Method for Producing Isoprene Using Recombinant Halophilic Methanotroph

20170211100 ยท 2017-07-27

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention relates to a recombinant methanotroph having an ability to produce isoprene and a method for producing isoprene using the same, and more particularly to a recombinant methanotroph having an ability to produce isoprene wherein a gene encoding an isoprene synthase having a homology of at least 70% to the amino acid sequence of Ipomoea batatas isoprene synthase is introduced into the recombinant methanotroph, and a method for producing isoprene using the recombinant methanotroph. The use of a recombinant methanotroph according to the present invention enables isoprene to be produced in high yield by using methane gas or methanol which is obtained from waste such as natural gas, biomass, municipal waste or the like as a carbon source.

    Claims

    1. A recombinant methanotroph having an ability to produce isoprene, into which a gene encoding an isoprene synthase having a homology of at least 70% to an amino acid sequence of SEQ ID NO: 1 is introduced.

    2. The recombinant methanotroph of claim 1, wherein the methanotroph is selected from the group consisting of Methylomonas, Methylobacter, Methylococcus, Methylosinus, Methylocystis, Methylomicrobium, Methanomonas, Methylocella, and Methylocapsa.

    3. The recombinant methanotroph of claim 2, wherein the methanotroph is Methylomicrobium alcaliphilum.

    4. A method for producing isoprene, the method comprising the steps of: (a) culturing the recombinant methanotroph of claim 1 in the presence of methane or methanol as a carbon source, thereby produce isoprene; and (b) recovering the produced isoprene.

    5. The method of claim 4, wherein the recovery of isoprene in step (b) is performed by any one method selected from the group consisting of gas chromatography (GC), gas chromatography-mass spectrometry (GC-MS), gas stripping, distillation, polymer membrane separation, adsorption/desorption by pervaporation, thermal desorption, vacuum desorption, and solvent extraction.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0015] FIG. 1 shows the amount of isoprene produced by a recombinant methanotroph according to the present invention.

    [0016] FIG. 2 shows the results of GC-MS analysis of isoprene in a culture of a recombinant methanotroph according to the present invention.

    [0017] FIG. 3 shows the results of producing isoprene by a recombinant methanotroph according to the present invention in the presence of a methane substrate.

    DESCRIPTION OF THE INVENTION

    [0018] In the present invention, in order to produce isoprene in high yield by use of methanol or methane as a carbon source, a recombinant methanotroph was constructed by introducing an Ipomoea batatas isoprene synthase gene (IspS) into a halophilic methanotroph. It was found that the recombinant methanotroph exhibited the ability to produce isoprene, which did not appear in a wild-type methanotroph.

    [0019] The methanotroph that is used in the present invention is a halophilic methanotroph capable of producing DMAPP through the MEP metabolic pathway by use of a carbon source as a substrate, and may contain genes encoding the following methylerythritol phosphate (MEP) pathway enzymes:

    [0020] (i) MEP pathway enzymes: 1-deoxyxyluose-5-phosphate synthase (DXS), 1-deoxy-D-xyluose 5-phosphate reductoisomerase (DXR), 1-deoxy-D-ribulose 5-phosphate reductoisomerase (DRL), 4-diphophocytidyl-2C-methyl-D-erythritol synthase (ispD), 4-diphosphocytidyl-2-C-methylerythritol kinase (ispE), 2C-methyl-D-erythritol 2,4-cyclodiphosphate synthase (ispF), 1-hydroxy-2-methyl-2-(E)-butenyl 4-diphosphate synthase (ispG), isopentenyl-diphosphate: NAD(P)+oxidoreductase (ispH), and isopentyl diphosphate isomerase (IDI).

    [0021] Therefore, in one aspect, the present invention is directed to a recombinant methanotroph having an ability to produce isoprene wherein a gene encoding an isoprene synthase having a homology of at least 70% to an amino acid sequence of SEQ ID NO: 1 is introduced in the recombinant methanotroph.

    [0022] In the present invention, the isoprene synthase having an amino acid sequence of SEQ ID NO: 1 is an Ipomoea batatas isoprene synthase (IspS) showing high isoprene production efficiency.

    [0023] A gene having the highest homology to the Ipomoea batatas IspS gene is Olea europaea terpene synthase 3 which merely shows a homology of 68% to the Ipomoea batatas IspS gene, thereby the IspS gene used in the present invention is a novel enzyme having a very low homology to a conventional terpene synthase.

    [0024] In the present invention, the gene encoding an isoprene synthase may have a homology of preferably at least 70%, more preferably at least 80%, even more preferably 90%, and most preferably 95% to an amino acid sequence of SEQ ID NO: 1

    [0025] In the present invention, the methanotroph may be selected from the group consisting of Methylomonas, Methylobacter, Methylococcus, Methylosinus, Methylocystis, Methylomicrobium, Methanomonas, Methylocella, and Methylocapsa. Preferably, the methanotroph that can be used in the present invention may be Methylomicrobium alcaliphilum, but is not limited thereto.

    [0026] In an example of the present invention, the Ipomoea batatas IspS gene was introduced into Methylomicrobium alcaliphilum 20Z (DSM 19304), thereby constructing a recombinant methanotroph having an ability to biosynthesize isoprene.

    [0027] In another aspect, the present invention is directed to a method for producing isoprene, comprising the steps of: (a) culturing the recombinant methanotroph in the presence of methane or methanol as a carbon source to thereby produce isoprene; and (b) recovering the produced isoprene.

    [0028] The recovery of isoprene in step (b) may be performed by a known method such as gas chromatography (GC), gas chromatography-mass spectrometry (GC-MS), gas stripping, distillation, polymer membrane separation, adsorption/desorption by pervaporation, thermal desorption, vacuum desorption, solvent extraction or the like, but is not limited thereto.

    EXAMPLES

    [0029] Hereinafter, the present invention will be described in further detail with reference to examples. It will be obvious to a person having ordinary skill in the art that these examples are illustrative purposes only and are not to be construed to limit the scope of the present invention.

    Example 1

    Preparation of Recombinant Methanotroph by Introducing IspS Gene

    [0030] To construct the plasmid BlueScript-SK-IspS, primers of F_ibat_Nde [SEQ ID NO: 2] and R_ibat_Kpn [SEQ ID NO: 3] were synthesized and the IspS gene was amplified by PCR using a pair of primers of SEQ ID NOs: 2 and 3 and inserted into a pBlueScript vector using NdeI and KpnI restriction enzymes.

    [0031] Then the IspS gene was amplified from the pBlueScrip-SK-IspS using two sets of primers: Ptac-IspS-F(SEQ ID NO:4)/IspS-pawp78R(SEQ ID NO:5) and Phps-IspF (SEQ ID NO:6)/IspS-pawp78R(SEQ ID NO:5). The primers have a complementarity to Ptac or Phps or pAWP78 sequence at 5-end(overlap region) to facilitate the annealing of fragments. All the primers used are listed in Table 1 below.

    TABLE-US-00001 TABLE1 Primersequences SEQ Namesof IDNOS: primers Sequences(5>3) 2 F_ibat_Nde CATATGACTGCCCGCCGCTC 3 R_ibat_Kpn GGTACCCTATTCCACTGGATTAATGATAACTGAC 4 Ptac-IspS-F ccatgattacgaaaggaggacaATGACTGCCCGCCGCTCAGC 5 IspS-pawp78-R GCATCTTCCCGACAACTACTACTATTCCACTGGATTAATGATAAC 6 Phps-IspF GTAACTATCGGAGAAGAAACATGACTGCCCGCCGCTCAGCAAAC

    [0032] Ptac promoter and Phps promoter are functional synthetic hybrids derived from tac or hps promoters, respectively, and the 10 and the ribosome binding site from the hps and pmoA gene promoter, respectively.

    [0033] The amplified IspS fragments were linked with the corresponding promoter region and cloned into of pAWP78 (Puri, A. W. et al., Appl Environ Microbiol. 81(5): 1775-81, 2015) using Gibson assembly (NEBuilder HiFi DNA Assembly Master Mix from NEBlabs).

    [0034] The resulted fragments were transformed into NEB-5 competent E. coli. The transformed clones were cultured in LB+Kan (kanamycin) medium, and correctly assembled strains were screened by PCR. Gene constructs were obtained from 2-3 clones and sequenced to confirm it. The validated constructs (pAWP78::Ptac-ispS and pAWP78::Phps-ispS) were sub-cloned into E. coli S17-1, and incorporated into Methylomicrobium alcaliphilum 20Z (DSM 19304) by biparental mating (Ojala D. S. et al, Methods Enzymol. 495: 99-118, 2011). The recombinant Methylomicrobium alcaliphilum 20Z containing pAWP78::Ptac-ispS or pWP78::Phps-ispS were selected using a medium containing kanamycin (100 g/mL) and Rif (50 g/mL), which has the composition shown in Tables 2 to 5 below.

    Example 2

    Production of Isoprene from Recombinant Methanotroph in the Presence of Methanol Substrate

    [0035] To a 50-ml sterilized closed serum vial, 12.5 mL of a medium having the composition shown in Table 2 below was added, and 2 g/L of methanol as a carbon source was added. In Table 2, the compositions of a trace element solution, a phosphate solution and a carbonate solution are shown in Tables 3, 4 and 5, respectively. Methylomicrobium alcaliphilum 20Z transformed with the IspS gene which is constructed in Example 1, was inoculated into the medium and cultured at a temperature of 30 C. and a stirring speed of 250 rpm for 3 days.

    TABLE-US-00002 TABLE 2 Medium components Contents KNO.sub.3 1.0 g/L MgSO.sub.47H.sub.2O 0.2 g/L CaCl.sub.22H.sub.2O 0.02 g/L Trace solution (1000) 1 ml/L NaCl 30 g/L Phosphate solution 20 ml/L Carbonate solution 40 ml/L (1M, pH 8.8-9.0) dH.sub.2O Fill up to 1 L

    TABLE-US-00003 TABLE 3 Components of Trace Element Solution Contents (g/L) Na.sub.2EDTA 5 FeSO.sub.47H.sub.2O 2 ZnSO.sub.47H.sub.2O 0.3 MnCl.sub.24H.sub.2O 0.03 CoCl.sub.26H.sub.2O 0.2 CuSO.sub.45H.sub.2O 0.3 NiCl.sub.26H.sub.2O 0.05 Na.sub.2MoO.sub.42H.sub.2O 0.05 H.sub.3BO.sub.3 0.03 dH.sub.2O Fill up to 1 L

    TABLE-US-00004 TABLE 4 Components of Phosphate Solution Contents (g/L) KH.sub.2PO.sub.4 5.44 Na.sub.2HPO.sub.4 5.68

    TABLE-US-00005 TABLE 5 Components of Carbonate Solution Contents (g/L) NaHCO.sub.3 75.6 Na.sub.2CO.sub.3 10.5

    [0036] Next, the seed culture was inoculated into a freshly prepared serum vial, and then cultured for 3 days under the same conditions as described above, after which isoprene production was analyzed.

    [0037] The production of isoprene was analyzed by GC/FID (column: DB-5MS (60M length*0.25 mm I.D*0.25 mm thickness); inlet split ratio: 10:1; inlet temperature: 280 C.; oven temperature: initial 30 C. (10 min), ramp: 10 C./min, isothermal: 180 C. (0 min).

    [0038] As a result, as shown in FIGS. 1 and 2, a wild-type Methylomicrobium alcaliphilum 20Z strain did not produce isoprene, but the strain containing the pAWP78::Ptac-ispS or pWP78::Phps-ispS, constructed in Example 1, produced isoprene at a high concentration of about 50 g/ml.

    Example 3

    Production of Isoprene from Recombinant Methanotroph in the Presence of Methane Substrate

    [0039] To a 250 ml sterilized baffled flask, 50 ml of P medium was added, and the Methylomicrobium alcaliphilum 20Z recombinant strain transformed with the IspS gene was inoculated into the medium and cultured at 30 C. and 200 rpm for 24 hours. As a carbon source, 2 g/L of methanol was added. Next, the cultured cells were inoculated into a 1.5-L working volume of P medium in a 3-L fermenter and cultured at 30 C., 200 rpm or higher and pH 8.7-9. As a carbon source, methane gas (10 v/v %, 90% N.sub.2) was used. A mixture of the carbon source with air was injected, and isoprene was analyzed during culture of the cells. Off-gas was captured, and isoprene in the off-gas was analyzed. As a result, as shown in FIG. 3, isoprene production could be confirmed.