Monoclonal antibodies with enhanced ADCC function

09718890 ยท 2017-08-01

Assignee

Inventors

Cpc classification

International classification

Abstract

The invention concerns a method for obtaining and selecting monoclonal antibodies by an ADCC-type test, said antibodies capable of activating type III Fcy receptors and having a particular glycan structure. The inventive anti-D antibodies can be used for preventing Rhesus isoimmunization in Rh negative persons, in particular for hemolytic disease in a new-born baby or for uses such as idiopathic thrombocytopenic purpura (ITP).

Claims

1. A cell culture producing monoclonal antibodies having on the Fey glycosylation site (Asn 297, EU numbering) bi-antennary glycan structures, wherein said glycan structures of the monoclonal antibodies have a fucose content less than 55%, and wherein said monoclonal antibodies are IgG antibodies directed against an antigen and activate effector cells expressing Fc type III receptors.

2. The cell culture of claim 1, wherein the fucose content is less than 50%.

3. The cell culture of claim 2, wherein the fucose content is less than 40%.

4. The cell culture of claim 1, wherein the monoclonal antibodies cause lysis of target cells presenting the antigen greater than 60% of lysis caused by polyclonal antibodies directed against the antigen.

5. The cell culture of claim 4, wherein the antigen is rhesus D.

6. The cell culture of claim 1, wherein the monoclonal antibodies cause lysis of target cells presenting the antigen greater than 90% of lysis caused by polyclonal antibodies directed against the antigen.

7. The cell culture of claim 1, wherein the antigen is rhesus D.

8. The cell culture of claim 1, wherein the monoclonal antibodies are IgG1 antibodies.

9. The cell culture of claim 1, wherein the monoclonal antibodies are IgG3 antibodies.

10. The cell culture of claim 1, wherein said glycan structures of the monoclonal antibodies have a sialic acid content of less than 25%.

11. The cell culture of claim 1, wherein the cell culture comprises a clone produced by transfection of a cell line with a gene coding for said monoclonal antibodies.

12. The cell culture of claim 11, wherein the cell culture comprises a clone produced by transfection of a cell line deposited with the ATCC as accession number CRL-1662.

13. The cell culture of claim 1, wherein the cell culture comprises a clone isolated from a cell line transfected with a gene coding for said monoclonal antibodies.

14. The cell culture of claim 13, wherein the cell culture comprises a clone isolated from a cell line deposited with the ATCC as accession number CRL-1662 transfected with a gene coding for said monoclonal antibodies.

15. The cell culture of claim 1, wherein the fucose content is between 20% and 55%.

16. The cell culture of claim 1, wherein the fucose content is between 25% and 55%.

17. The cell culture of claim 15, wherein the fucose content is between 20% and 30%.

18. The cell culture of claim 16, wherein the fucose content is between 25% and 30%.

19. The cell culture of claim 1, wherein the antigen is an infectious disease antigen.

20. The cell culture of claim 1, wherein the antigen is a cancer antigen.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1: ADCC evaluation of F60 and T125 YB2/0 (R270). This figure represents the percentage lysis obtained as a function of the antibody concentration in the presence of 100 and 500 g/well of TEGELINE (LFB, France). A high percentage lysis is obtained for the antibodies according to the invention F60 and T125.

(2) FIG. 2: Anti-D binding to the receptor (FcRIII). A high binding index is obtained for the antibodies according to the invention F60 and T125.

(3) FIG. 3: Construction of the expression vector T125-H26 for expressing the H chain of T125.

(4) FIG. 4: Construction of the expression vector T125-K47 for expressing the L chain of T125

(5) FIG. 5: Construction of the expression vector T125-IG24 for expressing the whole antibody T125

(6) FIG. 6: ADCC inhibition in the presence of anti-FcRIII (CD16)

(7) The ADCC assay is established according to the procedure described in 3.3 in the presence of the commercial anti-CD16 3G8 (TEBU), the action of which is to block the FcRIII receptors present on the effector cells. The final concentration of 3G8 is 5 g/well (25 g/ml). A control is carried out in parallel in the absence of 3G8.

(8) The three antibodies tested are Poly-D WinRho, the antibody F60 (Pf 155 99/47) obtained according to the method described in example I, and R297 (Pf 210 01/76) obtained according to the method described in example II.

(9) Results: an inhibition is observed in the presence of 3G8, which demonstrates that the ADCC induced by the three antibodies tested is mainly FcRIII-dependent. A slightly stronger inhibition is observed in the presence of Poly-D WinRho (83% compared to 68% and 61% inhibition for F60 and 8297, respectively). This difference may be due to the presence, in the Poly-D, of non-anti-D human IgGs which will inhibit type I receptors (FCRI or CD64) and therefore act synergistically with the anti-CD16.

(10) FIG. 7: Characterization of the anti-D glycans by mass spectrometry (MS).

(11) FIG. 8: Comparison of the MS spectra for R290 and DF5.

(12) FIG. 9: Study of the glycosylation of the anti-D D31DMM by MS.

(13) FIG. 10: Preferred embodiments of antibodies having a particular glycan structure conferring FcRIII-dependent effector activity.

(14) FIG. 11: A preferred embodiment for producing an IgG1 possessing a Kappa light chain.

(15) FIG. 12: A preferred embodiment for producing an IgG3 possessing a Kappa light chain.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

Example 1: Establishing a Heterohybrid Cell Line Producing an Anti-Rh(D) Antibody

(16) 1Production of Lymphoblastoid and Heterohybrid Clones:

(17) 1.1Lymphocyte Source:

(18) The B lymphocyte donor is selected from anti-Rh(D) donors undergoing plasmapheresis, based on the activity of his or her anti-Rh(D) serum antibodies in the ADCC activity assay described in 33. After a whole blood donation, in 1998, the buffy coat fraction (leukocyte concentrate) was recovered.

(19) 1.2Immortalization of the B Lymphocytes from the Donor

(20) The peripheral blood mononuclear cells are separated from the other elements by centrifugation on Ficoll Plus (Pharmacia). They are then diluted to 10.sup.6 cell/ml in IMDM containing 20% (v/v) of fetal calf serum (FCS), to which 20% of culture supernatant of the B95-8 line (ATCC-CRL1612), 0.1 g/ml of cyclosporin A (Sandoz), 50 g/ml of gentamycin sulfate (Life Technologies) are added, and distributed into round-bottomed 96-well plates or 24-well plates (P24 Greiner). They are then placed in an incubator at 37 C., 7% CO.sub.2. After 3 weeks, the presence of anti-Rh(D) antibodies is sought by ADCC.

(21) Each one of the 16 microwells of a positive P24 plate well is transferred into a new P24 well. This enrichment is repeated after 10 to 15 days of culturing and each microwell is amplified in a P96 and then in a P24.

(22) The positive P96 wells are taken up and amplified in a flat-bottomed P24 (Nunc). After a few days of culturing, the presence of anti-Rh(D) antibodies is sought by ADCC.

(23) 1.3Enrichment by Immunorosetting (IR):

(24) The cells derived from one or more P24 wells are enriched in specific cells by the formation and separation of rosettes with papain-treated Rh(D)-positive red blood cells: one volume of red blood cells washed in 0.9% NaCl is incubated for 10 minutes at 37 C. with 1 volume of papain (Merck) solution at 1/1 000th (m/v), and then washed 3 times in 0.9% NaCl. The cells were then washed once in Hanks solution, suspended in FCS and mixed with the papain-treated red blood cells in a ratio of 1 cell to 33 red blood cells. The mixture is placed in a cone-bottomed centrifuged tube, centrifuged for 5 minutes at 80 g and incubated for one hour in melting ice. The mixture is then carefully agitated and Ficoll is deposited at the bottom of the tube for separation at 900 g for 20 minutes. The pellet containing the rosettes is hemolyzed in a solution of NH.sub.4Cl for 5 minutes and the cells are placed in culture again in a P24 containing irradiated human mononuclear cells. After approximately 1 week, the supernatants are evaluated in CELA (paragraph 3.2) and ADCC assays for the presence of anti-Rh(D) antibodies having good activity. A further cycle of enrichment is carried out if the percentage of cells forming rosettes significantly increases compared to the preceding cycle.

(25) 1.4Cloning of the Lymphoblastoid Cells:

(26) The IR-enriched cells are distributed at 5 and 0.5 cells per well in round-bottomed 96-well plates containing irradiated human mononuclear cells.

(27) After approximately 4 weeks of culturing, the supernatants from the wells containing cell aggregates are evaluated by ADCC assay.

(28) 1.5Heterofusion:

(29) The wells from cloning the EBV-transformed cells exhibiting an advantageous ADCC activity are amplified in culture and then fused with the heteromyeloma K6H6-B5 (ATCC CRL-1823) according to the standard PEG technique. After fusion, the cells are distributed, in a proportion of 210.sup.4 cells/well, into flat-bottomed P96s containing murine intraperitoneal macrophages and in a selective medium containing aminopterin and ouabain (Sigma).

(30) After 3 to 4 weeks of culturing, the supernatants of the wells containing cell aggregates are evaluated by ADCC assay.

(31) 1.6Cloning of the heterohybridomas:

(32) Cloning by limiting dilution is carried out at 4, 2 and 1 cell/well in flat-bottomed P96s. After 2 weeks, the microscopic appearance of the wells is examined in order to identify the single clones, and the medium is then renewed. After approximately 2 weeks, the supernatants of the wells containing cell aggregates are evaluated by ADCC assay.

(33) 2History of the Clones Selected:

(34) 2.1Clone producing an IgG1

(35) EBV transformation of the cells of donor d13 made it possible to select a well, designated T125 2A2, on which the following were successively carried out: 2 enrichments, 3 cycles of IR, and cloning at 5 cells/well to give 2 clones: 1) T125 2A2 (5/1)A2 from which the DNA was extracted in order to prepare the recombinant vector; 2) T125 (5/1)A2 which was fused with K6H6-B5 to give F60 2F6 and then, after 5 rounds of cloning, F60 2F6 (5) 4C4, a clone selected for constituting a cell stock prior to preparing libraries.

(36) It is an IgG1 possessing a Kappa light chain. The method is shown in FIG. 11.

(37) 2.2Clone producing an IgG3

(38) A line producing an IgG3 was prepared according to the same method as that used to prepare the antibody of IgG1 isotype. The cells of origin originate from a donation of whole blood, from a designated donor, from which the buffy coat fraction (leukocyte concentrate) was recovered.

(39) It is an IgG3 possessing a Kappa light chain. The method is shown in FIG. 12.

(40) 3Methods for Evaluating the Anti-Rh(D) Antibodies:

(41) After purification by affinity chromatography on protein A sepharose (Pharmacia) and dialysis in 25 mM Tris buffer, 150 mM NaCl, pH 7.4, the concentration of the antibody T125 is determined by the ELISA technique. The biological activity in vitro is then measured by the ADCC technique.

(42) 3.1Determination of the IgG Level and of the Isotypes by the ELISA Technique:

(43) Total IgGs

(44) Coating: anti-IgG (Calbiochem) at 2 g/ml in 0.05M carbonate buffer, pH 9.5, overnight at 4 C. Saturation: dilution buffer (PBS+1% BSA+0.05% Tween 20, pH 7.2), 1 h at ambient temperature. Washing (to be renewed at each step): H.sub.2O+150 mM NaCl+0.05% Tween 20. Dilution of the samples, in dilution buffer to approximately 100 ng/ml and of the control range made up of LFB polyvalent human IgGs prediluted to 100 ng/ml. Incubation for 2 h at ambient temperature. Conjugate: anti-IgG (Diagnostic Pasteur) diluted to 1/5 000, 2 hours at ambient temperature. Substrate: OPD at 0.5 mg/ml (Sigma) in phosphate-citrate buffer containing sodium perborate (Sigma), 10 minutes in the dark. Reaction stopped with 1N HCl, and read at 492 nm.

(45) Assaying of Kappa Chain

(46) Coating: anti-Kappa (Caltag Lab) at 5 g/ml in 0.05M carbonate buffer, pH 9.5, overnight at 4 C. Saturation: dilution buffer (PBS+1% BSA+0.05% Tween 20, pH 7.2), 1 h at ambient temperature. The washing (to be renewed at each step): H.sub.2O+150 mM NaCl+0.05% Tween 20. Dilution of the samples, in dilution buffer, to approximately 100 ng/ml and of the control range made up of the LFB monoclonal antibody AD3T1 (Kappa/gamma 3) prediluted to 100 ng/ml. Incubation for 2 h at ambient temperature. Conjugate: biotinylated anti-Kappa (Pierce) diluted to 1/1 000 in the presence of streptavidin-peroxidase (Pierce) diluted to 1/1 500, 2 hours at ambient temperature. Substrate: OPD at 0.5 mg/ml (sigma) in phosphate-citrate buffer containing sodium perborate (Sigma), 10 minutes in the dark. The reaction is stopped with 1N HCl, and read at 492 nm.

(47) 3.2Specific Assaying of Anti-D by the CELA (Cellular Enzyme Linked Assay) Technique:

(48) This method is used for specifically assaying the anti-D antibodies in particular when this involves a culture supernatant at culturing stages at which other non-anti-D immunoglobulins are present in the solution (early stages after EBV transformation).

(49) Principle:

(50) The anti-D antibody is incubated with Rhesus-positive red blood cells and then revealed with an alkaline phosphatase-labeled anti-human Ig.

(51) 100 l of Rh+ red blood cells at 10% diluted in Liss-1% BSA dilution buffer. Dilution of the samples, in dilution buffer, to approximately 500 ng/ml and of the control range made up of a purified monoclonal human anti-D IgG (DF5, LFB) prediluted to 500 ng/ml. Incubation for 45 min at ambient temperature. Washing (to be renewed at each step): H.sub.2O+150 mM NaCl. Conjugate: anti-IgG alkaline phosphatase (Jackson) diluted to 1/4 000 in PBS+1% BSA, 1 h 30 at ambient temperature. Substrate: PNPP at 1 mg/ml (sigma) in 1M diethanolamine, 0.5 mM MgCl.sub.2, pH 9.8. The reaction is stopped with 1N NaOH, and read at 405 nm.

(52) 3.3ADCC Technique

(53) The ADCC (antibody-dependent cellular cytotoxicity) technique makes it possible to evaluate the ability of the (anti-D) antibodies to induce lysis of Rh-positive red blood cells, in the presence of effector cells (mononuclear cells or lymphocytes).

(54) Briefly, the red blood cells of an Rh-positive cell concentrate are treated with papain (1 mg/ml, 10 min at 37 C.) and then washed in 0.9% NaCl. The effector cells are isolated from a pool of at least 3 buffy-coats, by centrifugation on Ficoll (Pharmacia), followed by a step of adhesion in the presence of 25% FCS, so as to obtain a lymphocyte/monocyte ratio of the order of 9. The following are deposited, per well, into a microtitration plate (96 well): 100 l of purified anti-D antibody at 200 ng/ml, 25 l of Rh+ papain-treated red blood cells (i.e. 110.sup.6), 25 l of effector cells (i.e. 210.sup.6) and 50 l of polyvalent IgG (Tegeline, LFB, for example) at the usual concentrations of 10 and 2 mg/ml. The dilutions are made in IMDM containing 0.25% FCS. After overnight incubation at 37 C., the plates are centrifuged, and the hemoglobin released into the supernatant is then measured in the presence of a substrate specific for peroxidase activity (2,7-diaminofluorene, DAF). The results are expressed as percentage lysis, 100% corresponding to total red blood cell lysis in NH.sub.4Cl (100% control), and 0% to the reaction mixture without antibody (0% control).

(55) The specific lysis is calculated as a percentage according to the following formula:

(56) ( OD sample - OD 0 % control ) 100 OD 100 % control - OD 0 % control = % ADCC

(57) The results given in FIG. 1 show the activity of the antibody produced by the heterohybrid F60 compared to those of the reference antibodies:

(58) the anti-Rh(D) polyclonal antibodies POLY-D LFB 51 and WinRhO W03 (Cangene)=positive controls

(59) the monoclonal antibody DF5 (inactive in vivo on clearance of Rh(D)-positive red blood cells (BROSSARD/FNTS, 1990, not published))=negative control

(60) the IgG1s purified (separated from the IgG3s) from the polyclonal WinRhO W03.

(61) Two concentrations of human IgGs (Tegeline LFB) are used to show that inhibition of activity of the negative control is linked to the binding of competing IgGs to the Fc type I receptors.

(62) 3.4FcRIII(CD16)-binding technique:

(63) This assay makes it possible to assess the binding of the anti-Rh(D) antibodies of IgG1 isotype to FcRIII, and in particular to differentiate IgG3 antibodies. Given the low affinity of this receptor for monomeric IgGs, prior binding of the antibodies to the D antigen is necessary.

(64) Principle:

(65) The antibody to be tested (anti-D) is added to membranes of Rh+ red blood cells coated with a microtitration plate, followed by transfected Jurkat cells expressing the FcRIII receptor at their surface. After centrifugation, the Rh+ membrane/anti-D/CD16 Jurkat interaction is visualized by a homogeneous plating of the CD16 Jurkats in the well. In the absence of interaction, the cells are, on the contrary, grouped at the center of the well. The intensity of the reaction is expressed as numbers of +.

(66) Method:

(67) 1) Incubation for 1 h at 37 C. of the anti-D antibody (50 l at 1 g/ml in IMDM) on a Capture R plate (Immunochim), and then washes in water+0.9% NaCl. Addition of CD16 Jurkat (210.sup.6 cells/ml) in IMDM+10% FCS. Incubation for 20 min at 37 C. and then centrifugation and evaluation of cell adhesion (against a control range).

(68) 2) Revelation of the anti-D bound to the Capture R plates by an ELISA-type technique using anti-human IgG-peroxidase at 1/5 000 (Sanofi Diagnostics Pasteur) after having lysed the CD16 Jurkat cells with 0.2M Tris-HCl, 6M urea, pH 5.3-5.5. OPD revelation and then reading of optical density (O.D.) at 492 nm.

(69) Expression of results: an arbitrary value of 0 to 3 is allotted as a function of the binding and of the plating of the CD16 Jurkat cells. These values are allotted at each OD interval defined (increments of 0.1). The following are plotted:

(70) either a curve: adhesion of the Jurkat cells (Y) as a function of the amount of anti-D bound to the red blood cell membranes (X).

(71) or a histogram of the binding indices corresponding, for each antibody, to the sum of each Jurkat cell binding value (0 to 3) allotted per OD interval (over a portion common to all the antibodies tested).

(72) An example of a histogram is given in FIG. 2.

(73) The anti-Rh(D) antibodies of IgG1 isotype (F60 and T125 YB2/0) show a binding index close to that of the polyclonal IgG1s (WinRho), whereas the negative control antibodies DF5 and AD1 do not bind. Similarly, the antibody of IgG3 isotype (F41) exhibits a good binding index, slightly less than that of the IgG3s purified from the polyclonal Winrho and greater than that of the antibody AD3 (other IgG3 tested and ineffective in clinical trial, in a mixture with AD1 (Biotest/LFB, 1997, not published).

Example 2

(74) Production of a Recombinant Anti-D Antibody (Ab)

(75) 1Isolation and Amplification of the cDNAs Encoding the Heavy and Light Chains of the Ab

(76) 1.1RNA Extraction and cDNA Synthesis

(77) The total RNAs were extracted from an anti-D Ab-producing clone (IgG G1/Kappa) obtained by EBV transformation: T125 A2 (5/1) A2 (see paragraph 2, example 1).

(78) The corresponding cDNAs were synthesized by reverse transcription of the total RNAs using oligo dT primers.

(79) 1.2Amplification of the Variable Region of the Heavy Chain of T125-A2: VH/T125-A2 Sequence

(80) The VH/T125-A2 sequence is obtained by amplification of the T125-A2 cDNAs using the following primers: primer A2VH5, located 5 of the leader region of the VH gene of T125-A2, introduces a consensus leader sequence (in bold) deduced from leader sequences already published and associated with VH genes belonging to the same VH3-30 family as the VH gene of T125-A2; this sequence also comprises an Eco RI restriction site (in italics) and a Kozak sequence (underlined):

(81) TABLE-US-00002 A2VH5(SEQIDNo.1): 5-CTCTCCGAATTCGCCGCCACCATGGAGTTTGGGCTGAGCTGGGT-3 antisense primer GSP2ANP, located 5 of the constant region (CH) of T125-A2:

(82) TABLE-US-00003 GSP2ANP(SEQIDNo.2): 5-GGAAGTAGTCCTTGACCAGGCAG-3.
1.3Amplification of the constant region of T125-A2: CH/T125-A2 sequence

(83) The CH/T125-A2 sequence is obtained by amplification of the T125-A2 cDNAs using the following primers: primer G1, located 5 of the CH region of T125-A2:

(84) TABLE-US-00004 G1(SEQIDNo.3): 5-CCCTCCACCAAGGGCCCATCGGTC-3 The first G base of the CH sequence is here replaced with a C (underlined) in order to recreate, after cloning, an Eco RI site (see paragraph 2.1.1).

(85) antisense primer H3Xba, located 3 of the CH of T125-A2, introduces an Xba I site (underlined) 3 of the amplified sequence:

(86) TABLE-US-00005 H3'Xba(SEQIDNo.4): 5-GAGAGGTCTAGACTATTTACCCGGAGACAGGGAGAG-3
1.4Amplification of the Kappa light chain: K/T125-A2 sequence

(87) The entire Kappa chain of T125-A2 (K/T125-A2 sequence) is amplified from the T125-A2 cDNAs using the following primers: primer A2VK3, located 5 of the leader region of the VK gene of T125-A2, introduces a consensus sequence (in bold) deduced from the sequence of several leader regions of VK VH genes belonging to the same VK1 subgroup as the VK gene of T125-A2; this sequence also comprises an Eco RI restriction site (in italics) and a Kozak sequence (underlined):

(88) TABLE-US-00006 A2VK3(SEQIDNo.5): 5-CCTACCGAATTCGCCGCCACCATGGACATGAGGGTCCCCGCTCA-3 antisense primer KSE1, located 3 of Kappa, introduces an Eco RI site (underlined):

(89) TABLE-US-00007 KSE1(SEQIDNo.6): 5-GGTGGTGAATTCCTAACACTCTCCCCTGTTGAAGCTCTT-3.

(90) FIG. 1 gives a diagrammatic illustration of the strategies for amplifying the heavy and light chains of T125-A2.

(91) 2Construction of Expression Vectors

(92) 2.1Vector for Expressing the Heavy Chain of T125-A2: T125-H26

(93) The construction of T125-H26 is summarized in FIG. 2. It is carried out in two stages: first of all, construction of the intermediate vector V51-CH/T125-A2 by insertion of the constant region of T125-A2 into the expression vector V51 derived from pCI-neo (FIG. 3) and then cloning of the variable region into V51-CH/T125-A2.

(94) 2.1.1Cloning of the Constant Region of T125-A2

(95) The amplified CH/T125-A2 sequence is inserted, after phosphorylation, at the Eco RI site of the vector V51 (FIG. 3). The ligation is performed after prior treatment of the Eco RI sticky ends of V51 with the Klenow polymerase in order to make them blunt-ended.

(96) The primer G1 used for amplifying CH/T125-A2 makes it possible to recreate, after its insertion into V51, an Eco RI site 5 of CH/T125-A2.

(97) 2.1.2Cloning of the Variable Region of T125-A2

(98) The VH/T125-A2 sequence obtained by amplification is digested with Eco RI and Apa I and then inserted at the Eco RI and Apa I sites of the vector V51-G1/T125-A2.

(99) 2.2T125-A2 Light Chain Vector: T125-K47

(100) The construction of T125-K47 is given in FIG. 4. The K/T125-A2 sequence obtained by PCR is digested with Eco RI and inserted at the Eco RI site of the expression vector V47 derived from pCI-neo (FIG. 5).

(101) 2.3T125-A2 Heavy and Light Chain Vector: T125-1G24

(102) The construction of T125-IG24 is illustrated diagrammatically in FIG. 6. This vector, which contains the two transcription units for the heavy and Kappa chains of T125-A2, is obtained by inserting the Sal I-Xho I fragment of T125-K47, containing the transcription unit for K/T125-A2, at the Xho I and Sal I sites of T125-H26.

(103) Thus, the heavy and light chains of T125-A2 are expressed under the control of the CMV promoter; other promoters may be used: RSV, IgG heavy chain promoter, MMLV LTR, HIV, -actin, etc.

(104) 2.4T125-A2 Heavy and Light Chain Specific Leader Vector: T125-LS4

(105) A second vector for expressing T125-A2 is also constructed, in which the consensus leader sequence of the Kappa chain is replaced with the real sequence of the leader region of T125-A2 determined beforehand by sequencing products from PCR 5-RACE (Rapid Amplification of cDNA 5 Ends).

(106) The construction of this T125-LS4 vector is described in FIG. 7. It is carried out in two stages: first of all, construction of a new vector for expressing the T125-A2 Kappa chain, T125-KLS18, and then assembly of the final expression vector, T125-LS4, containing the two heavy chain and modified light chain transcription units.

(107) 2.4.1Construction of the Vector T125-KLS18

(108) The 5 portion of the Kappa consensus leader sequence of the vector T125-K47 is replaced with the specific leader sequence of T125 (KLS/T125-A2) during a step of amplification of the K/T125-A2 sequence carried out using the following primers: primer A2VK9, modifies the 5 portion of the leader region (in bold) and introduces an Eco RI site (underlined) and also a Kozak sequence (in italics):

(109) TABLE-US-00008 A2VK9: 5-CCTACCGAATTCGCCGCCACCATGAGGGTCCCCGCTCAGCTC-3 primer KSE1 (described in paragraph 1.4)

(110) The vector T125-KLS18 is then obtained by replacing the Eco RI fragment of T125-K47, containing the K/T125-A2 sequence of origin, with the new sequence KLS/T125-A2 digested via Eco RI.

(111) 2.4.2Construction of the Final Vector T125-LS4

(112) The Sal I-Xho I fragment of T125-KLS18, containing the modified KLS/T125-A2 sequence, is inserted into T125-H26 at the Xho I and Sal I sites.

(113) 3Production of Anti-D Abs in the YB2/0 Line

(114) 3.1Without Gene Amplification

(115) The two expression vectors T125-IG24 and T125-LS4 were used to transfect cells of the YB2/0 line (rat myeloma, ATCC line No. 1662). After transfection by electroporation and selection of transformants in the presence of G418 (neo selection), several clones were isolated. The production of recombinant anti-D Abs is approximately 0.2 ng/10.sup.6 cells/24 h (value obtained for clone 3B2 of R270). The ADCC activity of this recombinant Ab is greater than or equal to that of the poly-D controls (FIG. 1). The Abs produced using the two expression vectors are not significantly different in terms of level of production or of ADCC activity.

(116) 3.2with Gene Amplification

(117) The gene amplification system used is based on the selection of transformants resistant to methotrexate (MTX). It requires the prior introduction of a transcription unit encoding the DHFR (dihydrofolate reductase) enzyme into the vector for expressing the recombinant Ab (SHITARI et al., 1994).

(118) 3.2.1Construction of the Expression Vector T125-Dhfr 13

(119) The scheme shown in FIG. 8 describes the construction of the vector for expressing T125-A2, containing the murine dhfr gene.

(120) A first vector (V64) was constructed from a vector derived from pCI-neo, V43 (FIG. 9), by replacing, 3 of the SV40 promoter and 5 of a synthetic polyadenylation sequence, the neo gene (Hind III-Csp 45 I fragment) with the cDNA of the murine dhfr gene (obtained by amplification from the plasmid pMT2). This vector is then modified so as to create a Cla I site 5 of the dhfr transcription unit. The Cla I fragment containing the dhfr transcription unit is then inserted at the Cla I site of T125-LS4.

(121) 3.2.2Selection in the Presence of MTX

(122) 1st Strategy:

(123) YB2/0 cells transfected by electroporation with the vector T125-dhfr13 are selected in the presence of G418. The recombinant Ab-producing transformants are then subjected to selection in the presence of increasing doses of MTX (from 25 nM to 25 M). The progression of the recombinant Ab production, reflecting the gene amplification process, is followed during the MTX selection steps. The MTX-resistant transformants are then cloned by limiting dilution. The level and the stability of the recombinant Ab production are evaluated for each clone obtained. The anti-D antibody productivity after gene amplification is approximately 13 (+/7) g/10.sup.6 cells/24 h.

(124) 2nd Strategy:

(125) YB2/0 cells transfected by electroporation with vector T125-dhfr13 are selected in the presence of G418. The best recombinant Ab-producing transformants are cloned by limiting dilution before selection in the presence of increasing doses of MTX. The progression of the production by each clone, reflecting the gene amplification process, is followed during the MTX selection steps. The level and the stability of the recombinant Ab production are evaluated for each MTX-resistant clone obtained.

(126) 4Evaluation of the Activity of the T125 Antibody Expressed in YB2/0

(127) After purification by affinity chromatography on protein A Sepharose (Pharmacia) and dialysis into 25 mM Tris buffer, 150 mM NaCl, pH 7.4, the concentration of the T125 antibody is determined by the ELISA technique. The biological activity in vitro is then measured by the ADCC assay described above. The results are given in FIG. 1.

Example 3: Demonstration of the Relationship Between Glycan Structure and FcRIII-Dependent Activity

(128) 1Cell Culture in the Presence of Deoxymannojirimycin (DMM)

(129) Several studies describe the effect of enzymatic inhibitors on the glycosylation of immunoglobulins and on their biological activity. An increase in ADCC activity is reported by ROTHMAN et al., 1989, this being an increase which cannot be attributed to an enhancement of the affinity of the antibody for its target. The modification of glycosylation caused by adding DMM consists of inhibition of the -1,2 mannosidase I present in le Golgi. It leads to the production of a greater proportion of polymannosylated, nonfucosylated structures.

(130) Various anti-Rh(D) antibody-producing lines were brought into contact with DMM and the functional activity of the monoclonal antibodies produced was evaluated in the form of culture supernatants or after purification.

(131) The cells (heterohybrid or lymphoblastoid cells) are seeded at between 1 and 310.sup.5 cell/ml, and cultured in IMDM culture medium (Life Technologies) with 10% of FCS and in the presence of 20 g/ml of DMM (Sigma, Boehringer). After having renewed the medium 3 times, the culture supernatants are assayed by human IgG ELISA and then by ADCC.

(132) TABLE-US-00009 TABLE 2 Effect of culturing in the presence of DMM on the ADCC activity of various anti-Rh(D)s ADCC activity as % of the Minimum dose activity of poly-D LFB51 of DMM Culture Culture in the necessary Samples without DMM presence of DMM g/ml F60 109 113 NT D31 19 87 10 DF5 26 62 20 T125 RI(3) 3 72 20 T125-CHO 0 105 5 NTnot tested Culturing in the presence of deoxymannojirimycin (DMM) brings a significant improvement to the ADCC results for the antibodies previously weakly active, produced by:

(133) TABLE-US-00010 a human-mouse hybridoma D31 a human lymphoblastoid line DF5 a transfected murine line T125 in CHO The addition of DMM may make it possible to restore the ADCC activity of an antibody derived from the cloid T125=T125 RI(3) (described in example 1) and which has lost this activity through sustained culturing. The strong activity of the antibody produced by the heterohybridoma F60 (the production of which is described in example 1) is not modified by culturing in the presence of DMM.
2Production of Recombinant Anti-D Antibodies by Various Cell Lines:
2.1Preparation of an Expression Vector for the Antibody DF5:

(134) The nucleotide sequence of the antibody DF5, a negative control in the ADCC assay, is used to study the transfection of this antibody into some lines, in parallel to transfection of the antibody T125.

(135) The sequences encoding the Ab DF5 are isolated and amplified according to the same techniques used for the recombinant Ab T125-A2. The corresponding cDNAs are first of all synthesized from total RNA extracted from the anti-D Ab-(IgG G1/Lambda)-producing clone 2MDF5 obtained by EBV transformation. Amplification of the heavy and light chains is then carried out from these cDNAs using the primers presented below. Amplification of the variable region of the heavy chain of DF5 (VH/DF5 sequence):

(136) primer DF5VH1, located 5 of the leader region (in bold) of the VH gene of DF5 (sequence published: L. Chouchane et al.); this primer also comprises an Eco RI restriction site (in italics) and a Kozak sequence (underlined):

(137) TABLE-US-00011 DF5VH1(SEQIDNo.8): 5CTCTCCGAATTCGCCGCCACCATGGACTGGACCTGGAGGATCCTC TTTTTGGTGG-3

(138) antisense primer GSP2ANP, located 5 of the constant region (CH) already described in paragraph 1.2 (example 2). Amplification of the constant region CH of DF5 (CH/DF5 sequence): primers G1 and H3Xba already described in paragraph 1.3 (example 2). Amplification of the Lambda light chain of DF5 (LBD/DF5 sequence):

(139) primer DF5VLBD1, located 5 of the leader region of the VL gene of DF5, introduces a consensus sequence (in bold) deduced from the sequence of several leader regions of VL genes belonging to the same VL1 subgroup as the VL gene of 2MDF5; this sequence also comprises an Eco RI restriction site (in italics) and a Kozak sequence (underlined):

(140) TABLE-US-00012 DF5VLBD1(SEQIDNo.9): 5CCTACCGAATTCGCCGCCACCATGGCCTGGTCTCCTCTCC TCCTCAC-3

(141) antisense primer LSE1, located 3 of Lambda, introduces an Eco RI site (underlined):

(142) TABLE-US-00013 LSE1(SEQIDNo.10): 5-GAGGAGGAATTCACTATGAACATTCTGTAGGGGCCACTGTCTT-3. The construction of the vectors for expressing the heavy chain (DF5-H31), light chain (DF5-L10) and heavy and light chains (DF5-IG1) of the Ab DF5 is carried out according to a construction scheme similar to vectors expressing the Ab T125-A2. All the leader sequences of origin (introduced in the amplification primers) are conserved in these various vectors.
2.2Transfection of Various Cell Lines with the Antibodies T125 and DF5

(143) The three expression vectors T125-IG24, T125-LS4 and DF5-IgG1 are used to transfect cells of various lines: Stable or transient transfections are performed by electroporation or using a transfection reagent.

(144) TABLE-US-00014 TABLE 3 Cell lines used for the transfection of anti-Rh(D) antibodies Name Reference Cell type CHO-K1 ATCC CCL 61 Chinese hamster ovary (epithelium like) CHO-Lec10 Fenouillet et al., 1996, Chinese hamster ovary (epithelium Virology, 218, 224-231 like) Jurkat ATCC TIB-152 Human T lymphocyte (T leukemia) Molt-4 ATCC CRL 1582 Human T lymphocyte (acute lymphoblastic leukemia) WIL2-NS ATCC CRL 8155 EBV-transformed human B lymphocyte Vero ATCC CCL 81 African green monkey kidney (fibroblast like) COS-7 ATCC CRL 1651 SV40-transformed African green monkey kidney (fibroblast like) 293-HEK ATCC CRL 1573 Primary human embryonic kidney transformed with defective adenovirus 5 DNA YB2/0 ATCC CRL 1662 Nonsecreting rat myeloma BHK-21 ATCC CCL 10 Newborn hamster kidney (fibroblast like) K6H6-B5 ATCC CRL 1823 Nonsecreting human-mouse heteromyeloma NSO ECACC 85110503 Nonsecreting mouse myeloma (lymphoblast like) SP2/0-Ag 14 ECACC 85072401 Nonsecreting mouse mouse hybridoma CHO Lec-1 ATCC CRL 1735 Chinese hamster ovary CHO dhfr ECACC 94060607 Chinese hamster ovary CHO Pro-5 ATCC CRL 1781 Chinese hamster ovary P3X63 ATCC CRL 1580 Nonsecreting mouse myeloma Ag8.653

(145) After selection of the transformants in the presence of G418 (neo selection), several clones were isolated.

(146) The modification of effector activity of a humanized monoclonal antibody as a function of the expressing cell has been described by CROWE et al. (1992), with the CHO, NSO and YB2/0 cell lines.

(147) The results obtained here confirm the importance of the expressing cell line with respect to the functional characteristics of the antibody to be produced. Among the cells tested, only the Vero, YB2/0 and CHO Lec-1 lines make it possible to express recombinant anti-Rh(D) monoclonal antibodies with strong lytic activity in the ADCC assay (see example 1 and table 4).

(148) TABLE-US-00015 TABLE 4 ADCC activity of the antibodies DF5 and T125 obtained by transfection into various cell lines. The results are expressed as percentage of the activity of the reference polyclonal antibody: Poly-D LFB 51 Transfected cell lines CHO- CHO- 293- K1 Lec10 Wil-2 Jurkat Vero Molt-4 COS-7 HEK YB2/0 antibodies T125 7 +/ 8 22 +/ 6 3 +/ 5 6 +/ 8 90 +/ 0 13 +/ 2 16 +/ 114 +/ n = 13 n = 11 n = 12 n = 7 21 n = 1 n = 4 13 28 n = 5 n = 12 n = 54 DF5 NT 51 +/ NT NT 72 +/ NT 21 +/ 4 12 +/ 94 +/ 19 17 n = 4 14 15 n = 3 n = 5 n = 12 n = 15 Transfected cell lines CHO- SP2/0- CHO CHO NSO BHK Lec1 Ag14 K6H6-B5 Pro-5 dhfr P3X63Ag8.653 antibodies T125 6 +/ 8 13 +/ 5 106 +/ 0 +/ 0 9 +/ 8 3 +/ 3 13 +/ 8 34 +/ 8 n = 3 n = 4 60 n = 6 n = 3 n = 4 n = 12 n = 9 n = 4
3Study of the Glycan Structures

(149) Characterization of the glycan structures of the anti-Rh-D antibody was carried out on four purified products having an ADCC activity (F60, and three recombinant proteins derived from T125) in comparison with two purified products inactive or very weakly active in the ADCC assay according to the invention (D31 and DF5).

(150) In practice, the oligosaccharides are separated from the protein by specific enzymatic deglycosylation with PNGase F at Asn 297. The oligosaccharides thus released are labeled with a fluorophore, separated and identified by various complementary techniques which allow:

(151) fine characterization of the glycan structures by matrix-assisted laser desorption ionization (MALDI) mass spectrometry by comparison of the experimental masses with the theoretical masses.

(152) determination of the degree of sialylation by ion exchange HPLC (GlycoSep C)

(153) separation and quantification of the oligosacharride forms according to hydrophilicity criteria by normal-phase HPLC (GlycoSep N)

(154) separation and quantification of the oligosaccharides by high performance capillary electrophoresis-laser induced fluorescence (HPCE-LIF).

1) CHARACTERIZATION OF THE GLYCANS OF ACTIVE FORMS

(155) The various active forms studied are F60 and three recombinant antibodies, R 290, R 297 and R 270, derived from T125 and produced in YB2/0. Fine characterization of the glycan structures by mass spectrometry (FIG. 7) shows that these forms are all of the bi-antennary type. In the case of R 270, the major form is of the agalactosylated, nonfucosylated type (G0, exp. mass 1459.37 Da, FIG. 1). Three other structures are identified: agalactosylated, fucosylated (G0F at 1605.41 Da), monogalactosylated, nonfucosylated (G1 at 1621.26 Da) and monogalactosylated, fucosylated (G1F at 1767.43 Da) in minor amount. These same four structures are characteristic of R 290, F 60 and R 297 (FIG. 1).

(156) These four antibodies which are active in ADCC are also characterized by the absence of oligosaccharides having a bisecting N-acetylglucosamine residue.

(157) Quantification of the glycan structures by the various techniques of HPLC and HPCE-LIF (table 1) confirms the presence of the four forms identified by mass: G0, G0F, G1 and G1F. The degree of sialylation is very low, in particular for the recombinant products, from 1 to 9.4%, which is confirmed by the similarity of the mass spectra obtained before and after enzymatic desialylation. The degree of fucosylation ranges from 34 to 59%.

2) INACTIVE FORMS

(158) The various inactive forms studied are D31 and DF5. Quantification of the glycan structures by the various chromatographic and capillary electrophoresis techniques (table 1) reveals, for these two antibodies, a degree of sialylation close to 50%, and a degree of fucosylation of 88 and 100% for D31 and DF5, respectively. These degrees of sialylation and fucosylation are much higher than those obtained from the active forms.

(159) Characterization of the glycan structures shows that the major form is, for the two antibodies, of the bi-antennary, monosialylated, digalactosylated, fucosylated type (G2S1F, table 1). The characterization by mass spectrometry of D31 (FIG. 7) reveals that the neutral forms are mainly of the monogalactosylated, fucosylated type (G1F at 1767.43 Da) and digalactosylated, fucosylated type (G2F at 1929.66 Da).

(160) The inactive antibody DF5 is characterized by the presence of oligosaccharides having an intercalated GlcNAc residue. In particular, the mass analysis (FIG. 8) reveals the presence of a major neutral form of the monogalactosylated, fucosylated, bisecting, intercalated GlcNAc type (G1FB at 1851.03 Da). On the other hand, these structural forms are undetectable or present in trace amounts on the active antibodies studied.

(161) The ADCC activity of D31 after the action of DMM increases from 10% to 60%. The glycan structures of DMM D31 differ from those of D31 by the presence of oligomannose forms (Man 5, Man 6 and Man 7) (see FIG. 9).

3) CONCLUSION

(162) The various active antibodies are modified on Asn 297 with N-glycosylations of the bi-antennary and/or oligomannoside type. For the bi-antennary forms, this involves short structures with a very low degree of sialylation, a low degree of fucosylation, a low degree of galactosylation and no intercalated GlcNAc.

REFERENCES

(163) Boylston, J. M., Gardner, B., Anderson, R. L., and Hughes-Jones, N. C. Production of human IgM anti-D in tissue culture by EB virus-transformed lymphocytes. Scand. J. Immunol. 12: 355-358 (1980). Bron, D., Feinberg, M. B., Teng, N. N. H. and Kaplan, H. S. Production of Human Monoclonal IgG Antibodies against Rhesus (D) Antigen. Proc. Nat. Acad. Sci. USA 81: 3214-3217 (1984). Chouchane, L., Van Spronsen, A., Breyer, J., Guglielmi, P., and Strosberg, A D. Molecular characterization of a human anti-Rh(D) antibody with a DII segment encoded by a germ-line sequence. Eur. J. Biochem. 1; 207(3): 1115-1121 (1992). Crawford, D. H., Barlow, M. J., Harrison, J. F., Winger, L. and Huehns, E. R. Production of human monoclonal antibody to rhesus D antigen. Lancet, i: 386-388 (1983). Doyle, A., Jones, T. J., Bidwell, J. L. and Bradley, B. A. In vitro development of human monoclonal antibody secreting plasmacytomas. Hum. Immunol. 13: 199-209 (1985). Edelman, L., Margaritte, C., Chaabihi, H., Monchatre, E., Blanchard, D., Cardona, A., Morin, F., Dumas, G., Petres, S. and Kaczorek, M. Obtaining a functional recombinant anti-rhesus (D) antibody using the baculovirus-insect cell expression System. Immunology, Vol. 91(1), 13-19 (1997). Foung, S. K. H., Blunt, J. A., Wu, P. S., Ahearn, P., Winn, L. C., Engleman, E. G. and Grumet, F. C. Human Monoclonal Antibodies to Rho (D). Vox Sang. 53: 44-47 (1987). Goossens, D., Champomier, F., Rouger, P., and Salmon, C. Human Monoclonal Antibodies against Blood Group Antigens: Preparation of a series of stable EBV immortalized B clones producing high levels of antibody of different isotypes and specificities. J. Immunol. Methods 101: 193-200 (1987). Issitt, P. D. Genetics of the Rh Blood Group System: Some Current Concepts. Med. Lab. Sci. 45: 395-404 (1988). Jefferis, R, Lund, J., Mizutani, H., Nakagawa, H., Kawazoe, Y., Arata, Y. and Takahashi, N. A comparative study of the N-linked oligosaccharides structure of human IgG Subclass proteins. Biochem. J., 268: 529-537 (1990). Koskimies, S. Human Lymphoblastoid Cell Line Producing Specific Antibody against Rh-Antigen D. Scand. Immunol. 11: 73-77 (1980). Kumpel, B. M., Goodrick, M. J., Pamphilon, D. H., Fraser, I. D., Poole G. D., Morse, C., Standen, G. R., Chapman, G. E., Thomas, D. P. and Anstee, D. J. Human Rh D monoclonal antibodies (BRAD-3 and BRAD-5) Cause Accelerated Clearance of Rh D+Red blood Cells and Suppression of Rh D Immunization in Rh D Volunteers. Blood, Vol. 86, No. 5, 1701-1709 (1995). Kumpel, B. M., Poole, G. D. and Bradley, B. A. Human Monoclonal Anti-D Antibodies. I. Their Production, Serology, Quantitation and Potential Use as Blood Grouping Reagents. Brit. J. Haemat. 71: 125-129 (1989a). Kumpel, B. M., Rademacher, T. W., Rook, G. A. W., Williams, P. J., Wilson, I. B. M. Galacatosylation of human IgG anti-D produced by EBV-transformed B lympho-blastoid cell lines is dependent on culture method and affects Fc receptor mediated functional activity. Hum. Antibodies and Hybridomas, 5: 143-151 (1994). Leatherbarrow, R. J., Rademacher, T. W., Dwek, R. A., Woof, J. M., Clark, A., Burton, D. R., Richardson, N. and Feinstein, A. Effector functions of monoclonal aglycosylated mouse IgG2a; binding and activation of complement component CI and itneraction with human Fc receptor. Molec. Immun 22, 407-415 (1985). Lomas, C., Tippett, P., Thompson, K. M., Melamed, M. D. and Hughes-Jones, N. C. Demonstration of seven epitopes on the Rh antigen D using human monoclonal anti-D antibodies and red cells from D categories. Vox Sang. 57: 261-264 (1989). Lund, J., Takahaski, N., Nakagawa, H., Goodall, M., Bentley, T., Hindley, S. A., Tyler, R. and Jefferis, R. Control of IgG/Fc glycosylation: a comparison of oligosaccharides from chimeric human/mouse and mouse subclass immunoglobulin G5. Molec. Immun 30, No. 8, 741-748 (1993). Lund, J., Tanaka, T., Takahashi, N., Sarmay, G., Arata, Y. and Jefferis, R. A protein structural change in aglycosylated IgG3 correlates with loss of hu FcRI and Hu FcRIII binding and/or activation. Molec. Immun. 27, 1145-1153 (1990). Ma, J. K. and Hein, M B Immunotherapeutic potential of antibodies produced in plants. Trends Biotechnol. 13, 522-527 (1995). Mc Cann-Carter, M. C., Bruce, M., Shaw, E. M., Thorpe, S. J., Sweeney, G. M., Armstrong, S. S. and James, K. The production and evaluation of two human monoclonal anti-D antibodies. Transf. Med. 3: 187-194 (1993). Melamed. M. D., Gordon, J., Ley, S. J., Edgar, D. and Hughes-Jones, N. C. Senescence of a human lymphoblastoid clone producing anti-Rhesus (D) Eur. J. Immunol. 115: 742-746 (1985). Parekh, R. B., Dwek, R. A., Sutton, B. J., Fernanes, D. L., Leung, A., Stanworth, D., Rademacher, T. W., Mizuochi, T., Taniguchi, T., Matsuta, K., Takeuchi, F., Nagano, Y., Miyamoto, T. and Kobata, A. Association of rheumatoid arthritis and primary osteoarthritis with changes in the glycosylation pattern of total serum IgG. Nature, 316: 452-457 (1985). Rothman, R. J., Perussia, B., Herlyn, D. and Warren, L. Antibody-dependent cytotoxicity mediated by natural killer cells is enhanced by castanospermine-induced alterations of IgG glycosylation. Mol. Immunol. 26(12): 1113-1123 (1989). Shitara K., Nakamura K., Tokutake-Tanaka Y., Fukushima M., and Hanai N. A new vector for the high level expression of chimeric antibodies to myeloma cells. J. Immunol. Methods 167: 271-278 (1994). Thompson, K. M., Hough, D. W., Maddison, P. J., Mclamed, M. D. and Hughes-Jones, N. C. Production of human monoclonal IgG and IgM antibodies with anti-D (rhesus) specificity using heterohybridomas. Immunology 58: 157-160 (1986). Thomson, A., Contreras, M., Gorick, B., Kumpel, B., Chapman, G. E., Lane, R. S., Teesdale, P. Hughes-Jones, N. C. and Mollison, P. L. Clearance of Rh D-positive red cells with monoclonal anti-D. Lancet 336: 1147-1150 (1990). Tippett, P. Sub-divisions of the Rh(D) antigen. Med. Lab. Sci. 45: 88-93 (1988). Ware, R. E. and Zimmerman, S. A. Anti-D: Mechanisms of action. Seminars in Hematology, vol. 35, No. 1, supp. 1: 14-22 (1998). Yu, I. P. C., Miller, W. J., Silberklang, M., Mark, G. E., Ellis, R. W., Huang, L., Glushka, J., Van Halbeek, H., Zhu, J. and Alhadeff, J. A. Structural characterization of the N-Glycans of a humanized anti-CD18 murine immunoglobulin G. Arch. Biochem. Biophys. 308, 387-399 (1994). Zupanska, B., Thompson, E., Brojer, E. and Merry, A. H. Phagocytosis of Erythrocytes Sensitized with Known Amounts of IgG1 and IgG3 anti-Rh antibodies. Vox Sang. 53: 96-101 (1987).