Recombinant spike protein subunit based vaccine for porcine epidemic diarrhea virus (PEDV)
09713639 ยท 2017-07-25
Assignee
Inventors
Cpc classification
C12N2710/14041
CHEMISTRY; METALLURGY
A61K39/215
HUMAN NECESSITIES
C12N7/00
CHEMISTRY; METALLURGY
C12N2770/20034
CHEMISTRY; METALLURGY
International classification
A61K39/215
HUMAN NECESSITIES
A61K39/295
HUMAN NECESSITIES
C12N7/00
CHEMISTRY; METALLURGY
Abstract
The present invention encompasses porcine epidemic diarrhea virus (PEDV) vaccines or compositions. The vaccine or composition may be a vaccine or composition containing PEDV antigens. The invention also encompasses recombinant vectors encoding and expressing PEDV antigens, epitopes or immunogens which can be used to protect porcine animals against PEDV.
Claims
1. An immunogenic composition comprising a recombinant spike polypeptide of porcine epidemic diarrhea virus comprising SEQ ID NO:19 and a pharmaceutically or veterinary acceptable vehicle, diluent or excipient, and wherein the recombinant spike polypeptide is expressed in a baculovirus expression system.
2. The immunogenic composition of claim further comprising a suitable adjuvant.
3. The immunogenic composition of claim 1, wherein the recombinant spike polypeptide is encoded by a nucleotide comprising the sequence of SEQ ID NO:18.
4. A method of vaccinating a host susceptible to PEDV comprising at least one administration of a vaccine according to claim 2.
5. The composition of claim 2, further comprising at least one additional antigen associated with a pathogen other than porcine epidemic diarrhea virus.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1) The figures are aligned with the sequences according to Table 1.
(2) TABLE-US-00001 TABLE 1 SEQ ID NO TYPE Description 1 DNA 5 UTR nucleotide sequence of Newport Labs PEDV isolate 2 DNA Polyprotein nucleotide sequence ORF1a and ORF1b 3 DNA Spike (S domain) nucleotide sequence 4 DNA ORF3 Coronavirus NS3b nucleotide sequence 5 DNA Envelope protein 6 DNA Reseq19R reverse gap fill primer 7 DNA Membrane protein nucleotide sequence 8 DNA Intergenic region B 9 DNA Nucleoprotein nucleotide sequence 10 DNA 3 UTR nucleotide sequence of Newport Labs PEDV isolate 11 protein ORF1a/ORF1b amino acid sequence 12 protein Spike (S1 and S2domains) protein amino acid sequence 13 protein ORF3 Coronavirus NS3b amino acid sequence 14 protein Envelope protein amino acid sequence 15 protein Membrane protein amino acid sequence 16 protein Nucleoprotein amino acid sequence 17 protein Truncated and fused S1 and S2 domains of the spike protein 18 DNA Codon optimized nucleotide sequence of the truncated and fused S1 and S2 domains of the spike protein 19 protein Codon optimized amino acid sequence of the truncated and fused S1 and S2 domains of the spike protein 20 DNA Final nucleotide sequence for cloning into vector showing N-terminal gp67 signal peptide sequence 21 protein Final amino acid sequence showing N-terminal gp67 signal peptide sequence and histidine tag 22 protein Antigenicity index of a portion of native spike (S1 domain) protein 23 protein Antigenicity index of a portion of native spike (S1 domain) protein 24 protein Antigenicity index of a portion of native spike (S1 domain) protein 25 protein Antigenicity index of a portion of native spike (S1 domain) protein 26 protein Antigenicity index of a portion of native spike (S1 domain) protein 27 protein Antigenicity index of a portion of native spike (S1 domain) protein 28 protein Antigenicity index of a portion of native spike (S1 domain) protein 29 protein Antigenicity index of a portion of native spike (S1 domain) protein 30 protein Antigenicity index of a portion of native spike (S1 domain) protein 31 protein Antigenicity index of a portion of native spike (S1 domain) protein 32 protein Antigenicity index of a portion of native spike (S1 domain) protein 33 protein Antigenicity index of a portion of native spike (S1 domain) protein 34 protein Antigenicity index of a portion of native spike (S1 domain) protein 35 protein Antigenicity index of a portion of native spike (S1 domain) protein 36 protein Antigenicity index of a portion of native spike (S1 domain) protein 37 protein Antigenicity index of a portion of native spike (S1 domain) protein 38 protein Antigenicity index of a portion of native spike (S1 domain) protein 39 protein Antigenicity index of a portion of native spike (S1 domain) protein 40 protein Antigenicity index of a portion of native spike (S1 domain) protein 41 protein Antigenicity index of a portion of native spike (S1 domain) protein 42 protein Antigenicity index of a portion of native spike (S1 domain) protein 43 protein Antigenicity index of a portion of native spike (S1 domain) protein 44 protein Antigenicity index of a portion of native spike (S1 domain) protein 45 protein Antigenicity index of a portion of native spike (S1 domain) protein 46 protein Antigenicity index of a portion of native spike (S1 domain) protein 47 protein Antigenicity index of a portion of native spike (S1 domain) protein 48 protein Antigenicity index of a portion of native spike (S1 domain) protein 49 protein Antigenicity index of a portion of native spike (S1 domain) protein 50 protein Antigenicity index of a portion of native spike (S1 domain) protein 51 protein Antigenicity index of a portion of native spike (S1 domain) protein 52 protein Antigenicity index of a portion of native spike (S1 domain) protein 53 protein Antigenicity index of a portion of native spike (S1 domain) protein 54 protein Antigenicity index of a portion of native spike (S1 domain) protein 55 protein Antigenicity index of a portion of native spike (S2 domain) protein 56 protein Antigenicity index of a portion of native spike (S2 domain) protein 57 protein Antigenicity index of a portion of native spike (S2 domain) protein 58 protein Antigenicity index of a portion of native spike (S2 domain) protein 59 protein Antigenicity index of a portion of native spike (S2 domain) protein 60 protein Antigenicity index of a portion of native spike (S2 domain) protein 61 protein Antigenicity index of a portion of native spike (S2 domain) protein 62 protein Antigenicity index of a portion of native spike (S2 domain) protein 63 protein Antigenicity index of a portion of native spike (S2 domain) protein 64 protein Antigenicity index of a portion of native spike (S2 domain) protein 65 protein Antigenicity index of a portion of native spike (S2 domain) protein 66 protein Antigenicity index of a portion of native spike (S2 domain) protein 67 protein Antigenicity index of a portion of native spike (S2 domain) protein 68 protein Antigenicity index of a portion of native spike (S2 domain) protein 69 protein Antigenicity index of a portion of native spike (S2 domain) protein 70 protein Antigenicity index of a portion of native spike (S2 domain) protein 71 protein Antigenicity index of a portion of native spike (S2 domain) protein 72 protein Antigenicity index of a portion of native spike (S2 domain) protein 73 protein Antigenicity index of a portion of native spike (S2 domain) protein 74 protein Antigenicity index of a portion of native spike (S2 domain) protein 75 protein Antigenicity index of a portion of native spike (S2 domain) protein 76 protein Antigenicity index of a portion of native spike (S2 domain) protein 77 protein Antigenicity index of a portion of native spike (S2 domain) protein 78 DNA Original non-truncated non-fused NPL-PEDV spike (S domain) nucleotide sequence 79 protein Original non-truncated non-fused NPL-PEDV spike (S domain) protein sequence 80 DNA PEDF1 forward primer 81 DNA PEDF2 forward primer 82 DNA PEDF3 forward primer 83 DNA PEDF4 forward primer 84 DNA PEDF5 forward primer 85 DNA PEDF6 forward primer 86 DNA PEDF7 forward primer 87 DNA PEDF8 forward primer 88 DNA PEDF9 forward primer 89 DNA PEDF10 forward primer 90 DNA PEDF11 forward primer 91 DNA PEDF12 forward primer 92 DNA PEDF13 forward primer 93 DNA PEDF14 forward primer 94 DNA PEDF15 forward primer 95 DNA PEDF16 forward primer 96 DNA PEDF17 forward primer 97 DNA PED18 forward primer 98 DNA PEDF19 forward primer 99 DNA PEDF20 forward primer 100 DNA PEDF21 forward primer 101 DNA PEDF22 forward primer 102 DNA PEDF23 forward primer 103 DNA PEDF24 forward primer 104 DNA PEDF25 forward primer 105 DNA PEDF26 forward primer 106 DNA PED27 forward primer 107 DNA PEDF28 forward primer 108 DNA PEDF29 forward primer 109 DNA PEDF30 forward primer 110 DNA PEDF31 forward primer 111 DNA PEDF32 forward primer 112 DNA PEDR1 reverse primer 113 DNA PEDR2 reverse primer 114 DNA PEDR3 reverse primer 115 DNA PEDR4 reverse primer 116 DNA PEDR5 reverse primer 117 DNA PEDR6 reverse primer 118 DNA PEDR7 reverse primer 119 DNA PEDR8 reverse primer 120 DNA PEDR9 reverse primer 121 DNA PEDR10 reverse primer 122 DNA PEDR11 reverse primer 123 DNA PEDR12 reverse primer 124 DNA PEDR13 reverse primer 125 DNA PEDR14 reverse primer 126 DNA PEDR15 reverse primer 127 DNA PEDR16 reverse primer 128 DNA PEDR17 reverse primer 129 DNA PEDR18 reverse primer 130 DNA PEDR19 reverse primer 131 DNA PEDR20 reverse primer 132 DNA PEDR21 reverse primer 133 DNA PEDR22 reverse primer 134 DNA PEDR23 reverse primer 135 DNA PEDR24 reverse primer 136 DNA PEDR25 reverse primer 137 DNA PEDR26 reverse primer 138 DNA PEDR27 reverse primer 139 DNA PEDR28 reverse primer 140 DNA PERR29 reverse primer 141 DNA PEDR30 reverse primer 142 DNA PEDR31 reverse primer 143 DNA PEDR32 reverse primer 144 DNA Reseq1F forward gap fill primer 145 DNA Reseq1R reverse gap fill primer 146 DNA Reseq2F forward gap fill primer 147 DNA Reseq2R reverse gap fill primer 148 DNA Reseq3F forward gap fill primer 149 DNA Reseq3R reverse gap fill primer 150 DNA Reseq4F forward gap fill primer 151 DNA Reseq4R reverse gap fill primer 152 DNA Reseq5F forward gap fill primer 153 DNA Reseq5R reverse gap fill primer 154 DNA Reseq6F forward gap fill primer 155 DNA Reseq6R reverse gap fill primer 156 DNA Reseq7F forward gap fill primer 157 DNA Reseq7R reverse gap fill primer 158 DNA Reseq8F forward gap fill primer 159 DNA Reseq8R reverse gap fill primer 160 DNA Reseq9F forward gap fill primer 161 DNA Reseq9R reverse gap fill primer 162 DNA Reseq10F forward gap fill primer 163 DNA Reseq10R reverse gap fill primer 164 DNA Reseq11F forward gap fill primer 165 DNA Reseq11R reverse gap fill primer 166 DNA Reseq12F forward gap fill primer 167 DNA Reseq12R reverse gap fill primer 168 DNA Reseq13F forward gap fill primer 169 DNA Reseq13R reverse gap fill primer 170 DNA Reseq14F forward gap fill primer 171 DNA Reseq14R reverse gap fill primer 172 DNA Reseq15F forward gap fill primer 173 DNA Reseq15R reverse gap fill primer 174 DNA Reseq16F forward gap fill primer 175 DNA Reseq16R reverse gap fill primer 176 DNA Reseq17F forward gap fill primer 177 DNA Reseq17R reverse gap fill primer 178 DNA Reseq18F forward gap fill primer 179 DNA Reseq18R reverse gap fill primer 180 DNA Reseq19F forward gap fill primer
(3) A full and enabling description of the present invention is set forth in the remainder of the specification, including reference to the accompanying figures, wherein:
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
DETAILED DESCRIPTION OF THE INVENTION
(18) Unless otherwise explained, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. The singular terms a, an, and the include plural referents unless context clearly indicates otherwise. Similarly, the word or is intended to include and unless the context clearly indicate otherwise.
(19) It is noted that in this disclosure and particularly in the claims and/or paragraphs, terms such as comprises, comprised, comprising and the like can have the meaning attributed to it in U.S. Patent law; e.g., they can mean includes, included, including, and the like; and that terms such as consisting essentially of and consists essentially of have the meaning ascribed to them in U.S. Patent law, e.g., they allow for elements not explicitly recited, but exclude elements that are found in the prior art or that affect a basic or novel characteristic of the invention.
(20) The antigenic polypeptides of the invention are capable of protecting against porcine epidemic diarrhea virus (PEDV). That is, they are capable of stimulating an immune response in an animal. By antigen or immunogen means a substance that induces a specific immune response in a host animal. The antigen of the instant invention is a subunit or portion of an organism; a recombinant vector containing an insert with immunogenic properties; a piece or fragment of DNA capable of inducing an immune response upon presentation to a host animal; a polypeptide, an epitope, a hapten, or any combination thereof.
(21) The term immunogenic protein, polypeptide, or peptide as used herein includes polypeptides that are immunologically active in the sense that once administered to the host, it is able to evoke an immune response of the humoral and/or cellular type directed against the protein. A protein fragment according to the invention has at least one epitope or antigenic determinant. An immunogenic protein or polypeptide, as used herein, includes the full-length sequence of the protein, analogs thereof, or immunogenic fragments thereof.
(22) As discussed the invention encompasses active fragments and variants of the antigenic polypeptide. Thus, the term immunogenic protein, polypeptide, or peptide further contemplates deletions, additions and substitutions to the sequence, so long as the polypeptide functions to produce an immunological response as defined herein. The term conservative variation denotes the replacement of an amino acid residue by another biologically similar residue, or the replacement of a nucleotide in a nucleic acid sequence such that the encoded amino acid residue does not change or is another biologically similar residue. In this regard, particularly preferred substitutions will generally be conservative in nature, i.e., those substitutions that take place within a family of amino acids. For example, amino acids are generally divided into four families: (1) acidicaspartate and glutamate; (2) basiclysine, arginine, histidine; (3) non-polaralanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan; and (4) uncharged polarglycine, asparagine, glutamine, cysteine, serine, threonine, tyrosine. Phenylalanine, tryptophan, and tyrosine are sometimes classified as aromatic amino acids. Examples of conservative variations include the substitution of one hydrophobic residue such as isoleucine, valine, leucine or methionine for another hydrophobic residue, or the substitution of one polar residue for another polar residue, such as the substitution of arginine for lysine, glutamic acid for aspartic acid, or glutamine for asparagine, and the like; or a similar conservative replacement of an amino acid with a structurally related amino acid that will not have a major effect on the biological activity. Proteins having substantially the same amino acid sequence as the reference molecule but possessing minor amino acid substitutions that do not substantially affect the immunogenicity of the protein are, therefore, within the definition of the reference polypeptide. All of the polypeptides produced by these modifications are included herein. The term conservative variation also includes the use of a substituted amino acid in place of an unsubstituted parent amino acid provided that antibodies raised to the substituted polypeptide also immunoreact with the unsubstituted polypeptide.
(23) The term epitope refers to the site on an antigen or hapten to which specific B cells and/or T cells respond. The term is also used interchangeably with antigenic determinant or antigenic determinant site. Antibodies that recognize the same epitope can be identified in a simple immunoassay showing the ability of one antibody to block the binding of another antibody to a target antigen.
(24) An immunological response to a composition or vaccine is the development in the host of a cellular and/or antibody-mediated immune response to a composition or vaccine of interest. Usually, an immunological response includes but is not limited to one or more of the following effects: the production of antibodies, B cells, helper T cells, and/or cytotoxic T cells, directed specifically to an antigen or antigens included in the composition or vaccine of interest. Preferably, the host will display either a therapeutic or protective immunological response such that resistance to new infection will be enhanced and/or the clinical severity of the disease reduced. Such protection will be demonstrated by either a reduction or lack of symptoms normally displayed by an infected host, a quicker recovery time and/or a lowered viral titer in the infected host.
(25) Synthetic antigens are also included within the definition, for example, polyepitopes, flanking epitopes, and other recombinant or synthetically derived antigens. See, e.g., Bergmann et al., 1993; Bergmann et al., 1996; Suhrbier, 1997; Gardner et al., 1998. Immunogenic fragments, for purposes of the present invention, will usually include at least about 3 amino acids, at least about 5 amino acids, at least about 10-15 amino acids, or about 15-25 amino acids or more amino acids, of the molecule. There is no critical upper limit to the length of the fragment, which could comprise nearly the full-length of the protein sequence, or even a fusion protein comprising at least one epitope of the protein.
(26) Accordingly, a minimum structure of a polynucleotide expressing an epitope is that it has nucleotides encoding an epitope or antigenic determinant of a PEDV polypeptide. A polynucleotide encoding a fragment of a PEDV polypeptide may have a minimum of 15 nucleotides, about 30-45 nucleotides, about 45-75, or at least 57, 87 or 150 consecutive or contiguous nucleotides of the sequence encoding the polypeptide. Epitope determination procedures, such as, generating overlapping peptide libraries (Hemmer et al., 1998), Pepscan (Geysen et al., 1984; Geysen et al., 1985; Van der Zee R. et al., 1989; Geysen, 1990; Multipin Peptide Synthesis Kits de Chiron) and algorithms (De Groot et al., 1999; PCT/US2004/022605) can be used in the practice of the invention.
(27) The term nucleic acid or polynucleotide refers to RNA or DNA that is linear or branched, single or double stranded, or a hybrid thereof. The term also encompasses RNA/DNA hybrids. The following are non-limiting examples of polynucleotides: a gene or gene fragment, exons, introns, mRNA, tRNA, rRNA, ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes and primers. A polynucleotide may comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs, uracyl, other sugars and linking groups such as fluororibose and thiolate, and nucleotide branches. The sequence of nucleotides may be further modified after polymerization, such as by conjugation, with a labeling component. Other types of modifications included in this definition are caps, substitution of one or more of the naturally occurring nucleotides with an analog, and introduction of means for attaching the polynucleotide to proteins, metal ions, labeling components, other polynucleotides or solid support. The polynucleotides can be obtained by chemical synthesis or derived from a microorganism.
(28) The term gene is used broadly to refer to any segment of polynucleotide associated with a biological function. Thus, genes include introns and exons as in genomic sequence, or just the coding sequences as in cDNAs and/or the regulatory sequences required for their expression. For example, gene also refers to a nucleic acid fragment that expresses mRNA or functional RNA, or encodes a specific protein, and which includes regulatory sequences.
(29) The invention further comprises a complementary strand to a polynucleotide encoding a PEDV antigen, epitope or immunogen. The complementary strand can be polymeric and of any length, and can contain deoxyribonucleotides, ribonucleotides, and analogs in any combination.
(30) The terms protein, peptide, polypeptide and polypeptide fragment are used interchangeably herein to refer to polymers of amino acid residues of any length. The polymer can be linear or branched, it may comprise modified amino acids or amino acid analogs, and it may be interrupted by chemical moieties other than amino acids. The terms also encompass an amino acid polymer that has been modified naturally or by intervention; for example disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation or modification, such as conjugation with a labeling or bioactive component.
(31) An isolated biological component (such as a nucleic acid or protein or organelle) refers to a component that has been substantially separated or purified away from other biological components in the cell of the organism in which the component naturally occurs, for instance, other chromosomal and extra-chromosomal DNA and RNA, proteins, and organelles. Nucleic acids and proteins that have been isolated include nucleic acids and proteins purified by standard purification methods. The term also embraces nucleic acids and proteins prepared by recombinant technology as well as chemical synthesis.
(32) The term purified as used herein does not require absolute purity; rather, it is intended as a relative term. Thus, for example, a purified polypeptide preparation is one in which the polypeptide is more enriched than the polypeptide is in its natural environment. That is the polypeptide is separated from cellular components. By substantially purified it is intended that such that the polypeptide represents several embodiments at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 98%, or more of the cellular components or materials have been removed. Likewise, the polypeptide may be partially purified. By partially purified is intended that less than 60% of the cellular components or material is removed. The same applies to polynucleotides. The polypeptides disclosed herein can be purified by any of the means known in the art.
(33) As noted above, the antigenic polypeptides or fragments or variants thereof are PEDV antigenic polypeptides that are produced in insect cells. Fragments and variants of the disclosed polynucleotides and polypeptides encoded thereby are also encompassed by the present invention. By fragment is intended a portion of the polynucleotide or a portion of the antigenic amino acid sequence encoded thereby. Fragments of a polynucleotide may encode protein fragments that retain the biological activity of the native protein and hence have immunogenic activity as noted elsewhere herein. Fragments of the polypeptide sequence retain the ability to induce a protective immune response in an animal.
(34) Variants is intended to mean substantially similar sequences. For polynucleotides, a variant comprises a deletion and/or addition of one or more nucleotides at one or more sites within the native polynucleotide and/or a substitution of one or more nucleotides at one or more sites in the native polynucleotide. As used herein, a native polynucleotide or polypeptide comprises a naturally occurring nucleotide sequence or amino acid sequence, respectively. Variants of a particular polynucleotide of the invention (i.e., the reference polynucleotide) can also be evaluated by comparison of the percent sequence identity between the polypeptide encoded by a variant polynucleotide and the polypeptide encoded by the reference polynucleotide. Variant protein is intended to mean a protein derived from the native protein by deletion or addition of one or more amino acids at one or more sites in the native protein and/or substitution of one or more amino acids at one or more sites in the native protein. Variant proteins encompassed by the present invention are biologically active, that is they the ability to elicit an immune response.
(35) As used herein, the term derivative or variant refers to a polypeptide, or a nucleic acid encoding a polypeptide, that has one or more conservative amino acid variations or other minor modifications such that (1) the corresponding polypeptide has substantially equivalent function when compared to the wild type polypeptide or (2) an antibody raised against the polypeptide is immunoreactive with the wild-type polypeptide. These variants or derivatives include polypeptides having minor modifications of the NPL-PEDV polypeptide primary amino acid sequences that may result in peptides which have substantially equivalent activity as compared to the unmodified counterpart polypeptide. Such modifications may be deliberate, as by site-directed mutagenesis, or may be spontaneous. The term variant further contemplates deletions, additions and substitutions to the sequence, so long as the polypeptide functions to produce an immunological response as defined herein.
(36) The term conservative variation denotes the replacement of an amino acid residue by another biologically similar residue, or the replacement of a nucleotide in a nucleic acid sequence such that the encoded amino acid residue does not change or is another biologically similar residue. In this regard, particularly preferred substitutions will generally be conservative in nature, as described above.
(37) The polynucleotides of the disclosure include sequences that are degenerate as a result of the genetic code, e.g., optimized codon usage for a specific host. As used herein, optimized refers to a polynucleotide that is genetically engineered to increase its expression in a given species. To provide optimized polynucleotides coding for PEDV polypeptides, the DNA sequence of the PEDV gene can be modified to 1) comprise codons preferred by highly expressed genes in a particular species; 2) comprise an A+T or G+C content in nucleotide base composition to that substantially found in said species; 3) form an initiation sequence of said species; or 4) eliminate sequences that cause destabilization, inappropriate polyadenylation, degradation and termination of RNA, or that form secondary structure hairpins or RNA splice sites. Increased expression of PEDV protein in said species can be achieved by utilizing the distribution frequency of codon usage in eukaryotes and prokaryotes, or in a particular species. The term frequency of preferred codon usage refers to the preference exhibited by a specific host cell in usage of nucleotide codons to specify a given amino acid. There are 20 natural amino acids, most of which are specified by more than one codon. Therefore, all degenerate nucleotide sequences are included in the disclosure as long as the amino acid sequence of the PEDV polypeptide encoded by the nucleotide sequence is functionally unchanged.
(38) The invention further encompasses the PEDV polynucleotides contained in a vector molecule or an expression vector and operably linked to a promoter element and optionally to an enhancer. A vector refers to a recombinant DNA or RNA plasmid or virus that comprises a heterologous polynucleotide to be delivered to a target cell, either in vitro or in vivo. The heterologous polynucleotide may comprise a sequence of interest for purposes of prevention or therapy, and may optionally be in the form of an expression cassette. As used herein, a vector needs not be capable of replication in the ultimate target cell or subject. The term includes cloning vectors and viral vectors.
(39) The term recombinant means a polynucleotide semisynthetic, or synthetic origin which either does not occur in nature or is linked to another polynucleotide in an arrangement not found in nature.
(40) Heterologous means derived from a genetically distinct entity from the rest of the entity to which it is being compared. For example, a polynucleotide may be placed by genetic engineering techniques into a plasmid or vector derived from a different source, and is a heterologous polynucleotide. A promoter removed from its native coding sequence and operatively linked to a coding sequence other than the native sequence is a heterologous promoter.
(41) The present invention relates to porcine vaccines or pharmaceutical or immunological compositions which may comprise an effective amount of a recombinant PEDV antigens and a pharmaceutically or veterinarily acceptable carrier, excipient, or vehicle.
(42) The subject matter described herein is directed in part, to compositions and methods related to the PEDV antigen prepared in an insect expression system that was highly immunogenic and protected animals against challenge from PEDV strains.
(43) Newport Laboratories Inc., received small intestine and colon samples from 0-7 day old piglets in May 2013. The piglets were exhibiting vomiting and diarrhea. PEDV is related to transmissible gastroenteritis virus (TGEV) and causes enteric disease clinically indistinguishable from TGEV. There is little to no cross protection afforded by immunity developed to one virus against the other. Similarly, diagnostic tests designed to detect TGEV will not detect PEDV or vice versa. However, we detected PEDV by qPCR using multiplex real-time RT-PCR technique (Kim et al., 2007). In addition, the samples were negative for TGEV or rotavirus group ABC. The samples were then used to extract viral RNA and the complete genome of the NPL-PEDV (i.e., Newport Laboratories Porcine Epidemic Diarrhea Virus). The strain was sequenced using a primer walking technique, assembled and annotated. Complete in silico genome analysis was performed and the spike protein was selected to develop a first generation recombinant vaccine.
(44) PEDV spike protein plays an important role in viral infection and pathogenesis. Mutation of spike protein can cause attenuation and antibodies against spike protein can reduce PEDV infection. In addition, the spike protein gene is highly conserved across pathogenic PEDV strains. Therefore, development of a subunit vaccine containing spike protein may afford broader protection. With this objective a recombinant spike protein gene was codon optimized and synthesized from the NPL-PEDV genome sequence information and expressed in a baculovirus expression system. The next generation of vaccines may include other possible PEDV target antigens such as M and N proteins and possibly portions of ORF1ab. Baculovirus expression systems could also be used to create virus-like particle (VLP) vaccines. This information will also be used to develop attenuated PEDV strains by directed mutagenesis for live vaccination program.
(45) Methods and Results
(46) Isolation of Viral RNA and Whole Genome Sequencing
(47) The intestinal samples were pooled into two sets and were used for total nucleic acid extraction independently. Briefly, 200 L of PEDV pools 1 and 2 were treated with a DNAse/RNAse cocktail [Epicentre Biotechnologies, WI, USA] using 2 U of enzyme/microliter of suspension after adding MgCl.sub.2 to a final concentration of 5 mM. Each sample was incubated for one hour at 37 C. in order to completely digest exogenous host DNA and RNA. After treatment, RNA was purified from the samples using Trizol LS reagent according to the manufacturer's recommendation [Life Technologies, NY, USA]. The precipitated RNA was resuspended in 50 L of 10 mM Tris buffer and frozen at 80 C. until cDNA conversion. The cDNA conversion was performed using the Maxima H Minus Double-stranded cDNA synthesis kit [Thermo Fisher Scientific, MA, USA] according to the manufacturer's instructions. For each sample 2 g of input RNA was used in conjunction with random hexamer primers at a 100 pmol concentration. Following cDNA synthesis, samples were treated with RNAse according to the kit instructions to eliminate any residual RNA from the sample preparation. Following treatment samples were immediately frozen and stored at 20 C.
(48) The double stranded DNA was used in polymerase chain reaction using a set of 32 primer pairs spanning the entire PEDV genome. See Table 2.
(49) TABLE-US-00002 TABLE2 Primername Primersequence5 .fwdarw. 3 PEDF1-SEQIDNO:80 ACTTAAAGAGATTTTCTATCTAC PEDF2-SEQIDNO:81 AGGTTGCACGTACTCCAAAGAT PEDF3-SEQIDNO:82 GCATTGGTTAAGCTTGTCAAGG PEDF4-SEQIDNO:83 CTTCAAGTATTATGCCACCAGTG PEDF5-SEQIDNO:84 TGACTTTGCAAGCTATGGAGGAC PEDF6-SEQIDNO:85 GCATGCACCTGAGCTTCTTG PEDF7-SEQIDNO:86 GTTGTAGCTAAGGTTGTACCAAG PEDF8-SEQIDNO:87 ACGTACTGGTATTATATTGCGT PEDF9-SEQIDNO:88 CTTAATGTGCAACCGACAGGTCC PEDF10-SEQIDNO:89 GACAATCCACTTAGTTGTGTGC PEDF11-SEQIDNO:90 CACAGAACACACTTGGCATGTTG PEDF12-SEQIDNO:91 ATGATGGTTCTGCAGCTGGTGT PEDF13-SEQIDNO:92 TGCACAAGGTCTTGTTAACATC PEDF14-SEQIDNO:93 GATGCTGTTAATAATGGTTCTCC PEDF15-SEQIDNO:94 GCCACTGTACGCTTGCAGGCTGG PEDF16-SEQIDNO:95 GAAGACATTCATCGTGTCTATGC PEDF17-SEQIDNO:96 GTGGTTGTATCACTGCTAAAGAGG PED18-SEQIDNO:97 TCGAGCCTGACATTAATAAAGGTC PEDF19-SEQIDNO:98 CACTTGTTATCATATAACGAAG PEDF20-SEQIDNO:99 ACTGTGTCTGAGATGGTCTATGAA PEDF21-SEQIDNO:100 CGTCAGAGCTCGTGCTCCACCAG PEDF22-SEQIDNO:101 ATGATGATACTGAGTGTGACAAG PEDF23-SEQIDNO:102 CAAGTACGGACTTGAAGATTAGC PEDF24-SEQIDNO:103 CTGATATGTATGATGGTAAGATT PEDF25-SEQIDNO:104 CTAGTGGTTACCAGCTTTATTTAC PEDF26-SEQIDNO:105 CCACTGTTTATAAATTCTTGGCTG PED27-SEQIDNO:106 GTCACTAGTGGTGCTGTTTATTC PEDF28-SEQIDNO:107 CTCTGCTATTGGTAATATAACTTC PEDF29-SEQIDNO:108 GTTGACCTTGAGTGGCTCAACCGAG PEDF30-SEQIDNO:109 TGGTCTAGTAGTTAATGTTATAC PEDF31-SEQIDNO:110 GTGGCCGCAAACGGGTGCCATTATC PEDF32-SEQIDNO:111 TAGCGTAGCAGCTTGCTTCGGACC PEDR1-SEQIDNO:112 ATCTTTGGAGTACGTGCAACCT PEDR2-SEQIDNO:113 CCTTGACAAGCTTAACCAATGC PEDR3-SEQIDNO:114 CACTGGTGGCATAATACTTGAAG PEDR4-SEQIDNO:115 GTCCTCCATAGCTTGCAAAGTCA PEDR5-SEQIDNO:116 CAAGAAGCTCAGGTGCATGCTT PEDR6-SEQIDNO:117 CTTGGTACAACCTTAGCTACAAC PEDR7-SEQIDNO:118 ACGCAATATAATACCAGTACGT PEDR8-SEQIDNO:119 GGACCTGTCGGTTGCACATTAAG PEDR9-SEQIDNO:120 GCACACAACTAAGTGGATTGTC PEDR10-SEQIDNO:121 CAACATGCCAAGTGTGTTCTGTG PEDR11-SEQIDNO:122 ACACCAGCTGCAGAACCATCAT PEDR12-SEQIDNO:123 GATGTTAACAAGACCTTGTGCA PEDR13-SEQIDNO:124 GGAGAACCATTATTAACAGCATC PEDR14-SEQIDNO:125 CCAGCCTGCAAGCGTACAGTGGC PEDR15-SEQIDNO:126 GCATAGACACGATGAATGTCTTC PEDR16-SEQIDNO:127 CCTCTTTAGCAGTGTTACAACCAC PEDR17-SEQIDNO:128 GACCTTTATTAATGTCAGGCTCGA PEDR18-SEQIDNO:129 CTTCGTTATATGATAACAAGTG PEDR19-SEQIDNO:130 TCATAGACCATCTCAGACACAGT PEDR20-SEQIDNO:131 CTGGTGGAGCACGAGCTCTGAGC PEDR21-SEQIDNO:132 CTTGTCACACTCAGTATCATCAT PEDR22-SEQIDNO:133 CGTAATCTTCAAGTCCGTACTTG PEDR23-SEQIDNO:134 AATCTTACCATCATACAT ATCAG PEDR24-SEQIDNO:135 GTAAATAAGCTGGTAACCACT AG PEDR25-SEQIDNO:136 CAGCCAAGAATTTATAAACAGTGG PEDR26-SEQIDNO:137 GAATAAACAGCACCACTAGTGAC PEDR27-SEQIDNO:138 GAAGTTATATTACCAATAGCAGAG PEDR28-SEQIDNO:139 CTCGGTTGAGCCACTCAAGGTCAAC PERR29-SEQIDNO:140 GTATAACATTAACTACTAGACCA PEDR30-SEQIDNO:141 GATAATGGCACCCGTTTGCGGCCAC PEDR31-SEQIDNO:142 GGTCCGAAGCAAGCTGCTACGCTA PEDR32-SEQIDNO:143 GTGTATCCATATCAACACCGTCAG
(50) The primers were designed based on the consensus-genome sequences of two U.S. PEDV strainsUSA/Colorado/2013 (GenBank accession no. KF272920) and 13-019349 (GenBank accession no. KF267450). Primer sets 1-32 were used to amplify segments of the PEDV genome. The letter F in the primer name denotes a forward primer. The letter R in the primer name denotes a reverse primer. Each reaction was performed using Phire Green Hot-Start II DNA polymerase [Thermo Fisher Scientific, MA, USA] according to the manufacturer's instructions. About 1-10 ng of the DNA template was used in a 50 l cocktail and the reaction was performed according to the manufacturer's protocol. The amplified products ranging from 900-1000 bp were run on an agarose gel to confirm their size. The PCR cycling conditions were as follows: initial denaturation at 98 C. for 30 sec, followed by 35 cycles: 98 C.15 sec, 50 C.15 sec, 72 C.45 sec and a final extension at 72 C. for 1 min.
(51) The PCR products were purified from each reaction using an IBI Gel/PCR product purification kit [IBI Scientific, IA, USA] according to the manufacturer's recommendation. The final elution was performed using 30 L of elution buffer. About 15 L of each purified product was sent to Eurofins/Operon [Eurofins MWG Operon, Ala., USA] for bi-directional sequencing using the amplification primers specific for each product as listed in Table 2.
(52) Sequence Assembly and Analysis
(53) The raw sequence data was assembled using USA/Colorado/2013 (GenBank accession no. KF272920) as reference sequence, using the Geneious assembler [Biomatters LTD., CA, USA]. After assembling the whole NPL-PED genome to the reference genome the gaps and ambiguous regions in NPL-PED genome were closed using a second set of internal primers disclosed in Table 3 following the same PCR and sequencing technique.
(54) TABLE-US-00003 TABLE3 Primername Primersequence5 .fwdarw. 3 Reseq1F-SEQIDNO:144 ATCACTGGTCTTAATACAATGTG Reseq1R-SEQIDNO:145 CAATACTACCATTGAGTGCTGGTGG Reseq2F-SEQIDNO:146 TGCAGAAGTGCTCGAATGATTAC Reseq2R-SEQIDNO:147 CTTGTTGAACATCTTCCTGGACAG Reseq3F-SEQIDNO:148 TTGTGATTCTTATGGTCCAGG Reseq3R-SEQIDNO:149 CTGGCCAACAACGCTGAGTCCAC Reseq4F-SEQIDNO:150 CTGCTCTGATTGTTACATCTTGC Reseq4R-SEQIDNO:151 TAGCCACAAAAGTAGGAAATCTC Reseq5F-SEQIDNO:152 GTTGACTTGCATAACAAGATC Reseq5R-SEQIDNO:153 AGCAGTGAATGCATAGCACTTAC Reseq6F-SEQIDNO:154 ACAATTGCGATGTTCTTAAGAG Reseq6R-SEQIDNO:155 TCCTCACCAAATATATCACTC Reseq7F-SEQIDNO:156 CAGACTGTTAAACCTGGCCATTTC Reseq7R-SEQIDNO:157 AGGTTGAGCTGTGTCATAGTG Reseq8F-SEQIDNO:158 TATGGTTACTTGCGTAAAC Reseq8R-SEQIDNO:159 CTCTAACACACCAGCATTAAG Reseq9F-SEQIDNO:160 TCTGACTACAGGTTGGCAAATG Reseq9R-SEQIDNO:161 GCACTAAGCTAGAATAAGCTTC Reseq10F-SEQIDNO:162 TGGATGAGGTCTCTATGTGCAC Reseq10R-SEQIDNO:163 CCACAACCCTCATTAGCCTG Reseq11F-SEQIDNO:164 ACTGATCAAGATCTTGCTGTTC Reseq11R-SEQIDNO:165 GCTAAGTGATCCCTTGTATC Reseq12F-SEQIDNO:166 CTAATGTCAAGACATTGGAGT Reseq12R-SEQIDNO:167 TACGACATTGAAAGCAATGTTC Reseq13F-SEQIDNO:168 TGGTATATTTACACTAGGAAG Reseq13R-SEQIDNO:169 GCAGGAGATCCATATACGTAC Reseq14F-SEQIDNO:170 TGCCACTGGATGCCATTATAG Reseq14R-SEQIDNO:171 CTAAATAGTGAACACCAATTAAG Reseq15F-SEQIDNO:172 TCAACTTGGTACTGTGCTGGC Reseq15R-SEQIDNO:173 GACAGTGACACGATCATTATC Reseq16F-SEQIDNO:174 GTGAGTTGATTACTGGCACGC Reseq16R-SEQIDNO:175 TGTCCTAATACTCATACTAAAG Reseq17F-SEQIDNO:176 TCGCTCTGTGGCAGATCTAGTC Reseq17R-SEQIDNO:177 TGAGGTGCTGCCTGTACCAGAGAG Reseq18F-SEQIDNO:178 CAGATTACATCGATGTTAAC Reseq18R-SEQIDNO:179 GACAAGTTAGCAGACTTTGAGAC Reseq19F-SEQIDNO:180 GCTGACCTACAGCTGTTGCG Reseq19R-SEQIDNO:6 TCATCAACGGGAATAGAACCG
(55) The complete sequence of the two NPL PEDV isolates were assembled as one large contig and annotated. Further global BLAST analysis and alignment was done using the web based software from NCBI, to identify indels/point mutations with reference to US and other PEDV isolates in the GenBank. The whole genome sequence of NPL-PED (
(56) The NPL-PEDV genome shares 99% identity with the all the U.S. isolates sequenced to date and many Chinese isolates as well (except for the strain OH851). The top three BLAST hits were against U.S. isolates, USA/Colorado/2013 (KF272920), IA1 (KF468753.1) and Iowa isolate 13-019349 (KF267450.1). NPL-PEDV also shares 99% identity with the Chinese outbreak isolate AH2012 (KC210145). When compared to KF272920, NPL-PEDV has insertions between 20634-20637nt, 25455-25474nt, a nucleotide substitution at 278 (T.fwdarw.C) which falls in the 5 UTR, an insertion at 9645nt (C) and a deletion at 9648nt.
(57) Analysis of Spike Protein
(58) The spike coding region (S domain) is highly conserved across PEDV strains. The spike protein is composed of two domains: S1 and S2.
(59) The nucleotide sequence of the truncated and fused spike protein was codon optimized for an insect cell system.
(60) Gene Synthesis, Cloning into Baculovirus Expression System and Detection of Recombinant Spike
(61) The complete nucleotide sequence of the synthesized spike protein gene is shown in
(62) The overall cloning, protein expression and detection is explained in
(63) The recombinant spike protein was expressed in high five cells and used for vaccination studies in pigs.
(64) In an embodiment, the invention is an immunogenic composition comprising a recombinant polypeptide sequence of the S1 and S2 domains of the S subunit of porcine epidemic diarrhea virus according to SEQ ID NO. 19 and a pharmaceutically or veterinary acceptable vehicle, diluent or excipient. The invention may further include a suitable adjuvant. The adjuvant may be an oil, emulsion, a metal salt (e.g. Al(OH).sub.3), or combinations thereof. In an embodiment, the adjuvant is TRIGEN or ULTRAGEN or PrimaVant (TRIGEN+Quil A), TS6 (described in U.S. Pat. No. 7,371,395 US to Merial), LR4 (described in U.S. Pat. No. 7,691,368, to Merial), or any formulation described in US 2011-0129494 A1 (to Merial).
(65) In another embodiment, the immunogenic composition is a recombinant nucleotide sequence 80% or greater in sequence identity to SEQ ID NO. 18.
(66) In another aspect, the invention is a method of vaccinating a host susceptible to PEDV comprising at least one administration of a recombinant polypeptide sequence of the S1 and S2 domains of the S subunit of porcine epidemic diarrhea virus according to SEQ ID NO. 19 and a pharmaceutically or veterinary acceptable vehicle, diluent or excipient. An adjuvant may also be included.
(67) In another aspect, the invention is a recombinant subunit vaccine for use against porcine epidemic diarrhea virus comprising a porcine epidemic diarrhea virus DNA fragment according to SEQ ID NO. 18 in a baculovirus expression system. In an embodiment, the invention is a recombinant subunit vaccine comprising the amino acid sequence according to SEQ ID NO. 19. In yet another embodiment, the invention is a recombinant subunit vaccine comprising the amino acid sequence according to SEQ ID NO. 20. In yet another embodiment, the invention is a recombinant subunit vaccine comprising the amino acid sequence according to SEQ ID NO. 21. In yet another embodiment, the invention is an immunogenic composition comprising a recombinant polypeptide sequence of the S1 and S2 domains of the S subunit of porcine epidemic diarrhea virus according to SEQ ID NO. 19 and a pharmaceutically or veterinary acceptable vehicle, diluent or excipient and at least one additional antigen associated with a pathogen other than porcine epidemic diarrhea virus.
(68) In yet another embodiment, the invention is an isolated polypeptide sequence, wherein the polypeptide sequence is 80% or greater in sequence identity to SEQ ID NO. 17. In yet another embodiment, the invention is an isolated polypeptide sequence, wherein the polypeptide sequence is 80% or greater in sequence identity to SEQ ID NO:19.
(69) The genome sequence of PEDV can also be used to generate virus-like particles (VLPs) using structural genes or other non-infectious components of PEDV. Examples are virus-like particles made from the E and M subunit genes of PEDV.
(70) The immunological compositions and vaccines according to the invention may comprise or consist essentially of one or more adjuvants. Suitable adjuvants for use in the practice of the present invention are (1) polymers of acrylic or methacrylic acid, maleic anhydride and alkenyl derivative polymers, (2) immunostimulating sequences (ISS), such as oligodeoxyribonucleotide sequences having one or more non-methylated CpG units (Klinman et al., 1996; WO98/16247), (3) an oil in water emulsion, such as the SPT emulsion described on page 147 of Vaccine Design, The Subunit and Adjuvant Approach published by M. Powell, M. Newman, Plenum Press 1995, and the emulsion MF59 described on page 183 of the same work, (4) cation lipids containing a quaternary ammonium salt, e.g., DDA (5) cytokines, (6) aluminum hydroxide or aluminum phosphate, (7) saponin or (8) other adjuvants discussed in any document cited and incorporated by reference into the instant application, or (9) any combinations or mixtures thereof.
(71) The oil in water emulsion (3), which is especially appropriate for viral vectors, can be based on: light liquid paraffin oil (European pharmacopoeia type), isoprenoid oil such as squalane, squalene, oil resulting from the oligomerization of alkenes, e.g. isobutene or decene, esters of acids or alcohols having a straight-chain alkyl group, such as vegetable oils, ethyl oleate, propylene glycol, di(caprylate/caprate), glycerol tri(caprylate/caprate) and propylene glycol dioleate, or esters of branched, fatty alcohols or acids, especially isostearic acid esters.
(72) The oil is used in combination with emulsifiers to form an emulsion. The emulsifiers may be nonionic surfactants, such as: esters of on the one hand sorbitan, mannide (e.g. anhydromannitol oleate), glycerol, polyglycerol or propylene glycol and on the other hand oleic, isostearic, ricinoleic or hydroxystearic acids, said esters being optionally ethoxylated, or polyoxypropylene-polyoxyethylene copolymer blocks, such as Pluronic, e.g., L121.
(73) Among the type (1) adjuvant polymers, polymers of crosslinked acrylic or methacrylic acid, e.g., crosslinked by polyalkenyl ethers of sugars or polyalcohols, are appropriate. These compounds are known under the name carbomer (Pharmeuropa, vol. 8, no. 2, June 1996). One skilled in the art can also refer to U.S. Pat. No. 2,909,462, which provides such acrylic polymers crosslinked by a polyhydroxyl compound having at least three hydroxyl groups, or no more than eight such groups, the hydrogen atoms of at least three hydroxyl groups being replaced by unsaturated, aliphatic radicals having at least two carbon atoms. Some radicals are those containing 2 to 4 carbon atoms, e.g., vinyls, allyls and other ethylenically unsaturated groups. The unsaturated radicals can also contain other substituents, such as methyl. Products sold under the name Carbopol (BF Goodrich, Ohio, USA) are especially suitable. They are crosslinked by allyl saccharose or by allyl pentaerythritol. Among them, reference is made to Carbopol 974P, 934P and 971P.
(74) As to the maleic anhydride-alkenyl derivative copolymers, the EMA (Monsanto) are straight-chain or crosslinked ethylene-maleic anhydride copolymers and they are, for example, crosslinked by divinyl ether. Reference is also made to J. Fields et al., 1960.
(75) With regard to structure, the acrylic or methacrylic acid polymers and EMA are formed by basic units having the following formula:
(76) ##STR00001##
in which: R1 and R2, which can be the same or different, represent H or CH3 x=0 or 1, preferably x=1 y=1 or 2, with x+y=2.
(77) For EMA, x=0 and y=2 and for carbomers x=y=1.
(78) These polymers are soluble in water or physiological salt solution (20 g/l NaCl) and the pH can be adjusted to 7.3 to 7.4, e.g., by soda (NaOH), to provide the adjuvant solution in which the expression vector(s) can be incorporated. The polymer concentration in the final immunological or vaccine composition can range between about 0.01 to about 1.5% w/v, about 0.05 to about 1% w/v, and about 0.1 to about 0.4% w/v.
(79) The cytokine or cytokines (5) can be in protein form in the immunological or vaccine composition, or can be co-expressed in the host with the immunogen or immunogens or epitope(s) thereof. Preference is given to the co-expression of the cytokine or cytokines, either by the same vector as that expressing the immunogen or immunogens or epitope(s) thereof, or by a separate vector thereof.
(80) The invention comprehends preparing such combination compositions; for instance by admixing the active components, advantageously together and with an adjuvant, carrier, cytokine, and/or diluent.
(81) Cytokines that may be used in the present invention include, but are not limited to, granulocyte colony stimulating factor (G-CSF), granulocyte/macrophage colony stimulating factor (GM-CSF), interferon (IFN), interferon (IFN), interferon , (IFN), interleukin-1 (IL-1), interleukin-1 (IL-1), interleukin-2 (IL-2), interleukin-3 (IL-3), interleukin-4 (IL-4), interleukin-5 (IL-5), interleukin-6 (IL-6), interleukin-7 (IL-7), interleukin-8 (IL-8), interleukin-9 (IL-9), interleukin-10 (IL-10), interleukin-11 (IL-11), interleukin-12 (IL-12), tumor necrosis factor (TNF), tumor necrosis factor (TNF), and transforming growth factor (TFG). It is understood that cytokines can be co-administered and/or sequentially administered with the immunological or vaccine composition of the present invention. Thus, for instance, the vaccine of the instant invention can also contain an exogenous nucleic acid molecule that expresses in vivo a suitable cytokine, e.g., a cytokine matched to this host to be vaccinated or in which an immunological response is to be elicited (for instance, a porcine cytokine for preparations to be administered to swine).
REFERENCES
(82) Bai B., Hu Q., Hu H., Zhou P., Shi Z., Meng J., Lu B., Huang Y., Mao P., Wang H. 2008. Virus-like particles of SARS-like coronavirus formed by membrane proteins from different origins demonstrate stimulating activity in human dendritic cells.
(83) PLoS One. 3(7):e2685. doi: 10.1371/journal.pone.0002685.
(84) Bosch B J., van der Zee R., de Haan C A., Rottier P J. 2003. The coronavirus spike protein is a class I virus fusion protein: structural and functional characterization of the fusion core complex. J. Virol. 77:8801-8811.
(85) Bridgen A., Kocherhans R., Tobler K., Carvajal A., Ackermann M. 1998. Further analysis of the genome of porcine epidemic diarrhea virus. Adv. Exp. Med. Biol. 440:781-786.
(86) de Haan C A., Stadler K., Godeke G J., Bosch B J., Rottier P J. 2004. Cleavage inhibition of the murine coronavirus spike protein by a furin-like enzyme affects cell-cell but not virus-cell fusion. J. Virol. 78 (11):6048-6054.
(87) Donaldson E F., Yount B., Sims A C., Burkett S., Pickles R J., Baric R S. 2008. Systematic assembly of a full-length infectious clone of human coronavirus NL63. J Virol 82: 11948-11957.
(88) Dijkman R., Jebbink M F., Wilbrink B., Pyrc K., Zaaijer H L., Minor P D., Franklin S., Berkhout B., Thiel V., van der Hoek L. 2006. Human coronavirus 229E encodes a single ORF4 protein between the spike and the envelope genes. Virol J 3: 106.
(89) Duarte M., Tobler K., Bridgen A., Rasschaert D., Ackermann M., Laude H. 1994. Sequence analysis of the porcine epidemic diarrhea virus genome between the nucleocapsid and spike protein genes reveals a polymorphic ORF. Virology 198:466-476.
(90) Duarte M., Laude H. 1994. Sequence of the spike protein of the porcine epidemic diarrhoea virus. J. Gen. Virol. 75 (Pt 5):1195-1200.
(91) Geiger J O, Connor J F. 2013. Porcine epidemic diarrhea, diagnosis, and elimination. Perry: American Association of Swine Practitioners: 1-4.
(92) Graham R L., Baric R S. 2010. Recombination, reservoirs, and the modular spike: mechanisms of coronavirus cross-species transmission. J. Virol. 84:3134-3146.
(93) Hsieh P K., Chang S C., Huang C C., Lee T T., Hsiao C W., Kou Y H., Chen I Y., Chang C K., Huang T H., Chang M F. 2005. Assembly of severe acute respiratory syndrome coronavirus RNA packaging signal into virus-like particles is nucleocapsid dependent J. Virol. 79:13848-13855.
(94) Kim S H., Kim I J., Pyo H M., Tark D S., Song J Y., Hyun B H. 2007. Multiplex real-time RT-PCR for the simultaneous detection and quantification of transmissible gastroenteritis virus and porcine epidemic diarrhea virus. J Virol Methods. 146 (1-2):172-177.
(95) Kocherhans R., Bridgen A., Ackermann M., Tobler K. 2001. Completion of the porcine epidemic diarrhoea coronavirus (PEDV) genome sequence. Virus Genes. 23(2):137-44.
(96) Li C., Li Z., Zou Y., Wicht O., van Kuppeveld F J., Rottier P J., Bosch B J. 2013. Manipulation of the porcine epidemic diarrhea virus genome using targeted RNA recombination. PLoS One. August 2; 8(8):e69997.
(97) Li, W., Li, H., Liu, Y., Pan, Y., Deng, F., Song, Y., Tang, X., He, Q. 2012. New variants of porcine epidemic diarrhea virus, China, 2011. Emerging infectious diseases 18, 1350-1353.
(98) Liao Y., Q. Yuan Q., J. Torres, J., Tam J P., Liu D X. 2006. Biochemical and functional characterization of the membrane association and membrane permeabilizing activity of the severe acute respiratory syndrome coronavirus envelope protein Virology, 349, 264-275.
(99) Liao Y., Lescar J., Tam J P., Liu D X. 2004. Expression of SARS-coronavirus envelope protein in Escherichia coli cells alters membrane permeability Biochem. Biophys. Res. Commu 325 374-380.
(100) Madan V., Garcia Mde, J., Sanz M A., Carrasco L. 2005. Viroporin activity of murine hepatitis virus E protein FEBS Lett., 579: 3607-3612.
(101) Masters P S., Sturman L S. 1990. Background paper. Functions of the coronavirus nucleocapsid protein Adv. Exp. Med. Biol. 276:235-238.
(102) Matsuyama S., Ujike M., Morikawa S., Tashiro M., Taguchi F. 2005. Protease-mediated enhancement of severe acute respiratory syndrome coronavirus infection. Proc. Natl. Acad. Sci. U.S.A. 102:12543-12547.
(103) Nelson G W., Stohlman S A., Tahara S M. 2000. High affinity interaction between nucleocapsid protein and leader/intergenic sequence of mouse hepatitis virus RNA. J. Gen. Virol. 81:181-188.
(104) Park S J., Song D. S., Park B. K., 2013. Molecular epidemiology and phylogenetic analysis of porcine epidemic diarrhea virus (PED) field isolates in Korea. Archives of Virology. 158(7):1533-1541.
(105) Park S J, Kim H K, Song D S, An D J, Park B K. 2012. Complete genome sequences of a Korean virulent porcine epidemic diarrhea virus and its attenuated counterpart. J. Virol. 86:5964-5964.5964.10.1128/JVI.00557-12.
(106) Park S J., Moon H J., Luo Y., Kim H K., Kim E M., Yang J S., Song D S., Kang B K., Lee C S., Park B K. 2008. Cloning and further sequence analysis of the ORF3 gene of wild- and attenuated-type porcine epidemic diarrhea viruses Virus Genes, 36: 95-104.
(107) Park S J., Song D S., Ha G W., Park B K. 2007. Cloning and further sequence analysis of the spike gene of attenuated porcine epidemic diarrhea virus DR13. Virus Genes 35: 55-64.
(108) Pensaert M., de Bouck, P. 1978. A New Coronavirus-like Particle Associated with Diarrhea in Swine. Archives of virology 58: 243-247.
(109) Pospischil A., Stuedli A., Kiupel M. 2002. Diagnostic Notes Update on porcine epidemic diarrhea. J Swine Health Prod 10: 81-85.
(110) Pratelli A. 2011. The evolutionary processes of canine coronaviruses. Adv Virol. Volume 2011 (2011), Article ID 562831 2011: 562831.
(111) ProMed, 2013. Porcine Epidemic Diarrhea-USA (Iowa) First Report. International Society for Infectious Diseases.
(112) Qian C., Din D., Tang Q., Zeng Y., Tang G X., Lu C. 2006. Identification of a B-cell antigenic epitope at the N-terminus of SARS-CoV M protein and characterization of monoclonal antibody against the protein. Virus Genes. 33:147-156.
(113) Sato T., Takeyama N., Katsumata A., Tuchiya K., Kodama T., Kusanagi K. 2011. Mutations in the spike gene of porcine epidemic diarrhea virus associated with growth adaptation in vitro and attenuation of virulence in vivo. Virus Genes 43: 72-78.
(114) Schmitz A., Tobler K., Suter M., Ackermann M. 1998. Prokaryotic expression of porcine epidemic diarrhoea virus ORF3 Adv. Exp. Med. Biol. 440:775-780.
(115) Shirato K., Matsuyama S., Ujike M, Taguchi F. 2011. Role of proteases in the release of porcine epidemic diarrhea virus from infected cells. J Virol. 85 (15):7872-7880.
(116) Simmons G., Reeves J D., Rennekamp A J., Amberg S M., Piefer A J., Bates P. 2004. Characterization of severe acute respiratory syndrome-associated coronavirus (SARS-CoV) spike glycoprotein-mediated viral entry. Proc. Natl. Acad. Sci. U.S.A. 101:4240-4245.
(117) Song D, Park B, 2012. Porcine epidemic diarrhoea virus: a comprehensive review of molecular epidemiology, diagnosis, and vaccines. Virus genes 44:167-175.
(118) Song D S., Oh J S., Kang B K., Yang J S., Moon H J., Yoo H S., Jang Y S., Park B K. 2007. Oral efficacy of vero cell attenuated porcine epidemic diarrhea virus DR13 strain. Res Vet Sci 82: 134-140.
(119) Spaan W., Cavanagh D., Horzinek M. C. 1988. Coronaviruses: structure and genome expression. J. Gen. Virol. 69(Pt 12):2939-2952.
(120) Spencer K A., Dee M., Britton P., Hiscox J A. 2008. Role of phosphorylation clusters in the biology of the coronavirus infectious bronchitis virus nucleocapsid protein. Virology. 370 (2):373-381.
(121) Stohlman S A., Baric R S., Nelson G N., Soe L H., Welter L M., Deans R J. 1988. Specific interaction between coronavirus leader RNA and nucleocapsid protein J. Virol. 62: 4288-4295.
(122) Surjit, M., Liu, B., Chow, V. T., Lal, S. K. 2006. The nucleocapsid protein of severe acute respiratory syndrome-coronavirus inhibits the activity of cyclin-cyclin-dependent kinase complex and blocks S phase progression in mammalian cells J. Biol. Chem. 281:10669-10681.
(123) Sun R Q, Cai R J, Chen Y Q, Liang P S, Chen D K, Song C X. 2012. Outbreak of porcine epidemic diarrhea in suckling piglets, china. Emerg Infect Dis 18: 161-163.
(124) Tang T K., Wu M P., Chen S T., Hou M H., Hong M H., Pan F M., Yu H M., Chen J H., Yao C W., Wang A H. 2005. Biochemical and immunological studies of nucleocapsid proteins of severe acute respiratory syndrome and 229E human coronaviruses Proteomics, 5: 925-937.
(125) The Center for Food Security and Public Health, 2013. Vaccines: Porcine Epidemic Diarrhea. Iowa State University.
(126) Turgeon D C., Morin M., Jolette J., Higgins R., Marsolais G., DiFranco E. 1980. Coronavirus-like particles associated with diarrhea in baby pigs in Quebec. Can Vet J. 21(3):100-xxiii.
(127) U.S. Department of Agriculture (US) [USDA]. Technical note, Porcine epidemic diarrhea (PED). Fort Collins (Colo.): USDA; 2013. p 4 p. Available from http://www.aphis.usda.gov/animal_health/animal_dis_spec/swine/downloads/ped_tech_note.pdf.
(128) USDA-APHIS-VS-CEAH National Surveillance Unit, 2013. Case definition for porcine epidemic diarrhea. Date accessed: May 21, 2013.
(129) Utiger A., Tobler K., Bridgen A., Suter M., Singh M., Ackermann M. 1995. Identification of proteins specified by porcine epidemic diarrhoea virus Adv. Exp. Med. Biol. 380:287-290.
(130) Wang K., Lu W., Chen J., Xie S., Shi H., Hsu H., Yu W., Xu K., Bian C., Fischer W B., Schwarz W., Feng L., Sun B. 2012. PEDV ORF3 encodes an ion channel protein and regulates virus production. FEBS Lett. 586:384-391.
(131) Wang L., Byrum B., Zhang Y. 2014. New Variant of Porcine Epidemic Diarrhea Virus, United States. Emerging Infectious Diseases. Vol 20, Number 5May 2014.
(132) Wood E N. 1977. An apparently new syndrome of porcine epidemic diarrhoea. The Veterinary record 100: 243-244.
(133) Woods R D. 2001. Efficacy of a transmissible gastroenteritis coronavirus with an altered ORF-3 gene. Can J Vet Res 65: 28-32.
(134) Xing J J., Liu S W., Han Z X., Shao Y H., Li H X., Kong X G. 2009. Identification of a novel B-cell epitope in the M protein of Avian Infectious Bronchitis Coronaviruses. J Microbiol. 47:589-599.
(135) Xu X., Zhang H., Zhang Q., Dong J., Liang Y., Huang Y., Liu H J., Tong D. 2013. Porcine epidemic diarrhea virus E protein causes endoplasmic reticulum stress and up-regulates interleukin-8 expression. Virol J. 10:26.
(136) Yoshikura H., Tejima S. 1981. Role of protease in mouse hepatitis virus-induced cell fusion. Studies with a cold-sensitive mutant isolated from a persistent infection. Virology 113: 503-511.
(137) Zhang Z., Chen J., Shi H., Chen X., Shi D., Feng L., Yang B. 2012. Identification of a conserved linear B-cell epitope in the M protein of porcine epidemic diarrhea virus. Virol J. 9:225.
(138) Zheng F M, Huo J Y, Zhao J, Chang H T, Wang X M, Chen L, 2013. Molecular characterization and phylogenetic analysis of porcine epidemic diarrhea virus field strains in central China during 2010-2012 outbreaks. Bing Du Xue Bao. (2):197-205.