Human pluripotent stem cells induced from undifferentiated stem cells derived from a human postnatal tissue
09714433 ยท 2017-07-25
Assignee
Inventors
- Kazuhiro Sakurada (Kanagawa, JP)
- Tetsuya Ishikawa (Tokyo, JP)
- Hideki Masaki (Tokyo, JP)
- Shunichi Takahashi (Hyogo, JP)
Cpc classification
C12N5/0696
CHEMISTRY; METALLURGY
A61P25/28
HUMAN NECESSITIES
C12N2799/027
CHEMISTRY; METALLURGY
International classification
Abstract
Establishment of human pluripotent stem cells having properties close to human ES cells with the genome of the patient per se that can circumvent immunological rejection of transplanted cells from cells derived from a postnatal human tissue are described. Human pluripotent stem cells can be induced by introducing three genes of Oct3/4, Sox2 and Klf 4, or three genes of Oct3/4, Sox2 and Klf 4 plus the c-Myc gene or a histone deacetylase (HDAC) inhibitor of undifferentiated stem cells present in various human postnatal tissues in which each gene of Tert, Nanog, Oct3/4 and Sox2 has not undergone epigenetic inactivation.
Claims
1. A method for generating a human pluripotent stem cell, comprising the steps of: (i) introducing one or more retroviral vectors comprising a gene encoding Oct3/4, a gene encoding Sox2 and a gene encoding Klf4 into an isolated human post-natal cell; and (ii) culturing the cell of step (i) in the presence of an inhibitor of Rho kinase and/or a histone deacetylase inhibitor under conditions that maintain pluripotency and self-renewal, thereby generating a human pluripotent stem cell.
2. The method of claim 1, wherein the inhibitor of Rho kinase is Y-27632 or HA-1077.
Description
BRIEF DESCRIPTION OF DRAWINGS
(1)
(2)
(3)
(4) In the figure, W1, W2, W3, W4, W5 and W6 represent the number of each well of the 6-well plate used in Example 12.
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15) T-F1 and F2 figure shows teratoma that were derived from freeze-thawed iPS-1-8 mTeSR cells cultured for 134 days (passage 19). Human iPS-1-8 mTeSR cells were injected into SCID mouse testes and analyzed 46 days (T-F1) and 48 days (T-F2) after injection. Tissues consisting of three germ layers were observed. Melanocytes were also observed in T-F2 experiment. Pluripotency were maintained even via freezing and thawing.
(16)
(17)
(18)
BEST MODE FOR CARRYING OUT THE INVENTION
(19) Undifferentiated stem cells present in a human postnatal tissues are undifferentiated stem cells which are present in human postnatal skin, bone marrow, adipose tissue, skeletal muscle tissue, and peripheral blood, and tissues concomitant to birth such as placenta, umbilical cord and cord blood and in which the Tert, Nanog, Oct3/4 and Sox2 genes have not undergone epigenetic inactivation, and, by using a combination of induced expression of the three genes of Oct3/4, Sox2 and Klf4 and the induced expression of c-Myc or the addition of a histone deacetylase inhibitor, can induce human pluripotent stem cells having a long-term self-renewal ability and the pluripotency of differentiating into ectoderm, mesoderm and endoderm. The above human pluripotent stem cells may further have a potential of differentiating into primordial germ cells.
(20) Undifferentiated stem cells present in a human postnatal tissue can be cultured using a plastic culture dish. When a 2% serum is used, PDGF and EGF or FGF-2 may be added to the culture medium, to which IGF or insulin may further be added. In this case, when a culture medium containing serum is used for a long term culture, properties of undifferentiated stem cells present in a human postnatal tissue may change, and thus it is important to limit the serum concentration to 2% or less and the number of passages to about twice. When a 2% low concentration serum is used, the MAPC medium or the FBM medium, for example, is used as the culture medium. As the culture condition, an incubator at 37 C. and 5% CO.sub.2 is used similarly to common culture cells. It is also possible to use low concentration oxygen, for example a 3% oxygen concentration. Culture plates are preferably coated with fibronectin etc.
(21) The human pluripotent stem cells of the present invention induced from undifferentiated stem cells present in a human postnatal tissue may be cultured using a plastic culture dish. In the primary culture, cells after the four genes of Oct3/4, Sox2, Klf4 and c-Myc were introduced therein are cultured in a MEF-conditioned human ES cell medium to which 10 ng/ml bFGF and 10 ng/ml activin A had been added, and the medium is changed every 1 to 2 days. The pluripotent stem cells induced are detached with dispase, collagenase, trypsin or the like, and subcultured. When MEF is used as a supporting layer after the primary culture, the induced human pluripotent stem cells are plated on a MEF-covered plastic culture dish, and cultured in a human ES cell medium supplemented with 10 ng/ml bFGF. When the supporting cells are not used, the induced human pluripotent stem cells are plated on a matrigel-coated plastic culture dish, and cultured in a MEF-conditioned human ES cell medium supplemented with 10 ng/ml bFGF and 10 ng/ml activin A. In either of the culture methods, the medium is changed every 1 to 2 days.
(22) In order to induce the human pluripotent stem cells of the present invention from undifferentiated stem cells present in a human postnatal tissue in which each gene of Tert, Nanog, Oct3/4 and Sox2 has not undergone epigenetic inactivation, the following method may be used. First, an adenovirus vector is constructed carrying cDNA having the sequence of coding region of the mouse-derived cationic amino acid transporter (mCAT) gene (see Example 2, Table 1), which is then introduced into the packaging cell based on the HEK293 cell to prepare a virus solution of the adenovirus vector. The virus solution is added at a multiplicity of infection (m.o.i.: the ratio of the number of virus particles to the number of cells) of 1 to 20 to undifferentiated stem cells present in a human postnatal tissue in which each gene of Tert, Nanog, Oct3/4 and Sox2 has not undergone epigenetic inactivation, and thus undifferentiated stem cells expressing mCAT are prepared.
(23) Then, a retrovirus vector carrying cDNA encoding human Oct3/4, a retrovirus vector carrying cDNA encoding human Sox2, a retrovirus vector carrying cDNA encoding human Klf4, and a retrovirus vector carrying cDNA encoding human c-Myc are constructed (Table 1), and then each of them is introduced into the packaging cell capable of producing an ecotropic recombinant virus constructed based on the HEK293 cell to prepare a virus solution of retrovirus vectors.
(24) To the undifferentiated stem cells in which mCAT has been expressed using an adenovirus vector and in which each of the Tert, Nanog, Oct3/4 and Sox2 genes has not undergone epigenetic inactivation, four types of retrovirus vectors each carrying the four genes (coding regions) of Oct3/4, Sox2, Klf4 and c-Myc, respectively, are added at a m.o.i. of 1 to 200 per virus vector to establish the induction of the human pluripotent stem cells of the present invention.
(25) To the undifferentiated stem cells in which mCAT has been expressed using an adenovirus vector and in which each of the Tert, Nanog, Oct3/4 and Sox2 genes has not undergone epigenetic inactivation, three types of virus vectors each carrying the genes (coding regions) of Oct3/4, Sox2 and Klf4, respectively, at a m.o.i. of 1 to 200 per virus vector, as well as MS-275 at a final concentration of 10 nM to 100 M, preferably 100 nM to 1 M, are added to establish the induction of the human pluripotent stem cells of the present invention.
(26) It is preferred that the human pluripotent stem cells of the present invention after being suspended in the Cryopreservation Medium For Primate ES Cells (manufactured by ReproCELL), preferably are rapidly frozen in liquid nitrogen, and stored in a liquid nitrogen storage vessel.
(27) It is preferred that the pluripotent stem cells of the present invention that were stored frozen are rapidly thawed by suspending in a medium that had been warmed to 37 C., removing the medium from the suspension by centrifugation, and then suspending again in a fresh medium to start culturing.
(28) The following explains a method in which, by applying the present invention, siRNA and a compound that inhibit the induction from undifferentiated stem cells present in a human postnatal tissue in which the Tert, Nanog, Oct3/4 and Sox2 genes have not undergone epigenetic inactivation to human pluripotent stem cells are searched using a high throughput screening system.
(29) siRNA represents a double stranded RNA that comprises about 19 base pairs which is part of the sequence of a gene, and that has an effect of inhibiting the translation of the gene to the protein due to RNA interference. When siRNA of a gene is introduced into a cell, only the function carried by the protein can be specifically deleted. Thus, by using a whole genome siRNA library in a specific cell, the state in which the function of only one gene among all the genes was deleted can be observed individually for every gene.
(30) Thus, by using the above siRNA library, it is possible to identify a gene that inhibits the induction from a undifferentiated stem cell present in a human postnatal tissue in which the Tert, Nanog, Oct3/4 and Sox2 genes have not undergone epigenetic inactivation to a human pluripotent stem cell. By developing an inhibitor of the gene using this method, it is possible to induce human pluripotent stem cells from undifferentiated stem cells present in a human postnatal tissue.
(31) As the siRNA library, those in which four siRNA's are synthesized for each gene of a total of about 25,000 human genes, mixed in equal amounts, and dispensed in a 384-well culture plate are used, and subjected to screening (manufactured by Qiagen). Details of it are as follows. Four siRNA's synthesized for each gene are mixed in equal amounts, and 2.5 pmol each is dispensed in each well of a 384-well culture plate. In order to cover all of about 25,000 genes, seventy three 384-well culture plates are needed. To predetermined wells of each plate, 2.5 pmol each of the positive and negative control siRNAs is dispensed in order to determine the introduction efficiency of siRNA into the cell and to correct for efficiency of each plate. The final concentration of siRNA is 50 nM.
(32) After siRNA was prepared, a primary screening is conducted. As methods of detecting the activation of genes that could be an index for differentiation into the pluripotent stem cells of the present invention such as Tert, Nanog, Oct3/4 and Sox2 in the cell to be targeted, there are the promoter reporter assay of the gene of interest [as the reporter gene, EGFP (enhanced green fluorescence protein), luciferase etc.], the immunocytochemical staining method to said gene product, and the like.
(33) For transfection of siRNA to the cell, the lipofection method may be used. To each well of a total of 73 plates in which siRNA has been dispensed, 0.1 l of LipofectAMINE RNAiMax (manufactured by Invitrogen) in 10 l of Opti-MEM (manufactured by Invitrogen) is dispensed. Ten minutes later, target cells prepared at 20 to 25 cells/l in up to 40 l of the medium are dispended to every well on the 73 plates to introduce siRNA into the cell. The number of cells and the amount of the medium are determined as appropriate depending on the cell used for screening.
(34) In conducting a reporter assay, cells in which a reporter system has been permanently integrated with a retrovirus vector (including lentivirus) or cells 1 to 7 days after infection with an adenovirus vector carrying the reporter system of interest are used for cells such as adult stem cells for which gene introduction by the lipofection method or the calcium phosphate method is difficult. When the reporter system of the present invention is applied to cultured lined cells such as HEK293 cells and Hela cells, the reporter system should be introduced one day in advance or simultaneously with siRNA by a gene introduction method suitable for respective cells.
(35) The entire 73 plates to which transfection reagents and cells have been dispensed are cultured in a culturing equipment maintained at 37 C. and 5% CO.sub.2 for 2 to 7 days. The culturing time may vary as appropriate depending on the type of the cell, the gene to be detected, and the like.
(36) As a method of selecting siRNA that promotes the induction from undifferentiated stem cells present in a human postnatal tissue to human pluripotent stem cells, alkaline phosphatase staining can be used. As the alkaline phosphatase staining method, the following method can be mentioned. After removing the culture liquid from each well, cells are fixed in a 10% formaldehyde solution at room temperature for 2 to 5 minutes, washed with a phosphate buffer etc., and a chromogenic substrate of alkaline phosphatase, nitroblue tetrazolium chloride/5-bromo-4-chloro-3-indolyl phosphatase para-toluidine salt solution (hereinafter referred to as the NBT/BLIP solution) is added and reacted at room temperature for 20 to 30 minutes.
(37) Also when a compound library is used, the method used is conducted similarly to the above screening used for siRNA. The compound in stead of siRNA is spotted in each well, the cell is dispensed and cultured, and similarly determined. The transfection procedure is not necessary.
EXAMPLES
Example 1. Preparation of Retrovirus Vector
(38) The retrovirus vector plasmids for the four genes of Oct3/4-pMx, Sox2-pMx, Klf4-pMx and c-Myc-pMx constructed as in Table 1 were introduced into the packaging cell, the Plat-E cell [Experimental Hematology, 2003, 31 (11): 1007-14], using Fugene HD (manufactured by Roche). During 24 to 48 hours after retrovirus vector introduction, the medium was replaced with a medium suitable for the cell to which gene is to be introduced. After culturing the Plat-E cell to which retrovirus vector was introduced for more than 4 hours, the supernatant was recovered and passed through a filter of 45 m in diameter (manufactured by Millipore). By the above procedure, the retrovirus vector solutions of the four genes (Oct3/4, Sox2, Klf4 and c-Myc) were prepared.
(39) The retrovirus vector plasmids for the three genes of Oct3/4-pMx, Sox2-pMx, Klf4-pMx and c-Myc-pMx were introduced into the packaging cell, the Plat-E cell, using Fugene HD (manufactured by Roche). During 24 to 48 hours after retrovirus vector introduction, the medium was replaced with a medium suitable for the cell to which gene is to be introduced. After culturing the Plat-E cell to which retrovirus vector was introduced for more than 4 hours, the supernatant was recovered and passed through a filter of 45 m in diameter (manufactured by Millipore). By the above procedure, the retrovirus vector solution of the three genes (Oct3/4, Sox2 and Klf4) were prepared.
Example 2. Preparation of Adenovirus Vector
(40) According to the present invention, it was necessary to introduce genes including an oncogene (c-Myc) into human cells by retrovirus vector in order to induce pluripotent stem cells. In this case, when a gene is introduced into human cells using an amphotropic retrovirus vector which can infect into human cells, there is a risk of infection to human cells other than the cells of interest. Thus, in preparation for safe experiment, an ecotropic retrovirus vector that infect the rodent cells but not human cells and an adenovirus vector carrying gene encoding its receptor which is mouse-derived cationic amino acid transporter 1 (mCAT1) were combined and used in gene introduction into the human cells.
(41) First, an adenovirus vector carrying cDNA having the sequence of coding region of the mouse-derived cationic amino acid transporter (mCAT1) gene was constructed. Specifically, Adeno-X Expression System 1 kit (manufactured by TakaraBio Clontech) was used. In Adeno-X Expression System 1 kit, based on the experimental method attached to the kit by TakaraBio, the mCAT1 gene was subcloned into the multi-cloning site of a vector called pShuttle.
(42) Subsequently, an expression cassette was excised by the PI-Sce I site and the I-Ceu I site, cleavage sites on both ends of the expression cassette of pShuttle, and a DNA fragment containing the desired gene was inserted in between the PI-Sce I site and the I-Ceu I site in the Adeno-X Viral DNA in the above kit, which was then treated with a restriction enzyme Swa I to remove adenovirus DNA for which integration was unsuccessful. After the plasmid was transformed into an E. coli DH5 strain, whether the desired gene was correctly introduced into adenovirus DNA or not was confirmed by restriction enzyme treatment, PCR etc. The plasmid was prepared in large quantities, and cleaved with the Pac I restriction enzyme. Using the recombinant adenovirus DNA thus obtained, the gene was introduced into the HEK293 cells (MicroBix) plated in six wells using Lipofectamin 2000 (manufactured by Invitrogen), and two weeks later when the cell exhibited a cytopathic effect (CPE), the cells were collected as they are in the medium.
(43) Subsequently, after the cell suspension was subjected to freezing and thawing for three times, the cells were disrupted, and virus particles present in the cells were allowed to release into the liquid. The virus suspension thus prepared was added to one 100 mm plastic culture dish equivalent of HEK293 cells (510.sup.6 cells) to infect the cells, the virus was propagated. Furthermore, after virus was prepared in large quantities using four 150 mm plate equivalent of HEK293 cells, virus was purified using the Adenovirus Purification kit (manufactured by Clontech), and stored frozen at 80 C.
(44) The titer (plaque forming units, PFU) of the mCAT1 adenovirus vector was determined using the Adeno-X Rapid Titer kit. On a 24-well plate, HEK293 low cells were plated at a concentration of 510.sup.4 cells/500 l per well. Fifty l of serially diluted (from 10.sup.2 to 10.sup.7) virus vector was mixed with 500 l of the medium, and then used to infect the cells. After culturing at 5% CO.sub.2 and 37 C. for 48 hours, the medium was aspirated off, the cells were dried for 5 minutes, and then using 500 l of cold 100% methanol the cells were fixed by allowing to stand at 20 C. for 10 minutes. After aspirating off methanol, the wells were washed three times with 500 l of phosphate buffer containing 1% bovine serum albumin. A mouse anti-Hexon antibody was diluted 1000-fold with phosphate buffer containing 1% bovine serum albumin, and 250 l each of it was added to wells.
(45) After allowing to stand at 37 C. for 1 hour, the antibody solution was removed, and the wells were washed three times with 500 l of phosphate buffer containing 1% bovine serum albumin. Horseradish peroxidase-labelled rat anti-mouse immunoglobulin antibody was diluted 500-fold with phosphate buffer containing 1% bovine serum albumin, and 250 l was added to wells. After allowing to stand at 37 C. for 1 hour, the antibody solution was removed, and washed three times with 500 l of phosphate buffer containing 1% bovine serum albumin. 250 l of the DAB (diaminobenzidine) solution (10-fold DAB concentrate was diluted with a stable peroxidase buffer) was added to wells, and was allowed to stand at room temperature for 10 minutes. After aspirating off DAB, 500 l of phosphate buffer was added. Using a 20 objective lens, the number of brown positive cells in six viewing fields was counted.
(46) Radius of a standard 20 objective lens: 0.5 mm
(47) Area in one viewing field: 7.85310.sup.3 cm.sup.2
(48) Area of a well: 2 cm.sup.2
(49) Viewing field of a well: 2 cm.sup.2/7.85310.sup.3 cm.sup.2=254.7 viewing fields
(32/6)254.7/(0.5510.sup.5)=2.510.sup.8 ifu (infection unit)/ml
Example 3. Alkaline Phosphatase Staining
(50) Staining for confirming alkaline phosphatase activity which is a characteristic of pluripotent stem cells was conducted in the following manner. After removing the culture medium, a 10% formalin neutral buffer solution was added to wells, and cells were fixed at room temperature for 5 minutes. After washing with a phosphate buffer etc., a chromogenic substrate of alkaline phosphatase, 1 step NBT/BCIP (manufactured by Pierce) was added and reacted at room temperature for 20 to 30 minutes. Cells having alkaline phosphatase activity were all stained blue violet.
Example 4. Determination Gene Expression of a Colony by Quantitative PCR
(51) The expression of target gene of each colony including an alkaline phosphatase-positive colonies was determined using quantitative PCR in the following manner. Colonies developed by the induction of pluripotent stem cells were harvested, and RNA was extracted using the Recoverall total nucleic acid isolation kit for FFPE (manufactured by Ambion). After synthesizing cDNA from the extracted RNA, the target gene was amplified using the Taqman Preamp mastermix (manufactured by Applied Biosystems).
(52) As the primers for quantitative PCR, the Taqman gene exprESsion assay (manufactured by Applied Biosystems) was used. The following shows the name of the target gene and the product code of each primer. Human Hprt: Hs99999909_m1, human Nanog: Hs02387400_g1, human Tert: Hs00162669_m1, Mouse Hprt: Mm01545399_m1, mouse Nanog: Ma02019550_s1.
(53) As the positive control for quantitative PCR, cDNA extracted from mesenchymal stem cells established by the following manner was used.
(54) One vial (2.510.sup.7 cells) of human bone marrow-derived mononuclear cells (hBMMNCs (manufactured by Lonza), Lot 060175A: female, 21 years old, black) was thawed in a 37 C. water bath, and suspended in 10 ml of the MSCGM medium (a growth medium for mesenchymal cells) (manufactured by Lonza). In order to remove DMSO in the frozen solution, this was centrifuged at 300 g and 4 C. for seven minutes and the supernatant was removed. The cell mass thus obtained was resuspended in 10 ml of MSCGM medium, and plated on a 100 mm plate at a concentration of 10.sup.5 cells/cm.sup.2 and cultured at 37 C. Seven days later, the medium was changed. At this time, the suspended cells in the old medium were collected by centrifuging at 300 g and 4 C. for five minutes, and were returned to the cells together with the fresh medium. On day 13 when the adherent cells became confluent, the supernatant was removed, non-adherent cells were washed off with a phosphate buffer, and adherent cells were collected by detaching with a 0.05% trypsin-EDTA solution and plated at a concentration of 3000 cells/cm.sup.2. RNA was collected from the cells of the third subculture, and cDNA was synthesized.
Example 5. Induction of Human Pluripotent Stem Cells from Undifferentiated Stem Cells Present in a Postnatal Human Adult Bone Marrow Tissue
(55) From human adult bone marrow-derived cells (trade name: Human Bone Marrow-Derived Mononuclear Cell) containing undifferentiated stem cells present in a postnatal human adult bone marrow tissue, the cells were established under the low serum (2%) and the high serum (10%) culture conditions, and were used in the experiment for inducing pluripotent stem cells. Thus, one vial each (2.510.sup.7 cells) of frozen human bone marrow-derived mononuclear cells (hBMMNCs (manufactured by Lonza), Lot 060809B: female, 20 years old, white/and hBMMNCs (manufactured by Lonza), Lot 060470B: female, 20 years old, black) was thawed in a 37 C. water bath, and suspended in 10 ml of the MAPC medium for use in the low serum culture. In order to remove DMSO in the frozen solution, this was centrifuged at 300 g and 4 C. for seven minutes and the supernatant was removed.
(56) The cell mass thus obtained was resuspended, and plated at a concentration of 10.sup.5 cells/cm.sup.2 on a 100 mm plate coated with 10 ng/ml fibronectin. Growth factors [10 ng/ml PDGF-BB (manufactured by Peprotech), 10 ng/ml EGF (manufactured by Peprotech), 10 ng/ml IGF-1 (manufactured by Peprotech)] were added. Three days later, growth factors were only added. Seven days later, the suspended cells and the medium were collected except the adherent cells, and centrifuged at 300 g and 4 C. for five minutes. After the supernatant was removed, the cells were resuspended in a fresh medium. The cell suspension was returned to the original 10 cm dish, and growth factors were added thereto. On day 10 when the adherent cells became confluent, the supernatant was removed, non-adherent cells were washed off with a phosphate buffer, and adherent cells were collected by detaching with a 0.05% trypsin-EDTA solution, and using a cell banker (manufactured by Juji Field), the primary culture was stored frozen.
(57) Using the human bone marrow-derived mononuclear cell of the same lot, the cells were established using a MSCGM medium (manufactured by Lonza) containing 10% FBS under the high serum condition. The Human Bone Marrow-Derived Mononuclear Cells were plated at a concentration of 10.sup.5 cells/cm.sup.2 in a 100 mm plate to which 10 ml of the MSCGM medium had been added, and cultured at 37 C. Seven days later, the suspended cells and the medium were collected except the adherent cells, and centrifuged at 300 g and 4 C. for five minutes, and after the supernatant was removed, the cells were resuspended in a fresh medium. The cell suspension was returned to the original 10 cm dish, and culturing was continued. On day 13 when the adherent cells became confluent, the supernatant was removed, non-adherent cells were washed off with a phosphate buffer. Adherent cells were collected by detaching with a 0.05% trypsin-EDTA solution, and using a cell banker (manufactured by Juji Field), the primary culture was stored frozen.
(58) One vial each of the human bone marrow-derived primary culture cells that were established under the high serum and the low serum conditions and stored frozen was thawed in a 37 C. incubator. Two ml of the medium used for the establishment was added to the cells respectively, and the cells were plated at a concentration of 10.sup.4 cells/cm.sup.2 on a 6-well plastic culture dish of which bottom had been coated with matrigel (manufactured by Becton Dickinson) at a concentration of 20 g/cm.sup.2 and cultured for 14 hours (a second subculture cells). Fourteen hours later, the medium was removed, and the mCAT1 adenovirus vector prepared in Example 2 at an amount equivalent to a m.o.i. of 10 in 500 l of the Hank's balanced salt solution per well was added, and were infected at room temperature for 30 minutes.
(59) Two ml each of the medium used for establishment was added to each well, and cultured at 37 C. Forty eight hours after the introduction of the mCAT-1 adenovirus vector, the medium of each well was replaced with 2 ml of the retrovirus vector solution (polybrene at a final concentration of 4 g/ml was added) of four genes (Oct3/4, Sox2, Klf4, c-Myc) which were prepared in Example 1, and cultured at 37 C. for 14 hours. The virus supernatant was removed and replaced with the MEF-conditioned ES medium. Then medium change with the MEF-conditioned ES medium was continued every two days. On examining fourteen days after the introduction of the four genes, one typical colony was found in the low serum condition group of Lot 060809B that exhibits a characteristics of the induced pluripotent stem cells. Said colony was composed of markedly smaller cells than the surrounding cells. In addition to the pluripotent stem cell-like colony, a plurality of colonies were observed in both the low serum group and the high serum group, but they were not stained with alkaline phosphatase.
(60) In order to isolate the pluripotent stem cell-like colonies, the wells were washed with the Hank's balanced salt solution, and then colonies were surrounded by a cloning ring (manufactured by Iwaki) to the bottom of which silicone grease had been applied. One hundred l of the Detachment Medium For Primate ES Cells (manufactured by ReproCELL) was added in the ring and cultured at 37 C. for 10 to 20 minutes. The cell suspension in the ring containing the detached colony was added to 2 ml of the MEF-conditioned ES medium, and plated in one well of a MEF-coated 24-well plate. After culturing at 37 C. for 8 to 14 hours, the medium was changed, and subsequently medium change was continued every two days, and 8 days later a second subculture was carried out.
(61) The medium was removed, washed with the Hank's balanced salt solution, the Detachment Medium For Primate ES Cells (manufactured by ReproCELL) was added, cultured at 37 C. for 10 minutes, and 2 ml of the medium was added to stop the reaction. The cell suspension was transferred to a centrifuge tube, and centrifuged at 4 C. and 200 g for 5 minutes to remove the supernatant. The cells were resuspended in the MEF-conditioned ES medium, and plated in 4 wells of the MEF-coated 24-well plate. Medium change was continued every 2 days, and seven days after the second subculture, the cells were subjected to alkaline phosphatase staining, and the cloned colony-derived cells were stained blue violet.
(62) Furthermore, by quantitative PCR, it was confirmed that Nanog and Tert were expressed by the colony of alkaline phosphatase activity-positive pluripotent stem cells. When compared to the mesenchymal stem cells established in Example 4, the amount expressed of Nanog was as much as 30-fold higher. The expression of Tert was noted only in said pluripotent stem cells, and not in the mesenchymal stem cells. In the cells that did not form colonies despite the introduction of the four genes, Nanog or Tert was not expressed (
(63) From the foregoing, when human adult bone marrow-derived cells were used, the pluripotent stem cells were obtained from the low serum culture group but not at all from the high serum culture group (Lot 060809B and Lot 060470B) (Table 2). Also, culturing under the low serum condition was suitable for the maintenance of the undifferentiated cells.
Example 6. Induction of Human Pluripotent Stem Cells from Undifferentiated Stem Cells Present in Human Neonatal Skin
(64) Using cells (trade name: Neonatal Normal Human Skin Fibroblasts, primary culture) derived from a human neonatal tissue, a human tissue immediately after birth, the induction of human pluripotent stem cells from undifferentiated stem cells present in the skin of a human neonate was attempted.
(65) One vial of the frozen Neonatal Normal Human Skin Fibroblasts (primary culture, manufactured by Lonza, Lot 5F0438) was thawed in a 37 C. incubator, and was suspended in the MCDB202 modified medium, a medium containing 2% fetal bovine serum, 5 g/ml insulin, 50 g/ml gentamycin, 50 ng/ml amphotericin-B (FBM medium, manufactured by Lonza) to obtain 12 ml of a cell suspension. Two ml each of the cell suspension was plated on a 6-well plastic culture dish of which bottom had been coated with matrigel (manufactured by Becton Dickinson) at a concentration of 20 g/cm.sup.2 (second subculture cells).
(66) Fourteen hours later, the medium was removed, and the mCAT1 adenovirus vector prepared in Example 2 at an amount equivalent to a m.o.i. of 5 in 500 l of the Hank's balanced salt solution per well was added, and was infected at room temperature for 30 minutes. To each well, 2 ml of the FBM medium was added respectively, and cultured at 37 C. Forty eight hours after the introduction of the mCAT-1 adenovirus vector, the medium of each well was replaced with 2 ml of the retrovirus vector solution (polybrene at a final concentration of 4 g/ml was added) of the four genes (Oct3/4, Sox2, Klf4 and c-Myc) prepared in Example 1, and cultured at 37 C. for 4 hours.
(67) The virus supernatant was removed and replaced with the MEF-conditioned ES medium. Then medium change with the MEF-conditioned ES medium was continued every two days, and fourteen days after the introduction of the four genes, one well of the 6-well plate was subjected to alkaline phosphatase staining. As a result, six pluripotent stem cell-like alkaline phosphatase-positive colonies were obtained. Alkaline phosphatase-positive colonies were composed of markedly smaller cells than the neonatal normal human skin fibroblasts.
(68) Subsequently, by quantitative PCR, it was confirmed that Nanog and Tert were expressed by the colonies of alkaline phosphatase activity-positive pluripotent stem cells. When compared to the mesenchymal stem cells established under the high serum (10%) culture condition in Example 5, the neonatal normal human skin fibroblasts before the introduction of the four genes did not express Nanog, whereas in the case of the cells after the introduction of the four genes, 9-fold as much in the cells that are not forming colonies and 18-fold as much expression of Nanog in the alkaline phosphatase activity-positive colonies were observed (
(69) Colonies of the pluripotent stem cells were isolated in the following manner. On day 17 after gene introduction, six colonies with a characteristic shape were selected from the remaining wells. After washing the wells with the Hank's balanced salt solution, colonies were surrounded by a cloning ring (manufactured by Iwaki) to the bottom of which silicone grease had been applied. One hundred l of the Detachment Medium For Primate ES Cells (manufactured by ReproCELL) was added in the ring and cultured at 37 C. for 20 minutes. The cell suspension in the ring containing the detached colonies was added to 2 ml of the MEF-conditioned ES medium, and plated in one well of a MEF-coated 24-well plate. After culturing at 37 C. for 14 hours, the medium was changed, and subsequently medium change was continued every two days, and 8 days later a second subculture was carried out. The medium was removed, the cells were washed with the Hank's balanced salt solution, the Detachment Medium For Primate ES Cells was added and cultured at 37 C. for 10 minutes, and 2 ml of the medium was added to stop the reaction.
(70) The cell suspension was transferred to a centrifuge tube, and centrifuged at 4 C. and 200 g for 5 minutes, and the supernatant was removed. The cells were resuspended in the MEF-conditioned ES medium, and plated on four wells of a MEF-coated 24-well plate. Seven days after the second subculture, in a subculturing method described below, the cells were plated on a 60 mm plastic culture dish of which bottom had been coated with matrigel at a concentration of 20 g/cm.sup.2. Further eight days later (37 days after the introduction of the four genes), a third subculture was conducted, and plated on two matrigel-coated 60 mm plastic culture dishes, and part of it was used in alkaline phosphatase staining and RNA extraction. The result confirmed that the cells derived from the cloned colonies are alkaline phosphatase activity-positive and are expressing Nanog and Tert at high rate, thereby endorsing that they are pluripotent stem cells.
(71) The induced pluripotent stem cells were subcultured every 5 to 7 days for maintenance and growth. From the plastic culture dish on which subculturing is to be conducted, the medium was removed, the cells were washed with the Hank's balanced salt solution, dispase or the Detachment Medium For Primate ES Cells was added, and cultured at 37 C. for 5 to 10 minutes. When more than half of the colonies were detached, the ES medium was added to stop the reaction, and the cell suspension was transferred to a centrifuge tube. When colonies precipitated on the bottom of the tube, the supernatant was removed, and the ES medium was added again for suspension. After examining the size of the colonies, any extremely large ones were divided into appropriate sizes by slowly pipetting. Appropriately sized colonies were plated on a matrigel-coated plastic culture dish with a base area of about 3 to 6 times that before subculture. The colony-derived pluripotent stem cells are being grown and maintained now.
(72) As shown in Table 2, the Neonatal Normal Human Skin Fibroblasts in the lot (Lot 5F0474) other than the above lot 5F0438 exhibited a favorable induction of pluripotent stem cells. From comparison to Example 5, cells derived from young individuals or cells of which culturing time is short were thought to be suitable for the induction of the pluripotent stem cells.
(73) From the above results, when cells derived from human neonatal tissue that is a human postnatal tissue containing undifferentiated cells were subjected to a second subculture in a culture medium containing 2% serum, it was possible to induce the pluripotent stem cells.
Example 7. Induction of Human Pluripotent Stem Cells from Undifferentiated Stem Cells Present in a Human Adult Skin
(74) Then, using human adult tissue-derived cells (trade name: Adult Normal Human Skin Fibroblasts, primary culture) containing undifferentiated stem cells present in a human adult skin, the induction of pluripotent stem cells of the present invention was carried out.
(75) One vial each of the frozen Adult Normal Human Skin Fibroblasts (primary culture, manufactured by Lonza, Lot 6F3535: 28 years old, female, white, Lot 6F4026: 39 year old, female, white) was thawed in a 37 C. incubator, suspended in the FBM medium, and 12 ml of the cell suspension was obtained, respectively. Two ml each of the cell suspensions was plated on a 6-well plastic culture dish of which bottom had been coated with matrigel at a concentration of 20 g/cm.sup.2 (second subculture cells).
(76) Fourteen hours later, the medium was removed, and the mCAT1 adenovirus vector prepared in Example 2 at an amount equivalent to a m.o.i. of 5 in 500 l of the Hank's balanced salt solution per well was added, and was infected at room temperature for 30 minutes. To each well, 2 ml of the FBM medium was added, and cultured at 37 C. Forty eight hours after the introduction of the mCAT-1 adenovirus vector, the medium of each well was replaced with 2 ml of the retrovirus vector solution (polybrene at a final concentration of 4 g/ml was added) of the four genes (Oct3/4, Sox2, Klf4 and c-Myc) prepared in Example 1, and cultured at 37 C. for 4 hours. The virus supernatant was removed and replaced with the MEF-conditioned ES medium. Then medium change with the MEF-conditioned ES medium was continued every two days, and thirteen days after the introduction of the four genes, alkaline phosphatase staining was carried out. As a result, two pluripotent stem cell-like alkaline phosphatase-positive colonies per well were obtained from the Lot 6F3535, whereas no alkaline phosphatase-positive colonies were obtained from the Lot 6F4242 (Table 2).
(77) From comparison to Example 6, the neonate-derived cells among the skin fibroblasts had a higher efficiency of inducing the pluripotent stem cells. Also, among the Adult Normal Human Skin Fibroblasts, cells derived from younger donors had a higher transformation efficiency. From the foregoing, it was demonstrated that the efficiency of inducing the pluripotent stem cells decreases in an age-dependent manner.
Example 8. Examination Using Neonatal Normal Human Skin Fibroblasts of the Third Subculture
(78) One vial of frozen Neonatal Normal Human Skin Fibroblasts (primary culture, manufactured by Lonza, Lot 5F0439) was thawed in a 37 C. incubator, suspended in the FBM medium, and plated on two 100 mm plastic culture dishes (a second subculture). After culturing for six days until a 70 to 90% confluence could be obtained, the cells were detached using a 0.025% trypsin-EDTA solution (manufactured by Lonza), centrifuged at 4 C. and 200 g for 5 minutes, and the supernatant was removed. The second subcultured cells collected were stored frozen using the cell banker.
(79) The frozen second subculture cells were thawed in a 37 C. incubator, suspended in 12 ml of the FBM medium, centrifuged at 4 C. and 200 g for 5 minutes, and the supernatant was removed. The cells were suspended, and plated at a concentration of 10.sup.4 cell/cm.sup.2 on a 100 mm plastic culture dish of which bottom had been coated with matrigel at a concentration of 20 g/cm.sup.2 (a third subculture). Fourteen hours later, the medium was removed, and the mCAT1 adenovirus vector prepared in Example 2 at an amount equivalent to a m.o.i. of 5 in 2 ml of the Hank's balanced salt solution was added, and was infected at room temperature for 30 minutes. To each well, 10 ml of the FBM medium was added, and cultured at 37 C.
(80) Forty eight hours after the introduction of the mCAT-1 adenovirus vector, the medium was removed, and replaced with 10 ml of the retrovirus vector solution (polybrene at a final concentration of 4 g/ml was added) of the four genes (Oct3/4, Sox2, Klf4 and c-Myc) prepared in Example 1, and cultured at 37 C. for 4 hours. The virus supernatant was removed and replaced with the MEF-conditioned ES medium. Then medium change with the MEF-conditioned ES medium was continued every two days, and fourteen days after the introduction of the four genes, alkaline phosphatase staining was carried out. As a result, five pluripotent stem cell-like alkaline phosphatase-positive colonies were obtained. By calculating based on the area of the bottom, this indicates that 0.83 colony per well of the 6-well plate was obtained (Table 2).
(81) From comparison to Example 6, it was demonstrated that the efficiency of inducing the pluripotent stem cells decreases with the prolonged culture period.
Example 9. Induction of Human Pluripotent Stem Cells from Undifferentiated Stem Cells Present in the Umbilical Cord (1)
(82) Using the cells (trade name: Normal Human Umbilical Vein Endothelial Cells, primary culture) derived from a human umbilical cord, a human tissue immediately after birth, the induction of the human pluripotent stem cells of the present invention from undifferentiated stem cells present in the umbilical cord was attempted.
(83) One vial of the frozen Normal Human Umbilical Vein Endothelial Cells (primary culture, manufactured by Lonza) was thawed in a 37 C. incubator, and suspended in the Endothelial Cell Medium kit-2 manufactured by Lonza (2% serum) (hereinafter referred to as EBM-2) to obtain 12 ml of the cell suspension. About 10.sup.5/2 ml/well each of the cell suspension was plated to a 6-well plastic culture dish of which bottom had been coated with matrigel at a concentration of 20 g/cm.sup.2 (second subculture). Six hours later, the medium was removed, and the mCAT1 adenovirus vector prepared in Example 2 at an amount equivalent to a m.o.i. of 5 in 500 l of the Hank's balanced salt solution per well was added, and infected at room temperature for 30 minutes.
(84) 2.5 ml each of the EBM-2 medium was added to each well, and cultured at 37 C. Forty eight hours after the introduction of the mCAT-1 adenovirus vector, the medium of each well was replaced with 2 ml each of the retrovirus vector solutions (polybrene at a final concentration of 5 g/ml was added) of the four genes (Oct3/4, Sox2, Klf4 and c-Myc) prepared in Example 1, and cultured at 37 C. for 4 hours. The virus supernatant was removed and replaced with the MEF-conditioned ES medium. Then medium change with the MEF-conditioned ES medium was continued every two days. Twelve days after the introduction of the four genes, colonies were confirmed.
(85) Thirteen days after the introduction of the four genes, the induced colonies were stained with alkaline phosphatase activity.
(86) From the above results, when cells derived from human umbilical cord that is a human tissue immediately after birth containing undifferentiated cells were subjected to a second subculture in a culture medium containing 2% serum, it was possible to induce the pluripotent stem cells.
Example 10. Induction of Human Pluripotent Stem Cells from Undifferentiated Stem Cells Present in the Umbilical Cord (2)
(87) As described below, using the cells (trade name: Normal Human Umbilical Artery Smooth Muscle Cells, the third subculture) derived from a human umbilical cord, a human tissue immediately after birth, the induction of the human pluripotent stem cells of the present invention from undifferentiated stem cells present in the umbilical cord was attempted.
(88) One vial of the frozen Normal Human Umbilical Artery Smooth Muscle Cells (the third culture, manufactured by Lonza) was thawed in a 37 C. incubator, and suspended in the Smooth Muscle Cell Medium kit-2 manufactured by Lonza (5% serum) (hereinafter referred to as SmGM-2) to obtain 12 ml of the cell suspension. About 10.sup.5/2 ml/well each of the cell suspension was plated to a 6-well plastic culture dish (manufactured by Becton Dickinson) of which bottom had been coated with matrigel (manufactured by Becton Dickinson) at a concentration of 20 g/cm.sup.2 (the fourth subculture). One day later, the medium was removed, and the mCAT1 adenovirus vector at an amount equivalent to a m.o.i. of 1.25 to 5 in 500 l of the Hank's balanced salt solution per well was added, and infected at room temperature for 30 minutes. 2.5 ml each of the SmGM-2 medium was added to each well, and cultured at 37 C.
(89) Forty eight hours after the introduction of the mCAT-1 adenovirus vector, the medium of each well was replaced with 2 ml each of the retrovirus vector solutions (polybrene at a final concentration of 5 g/ml was added) of the four genes (Oct3/4, Sox2, Klf4 and c-Myc) prepared in Example 1, and cultured at 37 C. for 4 hours. The virus supernatant was removed and replaced with the MEF-conditioned ES medium. Then medium change with the MEF-conditioned ES medium was continued every two days. Thirteen days after the introduction of the four genes, colonies were confirmed. However, the induced colonies were not stained with alkaline phosphatase activity.
(90) From the above results, it was revealed that though the cells derived from human umbilical cord which is a human tissue immediately after birth contains undifferentiated cells present in the umbilical cord, when the cells were subjected to a fourth subculture in a culture medium containing 5% serum, the induction of the pluripotent stem cells was extremely difficult.
Example 11. Induction of Mouse Pluripotent Stem Cells from Undifferentiated Stem Cells Present in a Mouse Postnatal Tissue
(91) Using mouse bone marrow-derived cells, a mouse postnatal tissue, the induction of pluripotent stem cells of the present invention from undifferentiated stem cells present in a mouse postnatal tissue was attempted.
(92) Femurs and tibias were extracted from 4 to 6 week-old mice (c57BL/6N lineage, 4-week-old, female) taking utmost care not to bring in any other tissue. By soaking the collected bone in 70% ethanol for a short period of time, the cells that attached to the outside of the bone were killed to prevent the contamination of cells other than the bone marrow. After ethanol treatment, the bone was immediately transferred to IMDM (Iscove's Modified Dulbecco's Medium) (manufactured by SIGMA) to prevent the effect of the cells inside of the bone marrow. The outside of each bone was wiped with Kimwipe to remove the connective tissue. All of the treated bone was transferred to a mortar having IMDM, and was smashed with a pestle. After washing several times with IMDM, the bone was cut into pieces with scissors. After further washing with IMDM several times, bone fragments were transferred to centrifuge tubes.
(93) After removing IMDM, 10 ml per five mice of IMDM containing 0.2% collagenase I (manufactured by SIGMA) was added, and shaken at 37 C. for 1 hour. After shaking, the suspension was stirred several times using a Pipetman, and then the supernatant was transferred to another tube, to which an equal amount of cold 10% FBS-containing IMDM was added to stop the enzyme reaction. The bone fragments after enzyme treatment were transferred to a mortar containing cold 10% FBS-containing IMDM, and smashed again with a pestle, and after stirring several times, the supernatant was collected. The cell suspension thus collected was filtered by sequentially passing through a Nylon mesh of 70 m and 40 m in diameter. The cell suspension was centrifuged at 4 C. and 600 g for 7 minutes, and cells derived from the mouse deep bone marrow were collected.
(94) The cells derived from mouse deep bone marrow were suspended in the MAPC medium, and plated at a concentration of 10.sup.5 cells/cm.sup.2. For plating of cells, a dish previously coated with a phosphate buffer containing 10 ng/ml fibronectin (Becton Dickinson) was used. To the medium, growth factors [10 ng/ml PDGF-BB (manufactured by Peprotech), 10 ng/ml EGF (manufactured by Peprotech), 1000 units/ml LIF (manufactured by Chemicon)] were added at the time of use. Three days after plating, growth factors were only added without changing the medium. Six days later, non-adherent cells were washed off with the phosphate buffer, and adherent cells were collected by detaching with a 0.05% trypsin-EDTA solution (manufactured by Invitrogen), and using a cell banker (manufactured by Juji Field), the cells were stored frozen as the primary culture.
(95) The primary culture cells that had been stored frozen were thawed in a 37 C. water bath, and suspended in 10 ml of the MAPC medium that is a medium containing 2% FBS. In order to remove DMSO in the frozen solution, it was centrifuged at 4 C. and 300 g for 7 minutes, and the supernatant was removed. The cell mass obtained was resuspended, and plated at a concentration of 2.510.sup.3 cells/cm.sup.2 on a 12-well plastic plate having the bottom which had been gelatin-coated with 0.1% gelatin/phosphate buffer, and 2 ml each of the MAPC medium was added (the second subculture).
(96) Eight to 14 hours later, the medium was removed, and 2 ml each of the four gene retrovirus vector solution prepared as in Example 1 was added thereto and cultured at 37 C. for 4 to 14 hours. Then the virus solution was removed, and replaced with the mouse ES medium [the ES medium to which a final concentration of 0.3% FBS (manufactured by Invitrogen), 1000 units/ml LIF (manufactured by Chemicon), and 0.1 mM 2-mercaptoethanol were added]. Then medium change with the mouse ES medium was continued every three days, and 5 to 7 days after the introduction of the four genes, said pluripotent stem cells formed colonies comprising mouse ES cell-like small cells. The colonies of the induced pluripotent stem cells were stained blue violet by alkaline phosphatase activity.
(97) From the remaining wells of the 12-well plate, the mouse pluripotent stem cells were subcultured, and subculture was continued to a gelatin-coated 100 mm plate. From the seventh subculture cells, RNA was extracted using the RNeasy mini kit (manufactured by QIAGEN) and cDNA was synthesized. Using the cDNA, quantitative PCR was conducted to confirm the expression of Nanog.
(98) The mouse pluripotent stem cells of the seventh subculture were subcutaneously transplanted to the back of three syngeneic C57BL/6N mice at 310.sup.5 cells/mouse, and 38 days later the teratoma that formed was extracted. Teratoma was formed in all three mice. From the extracted teratoma, slices were prepared, and differentiation potential into three germ layers was analyzed by immunological staining and histological staining (HE stain, alcian blue stain). As a result, MAP2-positive cells (the nervous system) and GFAP-positive cells (the nervous system) as the ectodermic system, skeletal muscle cells (myocytes) and cartilage tissues as the mesodermic system, and intestinal tract tissues as the endodermic system were observed.
(99) In order to maintain and grow the mouse pluripotent stem cells, they were subcultured every 3 to 4 days. The medium was removed from the plastic culture dish in which subculture is carried out, washed with phosphate buffer, a 0.05% trypsin-EDTA solution was added, and cultured at 37 C. for 5 minutes. When the cells detached, the ES medium was added to stop the reaction, and the cell suspension was transferred to a centrifuge tube. By centrifuging at 200 g for 5 minutes, the supernatant was removed, and after suspending the precipitate in the mouse ES medium, the cells were plated in a gelatin-coated plate at a concentration of 10.sup.4 cells/cm.sup.2. The pluripotent stem cells induced from the cells derived from the mouse bone marrow cultured in low serum in the same subculture method could be cultured for a long time.
(100) As described above, pluripotent stem cells were induced from the postnatal mouse bone marrow-derived cells established under the low serum condition.
Example 12. Induction of Mouse Pluripotent Stem Cells by the Introduction of Three Genes and Histone Deacetylase Inhibitor Treatment
(101) Using cells derived from mouse bone marrow that is a mouse postnatal tissue, the induction of pluripotent stem cells was carried out with the introduction of three genes and histone deacetylase inhibitor treatment.
(102) The primary culture cells derived from mouse bone marrow containing undifferentiated stem cells that had been stored frozen after preparing in a manner similar to Example 11 were plated at a concentration of 510.sup.3 cells/cm.sup.2 on a 24-well plastic plate (manufactured by Becton Dickinson) having the bottom which had been gelatin-coated with a 0.1% gelatin/phosphate buffer, and 2 ml each of the MAPC medium was added.
(103) Eight hours later, the medium was removed, 2 ml each of the three gene (human Oct3/4, Sox2 and Klf4) retrovirus vector solution prepared as in Example 1 were added, and after further adding MS-275, a histone deacetylase inhibitor, at a final concentration of 1 or 0.1 M, they were cultured at 37 C. for 14 hours. Then after removing the virus solution, 2 ml each of the MAPC medium containing MS-275, a histone deacetylase inhibitor, at a final concentration of 1 or 0.1 M was added. Three days later, the medium was replaced with the mouse ES medium [a final concentration of 0.3% FBS (manufactured by Invitrogen), 1000 units/ml LIF (manufactured by Chemicon) and 0.1 mM 2-mercaptoethanol were added to the ES medium at the time of use].
(104) Medium change with the mouse ES medium was continued every 2 to 3 days. Twelve days after the introduction of three genes (human Oct3/4, Sox2 and Klf4) retrovirus vector, the cells were subcultured from each well of the 24-well plastic plate to each well of a 6-well plastic plate. A portion of it was also cultured in a 24-well plastic plate. Fifteen days after said three gene introduction and MS-275 treatment, the pluripotent stem cells formed colonies composed of mouse ES cell-like small cells. The colonies of said pluripotent stem cells were stained blue violet by alkaline phosphatase activity.
(105) Then, the amount expressed of the Nanog gene was confirmed by quantitative PCR, and the expression of mouse Nanog of colonies of pluripotent stem cells having alkaline phosphatase activity was confirmed (
(106) Eighteen days after said three gene introduction and MS-275 treatment, the pluripotent stem cells were subcultured from each well of the 6-well plate to a gelatin-coated 100 mm plate. Subculture was continued similarly.
(107) Twenty nine days after said three gene introduction and MS-275 treatment, the mouse pluripotent stem cells were subcutaneously transplanted to the back of syngeneic C57BL/6N mice at 210.sup.7 cells/mouse, and 34 days later the teratoma that formed was extracted. From the extracted teratoma, slices were prepared, and differentiation potential into three germ layers was analyzed by immunological and histological staining (HE stain, alcian blue stain). As a result, GFAP-positive cells (the nervous system) and keratin producing cells (skin cells) as the ectodermic system, smooth muscle actin-positive cells (smooth muscle cells), bone tissues and cartilage tissues as the mesodermic system, and intestinal tract tissues (endodermal epithelium positive for MUC-1) as the endodermic system were observed.
Example 13. Induction of Mouse Pluripotent Stem Cells by the Introduction of Three Genes
(108) Then, using cells derived from mouse bone marrow that is a mouse postnatal tissue, the induction of mouse pluripotent stem cells was carried out with the introduction of three genes.
(109) The primary culture cells derived from mouse bone marrow containing undifferentiated stem cells that had been stored frozen after preparing in Example 11 were plated at a concentration of 110.sup.4 cells/cm.sup.2 on a 24-well plastic plate (manufactured by Becton Dickinson) having the bottom which had been gelatin-coated with a 0.1% gelatin/phosphate buffer solution, and 2 ml each of the MAPC medium was added.
(110) Two days later, the medium was removed, 2 ml each of the three gene (human Oct3/4, Sox2 and Klf4) retrovirus vector solution prepared as in Example 1 were added, and after culturing at 37 C. for 1 day, the virus solution was removed, and 2 ml each of the MAPC medium was added. Three days later, the medium was replaced with the mouse ES medium [a final concentration of 0.3% FBS (manufactured by Invitrogen), 1000 units/ml LIF (manufactured by Chemicon) and 0.1 mM 2-mercaptoethanol were added to the ES medium at the time of use]. Then medium change with the mouse ES medium was continued every 2 to 3 days. Eleven days after the introduction of three gene (human Oct3/4, Sox2 and Klf4) retrovirus vector, the cells were subcultured from each well of the 24-well plastic plate to each well of a 6-well plastic plate.
(111) Then medium change with the mouse ES medium was continued every 2 to 3 days. Nineteen days after said three gene introduction, the pluripotent stem cells formed colonies composed of mouse ES cell-like small cells. In order to confirm the alkaline phosphatase activity, the medium was removed and then a 10% formalin neutral buffer solution was added to wells, and fixed at room temperature for 5 minutes. After washing with a phosphate buffer etc., the 1 step NBT/BCIP solution (manufactured by Pierce) comprising a chromogenic substrate of alkaline phosphatase was added and reacted at room temperature for 20 to 30 minutes. The colonies of said pluripotent stem cells were stained blue violet by alkaline phosphatase activity.
(112) Then, the amount expressed of the Nanog gene was confirmed by quantitative PCR, and the expression of mouse Nanog of colonies of pluripotent stem cells having alkaline phosphatase activity was confirmed.
(113) Using cells derived from mouse bone marrow that is a mouse postnatal tissue, the induction of pluripotent stem cells was carried out with the introduction of three genes.
(114) The primary culture cells derived from mouse bone marrow containing undifferentiated stem cells that had been stored frozen after preparing in Example 11 were plated at a concentration of 110.sup.4 cells/cm.sup.2 on a 6-well plastic plate (manufactured by Becton Dickinson) the bottom of which had been gelatin-coated with a 0.1% gelatin/phosphate buffer solution, and the MAPC medium was added in 2 ml portions.
(115) Two days later, the medium was removed, the three gene (human Oct3/4, Sox2 and Klf4) retrovirus vector solution prepared as in Example 1 were added in 2 ml portions, and after culturing at 37 C. for 1 day, the virus solution was removed, and the MAPC medium was added in 2 ml portions. Three days later, the medium was replaced with the mouse ES medium [a final concentration of 0.3% FBS (manufactured by Invitrogen), 1000 units/ml LIF (manufactured by Chemicon) and 0.1 mM 2-mercaptoethanol were added to the ES medium at the time of use]. Medium change with the mouse ES medium was continued every 2 to 3 days. Nine days after the introduction of three gene (human Oct3/4, Sox2 and Klf4) retrovirus vector, the cells were subcultured from each well of the 6-well plastic plate to each well of a 10 cm plastic dish.
(116) Medium change with the mouse ES medium was continued every 2 to 3 days. Seven days after said three gene introduction, the pluripotent stem cells formed colonies composed of mouse ES cell-like small cells. In order to confirm the alkaline phosphatase activity, the medium was removed and then a 10% formalin neutral buffer solution was added to wells, and fixed at room temperature for 5 minutes. After washing with a phosphate buffer etc., the 1 step NBT/BCIP (manufactured by Pierce), a chromogenic substrate of alkaline phosphatase, was added and reacted at room temperature for 20 to 30 minutes. The colonies of said pluripotent stem cells were stained blue violet by alkaline phosphatase activity.
(117) Then, the amount expressed of the Nanog gene was confirmed by quantitative PCR, and the expression of mouse Nanog of colonies of pluripotent stem cells having alkaline phosphatase activity was confirmed.
(118) Forty nine days after said three gene introduction, the mouse pluripotent stem cells were subcutaneously transplanted on the back of syngeneic C57BL/6N mice at 210.sup.7 cells/mouse, and 13 and 17 days later the teratoma that formed was extracted. Slices were prepared from the extracted teratoma, and differentiation potential into three germ layers was analyzed by immunological and histological staining (HE stain, alcian blue stain). As a result, GFAP-positive cells (the nervous system) and keratin producing cells as the ectodermic system, smooth muscle actin-positive cells (smooth muscle cells), bone tissues and cartilage tissues as the mesodermic system, and intestinal tract tissues (endodermal epithelium positive for MUC-1) as the endodermic system were observed.
(119) Likewise, after said three gene introduction, the mouse pluripotent stem cells which were single-sorted based on GFP and SSEA-1 positive with FACSAria, were subcutaneously transplanted on the back of syngeneic C57BL/6N mice at 210.sup.7 cells/mouse, and 13 and 14 days later the teratoma that formed was extracted. Slices were prepared from the extracted teratoma, and differentiation potential into three germ layers was analyzed by immunological and histological staining (HE stain, alcian blue stain). As a result, neural tube derived cells positive for GFAP, Nestin or Neurofilament as ectodermic system and cartilage tissues as the mesodermic system, and intestinal tract tissues (endodermal epithelium positive for MUC-1 and alpha-fetoprotein) as the endodermic system were observed.
(120) From the above results, pluripotent stem cell were obtained by the forced expression of each of three genes of Oct3/4, Sox2, and Klf4 in undifferentiated stem cell present in a postnatal tissue. The pluripotent stem cells showed an in vitro long-term self-renewal ability, and were expressed ES cell marker, Nanog expression and alkaline phosphatase activity, and the ability of differentiation of tissues derivative from all three germ layers (ectoderm, mesoderm and endoderm).
Example 14. Long Term Expansion and Characterization of Human Induced Pluripotent Stem Cells
(121) Human induced pluripotent stem (iPS) cell line generated from neonatal human skin fibroblasts (lot #5F0438) in Example 6 which was termed iPS-1 was further sub-cloned with cloning cylinder and 0.25% trypsin-EDTA as described in Example 6. Nine sub-clones which were termed human iPS-1-1, 1-2, 1-3, 1-4, 1-5, 1-6, 1-7, 1-8 and 1-9 were obtained. One of nine sub clones, termed human iPS-1-8 clone, was successfully expanded on MEF feeder cells in human ES medium supplemented with 0.1 mM 2-mercaptoethanol and 10 ng/ml bFGF or in mTeSR1 defined medium (Stem cell Technologies) on matrigel (Invitrogen)-coated culture dishes. Medium was changed for human iPS-1-8 clone culture everyday and usually treated with 5 to 20 M of Y-27632 (Calbiochem) to avoid cell apoptosis triggered by the passaging procedures. For the passage to continue the culture, human induced pluripotent stem cells were washed with Hanks's balanced solution, incubated in 0.25% trypsin-EDTA (Gibco) at 37 C. for 3 minutes, and then added the culture medium to terminate the trypsin activity. Human induced pluripotent stem cells were centrifuged at 300g at room temperature or 4 C. for 5 minutes and the supernatant was removed. Precipitated human induced pluripotent stem cells were re-suspended into culture medium. The pluripotent stem cells were usually split into new culture dishes using 1:4 to 1:6 splits. Human iPS-1-8 clone was frozen using Cell freezing solution for ES cells (Reprocell) according to the manufacture's manual.
(122) Human iPS-1-8 clone was morphologically indistinguishable from typical human ES cell colonies that consist of small, round, and compact cells with defined edges when cultured on mitomycin-C treated mouse embryonic fibroblasts (MEFs) (
(123) Karyotype analysis of long-term cultured human iPS-1-8 clone (1-8 mTeSR) was performed using giemsa stain and multicolor-FISH analysis. Human iPS cells were pretreated with 0.02 g/ml colecemid for 2 hours, followed by incubation with 0.075 M KCl for 20 minutes, and then fixed with Carnoy's fixative. For multicolor-FISH analysis, cells were hybridized with the multicolor FISH probe (Cambio) and analyzed under DMRA2 fluorescent microscope (Leica). Human iPS-1-8 mTeSR cells mainly maintained a normal karyotype (46XY) after long-term culture in mTeSR (68%) without any chromosomal translocation or deletion (
(124) For alkaline phosphatase staining, cells were fixed with 10% formalin neutral buffer solution (Wako) at room temperature for 5 minutes, washed with PBS, and incubated with alkaline phosphatase substrate 1 step NBT/BCIP (Pierce) at room temperature for 20-30 minutes. Cells having alkaline phosphatase activity were stained in blue violet. For immunocytochemistry, cultured cells were fixed with 10% formaldehyde for 10 minutes and blocked with 0.1% gelatin/PBS at room temperature for 1 hour. The cells were incubated overnight at 4 C. with primary antibodies against SSEA-3 (MC-631; Chemicon), SSEA-4 (MC813-70; Chemicon) TRA-1-60 (abcam), TRA-1-81 (abcam), CD9 (M-L13; R&D systems), CD24 (ALB9; abcam), CD90 (5E10; BD bioscience), or Nanog (R&D systems). For Nanog staining, cells were permeabilized with 0.1% Triton X-100/PBS before blocking. The cells were washed with PBS for three times, and then incubated with AlexaFluor 488-conjugated secondary antibodies (Molecular Probes) and Hoechst 33258 at room temperature for 1 hour. After further washing, fluorescence was detected with an Axiovert 200M microscope (Carl Zeiss).
(125) Human iPS-1-8 mTeSR cells were positive for alkaline phosphatase (hereinafter referred to as ALP) activity and the glycolipid antigens SSEA-3 and SSEA-4, the keratin sulfate antigens TRA-1-60 and TRA-1-81, and the protein antigens CD9, CD24, Thy-1 (CD90) staining (
(126) Total RNA was isolated from human iPS-1-8 clone, its parental fibroblasts, and crude fibroblasts obtained on 17 days after gene transduction by using RNeasy (Qiagen). cDNA was synthesized by SuperScript III (Invitrogen). Gene expressions were detected by PCR using Extaq (Takara). Sequences of the primers were described in Table 4.
(127) Human iPS-1-8 clone expressed human ES marker genes Nanog, TERT, Sall4, Zfp42, GDF3, Dnmt3b, TDGF1, GABRB3, and CYP26A1 though the parental fibroblasts expressed none of those marker genes (
(128) Human iPS cells cultured in both mTeSR on matrigel 1-8 mTeSR and MEF-conditioned medium on matrigel (1-8CM) and its parental fibroblasts (5F0438) were analyzed for global gene expression. The microarray study was carried out using the Affymetrix Human Genome U133 Plus 2.0 gene expression arrays (Affymetrix, Santa Clara, Calif.). The GeneChip Human Genome U133 Plus 2.0 Array provides comprehensive coverage of the transcribed human genome on a single array and analyzes the expression level of over 47,000 transcripts and variants, including 38,500 well-characterized human genes. Briefly, total RNA was extracted from cells with RNAeasy (Qiagen). Biotin-labelled cRNA was reverse transcribed from 1 g of total RNA according to Affymetrix technical protocols. Fifteen micrograms of cRNA was fragmented and hybridized to a Affymetrix U133 plus 2 GeneChip arrays at 45 C. for 16 hours and then washed and stained using the Affimetrix Fluidics (Affymetrix). The assays were scanned in the Affimetrix GCS3000 scanner, and the image obtained were analyzed using the GCOS software. Data from this experiment and GEO were investigated with the GeneSpring 7.3.1. software.
(129) For scatter plot analyses, human induced pluripotent stem cell clone-1-8, cultured in mTeSR on matrigel (1-8 mTeSR) and its parental fibroblasts (5F0438) were analyzed based on a set of 21,080 genes with present flag call (P<0.04) or marginal flag call (0.04P<0.06) for both clone 1-8 and H14 hES line which is data from GEO (GSM151741), were used as a representative of human ES cells for comparison.
(130) For cluster analysis, DNA microarray data for clone-1-8 cultured in mTeSR (1-8 mTeSR), clone 1-8 cultured in MEF-conditioned medium (1-8CM) and its parental fibroblasts (5F0438) were compared with DNA microarray data for Sheff 4 line cultured on MEF (hES1:GSM194307, hES2: GSM194308, hES3: GSM194309), Sheff 4 line cultured on matrigel (hES4: GSM194313, hES5: GSM194314), H14 line cultured on MEF (hES6: GSM151739, hES7: GSM151741), and three fibroblasts (GSM96262 for Fibroblasts1, GSM96263 for Fibroblasts2 and GSM96264 for Fibroblasts3).
(131) The global gene expression profile of the human iPS cell line (clone 1-8) and its parental fibroblasts were analyzed. Cluster analysis using the gene set defined by the International Stem Cell Initiative revealed that the human iPS cell line 1-8 clustered with human ES cell lines but separated from the parental fibroblasts (
(132) The promoter regions of Nanog and Oct3/4 were analyzed for methylation of individual CpG sites. Ten nanograms of bisulfite-treated genomic DNA was PCR-amplified with primers containing a T7-promoter and transcripts treated with RNase A. As fragments originating from a methylated CpG sequence contained a G instead of an A-base, they had a 16 Da higher molecular weight than those resulting from the corresponding non-methylated CpG. This mass difference was detected using a MALDI-TOF mass spectrometer (Autoflex, Bruker Daltonics). The spectra produced by the mass spectrometer were analyzed using the EpiTYPER (Sequenom). The percentage methylation of individual CpG sites was calculated using the area under the peak of the signal from the unmethylated and methylated fragments. The percentage methylation of individual CpG sites were calculated using the area under the peak of the signal from the unmethylated and methylated fragments. Table 9 lists up locations and sizes in genome corresponding to amplicon using for methylation analyses. Table 10 lists up the primer sets using for methylation analyses. The Oct3/4 proximal promoter including conserved region 1 (CR1), the Oct3/4 promoter distal enhancer including CR4 and the Nanog proximal promoter including Oct3/4 and Sox2 binding sites were examined (
(133) Human iPS-1-8 mTeSR cell-suspension (0.5 to 210.sup.6 cells/mouse) was injected into the medulla of left testis of 7 to 8 week old SCID mice (CB17, Oriental Yeast) using a Hamilton syringe. After 6 to 8 weeks, the teratomas were excised under perfusion with PBS followed with 10% buffered formalin, and subjected to the histological analysis. Human iPS-1-8 mTeSR cells gave rise to teratomas 4 to 8 weeks after transplantation into testes of SCID mice.
(134) Teratomas were embedded in the mounting medium, and sectioned at 10 m on a cryostat. Serial sections were stained with hematoxylin-eosin (HE) to visualize the general morphology. For the detection of cartilage, alcian blue staining was employed or combined with HE.
(135) For immunostaining, sections were treated with Immunoblock (Dainippon-Sumitomo) for 30 minutes to block non-specific binding. Slides were incubated with the following primary antibodies: anti Nestin polyclonal antibody (PRB-570C, COVANCE, 1:300), anti Type II collagen polyclonal antibody (LB-1297, LSL, 1:200), anti Smooth muscle actin polyclonal antibody (RB-9010-R7, LAB VISION, 1:1), anti -Fetoprotein polyclonal antibody (A0008, DAKO, 1:500), anti MUC-1 polyclonal antibody (RB-9222-P0, LAB VISION, 1:100), and anti Human nuclei monoclonal antibody (HuNu) (MAB1281, CHEMICON, 1:300). For Type II collagen, before the treatment with primary antibody a section was incubated with Hyaluronidase (25 mg/mL) for 30 minutes. Localization of antigens was visualized by using appropriate secondary antibodies (Alexa fluor 594 and 688, Molecular Probes, 1:600). Nuclei were stained with DAPI. Immunostained teratoma sections were analyzed under a fluorescence microscope (Axio Imager Z1, Zeiss).
(136) Teratomas of human iPS-1-8 mTeSR cells contained tissues representative of three germ layers, neuroectoderm, mesoderm, and endoderm.
(137) Both southern blot analysis and genomic PCR analysis indicated human iPS-1-8 clone carried four transgenes. In southern blot analysis cDNA fragments were prepared by restriction enzyme digestion (XhoI for POU5F1, NotI for Sox2, PstI for KIF4) from the corresponding pMX vector plasmids. These fragments were purified as [32P]-labeled probes with agarose gel electrophoresis and a QIAquick gel extraction kit (QIAGEN). Genomic DNA was prepared from the human iPS clone 1-8 and its parental fibroblasts. Five g of each genomic DNA was digested with KpnI (POU5F1, Sox2, and Klf4). Fragments were separated on a 0.8% agarose gel, blotted onto HybondXL membrane (GE Healthcare), and hybridized with [32P]-labeled probes. Human iPS clone-1-8 was shown to carry approximately ten copies of both Oct3/4 transgenes and Sox2 transgenes, and a single copy of Klf4 transgene (
(138) SNP genotyping was performed with the use of the GeneChip Human Mapping 500K Array Set (Affymetrix) according to the manufacture's protocol. Human iPS-1-8 mTeSR cells cultured in mTeSR on matrigel, its parental fibroblasts (5F0438), and fibroblast (5F0416) derived from a different donor were analyzed for this assay. The array set includes a StyI and a NspI chip. Two aliquots of 250 ng of DNA each were digested with NspI and StyI, respectively. Each enzyme preparation was hybridized to the corresponding SNP array (262,000 and 238,000 on the NspI and StyI array respectively). The 93% call rate threshold at P=0.33 (dynamic Model algorithm confidence threshold) with the Dynamic Model algorithm 138 was used in individual assays.
(139) To confirm whether human iPS-1-8 mTeSR cells were generated from fibroblasts (5F0438), we compared SNP genotyping between human iPS-1-8 mTeSR cells and the employed fibroblasts (Table 5). SNPs of human iPS-1-8 mTeSR cells were consistent to that of parental cells in 464,069 (99.17%) of 467,946 of called SNPs and different from that of parental cells in 3,877 (0.83%) of them. In contrast, SNPs of human iPS-1-8 mTeSR cells were consistent to that of unrelated donor cells (5F0416) only in 284,950 (60.50%) of 470,960 of called SNPs and different from that of the unrelated cells in 186,010 (39.50%) of them. Thus, human iPS-1-8 clone (1-8 mTeSR) and parental cells had almost the same SNP genotype each other, strongly suggesting that both cells were originated from a single donor.
(140) HLA DNA typing was performed by utilizing hybridization of PCR-amplified DNA with sequence specific oligonucleotide probes (SSOP) (Luminex). Assays were performed to determine the HLA-A, HLA-B, HLA-Cw, HLA-DR, HLA-DQ, HLA-DP and Bw loci according to manufacturer's instructions. Human iPS cells are promising materials in cell transplantation therapies, they would overcome immune rejection, because human iPS cells can be directly generated from patients' cells and must be the identical HLA type. To actually prove the HLA issue, we carried out HLA typing of human iPS-1-8 clone (1-8 mTeSR), parental cells (5F0438), and unrelated fibroblasts (5F0416). As expected, HLA type of iPS-1-8 clone was completely identical to that of 5F0438 but not 5F0416 (Table 6).
(141) From the foregoing, human pluripotent stem cell were obtained by the forced expression of each of four genes of Oct3/4, Sox2, Klf4, and c-Myc in undifferentiated stem cell present in a human postnatal tissue. The human pluripotent stem cells showed an in vitro long-term self-renewal ability and the pluripotency of differentiation into ectoderm, mesoderm and endoderm. The human pluripotent stem cells were expressed cell surface antigens SSEA-3, SSEA-4, TRA-1-60, TRA-1-81, CD9, CD24, and CD90, and ES cell marker genes Nanog, Oct3/4, TDGF1, Dnmt3b, GABRB3, GDF3, Zfp42, ALP, CD9, and Thy-1. The promoter regions of Nanog and Oct3/4 in the human pluripotent stem cells were demethylated compared to the parental fibroblasts. The human pluripotent stem cells carries at least a single copy of Oct3/4, Sox2, Klf4, and c-Myc transgene. The induced human pluripotent stem cells and the parental cells (undifferentiated stem cell present in a human postnatal tissue) had almost the same SNP genotype each other, and HLA type of the induced human pluripotent stem cell was completely identical to that of the parental cell (undifferentiated stem cell present in a human postnatal tissue).
Example 15. Gene Expression Profile of Primary Culture of 4 Genes Introduced Neonatal Fibroblast
(142) Two lots of neonatal fibroblasts (5F0416 and 5F0474) were seeded at 10.sup.3 cells/cm.sup.2 or 10.sup.4 cells/cm.sup.2 into 35 mm diameter wells of 6 well plates and cultured in FBM supplemented with FGM-2 SingleQuots (manufactured by Lonza) before the four genes transduction. Cells were infected with mCAT1-adenovirus vectors at 210.sup.5 ifu/well and then infected with the retroviral vectors carrying four genes as described in Example 6. Eight wells were prepared for this study (2 different lot and 2 different densities in duplicate).
(143) Seventeen days post 4-gene infection, cells were fixed and stained for alkaline phosphatase (ALP) as described in Example 3. In total, 163 ALP positive(+) colonies were observed in four independent experiments. All 163 ALP(+) colonies and 18 ALP-negative (ALP()) colonies were dissected, and total RNA from these colonies were extracted using a RecoverAll Total Nucleic Acid Isolation kit (manufactured by Ambion). After the cDNA preparation, genes of interest were amplified using Taqman preamp (manufactured by Applied Biosystems). Real-time quantitative PCR was performed with ABI PRISM 7900HT (manufactured by Applied Biosystems) using PCR primer sets (manufactured by Applied Biosystems, Nanog, Hs02387400_g1, Dnmt3b, Hs00171876_m1, FoxD3, Hs00255287_s1, Zfp42, Hs01938187_s1, TDGF1, Hs02339499_g1, TERT, Hs00162669_m1, GDF3, Hs00220998_m1, CYP26A1, Hs00175627_m1, GAPDH, Hs99999905_m1) to determine gene expression of human ES cell markers in colonies. Eight genes (Nanog, TDGF1, Dnmt3b Zfp42 FoxD3, GDF3, CYP26A1 and TERT genes) which were reported to express in human ES cells were selected as a pluripotent stem cell marker genes. A standard curves was generated for each primer pair. All expression values were normalized against GAPDH.
(144) It is known that mouse ES cells and mouse iPS cells form multilayered/aggregated colonies. Thus we first analyzed the mouse ES cell like aggregated colonies which were induced by ectopic expression of four gene in human fibroblasts (e.g. colony #1-2-F and #1-2-B in
(145) ALP positive colonies can be categorized into 40 groups based on the gene expression pattern of the eight human marker genes (Table 7). When colonies are categorized by the total number of eight marker genes expression, the distribution of colony number followed a normal distribution suggesting the presence of a stochastic process in the colony induction (
(146) Quantitative gene expression analysis of colonies formed 17 days after infection indicated that the transgenes c-Myc and Oct4 showed high expression in all the analyzed colonies (Table 11). In addition endogenous Nanog expression was very high in most of the ALP positive colonies, including cells lacking expression of one or more of the eight human ES cell marker genes (Table 11). These results indicate that the process of pluripotent stem cell induction from human skin fibroblasts is slower than that described for mouse iPS cell generation. Only 4 out of 163 ALP positive colonies were positive for Nanog, TDGF1, Dnmt3b, Zfp42, FoxD3, GDF3, Cyp26a1 and TERT (octa-positive colony). Cells in these octa-positive colonies showed common features: 1) small size with the high nucleus to cytoplasm ratio and 2) formation of small monolayer colonies within the space between fibroblasts (
(147) These results indicate that induced pluripotent stem cells can be isolated from small monolayer colonies comprising small cells with high nucleus to cytoplasm ratio not from fibroblastic colonies, defused colonies or multilayered colonies. Table 8 summarizes all of experiments and results on the ALP positive colony number using human neonatal fibroblasts.
Example 16. Generation of Human iPS-2-4 Clone from Human Neonatal Skin Fibroblasts
(148) Adenovirus vector plasmids for mCAT1 were transfected into 29310 cells. The mCAT1-adenoviruses were isolated from these cells by three freeze-thaw cycles, purified using Adenovirus purification kit (Clontech) and stored at 80 C. The titer of the vector stocks was determined by Adeno-X rapid titer kit (Clontech).
(149) The replication deficient MMLV derived retrovirus vector pMx was used for the ectopic expression of human Oct3/4, Sox-2, c-Myc and Klf4. Recombinant retroviruses were generated by transfecting vectors to the Plat-E packaging system (Morita et al., 2000) followed by incubation in FBM (Lonza) supplemented with FGM-2 SingleQuots (Lonza). Between 24 and 48 hours after the transfection, supernatant from the Plat-E culture was collected several times at intervals of at least 4 hours and passed through a 0.45 m filter.
(150) For MEF-conditioned medium (MEF-CM) preparation, human ES medium (DMEM/F12 (Gibco) supplemented with 20% Knockout Serum Replacement (KSR, Invitrogen), 2 mM L-glutamine (Sigma), 1 nonessential amino acids (Sigma), 10 g/ml gentamycin), 10 ng/ml bFGF was conditioned on mitomycin-C treated MEF (Reprocell) for 20-24 hours, harvested, filtered through a 0.45 m filter and supplemented with 0.1 mM 2-mercaptoethanol (Sigma) and 10 ng/ml bFGF before use.
(151) Using cells (trade name: Neonatal Normal Human Skin Fibroblasts, primary culture) derived from a human neonatal tissue, a human tissue immediately after birth, the induction of human pluripotent stem cells from undifferentiated stem cells present in the skin of a human neonate was attempted.
(152) Human neonatal dermal fibroblasts (Lonza; lot 5F0416) were cultured in FBM supplemented with FGM-2 SingleQuots. Three days before the 4 gene introduction, fibroblasts were seeded at 10.sup.3 cells/cm.sup.2 into 6 well plates. Eighteen hours later, the cells were mixed with the mCAT1 adenovirus vector solution in 500 l Hanks' balanced salt solution, and incubated at room temperature for 30 min. The cells were then added to 2 ml of medium and cultured for 48 hrs. Subsequently, the cells were incubated in 2 ml of the retrovirus/polybrene solution (mixture of equal volumes of the retrovirus vector suspension for each of the four genes (Oct3/4, Sox2, Klf4 and c-Myc) prepared in Example 1, supplemented with 5 g/ml of polybrene) at 37 C. for 4 hrs to overnight. The virus supernatant was replaced with the MEF-conditioned ES medium. Then medium was changed every days.
(153) On day 33 after gene introduction, a colony with a characteristic shape was picked with forceps from a well. The picked colony was transferred into a matigel-coated well in a 24-well plate and maintained in mTeSR defined medium supplemented with 10 M Y-27632. Fourteen hours later the medium was changed. Medium change was continued every days. At day 54 after the infection a second culture was carried out. At day 67, human iPS-2-4 clone was sub-cloned and designated as human iPS-2-4 sub-clone.
(154) For passaging, medium was removed, and the cells were washed with the Hank's balanced salt solution followed by the treatment with 0.25% trysin-EDTA at 37 C. for 3 minutes. Fresh medium was added to stop the reaction. The cell suspension was centrifuged at 4 C. and 200g for 5 minutes, and the supernatant was removed. The cells were resuspended in mTeSR defined medium supplemented with 10 M Y-27632 and plated.
(155) Human iPS-2-4 sub-clone was successfully expanded in mTeSR1 defined medium (Stem cell Technologies) on matrigel (Invitrogen)-coated culture dishes. We termed cells derived from the sub-clone iPS-2-4 and cultured in mTeSR1 medium as human iPS-2-4 mTeSR cells. Medium was changed for human iPS-2-4 mTeSR cell culture everyday and usually treated with Y-27632 (Calbiochem) to avoid cell apoptosis after passaging. For passaging, cells were washed with Hanks's balanced solution, incubated in 0.25% trypsin-EDTA (Gibco) at 37 C. for 3 minutes, and then added the culture medium. Cells were centrifuged at 300g at room temperature or 4 C. for 5 minutes and the supernatant was removed. The cells were re-suspended into culture medium. Human iPS-2-4 mTeSR cells were morphologically indistinguishable from typical human ES cells and human iPS-1-8 mTeSR cells consisting of small, round, and high nucleus to cytoplasm ratio cells with defined edges.
(156) Fifty nine days post 4-gene infection, a part of cells were fixed and stained for alkaline phosphatase (ALP) as described in Example 3. Colonies consisting of cells were positive for ALP and Total RNA from colonies were extracted using a RecoverAll Total Nucleic Acid Isolation kit (manufactured by Ambion). After the cDNA preparation, genes of interest were amplified using Taqman preamp (manufactured by Applied Biosystems). Real-time quantitative PCR was performed with ABI PRISM 7900HT (manufactured by Applied Biosystems) using PCR primer sets (manufactured by Applied Biosystems, Nanog, Hs02387400_g1, Dnmt3b, Hs00171876_m1, FoxD3, Hs00255287_s1, Zfp42, Hs01938187_s1, TDGF1, Hs02339499_g1, TERT, Hs00162669_m1, GDF3, Hs00220998_m1, CYP26A1, Hs00175627_m1, GAPDH, Hs99999905_m1) to determine gene expression of human ES cell markers in colonies. Conle-2-4 showed ES cell marker gene expressions (Table 12).
(157) From the above results, human pluripotent stem cell were obtained by the forced expression of each of four genes of Oct3/4, Sox2, Klf4, and c-Myc in undifferentiated stem cell present in a human postnatal tissue. The human pluripotent stem cells showed an in vitro long-term self-renewal ability, and were expressed ES cell marker genes Nanog, Oct3/4, TDGF1, Dnmt3b, GABRB3, GDF3, Zfp42, ALP, CD9, and Thy-1.
Example 17. Generation of Human iPS-3-2 Clone from Human Neonatal Skin Fibroblasts
(158) According to Example 16, human neonatal dermal fibroblasts (Lonza; lot 5F0438) were cultured in FBM supplemented with FGM-2 SingleQuots. Three days before the 4 gene introduction, fibroblasts were seeded at 10.sup.3 cells/cm.sup.2 into 6 well plates. Eighteen hours later, the cells were mixed with the mCAT1 adenovirus vector solution in 500 l Hanks' balanced salt solution, and incubated at room temperature for 30 min. The cells were then added to 2 ml of medium and cultured for 48 hrs. Subsequently, the cells were incubated in 2 ml of the retrovirus/polybrene solution (mixture of equal volumes of the retrovirus vector suspension for each of the four genes (Oct3/4, Sox2, Klf4 and c-Myc) prepared in Example 1, supplemented with 5 g/ml of polybrene) at 37 C. for 4 hrs to overnight. The virus supernatant was replaced with the MEF-conditioned ES medium. Then medium was changed every days. On day 21 after gene introduction, a colony with a characteristic shape was directly picked with forceps from one of dishes. The picked colony was transferred into a matigel-coated well in a 24-well plate and maintained in mTeSR defined medium supplemented with 10 M Y-27632.
(159) Fourteen hours later the medium was changed. Medium change was continued every days. 40 days after the infection, a second subcloning was carried out, and cells were successfully expanded in mTeSR1 defined medium (Stem cell Technologies) on matrigel (Invitrogen)-coated culture dishes. Medium was changed everyday and usually treated with Y-27632 (Calbiochem) to avoid cell apoptosis after passaging. For passaging, cells were washed with Hanks's balanced solution, incubated in 0.25% trypsin-EDTA (Gibco) at 37 C. for 5 minutes, and then added the culture medium. Cells were centrifuged at 300g at room temperature for 5 minutes and the supernatant was removed. The cells were re-suspended into culture medium.
(160) Cells were morphologically indistinguishable from typical human ES cells, human iPS-1-8 mTeSR cells, and human iPS-2-4 mTeSR cells that consist of small, round, and high nucleus to cytoplasm ratio cells with defined edges. Thus we termed this clone as human iPS-3-2 clone. Human iPS-3-2 clone actively proliferated in mTeSR1 medium. We termed these cells derived from human iPS-3-2 clone which culture in mTeSR1 medium as human iPS-3-2 mTeSR cells.
(161) Forty eight days post 4-gene infection, cells were fixed and stained for alkaline phosphatase (ALP) as described in Example 3. Total RNA from colonies were extracted using a RecoverAll Total Nucleic Acid Isolation kit (manufactured by Ambion). After the cDNA preparation, genes of interest were amplified using Taqman preamp (manufactured by Applied Biosystems). Real-time quantitative PCR was performed with ABI PRISM 7900HT (manufactured by Applied Biosystems) using PCR primer sets (manufactured by Applied Biosystems, Nanog, Hs02387400_g1, Dnmt3b, Hs00171876_m1, FoxD3, Hs00255287_s1, Zfp42, Hs01938187_s1, TDGF1, Hs02339499_g1, TERT, Hs00162669_m1, GDF3, Hs00220998_m1, CYP26A1, Hs00175627_m1, GAPDH, Hs99999905_m1) to determine gene expression of human ES cell markers in colonies. Conle-3-2 showed ES cell marker gene expressions (Table 12).
(162) From the above results, human pluripotent stem cell were obtained by the forced expression of each of four genes of Oct3/4, Sox2, Klf4, and c-Myc in undifferentiated stem cell present in a human postnatal tissue. The human pluripotent stem cells showed an in vitro long-term self-renewal ability, and were expressed ES cell marker genes Nanog, Oct3/4, TDGF1, Dnmt3b, GABRB3, GDF3, Zfp42, ALP, CD9, and Thy-1.
(163) Table 1 shows the name of gene, the NCBI number, the virus vector in which said gene was inserted, insert size, the restriction site at the 5-end, the restriction site at the 3-end, the length of the translated region, the length of the 3-untranslated region, clone ID, and the supplier of the four genes or the three genes and the receptor of mouse ecotropic retrovirus vector (mCAT: mouse-derived cationic amino acid transporter) used in Examples.
(164) TABLE-US-00001 TABLE 1 Construction data Gene- Name inserted 5-end 3-end Length of 3- of virus Insert restriction restriction translated untranslated gene NCBI No. vector size site site region region Clone ID Supplier human NM_002701 pMXs-puro 1411 EcoRI Xho1 1083 274 6578897 Open Oct3/4 Biosystems human BC013923 pMXs-neo 1172 EcoRI Xho1 954 143 2823424 Open Sox2 Biosystems human BC058901 pMXs-IB 1876 EcoRI Xho1 1365 473 6012670 Open c-Myc Biosystems human BC029923 pMXs-IB 1591 EcoRI EcoRI 1413 38 5111134 Open Klf4 Biosystems mCAT1 NM_007513 Adeno-X 2032 BssS1 BssS1 1869 132 A830015N05 RIKEN FANTOM clone
(165) Table 2 summarizes the number of alkaline phosphatase-positive colonies of Examples 4 to 7. For cell type, the number of subculture is attached. The day of four gene introduction is a day when a retrovirus vector was infected. Lot No. is that of Lonza products. Age of donors is based on the donor information of Lonza products. The number of colonies is the number of colonies composed of alkaline phosphatase-positive small cells per 10 cm.sup.2.
(166) TABLE-US-00002 TABLE 2 Examples 5 to 8 and 10, Number of alkaline phosphatase (ALP)-positive colonies formed by gene introduction No. of passages at Serum the time of Cell concentration gene Date of gene Date of ALP Colony Example Cell type Donor age Lot No. (%) introduction introduction staining count* 8 Neonatal skin fibroblast Neonate 5F0439 2 3 2007 Mar. 20 2007 Apr. 3 0.8 6 Neonatal skin fibroblast Neonate 5F0438 2 2 2007 Apr. 15 2007 Apr. 29 6.0 6 Neonatal skin fibroblast Neonate 5F0438 2 2 2007 May 5 2007 May 16 6.0 6 Neonatal skin fibroblast Neonate 5F0474 2 2 2007 May 5 2007 May 16 4.0 6 Neonatal skin fibroblast Neonate 5F0438 2 2 2007 May 12 2007 May 26 7.0 6 Neonatal skin fibroblast Neonate 5F0474 2 2 2007 May 12 2007 May 26 9.5 7 Adult skin fibroblast 28 6F3535 2 2 2007 May 5 2007 May 16 2.0 7 Adult skin fibroblast 39 6F4026 2 2 2007 May 5 2007 May 16 0.0 5 Adult BM-derived cell (low 20 060470B 2 2 2007 Mar. 20 2007 Apr. 3 0.0 serum) 5 Adult BM-derived cell (low 20 060809B 2 2 2007 Mar. 26 2007 Apr. 9 0.0 serum) 5 Adult BM-derived cell (low 20 060809B 2 2 2007 Apr. 15 2007 Apr. 29 0.2 serum) 5 Adult BM-derived cell (low 20 060809B 2 2 2007 May 5 2007 May 19 0.0 serum) 5 Adult BM-derived mesenchymal 20 060809B 10 2 2007 Mar. 20 2007 Apr. 3 0.0 stem cell (high serum) 5 Adult BM-derived mesenchymal 20 060470B 10 2 2007 Mar. 26 2007 Apr. 9 0.0 stem cell (high serum) 10 Neonatal umbilical cord artery Neonate 5F0442 5 4 2007 May 11 2007 May 24 0.0 smooth muscle cell *The number of colonies composed of alkaline phosphatase-positive small cells per 10 cm.sup.2. BM in Table 2 means Bone Marrow.
Table 3 summarizes the distribution of the karyotype of clone 1-8 at day 101. After the Giemsa stain, chromosome numbers were counted. 67 of 100 cells showed normal karyotype.
(167) TABLE-US-00003 TABLE 3 karyotype analysis Chromosome no. Cell no 44 1 45 22 46 67 47 7 48 1 89 1 136 1 One hundred cells were analyzed in human iPS cells (clone 1-8mTeSR)
Table 4 shows primer sequences used in
(168) TABLE-US-00004 TABLE4 PrimerSequencesforRT-PCR Forwardprimer Reverseprimer sequence sequence HPRT AGTCTGGCTTATATCCAACACTTCG GACTTTGCTTTCCTTGGTCAGG Nanog TACCTCAGCCTCCAGCAGAT TGCGTCACACCATTGCTATT TERT AGCCAGTCTCACCTTCAACCGC GGAGTAGCAGAGGGAGGCCG Sal14 AAACCCCAGCACATCAACTC GTCATTCCCTGGGTGGTTC Zfp42 TTGGAGTGCAATGGTGTGAT TCTGTTCACACAGGCTCCAG GDF3 GGCGTCCGCGGGAATGTACTTC TGGCTTAGGGGTGGTCTGGCC Dnmt3b GCAGCGACCAGTCCTCCGACT AACGTGGGGAAGGCCTGTGC TDGF1 ACAGAACCTGCTGCCTGAAT AGAAATGCCTGAGGAAAGCA GABRB3 CTTGACAATCGAGTGGCTGA TCATCCGTGGTGTAGCCATA CYP26A1 AACCTGCACGACTCCTCGCACA AGGATGCGCATGGCGATTCG Oct4-total GAGAAGGAGAAGCTGGAGCA AATAGAACCCCCAGGGTGAG Oct4-exo AGTAGACGGCATCGCAGCTTGG GGAAGCTTAGCCAGGTCCGAGG Sox2-total CAGGAGAACCCCAAGATGC GCAGCCGCTTAGCCTCG Sox2-exo ACACTGCCCCTCTCACACAT CGGGACTATGGTTGCTGACT Klf4-total ACCCTGGGTCTTGAGGAAGT ACGATCGTCTTCCCCTCTTT Klf4-exo CTCACCCTTACCGAGTCGGCG GCAGCTGGGGCACCTGAACC c-Myc-total TCCAGCTTGTACCTGCAGGATCTGA CCTCCAGCAGAAGGTGATCCAGACT c-Myc-exo AGTAGACGGCATCGCAGCTTGG CCTCCAGCAGAAGGTGATCCAGACT
Table 5 summarizes SNP genotyping of human iPS clone 1-8 and fibroblasts (5F0438 and 5F04156) which were analyzed using the GeneChip Human Mapping 500K Array Set. SNPs of clone 1-8 were consistent to that of parental cells in 464,069 (99.17%) of 467,946 of called SNPs and different from that of parental cells in 3,877 (0.83%) of them. In contrast, SNPs of clone 1-8 mTeSR were consistent to that of unrelated donor cells (5F0416) only in 284,950 (60.50%) of 470,960 of called SNPs and different from that of the unrelated cells in 186,010 (39.50%) of them.
(169) TABLE-US-00005 TABLE 5 SNP genotyping 500K_Set Number of total SNP 500,568 Number of called SNP human iPS-1-8 484,393 96.77% neoFB (5F0438) 480,249 95.94% neoFB (5F0416) 485,626 97.01% human iPS-1-8 vs. neoFB (5F0438) Called SNP in both samples 467,946 ratio Consistent SNP 464,069 99.17% different SNP 3,877 0.83% No called SNP in neither 32,622 human iPS-1-8 vs. neoFB (5F0416) Called SNP in both samples 470,960 ratio Consistent SNP 284,950 60.50% different SNP 186,010 39.50% No called SNP in neither 29,608
Table 6 The HLA-A, HLA-B, HLA-Cw and HLA-DR types of human iPS1-8 (1-8 mTeSR) and fibroblasts (5F0438 and 5F0416) were classified using hybridization of PCR-amplified DNA with sequence specific oligonucleotide probes (SSOP) (Luminex).
(170) TABLE-US-00006 TABLE 6 HLA genotyping ID A allele B allele Cw allele DRB1 allele DQB1 allele DPB1 allele 5F0438 *0101/ *0206/ *3801/09 *3905 *0602/ *0702/ *0802 *1104/43/ *0301/ *0402 *0402/ *0501 5F0416 *0201/ *1501/ *5101/ *0303/ *0401/ *0401/33/38 *0801/26 *0302/ *0402 *0201 *0301/ 1-8(5F0438) *0101/ *0206/ *3801/09 *3905 *0602/ *0702/ *0802 *1104/43/ *0301/ *0402 *0402/ *0501 ID HLA-A HLA-B HLA-Cw HLA-DR HLA-DQ HLA-DP Bw 5F0438 A1 A2 B38 B39 Cw6 Cw7 DR8.2 DR11 DQ7 DQ4 DP4 DP5 4/6 5F0416 A2 B62 B51 Cw9 Cw4 DR4.1 DR8.1 DQ8 DQ4 DP2 DP3 4/6 1-8(5F0438) A1 A2 B38 B39 Cw6 Cw7 DR8.2 DR11 DQ7 DQ4 DP4 DP5 4/6
Table 7 summarized hES cell marker gene expression patterns in colonies. Colonies were stained for alkaline phosphatase at 17 days post 4 genes transduction. All ALP(+) colonies and 18 ALP() colonies were dissected and determined their hES marker gene expression by RT-PCR. Each colony was categorized and counted the number. + represents gene expression, and represents no detection by a 40 cycle RT-PCR using amplified cDNA samples.
(171) TABLE-US-00007 TABLE 7 Gene expression patterns in ALP(+) and ALP() colonies No. of Group gene No. of No. expressed Nanog TDGF1 Dnmt3b Zfp42 FoxD3 GDF3 CYP26A1 TERT colony Gene expression patterns in ALP(+) colonies 1 8 + + + + + + + + 4 2 7 + + + + + + + 7 3 7 + + + + + + + 11 4 7 + + + + + + + 1 5 6 + + + + + + 25 6 6 + + + + + + 4 7 6 + + + + + + 3 8 6 + + + + + + 2 9 6 + + + + + + 3 10 6 + + + + + + 1 11 6 + + + + + + 1 12 5 + + + + + 22 13 5 + + + + + 9 14 5 + + + + + 2 15 5 + + + + + 4 16 5 + + + + + 2 17 5 + + + + + 1 18 5 + + + + + 2 19 5 + + + + + 1 20 4 + + + + 9 21 4 + + + + 3 22 4 + + + + 5 23 4 + + + + 7 24 4 + + + + 1 25 4 + + + + 2 26 4 + + + + 1 27 3 + + + 1 28 3 + + + 3 29 3 + + + 4 30 3 + + + 1 31 3 + + + 1 32 3 + + + 2 33 3 + + + 1 34 3 + + + 1 35 3 + + + 1 36 2 + + 4 37 2 + + 5 38 2 + + 2 39 1 + 2 40 0 2 Gene expression patterns in ALP() colonies 41 6 + + + + + + 1 42 6 + + + + + + 1 43 5 + + + + + 3 44 5 + + + + + 6 45 4 + + + + 1 46 4 + + + + 1 47 4 + + + + 1 48 2 + + 1 49 1 + 1 50 1 + 1 51 0 1
Table 8 summarizes the number of alkaline phosphatase-positive colonies of the experiments using neonatal fibroblasts. The date of four gene introduction is a day when a retrovirus vector was infected. The donor indicates lot number of Lonza products. The number of colonies is the number of colonies composed of alkaline phosphatase-positive small cells per 10 cm.sup.2. ND: not determined.
(172) TABLE-US-00008 TABLE 8 List of experiments experimental conditions ALP staining date of 4 gene cell density number of transduction donor (cell/cm.sup.2) date colony (/10 cm.sup.2) notes 2007 Mar. 20 5F0439 1 10.sup.4 2007 Apr. 3 0.8 2007 Apr. 15 5F0438 1 10.sup.4 2007 Apr. 29 6.0 iPS clone#1-8 2007 May 5 5F0438 1 10.sup.4 2007 May 16 6.0 5F0474 1 10.sup.4 4.0 2007 May 12 5F0438 1 10.sup.4 2007 May 26 7.0 5F0474 1 10.sup.4 9.5 2007 May 26 5F0474 1 10.sup.4 2007 Jun. 9 13.3 2007 Jun. 8 5F0416 1 10.sup.3 2007 Jun. 22 19.0 5F0416 1 10.sup.4 17.5 5F0474 1 10.sup.4 14.0 2007 Jul. 20 5F0416 1 10.sup.3 2007 Aug. 6 3.0 5F0416 1 10.sup.4 9.0 2007 Aug. 10 5F0416 1 10.sup.3 2007 Aug. 27 21.0 ALP(+) colony 5F0416 1 10.sup.4 21.5 classification 5F0474 1 10.sup.3 17.0 5F0474 1 10.sup.4 19.5 2007 Aug. 17 5F0416 1 10.sup.3 ND iPS clone #2-4 5F0416 1 10.sup.4 ND 5F0474 1 10.sup.3 ND 5F0474 1 10.sup.4 ND 2007 Aug. 31 5F1195 1 10.sup.3 ND 2007 Sep. 14 5F0438 1 10.sup.3 ND iPS clone #3-2
Table 9 lists up locations and sizes in genome corresponding to amplicons using for methylation analyses of the promoter regions of Nanog and Oct3/4. Columns A, B and C indicate amplicon name, locations and sizes in genome corresponding to amplicons, respectively.
(173) TABLE-US-00009 TABLE 9 Promoter regions in methylation analysis amplicon location in genome size of name corresponding to amplicon amplicon Nanog-z1 chr12: 7832645-7832959 315 Nanog-z2 chr12: 7832877-7833269 393 Oct3/4-z1 chr6: 31248581-31249029 449 Oct3/4-z2 chr6_qbl_hap2: 2388299-2388525 227
Table 10 lists up the primer sets using for methylation analyses of the promoter regions of Nanog and Oct3/4. Columns A and B indicate names of primers and sequences of primers (capital for gene-specific sequences, lower case for tag sequences), respectively.
(174) TABLE-US-00010 TABLE10 Primersequencesformethylationanalyses namesof sequencesofprimers(capitalforgene-specific primers sequences,lowercasefortagsequences) Nanog-z1-L aggaagagagGGAATTTAAGGTGTATGTATTTTTTATTTT cagtaatacgactcactatagggagaaggctATAACCCACCCCTATAATC Nanog-z1-R CCAATA Nanog-z2-L aggaagagagGTTAGGTTGGTTTTAAATTTTTGAT cagtaatacgactcactatagggagaaggctTTTATAATAAAAACTCTAT Nanog-z2-R CACCTTAAACC Oct3/4-z1-L aggaagagagTAGTAGGGATTTTTTGGATTGGTTT cagtaatacgactcactatagggagaaggctAAAACTTTTCCCCCACTCT Oct3/4-z1-R TATATTAC Oct3/4-z2-L aggaagagagGGTAATAAAGTGAGATTTTGTTTTAAAAA cagtaatacgactcactatagggagaaggctCCACCCACTAACCTTAACC Oct3/4-z2-R TCTAA
Table 11 summarizes relative mRNA expression in ALP positive colonies of Examples 15. Numbers of colonies are corresponding to
(175) TABLE-US-00011 TABLE 11 Relative mRNA expression of ES cell markers in ALP positive colonies Sam- Nanog GDF3 CYP26A1 TERT Myc Oct4 Group ple ALP mean SD mean SD mean SD mean SD mean SD mean SD iPS ALP(+) 1.0 1.0 1.0 1.0 1.0 1.0 1-8 1 #5-2- ALP(+) 9.3 1.5 4.8 0.3 27.2 12.5 0.2 0.0 1121.1 25.3 39.3 1.5 32 1 #5-2- ALP(+) 15.9 5.7 242.9 78.8 3.0 0.3 3.7 0.5 1106.3 51.8 770.6 9.3 49 1 #5-2- ALP(+) 27.1 2.2 419.2 24.7 73.5 8.2 2.5 0.1 1329.4 272.1 101.6 5.1 51 1 #7-2- ALP(+) 36.9 7.8 171.3 20.0 110.1 15.4 6.2 1.1 566.9 22.1 30.9 2.4 37 3 #1- ALP(+) 21.0 2.4 59.2 10.2 0.0 0.0 0.12 0.09 436 12 25.0 1.2 1-5 3 #1-1- ALP(+) 127.6 6.0 259.7 3.9 0.0 0.0 0.6 0.3 59.2 1.2 9.1 0.1 11 3 #1-1- ALP(+) 32.6 8.4 34.0 5.0 0.0 0.0 1.1 446.9 15.8 14.9 0.1 19 3 #1-2- ALP(+) 9.5 1.0 3.4 0.9 0.0 0.0 1.6 0.1 1052.8 129.5 17.1 0.3 28 3 #3-1- ALP(+) 141.5 64.3 328.8 54.1 0.0 0.0 7.0 0.7 9796.2 275.5 324.2 29.8 218 3 #3-2- ALP(+) 78.0 16.6 188.2 3.8 0.0 0.0 67.6 7.1 9714.4 15.7 258.7 13.3 226 3 #5-2- ALP(+) 55.5 12.2 151.3 21.2 0.0 0.0 5.2 0.1 285.3 49.6 24.8 3.2 41 3 #5-2- ALP(+) 0.1 0.1 0.1 0.1 0.0 0.0 1.1 0.0 13065.1 769.8 241.8 0.7 44 3 #5-2- ALP(+) 10.9 2.6 67.9 12.3 0.0 0.0 4.4 0.8 171.5 2.3 578.7 13.4 46 3 #5-2- ALP(+) 0.1 0.0 0.4 0.1 0.0 0.0 0.7 0.5 3176.2 751.2 233.4 17.7 50 3 #7-2- ALP(+) 51.5 14.4 126.4 1.1 0.0 0.0 2.5 0.3 1446.0 421.7 33.8 2.6 26 4 #5- ALP(+) 0.7 0.1 0.0 0.0 5.0 0.5 0.2 6049.2 396.9 3.8 0.3 1-2 7 #3-2- ALP(+) 14.6 1.1 0.0 0.0 0.0 0.0 40.0 5.7 27086.4 3870.8 530.6 84.1 227 7 #5-1- ALP(+) 20.1 5.9 0.0 0.0 0.0 0.0 1.9 1.0 9125.8 883.7 7.5 0.7 13 7 #7-2- ALP(+) 1.1 0.4 0.0 0.0 0.0 0.0 20.6 0.6 8344.9 2054.5 6.7 0.5 31 8 #3-1- ALP(+) 103.4 11.7 195.3 17.7 0.0 0.0 18.1 1.8 95692.9 5109.8 2843.9 113.9 210 8 #3-1- ALP(+) 50.8 3.6 291.3 43.9 0.0 0.0 20.2 2.9 29701.1 4821.3 483.1 13.9 211 11 #1-1- ALP(+) 50.3 14.5 34.3 3.6 10.4 2.0 1.3 0.1 533.8 24.8 30.2 1.2 20 12 #5-1- ALP(+) 9.3 0.5 0.0 0.0 0.0 0.0 0.0 0.0 16848.2 1742.0 4.7 0.2 20 19 #3-2- ALP(+) 126.4 65.3 0.0 0.0 0.0 0.0 28.7 4.9 23614.4 388.9 310.9 19.2 233 23 #5-1- ALP(+) 3.7 1.3 0.0 0.0 0.0 0.0 0.0 0.0 2927.9 412.5 130.3 10.1 16 23 #5-1- ALP(+) 1.9 0.3 0.0 0.0 0.0 0.0 0.0 0.0 19433.2 297.0 4.2 0.5 18 23 #7-2- ALP(+) 17.4 5.1 0.0 0.0 0.0 0.0 0.0 0.0 1959.8 379.9 8.5 0.7 46 28 #3-1- ALP(+) 2.2 0.3 0.0 0.0 0.0 0.0 0.0 0.0 6065.6 704.9 3.4 0.3 215 29 #3-1- ALP(+) 1.9 0.3 0.0 0.0 0.0 0.0 0.0 0.0 4572.6 303.7 7.4 0.1 212 29 #5- ALP(+) 1.4 0.2 0.0 0.0 0.0 0.0 0.0 0.0 53755.3 10897.7 22.9 3.0 1-4 30 #3-2- ALP(+) 5.6 2.9 0.0 0.0 0.0 0.0 807.1 13.4 25595.8 2002.8 414.9 22.6 228 42 #305- ALP() 0.5 0.1 0.1 0.0 0.0 0.0 0.0 5873.2 156.2 226.3 12.9 2-28 44 #5- ALP() 0.8 0.2 0.0 0.0 1.6 0.3 0.5 0.2 8698.4 492.3 58.7 2.6 1-3 44 #5-1- ALP() 6.9 1.1 0.0 0.0 0.0 0.0 0.7 0.1 9350.1 201.0 2.1 0.1 23 44 #5-1- ALP() 7.2 2.0 0.0 0.0 0.0 0.0 7.3 1.8 26133.6 3528.5 8.0 0.1 24 44 #5-2- ALP() 0.2 0.1 0.0 0.0 0.0 0.0 0.5 0.1 5211.8 618.7 370.7 7.8 25 44 #5-2- ALP() 2.5 0.5 0.0 0.0 0.0 0.0 0.5 0.1 8971.8 110.3 266.6 21.4 36 44 #7-2- ALP() 3.4 0.9 0.0 0.0 0.0 0.0 11.8 3.4 9748.3 530.0 7.3 0.1 40 47 #7-1- ALP() 0.2 0.1 0.0 0.0 0.0 0.0 14.6 1.9 7681.0 286.9 261.0 26.0 21 48 #F ALP() 0.6 0.3 0.0 0.0 0.0 0.0 8.2 0.6 53887.9 1343.2 13.3 1.2 49 #I ALP() 2.1 0.6 0.0 0.0 226.0 17.7 0.0 0.0 906.4 231.6 7.2 0.2 50 #B ALP() 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 4461.3 589.3 5.2 0.4 51 #H ALP() 2.1 0.6 0.0 0.0 226.0 17.7 0.0 0.0 906.4 231.6 7.2 0.2
Table 12 summarizes relative mRNA expression in clone-2-4 and 3-2. Total RNA was extracted from clones 2-4 and 3-2. Expression of ES cell marker genes were determined by qRT-PCR as described in Example 16 and 17. Both clone-2-4 and -3-2 showed ES cell marker gene expression. All expression values were normalized against human iPS clone-1-8 (day 94).
(176) TABLE-US-00012 TABLE 12 relative mRNA expression in clone-2-4 and 3-2. #3-2_day48 #2-4_day59 #1-8_day82 #1-8_day94 Nanog 4.21 1.11 2.88 0.43 2.41 1.00 0.24 TERT 1.52 0.50 1.94 0.14 0.69 1.00 0.70 GDF3 6.42 0.16 6.65 0.05 0.92 1.00 0.49 CYP26A1 72.45 14.92 49.12 0.06 62.50 1.00 0.01 TDGF1 2.55 0.10 3.53 0.05 3.53 1.00 0.01 Dnmt3b 2.66 0.04 0.96 0.02 0.91 1.00 0.01 Foxd3 1.16 0.08 0.59 0.17 1.14 1.00 0.18 Zfp42 0.98 0.15 0.76 0.01 2.44 1.00 0.02 Myc 6.14 0.58 4.58 0.16 3.82 1.00 0.05 Oct3/4 2.00 0.07 1.08 0.01 1.33 1.00 0.00
INDUSTRIAL APPLICABILITY
(177) Cells in a tissue that was lost in diseases etc. can be supplied by inducing human pluripotent cells from the undifferentiated stem cells harvested from a patient by using the induction method of the present invention, followed by inducing to differentiate into a necessary cell depending on diseases and then transplanting the cells to the patient. The undifferentiated stem cells of the present invention present in a human postnatal tissue can be used to search drugs that promote the induction from said undifferentiated stem cells to human pluripotent stem cells by using markers such as Tert, Nanog, Sox2, Oct3/4 and alkaline phosphatase that direct the induction to human pluripotent stem cells. Said drugs can be used in stead of gene introduction and can enhance the induction efficiency of human pluripotent stem cells.