APPARATUS AND METHODS FOR CONTROLLING CELLULAR DEVELOPMENT
20170211040 ยท 2017-07-27
Inventors
- Karl Deisseroth (Stanford, CA)
- Albrecht Stroh (Mainz, DE)
- M. Bret Schneider (Portola Valley, CA, US)
- Raag D. Airan (Menlo Park, CA)
Cpc classification
C12N2501/385
CHEMISTRY; METALLURGY
C12N5/0606
CHEMISTRY; METALLURGY
C12N2501/119
CHEMISTRY; METALLURGY
C12N2535/00
CHEMISTRY; METALLURGY
C12N2501/115
CHEMISTRY; METALLURGY
C12N2501/41
CHEMISTRY; METALLURGY
C12N15/86
CHEMISTRY; METALLURGY
C12N2740/00043
CHEMISTRY; METALLURGY
International classification
Abstract
According to one aspect and example, a method for facilitating cellular interactions in biological tissue provides controllable activation of a selected type of stem cell among a plurality of cell types present in the tissue. The method includes various steps including the introduction of a microbial opsin into a region of the tissue that includes a selected type of stem cell, by expressing the microbial opsin in the stem cell. A light source is then introduced near the stem cell, and the light source is used to controllably activate thejight source to direct pulses of illumination from the light source to the selected type of stem cell, for selectively controlling the growth and development of the stem cell in a manner that is independent of the growth and development of the other types of cells.
Claims
1. A method for facilitating cellular development in a biological environment having a selected type of stem cell that can be distinguished from other cell types, the method comprising the steps of: introducing a microbial opsin into a region of the biological environment that includes a selected type of stem cell, by expressing the microbial opsin in the stem cell; introducing a light source near the stem cell; and controllably activating the light source to direct pulses of illumination from the light source to the selected type of stem cell, for selectively controlling its growth and development independent of the growth and development of the other types of cells.
2. The method of claim 1, wherein the selected type of stem cell is as an integral part of the biological environment which includes a mixed set of cell types.
3. The method of claim 1, further including using intrinsic properties of axons and dendrites to facilitate the controlled development of young neurons.
4. The method of claim 3, wherein the intrinsic properties include one or more of: different associated chemo-attractants, temporal properties characterizing the speed at which axons and dendrites grow, and physical dimensions of axons relative to dendrites.
5. The method of claim 1, wherein the selected type of stem cell is as an integral part of tissue which includes a mixed set of cell types including cells that are targeted for control and cells that are not targeted for control.
6. The method of claim 5, further including facilitating discrete communication within the mixed set of cell types, whereby cells of individual types and individual roles in tissue development are governed.
7. The method of claim 1, further including facilitating cellular growth of the stem cell within a predetermined spatial configuration.
8. The method of claim 1, further including facilitating growth of the stem cell within a predetermined geometric configuration.
9. The method of claim 8, further including facilitating control for internal pacing of a portion of a brain, whether hypoactive or hyperactive portion of the brain being internally paced, while using another portion of the brain to facilitate control.
10. The method of claim 1, wherein the stem cells are immature cells.
11. The method of claim 1, wherein the biological environment is a tissue.
12. The method of claim 1, wherein the biological environment is a cell culture.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0023] The invention may be more completely understood in consideration of the detailed description of various embodiments of the invention that follows in connection with the accompanying drawings, in which:
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031] While the invention is amenable to various modifications and alternative forms, specifics thereof have been shown by way of example in the drawings and will be described in detail. It should be understood, however, that the intention is not to limit the invention to the particular embodiments described. On the contrary, the intention is to cover all modifications, equivalents, and alternatives falling within the spirit and scope of the invention.
DETAILED DESCRIPTION
[0032] The present invention is directed to methods and apparatus for culturing and promoting the growth of stem cells, such as embryonic stem cells, in biological tissue. The present invention has been found to be particularly suited for use in arrangements and methods dealing with growth of stem cells in neural networks. While the invention is not necessarily limited to such biological environments, various aspects of the invention may be appreciated through a discussion of various examples using this context.
[0033] Consistent with one example embodiment of the present invention, a method for facilitating cellular interactions in biological tissue or cell culture provides controllable activation of a selected type of stem cell among a plurality of cell types whether or not present in the tissue or cell culture. The method includes introducing a microbial opsin into a region of the tissue or cell culture that includes a selected type of stem cell, by expressing the microbial opsin in the stem cell. A light source is then introduced near the stem cell, and the light source is used to controllably activate the light to direct pulses of illumination from the light source to the selected type of stem cell, for selectively controlling the growth and development of the stem cell in a manner that is independent of the growth and development of the other types of cells.
[0034]
[0035] One function of G-Proteins is to mediate the process by which a stimulus upon a cell impacts the response of that cell; for example, the timing of electrical spikes delivered upon a neuron may or may not translate into the emergence of excitatory post-synaptic potentials, depending upon G-protein activities. G-proteins may carry out their roles by using various subordinate mediators. G-proteins such as Gx and Gq may be induced (by optical or pharmacological stimulation) so as to release factors such as BDNF, NGF, GDNF and VEGF. Stimulation of the G-protein may be accomplished in a cell-type-specific manner (for example using cell-type-specific genetic targeting and optogenetic stimulation methods as described in one or more of the underlying provisional patent documents and as described in Airan R. D., Thompson K. R., Fenno L. E., Bernstein H., Deisseroth K., Temporally Precise in vivo Control of Intracellular Signaling, Nature, 2009 Apr. 23, 458(7241):1025-9, Epub 2009 Mar. 18. When this is done, the regulation and control of a cell's response level to such factors applies only to the selected type of cell, and not to other adjacent populations within a tissue culture, neural circuit, animal, or patient. G-proteins may also be used to control the release of dopamine, norepinephrine, serotonin, vasopressin, oxytocin, and other neurotransmitters and hormones. Control of G-protein activity, thereby permit control of cellular differentiation, and which neural circuits are turned on or off at a given time.
[0036] Methods for external readout of levels of cellular activity within a network are known in the art. As described in Knopfel et al., Optical probing of neuronal circuit dynamics: genetically encoded versus classical fluorescent sensors, Trends Neurosci. 2006 Mar. 29, 3:160-6, such methods include use of non-protein calcium sensors such as Fura-2, Oregon green 488 BAPTA-1, and X-Rhod-5F; genetically-encoded calcium sensors, such as yellow cameleon 3.6, G-CaMP2, Camgaroo-2 and TN-L15; non protein voltage sensors such as di-4-ANEPPS and WW3028; and hybrid voltage sensors such as hVOS, genetically-encoded sensors such as FlaSh, SPARC and VSFP1. Additionally, absorbance-based measures of calcium flux such as RH-155 may be used by means known in the art.
[0037] Methods of providing readout regarding expression of cell products and the subpopulations of cells that produce them with an antibody linked to a fluorescent dye. For example, for gauging developmental stage of cellular development, one may use nestin staining (see, e.g., underlying U.S. provisional application No. 61/093,086).
[0038] Additionally, both size and morphology degree of differentiation in developing cells may be assessed and read out using automated image analysis software and systems. One example is a microscopy system built upon the PERL-based OME server project at Open Microscopy Environment (www.openmicroscopy.org), which implements image-based analysis of cellular dynamics and image-based screening of cellular localization or phenotypes. Another example of software readout may be based upon BD IPLab Advanced Image Analysis Software (BD Biosciences, Rockville, Md.). Other methods of providing readout regarding cellular activity are known in the art, and include spectroscopy (absorbance and transmittance), functional magnetic resonance imaging (such as use of the BOLD effect), and positron emission tomography. Readout on cellular metabolic activity may also be obtained via electronic chemical sniffers which react to the presence of gasses such as carbon dioxide.
[0039]
[0040] Under specific conditions known in the art, a variety of cells of various lineages may be induced to produce any of a variety of products or growth factors. For example, neurons themselves may secrete BDNF, as well as gastric hormones (such as vaso-intestinal peptide (VIP) or somatastatin), much like endodermally-derived cells normally do. In an alternative embodiment, neural stem cells or pluripotent stem cells or induced pluripotent stem cells (iPS) (Takahahi et al, Yu et al.) may be used in place of more differentiated counterparts, with some portions acquiring, for example, a neuronal path of development, and others assuming, for example, a vascular path of development.
[0041]
[0042] Also in accordance with the present invention,
[0043]
[0044]
[0045]
[0046]
[0047] Another aspect of the patent invention is directed to use and introduction of a microbial opsin into embryonic stem cells to develop optogenetic technology for stem cell engineering applications, with a novel automated system for noninvasive modulation of embryonic stem cell differentiation employing fast optics and optogenetic control of ion flux.
[0048] In one experimental embodiment, mouse embryonic stem cells (ESCs) were stably transduced with ChR2-YFP and purified by FACS. Illumination of resulting ChR2-ESCs with pulses of blue light triggered strong inward currents. These labeled ESCs retained the capability to differentiate into functional mature neurons, assessed by the presence of voltage-gated sodium currents, action potentials, fast excitatory synaptic transmission, and expression of mature neuronal proteins and morphology. Optically stimulating ChR2-ESCs during the first 5 days of neuronal differentiation, with high-speed optical switching on a custom robotic stage and environmental chamber for integrated optical stimulation and automated imaging, drove increased expression of neural markers. These data point to potential uses of ChR2 technology for chronic and temporally precise noninvasive optical control of embryonic stem cells both in vitro and in vivo, ranging from noninvasive control of stem cell differentiation to causal assessment of the specific contribution of transplanted cells to tissue and network function.
[0049] As another aspect of the present invention and useful alone or in combination with other aspects disclosed herein, optogenetic technology (e.g., as described herein) may be used to selectively affect certain cell types, rendering target cell types sensitive to light while other cell types remain insensitive to light. In this manner, such a system effectively differentiates between various cell types. In this regard, development of one cell type can be distinguished from other cell types by creating a viral vector in which a cell-type-specific promoter gene sequence sits immediately adjacent to the portion which codes for an opsin such as ChR2 or NpHR. As specific examples, glial cells may be targeted by use of a GFAP promoter; neurons in general by a Synapsin-I promoter; excitatory neurons by a CaMK2-alpha promoter; inhibitory neurons by a VGAT promoter; endothelial cells by a TIE-1 promoter, and stem cells including progenitor cells by a nestin promoter.
EXPERIMENTAL RESULTS
[0050] Transduction of Mouse ESCs with ChR2
[0051] To assess the potential of optogenetics in stem cells, mouse ESCs were transduced with a lentiviral ChR2-YFP-construct under the control of the EFla promoter; after sorting for the top 5% based on YFP fluorescence intensity, we found that the population doubling time and vitality of the resulting ChR2-YFP-ESCs did not differ significantly compared to non-transduced ESCs (not shown), and confocal microscopy demonstrated membrane localization of ChR2-YFP with high, uniform expression levels in the ESC population. ChR2-ESCs continued to express the embryonic stem cell marker SSEAl and Oct4 (not shown), maintaining the undifferentiated state as did non-transduced control cells. Electrophysiologically, the ChR2-ESCs displayed typical outwardly rectifying and passive currents, while illumination with blue light (470 nm, 500 ms pulse duration) evoked inward photocurrents (
[0052] The microbial opsins, including ChR2, require a chromophore (all-trans-retinal) to absorb incoming blue photons and gate the conformational change of the protein. A surprising finding in the development of microbial opsins for neurobiology was that mammalian neurons (but not invertebrate neurons) appear to have sufficient endogenous retinoids to allow ChR2 to function without addition of any chemical cofactors. If optogenetics is to become a useful tool in stem cell engineering, it will be important to determine in stem cells the extent of dependence on exogenous chemicals like retinoids both in vitro and in vivo. No retinoids were added for the in vitro experiments described above; to further determine dependence or independence from exogenous retinoids in vivo, 5105 ChR2-YFP expressing ESCs were stereotaxically injected into the cortex of healthy rats. One week after transplantation, animals were sacrificed and in acute slices, transplanted cells could be identified by YFP fluorescence. To test whether transplanted ChR2-ESCS could still respond to optical Stimulation, patch clamp recordings were conducted, revealing inward currents upon illumination with blue light (
Differentiation of ChR2-ESCs
[0053] Intracellular Ca.sup.2+ is a major mediator of differentiation and survival in stem cells and their progeny, especially in neural lineages. ChR2 itself is a nonselective cation channel that directly allows Ca.sup.2+ entry into cells. Additional routes of photo-evoked Ca.sup.2+ entry could include activation of voltage-gated Ca.sup.2+ channels (VGCCs) by virtue of ChR2-induced membrane voltage changes. Notably, we find that mouse ES cells express four major VGCCs assessed by RTPCR and immunoreactivity (
[0054] We first verified that ChR2-ESCs were capable of neural lineage differentiation, using a retinoic acid-based neural differentiation protocol (
Optical Modulation of Neural Differentiation
[0055] One challenge in deriving replacement tissues from ES cells is that the cell-type specification and phenotype consolidation processes, and therefore also the patterning and differentiation stimuli, take place over many days; to be applicable, optogenetic stimulation must therefore be deliverable in chronic fashion. In designing the system to meet this challenge, it is also important to consider that since knowledge of the precise combinations and timing of signaling events required for stem cell differentiation is limited, a multiwall configuration would in principle be desirable, to allow for fast optical mapping of cell lines, conditions, and differentiation space in the laboratory. We therefore devised an automated multiwell optogenetic stimulation approach designed to precisely revisit and optically stimulate multiple regions of interest (ROIs) in defined patterns over extended periods of time (
[0056] ROIs in multiwell plates were user-defined in a custom GUI and their locations saved for rapid and reproducible access by a robotic stage (
[0057] In a typical experiment, ESCs were seeded in a 24 well plate, at a density of 100,000 cells/ml and 1 ml/well. To directly capitalize on the advantages of the multiwall plate format, certain wells were seeded with native ESCs and others with ChR2-YFP ESCs; moreover specific wells were programmed to receive optical stimulation; finally, in combinatorial fashion, different wells within groups received different concentrations of differentiation factors (for example, the neural lineage factor retinoic acid at 0, 1, or 2.5 M). In this way differentiation space could be efficiently mapped while controlling for nonspecific effects related to the rig or to illumination. Cells were stimulated for 5 days with blue light (470 nm at 15 Hz for 10 s) delivered every 60 min using a 10 objective. The survival and morphology of the cells was monitored using time-lapse imaging every 8 hours (
[0058] To identify rapidly-acting effects of optical stimulation on ESC differentiation, cells were simultaneously assayed following the conclusion of stimulation (
[0059] Accordingly, the present invention presents an application of optical control technology to stem cell engineering, and demonstrates the potential of the optogenetic approach by successfully expressing and driving the light-gated cation channel channelrhodopsin-2 in mouse embryonic stem cells. We found that ChR2-YFP ESCs were viable and maintained the undifferentiated state, and also retained the capability to generate electrophysiologically mature neurons when differentiated. Moreover, pulsed illumination with blue light evoked precise and robust cation currents in ESCs, enabling reproducible and predictable control of ion flux without requiring addition of chemical cofactors either in vitro or within intact brain tissue. By developing automated multiwell optogenetic stimulation tools, we were able to deliver optical stimulation in combinatorial experiments over extended periods of time with high spatiotemporal precision, and found that optogenetic stimulation could modulate neural lineage progression in the presence of 2.5 M RA.
[0060] As specifically discussed in connection with the underlying provisional documents, depolarization has been reported in other studies to modulate neural differentiation processes in dividing cells, and indeed depolarization and calcium waves have both been observed in proliferating GNS progenitors in situ; for example, in early CNS development, Momose-Sato et al. demonstrated spontaneous depolarization waves, and Kriegstein and colleagues observed calcium waves in cortical progenitors. Likewise in postmitotic neurons, depolarization plays additional important roles in CNS development, affecting spine development and synaptic plasticity. In connection with the present invention, it is now believed that while the specific signal transduction cascades mediating the influence of membrane depolarization events in early development remains unclear, the Ca.sup.2+ and Ca.sup.2+ channels may play a key role and ChR2 is well suited to recruit these mechanisms. Emerging evidence points to the expression of VGCCs during early stages of embryonic, and in accordance with aspects of the present invention, this allows ChR2 to recruit Ca.sup.2+ dependent cellular processes not only via its own light-activated Ca.sup.2+ flux but also by activating native VGCCs as differentiating cells mature. According to other aspects, lineages arising from ESCs also are to be modulated by Ca.sup.2+, including cardiac cells and others reporting on enhancement of hematoendothelial differentiation upon chronic depolarization of human ESCs). In all of these cases, as we observed with the RA gating of optogenetic modulation, depolarization or Ca.sup.2+ influx is a function of other patterning and lineage-specific differentiation factors.
[0061] Recent studies have shown the induction of pluripotent stem cells (iPS) from somatic cell, significantly expanding the possible sources of stem cells in regenerative medicine but further highlighting the ongoing need for selective and highly sensitive stem cell differentiation and control tools. Globally applied stimuli such as growth factors and organic compounds will affect all cells present, including non-dividing constituents of the stem cell niche as well as the stem cells and their progeny, but it is unlikely that these growth factors will have the same desired effect in all of the very different cells present in the typical differentiation milieu. By targeting optical control to either the proliferating cells or to niche constituents like astrocytes, optogenetic control of intracellular signaling will allow selective control of the desired cell type.
[0062] Indeed, this optical specificity principle extends to the selective control of fully differentiated stem cell progeny in situ. Minimally invasive fiberoptic strategies have brought optogenetics to the fully intact, behaving mammal. Transplanted cells may require electrical activity to drive the final stages of phenotype consolidation and to fully integrate into host neural circuitry, representing the central goal of stem cell based regeneration medicine.
[0063] Compared to conventional electric stimulation or drugs, the genetic targeting of ChR2 makes it possible to specifically and reversibly drive precise amounts of activity in the transplanted ESCs and their progeny, which moreover do not require addition of chemical cofactors in vivo for ChR2 function. Finally, optically driving only the transplanted cells, with behavioral readouts or non-invasive imaging readout modalities like fMRI (and without the serious problem of signal interference from metal electrodes), opens the door to imaging and tuning the specific contribution of transplanted cells in the restoration of network activity and circuit dynamics, for example in Parkinson's disease. With these approaches and others, optogenetic technologies are applicable as valuable tools in stem cell biology and regenerative medicine.
EXPERIMENTAL METHODS
Mouse Embryonic Stem Cell Culturing
[0064] Mouse embryonic stem cells (CRL-1934, ATCC, Manassas, USA) were grown in DMEM medium (ATCC) containing medium conditioned by feeder cells (CRL-1503, ATCC), 15% fetal calf serum (Gibco), 15 ng/ml leukemia inhibitory factor (LIF; Sigma-Aldrich), 0.1 mM 2-mercaptoethanol (Sigma-Aldrich), and 1% penicillin-streptomycin (Sigma-Aldrich). The cells were cultured in 75 cm.sup.2 cell culture flasks (Falcon) with 20 ml medium at 37 C. and 5% CO.sub.2 and passaged every 3 days. Only undifferentiated cells in suspension were used for the experiments. After washing in phosphate-buffered saline (PBS) (Gibco, Invitrogen), cells were counted in a Neubauer counting chamber. The viability was determined by staining with trypan blue solution (0.4%; Sigma-Aldrich).
Transduction of ESCs with ChR2
[0065] Lentiviruses carrying the ChR2-EYFP fusion gene under the control of the EF-1-alpha promoter were generated as previously described. Viruses were concentrated via ultracentrifugation and redissolved in PBS at 1/1000 of the original volume. The concentrated viruses were then incubated with ESCs for 24 hr and transduction efficiency evaluated using fluorescent microscopy one week after transduction. To obtain a highly and homogenously expressing ChR2-ESC colony, cells were sorted using FACS; a subpopulation consisting of the top 5% of YFP-expressing cells was collected.
Neuronal Differentiation of Embryonic Stem Cells
[0066] Neuronal differentiation was performed as previously described, with modifications. ESCs were plated on matrigel-coated dishes in embryoid body stage in complete ESC medium (see above). 24 hours later, medium was changed to ESC medium lacking LIF and including 5 M retinoic acid, and changed every second day for 5 days. As a second differentiation step, cells were incubated with neural expansion medium for 7 days consisting of N2 supplement, SHH (50 ng/ml), FGF-8b (100 ng/ml), bFGF (10 ng/ml) and ascorbic acid (200 M, Sigma) in DMEM/F12 and changed every two days. Thereafter cells were cultured in N2 and ascorbic acid in DMEM/F12.
Immunohistochemical Staining of Cultured Cells
[0067] Cells were fixed with 4% paraformaldehyde in PBS for 30 min at room temperature. Fixation was stopped by washing cells three times with 0.1M glycine/PBS. Cells were permeabilized and blocked (4% BSA/0.4% saponin/PBS) for 30 min and incubated in primary antibody solution at 4 C. overnight. Cells were washed 4 times and incubated with secondary antibody at room temperature for 2 hr. Cells were washed 3 with PBS, and at the final washing step DAPl was added (1:50,000). Coverslips were mounted using anti-quenching Fluoromount. Primary antibodies were mouse anti-SSEA1 (Chemicon 1:300), mouse anti-nestin (Chemicon 1:200), chicken anti-ill tubulin (Chemicon 1:200), mouse anti MAP2ab (Sigma 1:500), rabbit anti vGlut 2 (Chemicon 1:200), and rabbit anti-a1C, -a1D, -a1G, and -a1H (all Alomone labs; 1:200). Cy3 or Cy5 conjugated donkey anti mouse, chicken and rabbit secondary antibodies (Jackson) were all used at 1:200.
[0068] Cells were homogenized by Homogenizer (Invitrogen). RNA isolation was performed using Micro-to-Midi Total RNA Purification System (Invitrogen). Prior to RT-PCR, RNA samples were pretreated with DNasel (Invitrogen) and reverse transcription conducted per manufacturer's protocol. Negative controls without reverse transcriptase did not result in amplified sequences. Mouse hippocampal total RNA was purchased from Clontech and the resulting cDNA served as a positive control. For PCR analysis, primers targeted to coding regions of two subunits each from both the L- and T-type VGCC families were used, as follows: L-type a1C Forward: GTGGTTAGCGTGTCCCTCAT Reverse: GTGGAGACGGTGAAGAGAGC; L-type a1D F: AATGGCACGGAATGTAGGAG R: GACGAAAAATGAGCCAAGGA; T-type a1G F: CTGAGCGGATCTTCCTAACG R: TGAAAAAGGCACAGCAGATG; T-type a1H F: TGGGAACGTGCTTCTTCTCT R: TGGGCATCCATGACGTAGTA; Housekeeping gene (Actin) F: GGCATTGTGATGGACTCCGG R: TGCCACAGGATTCCATACCC. 293 FT kidney cells did not express these channel subunits, as expected (
Long-Term Optical Stimulation of ESCs
[0069] Key components of the hardware interface include (a) Oasis4i Controller (Objective Imaging) (hardware for x-y-z 3-axis and focus control) (http://ww.objectiveimaging.com/Download/OI_Download.htm-software development kit (SDK) for the Oasis4i Controller), (b) DG4 Ultra High Speed wavelength switcher (Sutter), (c) Retiga SRV Camera (Qimaging), and (d) Leica DM6000 Microscope controlled by AHM (Abstract Hardware Model) controller. The parallel port is controlled using DLPORTIO library file (www.driverlinx.com/DownLoad/DIPortlO.htm-Dlls to for parallel port control) and camera parameters (gain, exposure) set using QCam SDK (Ver. 5.1.1.14) (http://ww.qimaging.com/support/downloads/-SDK to control the Retiga SRV/Exi Cameras). The custom software user interface to the optogenetic stimulation setup was developed using the Microsoft Foundation Library (MFC; Ver. 8.0) and is available on request. Briefly, regions of interest (for example, an embryoid body or a small well in a multiwall plate) to be stimulated and/or imaged are selected using the Oasis4i Controller, and their locations saved using the MFC interface. Stimulation parameters (excitation filter wavelength, the duration of the excitatory pulse, and the frequency and duty cycle of excitation) are then set in the custom GUI. To allow stimulation space to be mapped, each region of interest can be readily programmed to receive a different stimulus pattern to operate over the many days of stimulation and imaging. Similarly, imaging parameters can also be varied for selected regions, including number of images per region and exposure, gain, excitation and emission filters.
[0070] Undifferentiated cells were seeded on matrigel (BD) coated coverslips in 24-well plates in complete ESC medium at a density of 100,000 cells/well. Both native ESCs and ChR2-expressing ESCs were used in different wells on the same plate. 24 hours after seeding, medium was changed to the various experimental conditions including complete ESC medium, ESC medium lacking both LIF and conditioned media from feeder cells (differentiation medium), differentiation medium with 1 M retinoic acid (RA) (Sigma), and differentiation medium with 2.5 M RA. Optical stimulation was conducted using the previously-described tools (
Confocal Microscopy and Image Analysis
[0071] Confocal imaging was conducted using the Leica SP2 confocal microscope and a 40 oil objective (NA 0.75). For DAP1 excitation, a 402 nm diode laser was used; Cy5-nestin was excited using a 633 nm HeNe laser. 6 ROIs were randomly and blindly selected for analysis per coverslip, and 10241024 8-bit confocal images were obtained. For each ROI, a z-stack with 8-12 x-y-sections and a z step size of 0.98 m were collected, thereby including all cells present in the ROI. Data analysis was conducted using ImageJ (NIH, USA) software, and after unblinding, confocal images of all ROIs of all coverslips of each condition (e.g., ChR2-ESCs, optically stimulated, 2.5 M RA) were converted into a single z-stack. Fluorescence intensity histograms were calculated for DAP1 and nestin channels. DAN histograms reflecting the cell numbers allowed for a normalization of nestin histograms. All nestin voxel numbers have been divided by this DAP1 factor. Statistical analysis was conducted using SPSS (Chicago, USA) software. To statistically compare histograms, the parameter-free Kolmogorov-Smirnov test was employed, and to compare means, statistical significance was calculated using the t-test.
Stereotactic Cell Transplantation
[0072] Rats (male Wistars, 250-350 g) were the subjects of these experiments. Animal husbandry and all aspects of experimental manipulation of our animals were in strict accord with guidelines from the National Institute of Health and approved by members of the Stanford Institutional Animal Care and Use Committee. Rats were anaesthetized by i.p. injection (90 mg ketamine and 5 mg xylazine per kg of rat body weight). For cell transplantation, a 1 mm craniotomy was drilled over motor cortex. 1 L of ESCs expressing ChR2-EYFP fusion protein at a density of 50k cells/L, suspended in PBS were injected (26 g Hamilton Syringe) into rat motor cortex (AP+1.5 mm, ML+1.5 mm, DV+1.5 mm) The injection duration was 10 min; an additional 10 min delay followed before syringe withdrawal, and electrophysiology was conducted after 1 week.
Electrophysiology
[0073] For acute slice electrophysiological experiments, 1 week post cell transplantation, 250 m cortical slices were prepared in ice-cold cutting buffer (64 mM NaCl, 25 mM NaHCO.sub.3, 10 mM glucose, 120 mM sucrose, 2.5 mM KCl, 1.25 mM NaH.sub.2PO.sub.4, 0.5 mM CaCl.sub.2 and 7 mM MgCl.sub.2, equilibrated with 95% O.sub.2/5% CO.sub.2) using a vibratome (VT 1000 S; Leica). After a recovery period of 30 min in cutting buffer at 32-35 C., slices were gently removed to a recording chamber mounted on an upright microscope (DM LFSA, Leica) and continuously perfused at a rate of 3-5 ml/min with carbonated ACSF (124 mM NaCl, 3 mM KCI, 26 mM NaHCO.sub.3, 1.25 mM NaH.sub.2PO.sub.4, 2.4 mM CaCl.sub.2, 1.3 mM MgCl.sub.2, 10 mM Glucose), ventilated with 95% O.sub.2/5% CO.sub.2.ChR2-YFP-ESCs were identified on an upright fluorescence microscope (DM LFSA, Leica) with a 20, 0.5 NA water immersion objective and a YFP filter set. Images were recorded with a CCD camera (Retiga Exi, Qimaging) by Qimaging software. Electrophysiological recordings in cultured ChR2-YFP ESCs were performed as previously described, in Tyrode solution containing (in mM) NaCl 125, KCI 2, CaCI.sub.23, MgCl.sub.2 1, glucose 30 and HEPES 25 (pH 7.3 with NaOH). Membrane currents were measured with the patch-clamp technique in whole-cell mode using Axon Multiclamp 700B (Axon Instruments) amplifiers. Pipette solution consisted of (in mM): 97 potassium gluconate, 38 KCI, 6 NaCl, 0.35 sodium ATP, 4 magnesium ATP, 0.35 EGTA, 7 phosphocreatine and 20 HEPES (pH 7.25 with KOH). Pipette resistance was 4-8 M. Membrane potential was noted at the time of establishing the whole cell configuration. We employed pClamp 9 acquisition software (Axon Instruments), a DG-4 high-speed optical switch with 300 W xenon lamp (Sutter Instruments) and a GFP filter set (excitation filter HQ470/40x, dichroic Q495LP; Chroma) to deliver blue light for ChR2 activation. Through a 20 objective lens, power density of the blue light was 8-12 mW/mm.sup.2, measured by power meter (Newport). All experiments were performed at room temperature (22-24 C.).
[0074] The various embodiments described above are provided by way of illustration only and should not be construed to limit the invention. Based on the above discussion and illustrations, those skilled in the art will readily recognize that various modifications and changes may be made to the present invention without strictly following the exemplary embodiments and applications illustrated and described herein. Such modifications and changes do not depart from the true spirit and scope of the present invention, which is set forth in the following claims.