 4056 3026 2913 3650 3096 3185 549 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 544(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 550 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 545(V) 1747 1296 4310 3948 1758 4023 3716 2215 3813 615 540 3705 3860 3670 3887 3339 1741 3087 3252 2806 551 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 546(L) 2871 2457 4231 4103 1033 3803 3165 541 3734 3130 31 3935 3797 3286 3484 3713 2869 1136 2394 2220 552 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 547(A) 2404 890 1926 1629 1803 1275 1415 1282 1490 392 963 1316 1930 1328 1674 654 644 952 2187 1810 553 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 548(K) 2620 2961 2461 2046 3743 2791 1570 3603 3784 3387 2839 2048 3039 1260 465 2604 2536 3331 3001 2988 554 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 549(Y) 3621 2707 4176 4424 2950 4049 394 2539 4002 1942 1987 2749 3933 2854 3451 3299 3499 2690 349 4094 555 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 550(A) 3438 1472 2846 3040 3287 1726 2735 2840 3028 3257 2662 2236 2447 2798 2944 1216 1387 2183 3405 3320 556 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 551(H) 1741 2627 2070 1046 3303 2401 2713 2751 2478 2476 1755 1061 2375 27 2379 1621 1497 2477 2379 2161 557 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 552(L) 1014 876 2956 2408 582 2550 1529 1721 2079 2042 345 2114 2581 1775 2028 454 980 286 1414 1096 558 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 553(V) 933 842 2818 2467 1542 1870 1890 154 2226 1095 617 1932 2326 1995 2259 1126 1070 2769 2180 1826 559 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 554(S) 787 1522 1486 1172 2714 1599 1112 2500 433 2563 1791 1110 2067 796 1351 2916 989 1943 2648 2234 560 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 555(S) 326 1010 1779 1541 2691 1234 1566 2386 1486 2594 1749 1228 1196 1330 1747 2396 1967 1662 2876 2496 561 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 556(A) 3121 934 2489 2561 3081 1203 2295 2766 2533 3080 2234 1669 1953 2234 2533 936 746 1844 3331 3090 562 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 557(S) 897 1462 2333 2543 3185 1640 2474 3294 2686 3497 2780 1973 2360 2483 2703 3465 1316 2413 3310 3025 563 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 558(R) 586 1873 516 979 2188 1543 123 1869 1290 353 980 202 1622 314 1886 491 782 1495 2024 1439 564 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 559(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 565 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 560(C) 2804 3772 3185 3198 2739 1303 2462 2065 2882 2628 1924 1927 2044 2547 2727 661 799 1463 3099 2886 566 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 561(V) 1771 1603 3750 3689 2037 3050 3231 403 3479 1154 1076 3246 3399 3383 3437 2628 1917 3536 3074 2677 567 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 562(T) 1213 1674 2755 2906 3163 1922 2659 2698 2788 3105 2612 2311 2600 2708 2753 1463 3819 2197 3286 3156 568 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 563(D) 2784 3432 4016 1200 4140 2466 2197 4505 2621 4365 3956 1551 3014 2039 3232 2593 2938 4046 3710 3552 569 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 21 6715 7757 894 1115 701 1378 * * 564(F) 525 445 2202 1627 1946 2001 744 1247 1346 952 561 1079 2030 1067 1362 1067 465 338 714 230 570 * * * * * * * * * * * * * * * * * * * * * * * * * * * * 0