METHODS OF PREPARING LOOP FORK LIBRARIES
20250043275 ยท 2025-02-06
Inventors
- Eli M. Carrami (Cambridge, GB)
- Jonathan Mark Boutell (Bishops Stortford, GB)
- Oliver Jon Miller (Linton, GB)
- Aathavan Karunakaran (Berkeley, CA, US)
- Stephen Paul Bruinsma (Madison, WI, US)
- Niall Anthony Gormley (Cambridge, GB)
Cpc classification
C12N15/1065
CHEMISTRY; METALLURGY
C12N15/1068
CHEMISTRY; METALLURGY
International classification
Abstract
The invention relates to methods and kits for use in nucleic acid sequencing, in particular methods for use in concurrent sequencing, and in particular concurrent sequencing of tandem insert libraries.
Claims
1. A method of determining a polynucleotide sequence, the method comprising: preparing a polynucleotide library comprising a double-stranded polynucleotide fragment and adaptor, the double-stranded polynucleotide fragment comprising a first strand having a first sequence of nucleotides and a second strand having a second sequence of nucleotides that is complementary to the first sequence of nucleotides; amplifying the polynucleotide library to generate a plurality of template strands on a solid support, the plurality of template strands comprising a first portion that includes the first sequence of nucleotides and a second portion that includes a complement of the second sequence of nucleotides; sequencing the first portion and the second portion of the plurality of template strands concurrently, the sequencing comprising: contacting the plurality of template strands on the solid support with a plurality of labelled nucleotides, wherein a polymerase incorporates one or more types of labelled nucleotides complementary to at least the first portion or the second portion of the plurality of template strands; acquiring intensity data comprising a combined intensity of signal emitted by the one or more types of labelled nucleotides in response to illumination by a light source; and processing the intensity data to determine sequence information associated with the double-stranded polynucleotide fragment, wherein the intensity data is used to identify a match or a mismatch between the first portion of the plurality of template strands and the second portion of the plurality of template strands.
2. The method of claim 1, wherein the plurality of labelled nucleotides comprises different types of labelled nucleotides that are delivered to the solid support sequentially, and wherein the intensity data is acquired after each delivery of a different type of labelled nucleotides.
3. The method of claim 1, wherein the plurality of labelled nucleotides comprises different types of labelled nucleotides that are delivered to the solid support simultaneously.
4. The method of claim 1, wherein the adapter comprises (a) two adapter strands having at least one base-paired region and a non-complementary region, or (b) two adapter strands having a first base-paired region and a second base-paired region, and wherein the first base-paired region and the second base-paired region are separated by the non-complementary region.
5. The method of claim 1, wherein the combined intensity of signals is a combined intensity of co-localized optical signals.
6. The method of claim 5, wherein the co-localized optical signals are not spatially resolved on the solid support.
7. The method of claim 1, wherein the plurality of labelled nucleotides comprises different types of labelled nucleotides configured to emit optical signals for detection by an optical system having one optical channel, wherein the intensity data is acquired from optical signals detected in the one optical channel.
8. The method of claim 1, wherein the plurality of labelled nucleotides comprises different types of labelled nucleotides configured to emit optical signals for detection by an optical system having two optical channels.
9. The method of claim 8, wherein the different types of labelled nucleotides comprise a first type of labelled nucleotides and a second type of labelled nucleotides, and wherein the first type of labelled nucleotides and the second type of labelled nucleotides each comprise a spectrally distinct label.
10. The method of claim 9, wherein the intensity data is acquired from optical signals detected in at least one of the two optical channels.
11. The method of claim 1, wherein the plurality of labelled nucleotides comprises different types of labelled nucleotides configured to emit optical signals for detection by an optical system having four optical channels, each different type of labelled nucleotides comprising a spectrally distinct label.
12. The method of claim 1, wherein the polymerase incorporates the same type of labelled nucleotides complementary to the first portion of the plurality of template stands and the second portion of the plurality of template strands, and wherein the intensity data is used to identify a match between the first portion of the plurality of template strands and the second portion of the plurality of template strands.
13. The method of claim 12, wherein the intensity data is used to determine a base call.
14. The method of claim 1, wherein the polymerase does not incorporate the same type of labelled nucleotides complementary to the first portion of the plurality of template stands and the second portion of the plurality of template strands, and wherein the intensity data is used to identify a mismatch between the first portion of the plurality of template strands and the second portion of the plurality of template strands.
15. The method of claim 14, wherein the intensity data is not used to determine a base call.
16. The method of claim 1, wherein the first portion and the second portion of the plurality of template strands are sequenced in the same direction.
17. The method of claim 1, wherein using the intensity data to identify a match comprises mapping the signals emitted by the one or more types of labelled nucleotides to a distribution of intensity data representing the match.
18. The method of claim 1, wherein a match is identified when combined signal intensities from the first portion and the second portion indicate the same base is present at a position in the first portion and the second portion.
19. The method of claim 1, wherein using the intensity data to identify a mismatch comprises mapping the signals emitted by the one or more types of labelled nucleotides to a distribution of intensity data representing the mismatch.
20. The method of claim 19, wherein a mismatch is identified when combined signal intensities from the first portion and the second portion indicate the base present in the first portion is different from the base present at that position in the second portion.
21. A method of determining a polynucleotide sequence, the method comprising: providing an amplified polynucleotide library comprising a plurality of template strands on a solid support; hybridizing sequencing primers to the plurality of template strands on the solid support, wherein the sequencing primers hybridize to a first strand and the reverse complement of a second strand to sequence in the same direction on the template strands; sequencing the plurality of template strands on the solid support using a polymerase to incorporate a plurality of labelled nucleotides comprising one or more types of labelled nucleotides; acquiring intensity data comprising a combined intensity of the signals emitted by the one or more types of labelled nucleotides incorporated; and processing the intensity data to determine sequence information associated with the template strands, wherein library preparation errors and sequencing errors are removed from the sequence information.
22. The method of claim 21, wherein the plurality of labelled nucleotides comprises different types of labelled nucleotides that are delivered to the solid support sequentially, and wherein the intensity data is acquired after each delivery of a different type of labelled nucleotides.
23. The method of claim 21, wherein the plurality of labelled nucleotides comprises different types of labelled nucleotides that are delivered to the solid support simultaneously.
24. The method of claim 21, wherein the intensity of the signals emitted from both the first strand and the complement of the second strand identifies a base call at a position in a DNA sequence, the base call identifying a variant nucleotide in the sequence.
25. The method of claim 21, wherein the intensity data is used to identify a mismatch between the first strand and the complement of the second strand, wherein the mismatch is an error introduced during library preparation or sequencing.
26. The method of claim 21, wherein the plurality of labelled nucleotides comprises different types of labelled nucleotides configured to emit optical signals for detection by an optical system having one optical channel.
27. The method of claim 21 wherein the different types of labelled nucleotides comprise a first type of labelled nucleotides and a second type of labelled nucleotides, and wherein the first type of labelled nucleotides and the second type of labelled nucleotides each comprise a spectrally distinct label.
28. The method of claim 21, wherein the same type of labelled nucleotides are incorporated into the complement to the first strand and the copy of the second strand within the plurality of template strands, and wherein the intensity data is used to identify a match between the first strands and the copy of the second strands of the plurality of template strands.
29. The method of claim 21, wherein the plurality of template strands are produced by ligating adaptors to a first and second strand of a target polynucleotide and performing polymerase chain reaction to produce the amplified polynucleotide library comprising a plurality of template strands.
30. A method of determining a polynucleotide sequence, the method comprising: providing an amplified polynucleotide library comprising a plurality of template strands on a solid support, wherein the solid support is a bead, a well, or a flow cell surface; hybridizing sequencing primers to the plurality of template strands on the solid support, wherein the sequencing primers hybridize to a first strand and the reverse complement of a second strand to sequence in the same direction on the template strands; sequencing the plurality of template strands on the solid support by adding a plurality of labelled nucleotides comprising one or more types of labelled nucleotides in the presence of a polymerase to incorporate the one or more labelled nucleotides into complementary nucleotide sequences of the plurality of template strands, wherein the plurality of labelled nucleotides comprises different types of labelled nucleotides configured to emit optical signals; acquiring by an optical system intensity data comprising a combined intensity of the signals emitted by the one or more types of incorporated labelled nucleotides; and processing the intensity data obtained to determine sequence information associated with the template strands, wherein the intensity of the signals emitted from both the first strand and the complement of the second strand identifies a base call at a position in a DNA sequence, the base call identifying a variant nucleotide in the sequence, and wherein library preparation errors and sequencing errors are removed from the sequence information.
Description
DESCRIPTION OF THE DRAWINGS
[0046] Features of examples of the present disclosure will become apparent by reference to the following detailed description and drawings, in which like reference numerals correspond to similar, though perhaps not identical, components. For the sake of brevity, reference numerals or features having a previously described function may or may not be described in connection with other drawings in which they appear.
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
DETAILED DESCRIPTION OF THE INVENTION
[0070] All patents, patent applications, and other publications referred to herein, including all sequences disclosed within these references, are expressly incorporated herein by reference, to the same extent as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated by reference. All documents cited are, in relevant part, incorporated herein by reference in their entireties for the purposes indicated by the context of their citation herein. However, the citation of any document is not to be construed as an admission that it is prior art with respect to the present disclosure.
[0071] The present invention can be used in sequencing, in particular duplex sequencing. Methodologies applicable to the present invention have been described in WO 08/041002, WO 07/052006, WO 98/44151, WO 00/18957, WO 02/06456, WO 07/107710, WO05/068656, U.S. Ser. No. 13/661,524 and US 2012/0316086, the contents of which are herein incorporated by reference. Further information can be found in US 20060024681, US20060292611, WO 06/110855, WO 06/135342, WO 03/074734, WO07/010252, WO 07/091077, WO 00/179553, WO 98/44152 and WO 2022/087150, the contents of which are herein incorporated by reference.
[0072] As used herein, the term variant refers to a variant polypeptide sequence or part of the polypeptide sequence that retains desired function of the full non-variant sequence. For example, a desired function of the immobilised primer retains the ability to bind (i.e. hybridise) to a target sequence.
[0073] As used in any aspect described herein, a variant has at least 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99% overall sequence identity to the non-variant nucleic acid sequence. The sequence identity of a variant can be determined using any number of sequence alignment programs known in the art. As an example, Emboss Stretcher from the EMBL-EBI may be used: https://www.ebi.ac.uk/Tools/psa/emboss_stretcher/(using default parameters: pair output format, Matrix=BLOSUM62, Gap open=1, Gap extend=1 for proteins; pair output format, Matrix=DNAfull, Gap open=16, Gap extend=4 for nucleotides). As used herein, the term fragment refers to a functionally active series of consecutive nucleic acids from a longer nucleic acid sequence. The fragment may be at least 99%, at least 95%, at least 90%, at least 80%, at least 70%, at least 60%, at least 50%, at least 40% or at least 30% the length of the longer nucleic acid sequence. A fragment as used herein may also retain the ability to bind (i.e. hybridise) to a target sequence.
[0074] Sequencing typically comprises four fundamental steps: 1) library preparation to form a plurality of target polynucleotides for identification; 2) cluster generation to form an array of amplified template polynucleotides; 3) sequencing the cluster array of amplified template polynucleotides; and 4) data analysis to identify characteristics of the target polynucleotides from the amplified template polynucleotide sequences. These steps are described in greater detail below.
Library Strands and Template Terminology
[0075] For a given double-stranded polynucleotide sequence (also referred to herein as a polynucleotide library) to be identified, the polynucleotide sequence comprises a forward strand of the sequence and a reverse strand of the sequence.
[0076] Typically, when the polynucleotide sequence is replicated (e.g. using a DNA/RNA polymerase), complementary versions of the forward strand of the sequence and the reverse strand of the sequence are generated. These may be referred to as the forward complement strand of the sequence and the reverse complement strand of the sequence respectively.
[0077] By using the forward complement strand of the sequence as a template for complementary base pairing, a sequencing process (e.g. a sequencing-by-synthesis or a sequencing-by-ligation process) reproduces information that was present in the original forward strand of the sequence. The forward complement strand of the sequence may be referred to as the forward strand of the template.
[0078] Similarly, by using the reverse complement strand of the sequence as a template for complementary base pairing, a sequencing process (e.g. a sequencing-by-synthesis or a sequencing-by-ligation process) reproduces information that was present in the original reverse strand of the sequence. The reverse complement strand of the sequence may be referred to as the reverse strand of the template.
Library Preparation
[0079] Library preparation is the first step in any high-throughput sequencing platform. These libraries allow templates to be generated via complementary base pairing that can subsequently be clustered and amplified. During library preparation, nucleic acid sequences, for example genomic DNA sample, or cDNA or RNA sample, are converted into polynucleotide templates, which can then be sequenced. By way of example with a DNA sample, the first step in library preparation is random fragmentation of the DNA sample. Sample DNA is first fragmented and the fragments of a specific size (typically 200-500 bp, but can be larger) are ligated, sub-cloned or inserted in-between two oligo adaptors (adaptor sequences). The original sample DNA fragments are referred to as inserts. The target polynucleotides may advantageously also be size-fractionated prior to modification with the adaptor sequences.
[0080] As described herein, typically the templates to be generated from the libraries are duplexes comprising a first portion, that is the forward strand (of the template) and a second portion, that is the reverse strand (of the template). Generating these templates from particular libraries may be performed according to methods known to persons of skill in the art. However, some example approaches of preparing libraries suitable for generation of such templates are described below.
[0081] In some embodiments, the library is prepared by ligating adaptor sequences to the duplex, as described in more detail in e.g. WO 07/052006, which is incorporated herein by reference. In some cases, tagmentation can be used to attach the sample DNA to the adaptors, as described in more detail in e.g. WO 10/048605, US 2012/0301925, US 2013/0143774 and WO 2016/189331, each of which are incorporated herein by reference. In tagmentation, double-stranded DNA is simultaneously fragmented and tagged with adaptor sequences and PCR primer binding sites. The combined reaction eliminates the need for a separate mechanical shearing step during library preparation.
[0082] Where below features are described in relation to the forward strand, it should be considered that these features could equally be applied to the reverse strand.
[0083] In one embodiment, as described in further detail below, the library may be prepared using a loop fork method, which is described below. This procedure may be used, for example, for preparing templates including a first polynucleotide sequence comprising a first portion and a second polynucleotide sequence comprising a second portion, wherein the first portion is a forward strand of the template, and the second portion is a reverse complement strand of the template (or alternatively, wherein the first portion is a reverse strand of the template, and the second portion is a forward complement strand of the template). This procedure may also be used, for example, for preparing templates comprising concatenated polynucleotide sequences, wherein a single sequence comprises both the forward and reverse strands of the templateor a copy of the forward strand of the template (i.e. a forward complement strand of the template) and a copy of the reverse strand of the template (i.e. a reverse complement strand of the template). In one aspect, the present invention describes methods of preparing an inverted-repeat tandem-insert polynucleotide, where the orientation of the forward strand with respect to the reverse strand (or the copy of the forward strand with respect to the reverse strand) is inverted.
[0084] Starting from a double-stranded polynucleotide sequence comprising a forward strand of the sequence and a reverse strand of the sequence, adaptors may be ligated to a first end of the sequence (e.g. using processes as described in more detail in e.g. WO 07/052006, or tagmentation methods as described above). A second end of the sequence (different from the first end) may be ligated to a loop, which connects the forward strand of the sequence and the reverse strand of the sequence, thus generating a loop fork ligated polynucleotide sequence. Conducting PCR on the loop fork ligated polynucleotide sequence produces a new double-stranded polynucleotide sequence, one strand comprising the forward strand of the sequence and the reverse strand of the sequence, and the other strand comprising a forward complement strand of the sequence and a reverse complement strand of the sequence. The library is now ready for seeding, clustering and amplification.
[0085] As will be understood by the skilled person, a double-stranded nucleic acid will typically be formed from two complementary polynucleotide strands comprised of deoxyribonucleotides or ribonucleotides joined by phosphodiester bonds, but may additionally include one or more ribonucleotides and/or non-nucleotide chemical moieties and/or non-naturally occurring nucleotides and/or non-naturally occurring backbone linkages. In particular, the double-stranded nucleic acid may include non-nucleotide chemical moieties, e.g. linkers or spacers, at the 5 end of one or both strands. By way of non-limiting example, the double-stranded nucleic acid may include methylated nucleotides, uracil bases, phosphorothioate groups, peptide conjugates etc. Such non-DNA or non-natural modifications may be included in order to confer some desirable property to the nucleic acid, for example to enable covalent, non-covalent or metal-coordination attachment to a solid support, or to act as spacers to position the site of cleavage an optimal distance from the solid support. A single stranded nucleic acid consists of one such polynucleotide strand. Where a polynucleotide strand is only partially hybridised to a complementary strandfor example, a long polynucleotide strand hybridised to a short nucleotide primerit may still be referred to herein as a single stranded nucleic acid.
[0086] A sequence comprising at least a primer-binding sequence (a primer-binding sequence and a sequencing primer binding site, or a combination of a primer-binding sequence, an index sequence and a sequencing primer binding site) may be referred to herein as an adaptor sequence, and an insert (or inserts in concatenated strands) is flanked by a 5 adaptor sequence and a 3 adaptor sequence. The primer-binding sequence may also comprise a sequencing primer for the index read.
[0087] As used herein, an adaptor refers to a short sequence-specific oligonucleotide that is ligated to the 5 and 3 ends of each DNA (or RNA) fragment in a sequencing library as part of library preparation. The adaptor sequence may further comprise non-peptide linkers.
[0088] In a further embodiment, the P5 and P7 primer-binding sequences are complementary to short primer sequences (or lawn primers) present on the surface of a flow cell. Binding of P5 and P7 to their complements (P5 and P7) onfor examplethe surface of the flow cell, permits nucleic acid amplification. As used herein denotes the complementary strand.
[0089] The primer-binding sequences in the adaptor which permit hybridisation to amplification primers (e.g. lawn primers) will typically be around 20-40 nucleotides in length, although the invention is not limited to sequences of this length. The precise identity of the amplification primers (e.g. lawn primers), and hence the cognate sequences in the adaptors, are generally not material to the invention, as long as the primer-binding sequences are able to interact with the amplification primers in order to direct PCR amplification. The sequence of the amplification primers may be specific for a particular target nucleic acid that it is desired to amplify, but in other embodiments these sequences may be universal primer sequences which enable amplification of any target nucleic acid of known or unknown sequence which has been modified to enable amplification with the universal primers. The criteria for design of PCR primers are generally well known to those of ordinary skill in the art.
[0090] The index sequences (also known as a barcode or tag sequence) are unique short DNA (or RNA) sequences that are added to each DNA (or RNA) fragment during library preparation. The unique sequences allow many libraries to be pooled together and sequenced simultaneously. Sequencing reads from pooled libraries are identified and sorted computationally, based on their barcodes, before final data analysis. Library multiplexing is also a useful technique when working with small genomes or targeting genomic regions of interest. Multiplexing with barcodes can exponentially increase the number of samples analysed in a single run, without drastically increasing run cost or run time. Examples of tag sequences are found in WO05/068656, whose contents are incorporated herein by reference in their entirety. The tag can be read at the end of the first read, or equally at the end of the second read, for example using a sequencing primer complementary to the strand marked P7. The invention is not limited by the number of reads per cluster, for example two reads per cluster: three or more reads per cluster are obtainable simply by dehybridising a first extended sequencing primer, and rehybridising a second primer before or after a cluster repopulation/strand resynthesis step. Methods of preparing suitable samples for indexing are described in, for example WO 2008/093098, which is incorporated herein by reference. Single or dual indexing may also be used. With single indexing, up to 48 unique 6-base indexes can be used to generate up to 48 uniquely tagged libraries. With dual indexing, up to 24 unique 8-base Index 1 sequences and up to 16 unique 8-base Index 2 sequences can be used in combination to generate up to 384 uniquely tagged libraries. Pairs of indexes can also be used such that every i5 index and every i7 index are used only one time. With these unique dual indexes, it is possible to identify and filter indexed hopped reads, providing even higher confidence in multiplexed samples.
[0091] The sequencing primer binding sites are sequencing and/or index primer binding sites and indicate the starting point of the sequencing read. During the sequencing process, a sequencing primer anneals (i.e. hybridises) to at least a portion of the sequencing primer binding site on the template strand. The polymerase enzyme binds to this site and incorporates complementary nucleotides base by base into the growing opposite strand.
[0092] The loop complement (or the loop) may comprise an internal sequencing primer binding site. In other words, an internal sequencing primer binding site may form part of the loop complement. Alternatively, the loop complement may be an internal sequencing primer binding site. Accordingly, we may refer to the loop complement herein as comprising a second sequencing primer binding site, or as a second sequencing primer binding site.
Cluster Generation and Amplification
[0093] Once a double stranded nucleic acid template is formed, typically, the library has previously been subjected to denaturing conditions to provide single stranded nucleic acids. Suitable denaturing conditions will be apparent to the skilled reader with reference to standard molecular biology protocols (Sambrook et al., 2001, Molecular Cloning, A Laboratory Manual, 4th Ed, Cold Spring Harbor Laboratory Press, Cold Spring Harbor Laboratory Press, NY; Current Protocols, eds Ausubel et al). In one embodiment, chemical denaturation may be used.
[0094] Following denaturation, a single-stranded library may be contacted in free solution onto a solid support comprising surface capture moieties (for example P5 and P7 lawn primers).
[0095] Thus, embodiments of the present invention may be performed on a solid support 200, such as a flowcell. However, in alternative embodiments, seeding and clustering can be conducted off-flowcell using other types of solid support.
[0096] The solid support 200 may comprise a substrate 204. See
[0097] In one embodiment, the solid support comprises at least one first immobilised primer and at least one second immobilised primer. These immobilised primers may also be known as lawn primers.
[0098] Thus, each well 203 may comprise at least one first immobilised primer 201, and typically may comprise a plurality of first immobilised primers 201. In addition, each well 203 may comprise at least one second immobilised primer 202, and typically may comprise a plurality of second immobilised primers 202. Thus, each well 203 may comprise at least one first immobilised primer 201 and at least one second immobilised primer 202, and typically may comprise a plurality of first immobilised primers 201 and a plurality of second immobilised primers 202.
[0099] The first immobilised primer 201 may be attached via a 5-end of its polynucleotide chain to the solid support 200. When extension occurs from the first immobilised primer 201, the extension may be in a direction away from the solid support 200.
[0100] The second immobilised primer 202 may be attached via a 5-end of its polynucleotide chain to the solid support 200. When extension occurs from second immobilised primer 202, the extension may be in a direction away from the solid support 200.
[0101] The first immobilised primer 201 may be different to the second immobilised primer 202 and/or a complement of the second immobilised primer 202. The second immobilised primer 202 may be different to the first immobilised primer 201 and/or a complement of the first immobilised primer 201.
[0102] The (or each of the) first immobilised primer(s) 201 may comprise a sequence as defined in SEQ ID NO. 1 or 5, or a variant or fragment thereof. The second immobilised primer(s) 202 may comprise a sequence as defined in SEQ ID NO. 2, or a variant or fragment thereof.
[0103] By way of brief example, following attachment of the P5 and P7 primers to the solid support, the solid support may be contacted with the template to be amplified under conditions which permit hybridisation (or annealing-such terms may be used interchangeably) between the template and the immobilised primers. The template is usually added in free solution under suitable hybridisation conditions, which will be apparent to the skilled reader. Typically, hybridisation conditions are, for example, 5SSC at 40 C. However, other temperatures may be used during hybridisation, for example about 50 C. to about 75 C., about 55 C. to about 70 C., or about 60 C. to about 65 C. Solid-phase amplification can then proceed. The first step of the amplification is a primer extension step in which nucleotides are added to the 3 end of the immobilised primer using the template to produce a fully extended complementary strand. The template is then typically washed off the solid support. The complementary strand will include at its 3 end a primer-binding sequence (i.e. either P5 or P7) which is capable of bridging to the second primer molecule immobilised on the solid support and binding. The resulting structure is referred to herein as a sequence bridge. Further rounds of amplification (analogous to a standard PCR reaction) leads to the formation of clusters or colonies of template molecules bound to the solid support. This is called clustering.
[0104] Thus, solid-phase amplification by either a method analogous to that of WO 98/44151 or that of WO 00/18957 (the contents of which are incorporated herein in their entirety by reference) will result in production of a clustered array comprised of colonies of bridged amplification products (or sequence bridges). This process is known as bridge amplification. Both strands of the amplification products will be immobilised on the solid support at or near the 5 end, this attachment being derived from the original attachment of the amplification primers. Typically, the amplification products within each colony will be derived from amplification of a single template molecule. Other amplification procedures may be used, and will be known to the skilled person. For example, amplification may be isothermal amplification using a strand displacement polymerase; or may be exclusion amplification as described in WO 2013/188582. Further information on amplification can be found in WO 02/06456 and WO 07/107710, the contents of which are incorporated herein in their entirety by reference.
[0105] Through such approaches, a cluster of template molecules is formed, comprising copies of a template strand and copies of the complement of the template strand.
[0106] In some cases, to facilitate sequencing, one set of strands (either the original template strands or the complement strands thereof) may be removed from the solid support leaving either the original template strands or the complement strands. Suitable methods for removing such strands are described in more detail in application number WO 07/010251, the contents of which are incorporated herein by reference in their entirety.
[0107] The steps of cluster generation and amplification for templates comprising a first portion and a second portion are illustrated below and in
Sequencing
[0108] As described herein, the template provides information (e.g. identification of the genetic sequence, identification of epigenetic modifications) on the original target polynucleotide sequence. For example, a sequencing process (e.g. a sequencing-by-synthesis (referred to herein as SBS) or sequencing-by-ligation process) may reproduce information that was present in the original target polynucleotide sequence, by using complementary base pairing.
[0109] In one embodiment, sequencing may be carried out using any suitable sequencing-by-synthesis technique, wherein nucleotides are added successively in cycles to the free 3 hydroxyl group, resulting in synthesis of a polynucleotide chain in the 5 to 3 direction. The nature of the nucleotide added may be determined after each addition. One particular sequencing method relies on the use of modified nucleotides that can act as reversible chain terminators. Such reversible chain terminators comprise removable 3 blocking groups. Once such a modified nucleotide has been incorporated into the growing polynucleotide chain complementary to the region of the template being sequenced there is no free 3-OH group available to direct further sequence extension and therefore the polymerase cannot add further nucleotides. Once the nature of the base incorporated into the growing chain has been determined, the 3 block may be removed to allow addition of the next successive nucleotide. By ordering the products derived using these modified nucleotides it is possible to deduce the DNA sequence of the DNA template. Such reactions can be done in a single experiment if each of the modified nucleotides has attached thereto a different label, known to correspond to the particular base, to facilitate discrimination between the bases added at each incorporation step. Suitable labels are described in PCT application PCT/GB2007/001770, the contents of which are incorporated herein by reference in their entirety. Alternatively, a separate reaction may be carried out containing each of the modified nucleotides added individually.
[0110] The modified nucleotides may carry a label to facilitate their detection. Such a label may be configured to emit a signal, such as an electromagnetic signal, or a (visible) light signal.
[0111] In a particular embodiment, the label is a fluorescent label (e.g. a dye). Thus, such a label may be configured to emit an electromagnetic signal, or a (visible) light signal. One method for detecting the fluorescently labelled nucleotides comprises using laser light of a wavelength specific for the labelled nucleotides, or the use of other suitable sources of illumination. The fluorescence from the label on an incorporated nucleotide may be detected by a CCD camera or other suitable detection means. Suitable detection means are described in PCT/US2007/007991, the contents of which are incorporated herein by reference in their entirety.
[0112] However, the detectable label need not be a fluorescent label. Any label can be used which allows the detection of the incorporation of the nucleotide into the DNA sequence.
[0113] Each cycle may involve simultaneous delivery of four different nucleotide types to the array of template molecules. Alternatively, different nucleotide types can be added sequentially and an image of the array of template molecules can be obtained between each addition step.
[0114] In some embodiments, each nucleotide type may have a (spectrally) distinct label. In other words, four channels may be used to detect four nucleobases (also known as 4-channel chemistry) (
[0115] In some embodiments, detection of each nucleotide type may be conducted using fewer than four different labels. For example, sequencing-by-synthesis may be performed using methods and systems described in US 2013/0079232, which is incorporated herein by reference.
[0116] Thus, in some embodiments, two channels may be used to detect four nucleobases (also known as 2-channel chemistry) (
[0117] In some embodiments, one channel may be used to detect four nucleobases (also known as 1-channel chemistry) (
[0118] In one embodiment, the sequencing process comprises a first sequencing read (referred to herein as R1) and second sequencing read (referred to herein as R2). As described below, in each read at least two different polynucleotide strands may be sequenced simultaneously, generating a R1.1 and R1.2 read and a R2.1 and R2.2 read. The first sequencing read and the second sequencing read may also be conducted concurrently. In other words, the first sequencing read and the second sequencing read may be conducted at the same time.
[0119] The first sequencing read may comprise the binding of a first sequencing primer (also known as a read 1 sequencing primer) to the first sequencing primer binding site. The second sequencing read may comprise the binding of a second sequencing primer (also known as a read 2 sequencing primer) to the second sequencing primer binding site.
[0120] Alternative methods of sequencing include sequencing by ligation, for example as described in U.S. Pat. No. 6,306,597 or WO 06/084132, the contents of which are incorporated herein by reference.
Data Analysis Using 16 QaM
[0121]
[0122] The scatter plot of
[0123] For example, when the combined signal is mapped to bin 1612 for a base calling cycle, the computer processor base calls both the added nucleobase at the first portion and the added nucleobase at the second portion as C. When the combined signal is mapped to bin 1614 for the base calling cycle, the processor base calls the added nucleobase at the first portion as C and the added nucleobase at the second portion as T. When the combined signal is mapped to bin 1616 for the base calling cycle, the processor base calls the added nucleobase at the first portion as C and the added nucleobase at the second portion as G. When the combined signal is mapped to bin 1618 for the base calling cycle, the processor base calls the added nucleobase at the first portion as C and the added nucleobase at the second portion as A.
[0124] When the combined signal is mapped to bin 1622 for the base calling cycle, the processor base calls the added nucleobase at the first portion as T and the added nucleobase at the second portion as C. When the combined signal is mapped to bin 1624 for the base calling cycle, the processor base calls both the added nucleobase at the first portion and the added nucleobase at the second portion as T. When the combined signal is mapped to bin 1626 for the base calling cycle, the processor base calls the added nucleobase at the first portion as T and the added nucleobase at the second portion as G. When the combined signal is mapped to bin 1628 for the base calling cycle, the processor base calls the added nucleobase at the first portion as T and the added nucleobase at the second portion as A.
[0125] When the combined signal is mapped to bin 1632 for the base calling cycle, the processor base calls the added nucleobase at the first portion as G and the added nucleobase at the second portion as C. When the combined signal is mapped to bin 1634 for the base calling cycle, the processor base calls the added nucleobase at the first portion as G and the added nucleobase at the second portion as T. When the combined signal is mapped to bin 1636 for the base calling cycle, the processor base calls both the added nucleobase at the first portion and the added nucleobase at the second portion as G. When the combined signal is mapped to bin 1638 for the base calling cycle, the processor base calls the added nucleobase at the first portion as G and the added nucleobase at the second portion as A.
[0126] When the combined signal is mapped to bin 1642 for the base calling cycle, the processor base calls the added nucleobase at the first portion as A and the added nucleobase at the second portion as C. When the combined signal is mapped to bin 1644 for the base calling cycle, the processor base calls the added nucleobase at the first portion as A and the added nucleobase at the second portion as T. When the combined signal is mapped to bin 1646 for the base calling cycle, the processor base calls the added nucleobase at the first portion as A and the added nucleobase at the second portion as G. When the combined signal is mapped to bin 1648 for the base calling cycle, the processor base calls both the added nucleobase at the first portion and the added nucleobase at the second portion as A.
[0127] In this particular example, T is configured to emit a signal in both the IMAGE 1 channel and the IMAGE 2 channel, A is configured to emit a signal in the IMAGE 1 channel only, C is configured to emit a signal in the IMAGE 2 channel only, and G does not emit a signal in either channel. However, different permutations of nucleobases can be used to achieve the same effect by performing dye swaps. For example, A may be configured to emit a signal in both the IMAGE 1 channel and the IMAGE 2 channel, T may be configured to emit a signal in the IMAGE 1 channel only, C may be configured to emit a signal in the IMAGE 2 channel only, and G may be configured to not emit a signal in either channel.
[0128] Further details regarding performing base-calling based on a scatter plot having sixteen bins may be found in U.S. Patent Application Publication No. 2019/0212294, the disclosure of which is incorporated herein by reference.
[0129]
[0130] As shown in
[0131] At block 1710, intensity data is obtained. The intensity data includes first intensity data and second intensity data. The first intensity data comprises a combined intensity of a first signal component obtained based upon a respective first nucleobase of the first portion and a second signal component obtained based upon a respective second nucleobase of the second portion. Similarly, the second intensity data comprises a combined intensity of a third signal component obtained based upon the respective first nucleobase of the first portion and a fourth signal component obtained based upon the respective second nucleobase of the second portion.
[0132] As such, the first portion is capable of generating a first signal comprising a first signal component and a third signal component. The second portion is capable of generating a second signal comprising a second signal component and a fourth signal component.
[0133] As described above, the first portion and the second portion may be arranged on the solid support such that signals from the first portion and the second portion are detected by a single sensing portion and/or may comprise a single cluster such that first signals and second signals from each of the respective first portions and second portions cannot be spatially resolved.
[0134] In one example, obtaining the intensity data comprises selecting intensity data that corresponds to two (or more) different portions (e.g. the first portion and the second portion). In one example, intensity data is selected based upon a chastity score. A chastity score may be calculated as the ratio of the brightest base intensity divided by the sum of the brightest and second brightest base intensities. The desired chastity score may be different depending upon the expected intensity ratio of the light emissions associated with the different portions. As described above, it may be desired to produce clusters comprising the first portion and the second portion, which give rise to signals in a ratio of 2:1. In one example, high-quality data corresponding to two portions with an intensity ratio of 2:1 may have a chastity score of around 0.8 to 0.9.
[0135] After the intensity data has been obtained, the method may proceed to block 1720. In this step, one of a plurality of classifications is selected based on the intensity data. Each classification represents a possible combination of respective first and second nucleobases. In one example, the plurality of classifications comprises sixteen classifications as shown in
[0136] The method may then proceed to block 1730, where the respective first and second nucleobases are base called based on the classification selected in block 1720. The signals generated during a cycle of a sequencing are indicative of the identity of the nucleobase(s) added during sequencing (e.g. using sequencing-by-synthesis). It will be appreciated that there is a direct correspondence between the identity of the nucleobases that are incorporated and the identity of the complementary base at the corresponding position of the template sequence bound to the solid support. Therefore, any references herein to the base calling of respective nucleobases at the two portions encompasses the base calling of nucleobases hybridised to the template sequences and, alternatively or additionally, the identification of the corresponding nucleobases of the template sequences. The method may then end at block 1740.
Data Analysis Using 9 QaM
[0137] For two portions of polynucleotide sequences (e.g. a first portion and a second portion as described herein), there are sixteen possible combinations of nucleobases at any given position (i.e., an A in the first portion and an A in the second portion, an A in the first portion and a T in the second portion, and so on). When the same nucleobase is present at a given position in both portions, the light emissions associated with each target sequence during the relevant base calling cycle will be characteristic of the same nucleobase. In effect, the two portions behave as a single portion, and the identity of the bases at that position are uniquely callable.
[0138] However, when a nucleobase of the first portion is different from a nucleobase at a corresponding position of the second portion, the signals associated with each portion in the relevant base calling cycle will be characteristic of different nucleobases. In one embodiment, the first signal coming from the first portion have substantially the same intensity as the second signal coming from the second portion. The two signals may also be co-localised, and may not be spatially and/or optically resolved. Therefore, when different nucleobases are present at corresponding positions of the two portions, the identity of the nucleobases cannot be uniquely called from the combined signal alone. However, useful sequencing information can still be determined from these signals.
[0139] The scatter plot of
[0140] The intensity values shown in
[0141] Bins are selected based upon the combined intensity of the signals originating from each target sequence during the base calling cycle. For example, bin 1803 may be selected following the detection of a high-intensity (or on/on) signal in the first channel and a high-intensity signal in the second channel. Bin 1806 may be selected following the detection of a high-intensity signal in the first channel and an intermediate-intensity (on/off or off/on) signal in the second channel. Bin 1809 may be selected following the detection of a high-intensity signal in the first channel and a low-intensity or zero-intensity (off/off) signal in the second channel. Bin 1802 may be selected following the detection of an intermediate-intensity signal in the first channel and a high-intensity signal in the second channel. Bin 1805 may be selected following the detection of an intermediate-intensity signal in the first channel and an intermediate-intensity signal in the second channel. Bin 1808 may be selected following the detection of an intermediate-intensity signal in the first channel and a low-intensity or zero-intensity signal in the second channel. Bin 1801 may be selected following the detection of a low-intensity signal in the first channel and a high-intensity signal in the second channel. Bin 1804 may be selected following the detection of a low-intensity or zero-intensity signal in the first channel and an intermediate-intensity signal in the second channel. Bin 1807 may be selected following the detection of a low-intensity or zero-intensity signal in the first channel and a low-intensity signal in the second channel.
[0142] Four of the nine bins represent matches between respective nucleobases of the two portions sensed during the cycle (bins 1801, 1803, 1807, and 1809). In response to mapping the combined signal to a bin representing a match, the computer processor may detect a match between the first portion and the second portion at the sensed position. In response to mapping the combined signal to a bin representing a match, the computer processor may base call the respective nucleobases. For example, when the combined signal is mapped to bin 1801 for a base calling cycle, the computer processor base calls both the added nucleobase at the first portion and the added nucleobase at the second portion as T. When the combined signal is mapped to bin 1803 for the base calling cycle, the processor base calls both the added nucleobase at the first portion and the added nucleobase at the second portion as A. When the combined signal is mapped to bin 1807 for the base calling cycle, the processor base calls both the added nucleobase at the first portion and the added nucleobase at the second portion as G. When the combined signal is mapped to bin 1809 for the base calling cycle, the processor base calls both the added nucleobase at the first portion and the added nucleobase at the second portion as C.
[0143] The remaining five bins are ambiguous. That is to say that these bins each represent more than one possible combination of first and second nucleobases. Bins 1802, 1804, 1806, and 1808 each represent two possible combinations of first and second nucleobases. Bin 1805, meanwhile, represents four possible combinations. Nevertheless, mapping the combined signal to an ambiguous bin may still allow for sequencing information to be determined. For example, bins 1802, 1804, 1805, 1806, and 1808 represent mismatches between respective nucleobases of the two portions sensed during the cycle. Therefore, in response to mapping the combined signal to a bin representing a mismatch, the computer processor may detect a mismatch between the first portion and the second portion at the sensed position.
[0144] In this particular example, A is configured to emit a signal in both the first channel and the second channel, C is configured to emit a signal in the first channel only, T is configured to emit a signal in the second channel only, and G does not emit a signal in either channel. However, different permutations of nucleobases can be used to achieve the same effect by performing dye swaps. For example, A may be configured to emit a signal in both the first channel and the second channel, T may be configured to emit a signal in the first channel only, C may be configured to emit a signal in the second channel only, and G may be configured to not emit a signal in either channel.
[0145] The number of classifications, which may be selected based upon the combined signal intensities may be predetermined, for example based on the number of portions expected to be present in the nucleic acid cluster. Whilst
[0146] In addition to identifying matches and mismatches, the mapping of the combined signal to each of the different bins (e.g. in combination with additional knowledge, such as the library preparation methods used) can provide additional information about the first portion and the second portion, or about sequences from which the first portion and the second portion were derived. For example, given the nucleic acid material input and the processing methods used to generate the nucleic acid clusters, the first portion and the second portion may be expected to be identical at a given position. In this case, the mapping of the combined signal to a bin representing a mismatch may be indicative of an error introduced during library preparation. In addition, the first portion and the second portion may be expected to be different, for example due to deliberate sequence modifications introduced during library preparation to detect modified cytosines.
[0147] Errors arise during NGS library preparation, for example due to PCR artefacts or DNA damage. The error rate is determined by the library preparation method used, for example the number of cycles of PCR amplification carried out, and a typical error rate may be of the order of 0.1%. This limits the sensitivity of diagnostic assays based on the sequencing method, and may obscure true variants. The present methods allow for the identification of library preparation errors from fewer sequencing reads.
[0148] In the absence of any library preparation/sequencing errors, the signals produced by sequencing the two portions (e.g. using sequencing-by-synthesis) will match. The combined signal may therefore be mapped to one of the four corner clouds shown in
[0149] As mentioned herein, the library preparation may involve treatment with a conversion agent. In cases where the conversion reagent is configured to convert an unmodified cytosine to uracil or a nucleobase which is read as thymine/uracil, the correspondence between bases in the original polynucleotide and in the converted strands is shown in
[0150] In other cases where the conversion reagent is configured to convert a modified cytosine to thymine or a nucleobase which is read as thymine/uracil,
[0151]
[0152]
[0153] In the present example, for each base pair in the original double-stranded DNA molecule, it may be assumed that there are six possibilities: A-T, T-A, C-G, G-C, mC-G and G-mC. As shown in
[0154] In addition to determining methylation status, it may also be possible to identify library preparation/sequencing errors. Using the dye-encoding scheme shown in
[0155] The dye-encoding scheme may be optimised to allow for different combinations of first and second nucleobases to be resolved. This may be particularly useful where sequence modifications of a known type have been introduced into the first portions and the second portions. For example, where sequence modifications have been introduced that result in the conversion of unmodified cytosines to uracil or nucleobases which is read as thymine/uracil, or the conversion of modified cytosines to thymine or nucleobases which are read as thymine/uracil, the dye-encoding scheme may be selected such that the resulting combination of first and second nucleobases do not fall within the central bin (which represents four different nucleobase combinations).
[0156] In the case of conversion of modified cytosines to thymine (or nucleobases which are read as thymine/uracil), a T/C or G/A mismatch between the forward and reverse complement strands is indicative of the presence of a mC-G or G-mC base pair at the corresponding position of the library. The dye-encoding scheme may therefore be designed such that these mismatches may be resolved from other possible combinations of nucleobases. This may be achieved by detecting light emissions from A and T bases in a first illumination cycle, and from C and T bases in a second illumination cycle. In another example, light emissions may be detected from C and G bases in a first illumination cycle, and from C and T bases in a second illumination cycle. In another example, light emissions may be detected from C and A bases in a first illumination cycle, and from C and G bases in a second illumination cycle.
[0157] In the case of unmodified cytosines to uracil (or nucleobases which is read as thymine/uracil), a C/C or G/G match between the forward and reverse complement strands is indicative of the presence of a mC-G or G-mC base pair at the corresponding position of the library. In this case, a mC-G or G-mC base pair will always be resolvable. However, the dye-encoding scheme can still be designed to optimise the resolution between unmodified bases.
[0158]
[0159] In one embodiment, the first portion comprises or consists of a sequence derived from a nucleic acid sample (e.g. an insert) and the second portion comprises or consists of a sequence derived from a nucleic acid sample (e.g. an insert).
[0160] In one embodiment, the first portion is at least 25 or at least 50 base pairs and the second portion is at least 25 base pairs or at least 50 base pairs.
[0161] As shown in
[0162] At block 1910, intensity data is obtained. The intensity data includes first intensity data and second intensity data. The first intensity data comprises a combined intensity of a first signal component obtained based upon a respective first nucleobase of the first portion and a second signal component obtained based upon a respective second nucleobase of the second portion. Similarly, the second intensity data comprises a combined intensity of a third signal component obtained based upon the respective first nucleobase of the first portion and a fourth signal component obtained based upon the respective second nucleobase of the second portion.
[0163] As such, the first portion is capable of generating a first signal comprising a first signal component and a third signal component. The second portion is capable of generating a second signal comprising a second signal component and a fourth signal component.
[0164] As described above, the first portion and the second portion may be arranged on the solid support such that signals from the first portion and the second portion are detected by a single sensing portion and/or may comprise a single cluster such that first signals and second signals from each of the respective first portions and second portions cannot be spatially resolved.
[0165] In one example, obtaining the intensity data comprises selecting intensity data, for example based upon a chastity score. A chastity score may be calculated as the ratio of the brightest base intensity divided by the sum of the brightest and second brightest base intensities. In one example, high-quality data corresponding to two portions with a substantially equal intensity ratio may have a chastity score of around 0.8 to 0.9, for example 0.89-0.9.
[0166] After the intensity data has been obtained, the method may proceed to block 1920. In this step, one of a plurality of classifications is selected based on the intensity data. Each classification represents one or more possible combinations of respective first and second nucleobases, and at least one classification of the plurality of classifications represents more than one possible combination of respective first and second nucleobases. In one example, the plurality of classifications comprises nine classifications as shown in
[0167] The method may then proceed to block 1930, where sequence information of the respective first and second nucleobases is determined based on the classification selected in block 1920. The signals generated during a cycle of a sequencing are indicative of the identity of the nucleobase(s) added during sequencing (e.g. using sequencing-by-synthesis). For example, it may be determined that there is a match or a mismatch between the respective first and second nucleobases. Where it is determined that there is a match between the first and second respective nucleobases, the nucleobases may be base called. Whether there is a match or a mismatch, additional or alternative information may be obtained, as described above. It will be appreciated that there is a direct correspondence between the identity of the nucleobases that are incorporated and the identity of the complementary base at the corresponding position of the template sequence bound to the solid support. Therefore, any references herein to the base calling of respective nucleobases at the two portions encompasses the base calling of nucleobases hybridised to the template sequences and, alternatively or additionally, the identification of the corresponding nucleobases of the template sequences. The method may then end at block 1940.
Methods of Preparing and Sequencing a Tandem Library
[0168] In one aspect of the invention, there is provided a method of preparing at least one polynucleotide library strand, wherein the method comprises: [0169] attaching a first adaptor to a first end of a double-stranded polynucleotide sequence, wherein the first end comprises the 3 end of the forward strand and the 5 end of the reverse strand of the double-stranded polynucleotide sequence; and [0170] attaching a second adaptor to a second end of a double-stranded polynucleotide sequence, wherein the second end comprises the 5 end of the forward strand and the 3 end of the reverse strand of the double-stranded polynucleotide sequence; [0171] wherein the first adaptor comprises a polynucleotide loop and the second adaptor comprises at least one primer-binding sequence and at least one primer-binding complement sequence; [0172] wherein the first adaptor comprises a first restriction site for an endonuclease.
[0173] In another aspect of the invention, there is provided a method of preparing at least one polynucleotide library strand, wherein the method comprises: [0174] attaching a first adaptor to a first end of a double-stranded polynucleotide sequence, wherein the first end comprises the 3 end of the forward strand and the 5 end of the reverse strand of the double-stranded polynucleotide sequence; and [0175] attaching a second adaptor to a second end of a double-stranded polynucleotide sequence, wherein the second end comprises the 5 end of the forward strand and the 3 end of the reverse strand of the double-stranded polynucleotide sequence; [0176] wherein the first adaptor comprises a polynucleotide loop and the second adaptor comprises at least one primer-binding sequence and at least one primer-binding complement sequence; [0177] wherein the second adaptor comprises a cleavable site and/or a complement of a cleavable site.
[0178] In another aspect of the invention, there is provided a method of preparing at least one polynucleotide library strand, wherein the method comprises: [0179] attaching a first adaptor to a first end of a double-stranded polynucleotide sequence, wherein the first end comprises the 3 end of the forward strand and the 5 end of the reverse strand of the double-stranded polynucleotide sequence; and [0180] attaching a second adaptor to a second end of a double-stranded polynucleotide sequence, wherein the second end comprises the 5 end of the forward strand and the 3 end of the reverse strand of the double-stranded polynucleotide sequence; [0181] wherein the first adaptor comprises a polynucleotide loop and the second adaptor comprises at least one primer-binding sequence and at least one primer-binding complement sequence; [0182] wherein the first adaptor comprises a first restriction site for an endonuclease and wherein the second adaptor comprises a cleavable site and/or a complement of a cleavable site.
[0183] In another aspect of the invention, there is provided a polynucleotide library strand for sequencing comprising a first adaptor, a double-stranded polynucleotide sequence to be identified and a second adaptor, wherein the first adaptor is attached to a first end of the double-stranded polynucleotide sequence, wherein the first end comprises the 3 end of the forward strand and the 5 end of the reverse strand of the double-stranded polynucleotide sequence; and the second adaptor is attached to a second end of the double-stranded polynucleotide sequence, wherein the second end comprises the 5 end of the forward strand and the 3 end of the reverse strand of the double-stranded polynucleotide sequence; wherein the first adaptor comprises a loop that connects the 3 end of the forward strand and the 5 end of the reverse strand, and wherein the second adaptor comprises a base-paired stem, a primer-binding complement sequence and a primer-binding sequence, and wherein the first adaptor comprises at least one restriction site for an endonuclease.
[0184] The first and second adaptors may be attached to the polynucleotide using processes as described in more detail in e.g. WO 07/052006, or tagmentation methods as described above.
[0185] In a further embodiment, the second adaptor may also comprise at least one cleavable site. In other words, the first adaptor comprises at least one restriction site and the second adaptor comprises at least one cleavable site. The cleavable site may also be a restriction site.
[0186] By restriction site is meant a sequence of nucleotides recognised by an endonuclease, such as a single-stranded endonuclease. A restriction site may also be referred to as a recognition site or recognition sequence, and such terms may be used interchangeably.
[0187] In one embodiment, the endonuclease is a single strand restriction endonuclease, a nicking endonuclease or nicking enzyme or nickase (again, such terms may be used interchangeably). By any of these terms is meant an enzyme that can hydrolyze only one strand of the double-stranded polynucleotide (duplex), to produce DNA molecules that are nicked, rather than fully cleaved on both strands.
[0188] Examples of suitable nicking enzymes that may be used include, but are not limited to, Nb.BbvCI, Nb.Bsml, Nb.BsrDI, Nb.Btsl, Nt.Alwl, Nt.BsmAl, Nt.BspQI, Nt.BstNBI, BssSI, Nb.Bpu101 and Nt.CviPII. These nickases can be used either alone or in various combinations. Other suitable nicking endonucleases are available from commercial sources, including New England Biolabs and Fisher Scientific.
[0189] The restriction sites vary depending on the nickase used, and are well known in the art. In one example, the restriction site is selected from the following:
[0190] In one embodiment, the nickase is Nb.BssSI, and the restriction site is CACGAG, wherein Nb.BssSI catalyzes a single strand break within the recognition sequence.
[0191] In one embodiment, the nickase is Nt.BspQI, and the restriction site is GCTCTTC (1/7), wherein Nt.BspQI catalyzes a single strand break one base beyond the 3 side of the restriction site.
[0192] In one embodiment, the nickase is Nt.CviPII and the restriction site is (0/1) CCD, wherein Nt.CviPII catalyzes a single strand break at the 5 side of the restriction site.
[0193] In one embodiment, the nickase is Nt.BstNBI and the restriction site is GAGTC (4/5), wherein Nt.BstNBI catalyzes a single strand break four bases beyond the 3 side of the restriction site.
[0194] In one embodiment, the nickase is Nb.BsrDI and the restriction site is GCAATG, wherein Nb.BsrDI catalyzes a single strand break within the restriction site.
[0195] In one embodiment, the nickase is Nb.Btsl and the restriction site is GCAGTG, wherein Nb.Btsl catalyzes a single strand break within the restriction site.
[0196] In one embodiment, the nickase is Nt.Alwl and the restriction site is GGATC (4/5), wherein Nt.Alwl catalyzes a single strand break four bases beyond the 3 side of the restriction site.
[0197] In one embodiment, the nickase is Nb.BbvCI and the restriction site is CCTCAGC, wherein Nb. BbvCI catalyzes a single strand break within the restriction site.
[0198] In one embodiment, the nickase is Nb.Bsml and the restriction site is GAATGC, wherein Nb.Bsml catalyzes a single strand break within the restriction site.
[0199] In one embodiment, the nickase is Nt.BsmAl and the restriction site is GTCTC (1/5), wherein Nt. BsmAl catalyzes a single strand break one base beyond the 3 side of the restriction site.
[0200] In one embodiment, the nickase is Nb.Bpu101 and the restriction site is CCTNAGC, wherein Nb.Bpu101 catalyzes a single strand break within the restriction site.
[0201] Where the restriction site is described in the following format (x/y), x is the number of nucleotides beyond (i.e. 3 of) the 3 end of the restriction site where cleavage occurs; and y is the number of nucleotides in the restriction site.
[0202] In an alternative embodiment, the endonuclease is a Cas9 nickase.
[0203] Examples of a Cas9 nickase include Cas9 D10A and Cas9 H840A. For example, in one embodiment, the Cas9 protein may comprise the D10A or H840A amino acid substitutions. These nickases cleave only the DNA strand that is complementary to and recognized by a gRNA.
[0204] In one embodiment, the restriction site may be or may comprise a PAM (protospacer adjacent motif) sequence. Examples of suitable PAM sequences include NGG, NGAG, NGCG, NGN, NG, GAA, GAT, NNG, NGN, NRN, YG, NNGRRT, NNNRRT, NNAGAA, NNNNGATT and NNNNCRAA and complements thereof.
[0205] In a further embodiment, the Cas9 protein may alternatively or additionally comprise the N863A or N854A amino acid substitutions.
[0206] In a further embodiment, the Cas9 protein has been modified to improve activity. For example, in one embodiment, the Cas9 protein may additionally comprise a D1135E substitution. Alternatively, the Cas9 protein may also be the VQR variant.
[0207] In one embodiment, where the first and second adaptors both comprise a restriction site, the restriction sites are different sequences. Accordingly, in one embodiment, the first adaptor comprises a first restriction site and the second adaptor comprises a second restriction site.
[0208] In one embodiment, the target polynucleotide to be sequenced is a double stranded polynucleotide molecule (also referred to herein as a duplex), for example, as shown in
[0209] The first adaptor may be attached to the 5 end of the first portion and the 3 end of the second portion. Similarly, the second adaptor may be attached to the 3 end of the first portion and the 5 end of the second portion.
[0210] In one embodiment, the first adaptor is added to the 3 end of the polynucleotide duplex (that is, the 3 end of the forward strand and the 5 end of the reverse strand). The first adaptor may be an oligonucleotide of any structure or any sequence that allows the forward and reverse strands to be connected. For example, the adaptor may be capable of forming a loop. In one example, as shown in
[0211] In one embodiment, the (first) restriction site is in the base-paired stem, at either the 5 or 3 end of the base-paired stem. In one aspect, the restriction site is at the 5 end.
[0212] Where the first adaptor comprises a first restriction site, the location of the restriction sequence will depend on whether the cleavage site for the target endonuclease is immediately 3 of the restriction site or whether, as described above, the endonuclease cleaves (nicks) a number of nucleotides 3 of the restriction site. It is of course desirable that the endonuclease does not cleave in the target polynucleotide to be sequenced or in its complement on the template (i.e. in the first or second portions, which are the portions that allow the target polynucleotide to be sequenced).
[0213] In one embodiment, the second adaptor comprises at least one primer-binding sequence. In another embodiment, the second adaptor comprises at least one primer-binding complement sequence. In an alternative embodiment, the second adaptor comprises both a primer-binding sequence and a primer-binding complement sequence. The primer-binding sequence may be capable of binding to a lawn or immobilised primer that is immobilised on the surface of a solid support. For example, the primer-binding sequence may be either P5 (for example, SEQ ID NO: 3 or a variant or fragment thereof) or P7 (for example, SEQ ID NO: 4 or a variant or fragment thereof). Similarly, the primer-binding complement sequence may be either P5 (for example, SEQ ID NO: 1 or 5 or a variant or fragment thereof) or P7 (for example, SEQ ID NO: 2 or a variant or fragment thereof). If the primer-binding sequence is P5, the primer-binding complement sequence is P7. If the primer-binding sequence is P7, the primer-binding complement sequence is P5.
[0214] As shown in
[0215] In one embodiment the second adaptor comprises a (first) cleavable site. In one embodiment, the cleavable site is in the base-paired stem. As described above, the base-paired stem comprises two strands. In one example, the first strand comprises a cleavable site and the second strand comprises a complement of the cleavable site. In one embodiment, it is the strand that is attached to the primer-binding complement sequence that comprises the cleavable site, and the strand that is attached to the primer-binding sequence that comprises a complement of the cleavable site. The cleavable site and the complement of the cleavable site may be cleavable by the same cleaving agent (i.e. they are complementary sequences), although it is possible for the sequences to be cleavable by different agents (i.e. they are not complementary sequences of each other).
[0216] Alternatively, the second adaptor does not comprise a cleavable site in the base-paired stem.
[0217] In another embodiment, the second adaptor comprises a base-paired stem and a first arm of a fork and a second arm of a fork, where the first arm comprises a primer-binding sequence and a complement of a cleavable site, and the second arm comprises a primer-binding complement sequence and a cleavable site. Again, the cleavable site and complement thereof may be cleavable by the same cleaving agent or different cleaving agents, as described above.
[0218] Alternatively, the second adaptor may comprise a base-paired stem and a hairpin loop, where the loop comprises a primer-binding sequence, a second cleavable site and primer-binding complement sequence, where the cleavable site is in-between the primer-binding sequence and the primer-binding complement sequence. In one embodiment, the first adaptor comprises a first cleavable site in the base-paired stem as described above, and a second cleavable site in the loop and in-between the primer-binding sequence and the primer-binding complement sequence. Alternatively, the second adaptor does not comprise the first cleavable site.
[0219] As used herein, by cleavable site is meant any moiety, such as a modified nucleotide, that allows selective cleavage of the adaptor sequence. By way of non-limiting example, the cleavable site may comprise uracil bases, phosphorothioate groups, ribonucleotides, diol linkages, disulphide linkages, peptides etc.
[0220] In one example, the cleavable site is a uracil. Uracil can be cleaved using a uracil glycosylase or USER enzyme mix (which is a cocktail of uracil glycosylase and endonuclease VIII).
[0221] In another example, the cleavable site is 8-oxoguanine. 8-oxoguanine can be cleaved using a FPG glycosylase.
[0222] Alternatively, the cleavable site is a restriction site. In one embodiment, the first cleavable site is a restriction site. As referred to herein the first cleavable site may therefore be referred to as the second restriction site, and the second cleavable site may be referred to herein as the third restriction site. In some embodiments, the first, second and third restriction sites are all different (i.e. different restriction site sequences).
[0223] In one embodiment, the method may comprise cleaving the loop of the second adaptor at the cleavable site to open the loop. This will generate a fork structure, as described above. Specifically, following cleavage the second adaptor will form a base-paired stem and then a fork.
[0224] Although not shown in
[0225] In the first adaptor the sequencing primer-binding sites may be in the loop sequence or in the base-paired stem. In one embodiment, the base-paired stem comprises at least one sequencing primer-binding site. In one embodiment, the sequencing primer-binding site is in the base-paired stem, and in the part of the stem that connects to the reverse strand of the double-stranded polynucleotide. In another embodiment, the loop may comprise two sequencing primer sites. In one example, the loop comprises two sequencing primer sites and a restriction site, wherein the sequencing primer sites are either side of the restriction site.
[0226] In the second adaptor the sequencing primer-binding site(s) may also be in the base-paired stem. Alternatively, each fork of the second adaptor may additionally comprise a sequencing primer-binding site.
[0227] The sequencing primer binding sites are sequencing and/or index primer binding sites and indicate the starting point of the sequencing read. During the sequencing process, a sequencing primer anneals (i.e. hybridises) to at least a portion of the sequencing primer binding site on the template strand. The polymerase enzyme binds to this site and incorporates complementary nucleotides base by base into the growing opposite strand.
[0228] The sequence of the sequencing primers and the sequence primer binding sites are not material to the methods of the invention, as long as the sequencing primers are able to bind to the sequence primer binding site to enable amplification and sequencing of the regions to be identified.
[0229] In a further embodiment, as also not shown in
[0230] As shown in
[0231] Accordingly, in one embodiment, the first adaptor comprises at least one affinity tag. As such, where required, unwanted fork/fork molecules could easily be eliminated from the workflow via a single affinity-based purification system. As such, the affinity tag may be any tag that can be used in this system. Examples include, but are not limited to, biotin, avidins (e.g. streptavidin), antibodies, haptens, cucubiturils, adamantanes (e.g. 1-adamantylamine), ammonium ions (e.g. amino acids), ferrocenes, cyclodextrins, calixarenes, crown ethers (e.g. 18-crown-6, 15-crown-5, 12-crown-4), cryptands (e.g. [2.2.2]cryptand), His tags (e.g. His.sub.6 tag), or the like.
[0232] In one embodiment, the affinity tag is biotin. This would enable the elimination of fork/fork molecules using streptavidin beads (e.g. magnetic streptavidin beads) before/after PCR (
[0233] In one embodiment, the method may comprise preparing a polynucleotide library strand as described above, and applying an epigenetic conversion strategy. Such conversion strategies involve treating the polynucleotide library strand with a conversion reagent, wherein the conversion reagent is configured to convert a modified cytosine to thymine or a nucleobase which is read as thymine/uracil, and/or wherein the conversion reagent is configured to convert an unmodified cytosine to uracil or a nucleobase which is read as thymine/uracil. Suitable strategies are well appreciated by the skilled person. Non-limiting examples of such conversion strategies include bisulfite sequencing (BS-seq), oxidative bisulfite sequencing (oxBS-seq), reduced bisulfite sequencing (redBS-seq), TET-assisted bisulfite sequencing (TAB-seq), APOBEC-coupled epigenetic sequencing (ACE-seq), Enzymatic Methyl sequencing (EM-seq), TET-assisted pyridine borane sequencing (TAPS), TET-assisted pyridine borand sequencing with -glucosyltransferase blocking (TAPSB), chemical-assisted pyridine borane sequencing (CAPS), pyridine borane sequencing (PS), and pyridine borane sequencing for 5-caC (PS-c). Non-limiting examples of conversion reagents include sulfites (e.g. bisulfite), cytidine deaminases (e.g. wild-type or mutant enzymes of the APOBEC family), and boron-based reducing agents (e.g. amine-borane compounds or azine-borane compounds, such as t-butylamine borane, ammonia borane, ethylenediamine borane, dimethylamine borane, pyridine borane and 2-picoline borane),
[0234] As used herein, the term modified cytosine may refer to any one or more of 5-methylcytosine (5-mC), 5-hydroxymethylcytosine (5-hmC), 5-formylcytosine (5-fC) and 5-carboxylcytosine (5-caC):
##STR00001##
wherein the wavy line indicates an attachment point of the modified cytosine to the polynucleotide.
[0235] The resulting libraries may either be further amplified via PCR or be directly used for clustering in PCR-free workflows. If amplified, the resulting amplified (double-stranded) library strand is shown in
[0236] As shown in
[0237] Accordingly, the forward strand of the resulting amplified library strand will comprise (in the 5 to 3 direction): [0238] a complement of a first strand of the first adaptor (comprising a primer-binding complement sequence (e.g. P5, for example, SEQ ID NO: 1 or 5 or a variant or fragment thereof) and a complement of the first strand of the base-paired stem); [0239] a copy of the 3 end of the reverse strand (of the original library fragment) (A copy); [0240] a copy of the 5 end of the reverse strand (of the original library fragment) (B copy); [0241] a complement of the first adaptor (comprising a complement of the original loop sequence (L) flanked by complements of the base-paired stem of the first adaptor); [0242] a copy of the 3 end of the forward strand (of the original library fragment) (B copy); [0243] a copy of the 5 end of the forward strand (of the original library fragment) (A copy); and [0244] a complement of a second strand of the first adaptor (comprising a complement of the second strand of the base-paired stem of the first adaptor and a complement of the primer-binding complement sequence (e.g. a first primer-binding sequencee.g. P7 for example, SEQ ID NO: 4 or a variant or fragment thereof)).
[0245] The reverse strand of the resulting amplified library strand will comprise (in the 3 to 5 direction); [0246] a first strand of the second adaptor (comprising a second primer-binding sequence (e.g. P5, for example, SEQ ID NO: 3 or 6 or a variant or fragment thereof) and a first strand of the base-paired stem); [0247] the complement of the 5 half of the original forward strand (i.e. the 3 half of the reverse strand) (A); [0248] the complement of the 3 half of the forward strand (i.e. the 5 half of the reverse strand (B); [0249] the first adaptor, comprising a loop sequence (L) flanked by the base-paired stem of the first adaptor; [0250] the 3 half of the forward strand (B); [0251] the 5 half of the forward strand (A); and [0252] a second strand of the first adaptor (comprising the second strand of the base-paired stem of the first adaptor and second primer-binding complement sequence (e.g. P7, for example, SEQ ID NO: 2 or a variant or fragment thereof)).
[0253] As shown in
[0254] As also shown in
[0255] Accordingly, in a further aspect of the invention, there is provided, as described further above, an inverted-repeat tandem-insert polynucleotide library strand, wherein the library strand comprises a primer-binding complement sequence, a first portion to be identified, a loop sequence, a second portion to be identified and a primer-binding sequence, wherein the first and second portions are complementary sequences and wherein the sequence of the second portion is inverted with respect to the first portion, and wherein the loop sequence comprises at least one restriction site for a nicking endonuclease. In a further embodiment, the primer-binding sequence and primer-binding complement sequence comprise at least one cleavable site and/or complement of a cleavable site. In one embodiment, the cleavable site is a restriction site. The inverted-repeat tandem-insert polynucleotide library strand may be single or double-stranded.
[0256] In one embodiment, the first portion comprises or consists of a sequence derived from a nucleic acid sample (e.g. an insert) and the second portion comprises or consists of a sequence derived from a nucleic acid sample (e.g. an insert).
[0257] In one embodiment, the first portion is at least 25 or at least 50 base pairs and the second portion is at least 25 base pairs or at least 50 base pairs.
[0258] Sequencing of the termini of such inverted-repeat tandem-insert library strands results in equivalent sequences in the same direction (e.g. A-B-loop-B-A), whereby each end represents the sequence of a different strand of the original duplex (
[0259] Where the library strand has not undergone modification, for example, an epigenetic conversion strategy has not been applied as described above the inverted-repeat tandem-insert library strand is susceptible to re-hybridisation during SBS. A solution to this problem is described below.
[0260] In one aspect of the invention, there is provided a method of identifying at least a first region of a polynucleotide sequence, wherein the method comprises [0261] a. preparing at least one polynucleotide library strand as described above; [0262] b. amplifying the polynucleotide library strand to generate a first and second library strand, wherein each library strand comprises a first and second region; [0263] c. hybridising the first or second library strands to first and second immobilised primers respectively on a solid support and carrying out a first extension reaction to generate a first or second immobilised template strand; [0264] d. hybridising the first or second immobilised template strands to a second or first immobilised primer respectively and carrying out a second extension reaction to generate a second and first immobilised template strand; [0265] e. hybridising the first and second immobilised template strands; [0266] f. applying a first endonuclease; and [0267] g. sequencing the first and second immobilised template strands, wherein sequencing the first and second immobilised template strands identifies the first region.
[0268] In a further embodiment, the method comprises displacing or de-hybridising the (non-immobilised) library strands from the first or second immobilised strands and hybridising the first immobilised template strand to the 5 end of the second immobilised strand (which comprises a 5 primer sequence) or hybridising the second immobilised template strand to the 5 end of the first immobilised strand (which also comprises a 5 primer sequence). This allows extension of the second or first immobilised strands using the bridged first extension strand as a template. This step is referred to as clustering. In one embodiment, the cluster is generated by bridge amplification.
[0269] By identification or identifying is meant here obtaining genetic information from the polynucleotide strand or polynucleotide strands. This may include identification of the genetic sequence of the polynucleotide strand or polynucleotide strands (i.e. sequencing). Furthermore, this may instead, or additionally, include identification of mismatched base pairs. In addition, this may instead, or additionally, include identification of any epigenetic modifications, for example methylation. Accordingly, identification may mean identification of the genetic sequence of the polynucleotide strand or polynucleotide strands, mismatched base pairs, and/or identification of any epigenetic modifications.
[0270] In one embodiment, amplifying the polynucleotide library strand generates a first region to be identified and a second region (that may be also identified), such as on a single polynucleotide strand. As described above, the first and second regions may be complementary sequences, and are orientated as inverted-repeat tandem insertsthat is, both regions are on the same polynucleotide strand, and are inverted in sequence with respect to each other (as shown in
[0271] In one embodiment, each first and second library strands comprises a primer-binding complement sequence, a first portion to be identified, a loop sequence, a second portion to be identified and a primer-binding sequence, wherein the first and second portions are complementary sequences and wherein the sequence of the second portion is inverted with respect to the first portion, and wherein the loop sequence comprises at least one restriction site (a first restriction site) for an endonuclease. In a further embodiment, the primer-binding sequence and primer-binding complement sequence comprise at least one cleavable site and/or at least one complement of a cleavable site. In one embodiment, the cleavable site/complement of cleavable site is a restriction site/complement of a restriction site.
[0272] The inverted-repeat tandem-insert polynucleotide library strand may be single or double-stranded.
[0273] In a further embodiment, the method comprises converting any epigenetic modifications (e.g. modified cytosines) using a conversion reagent, as described above.
[0274] In a further embodiment, the method comprises applying the plurality of inverted-repeat tandem-insert library strands in solution to a solid support (such as a flow cell), wherein, as described above, each inverted-repeat tandem-insert library strand comprises a first or second 3 primer-binding sequence (e.g. P5 or P7), and wherein the solid support has immobilised thereon a plurality of lawn primer sequences complementary to the first and second 3 primer-binding sequences.
[0275] In a further embodiment, the method comprises hybridising the 3 primer binding sequence of the first library strand (a single stranded inverted-repeat tandem-insert library strand) to a first lawn primer or hybridising the 3 primer binding sequence of the second library strand (a single stranded inverted-repeat tandem-insert library strand) to a second lawn primer; and carrying out an extension reaction to extend the lawn primers to generate a first or second immobilised (also referred to herein as extended) template strand complementary to the library strands, wherein the immobilised strands comprise a 3 (second or first respectively) primer binding sequence. Accordingly, in one embodiment, the first and second library strands comprise a first and second 3 primer-binding sequence, the solid support comprises a first and second immobilised primer, and the first and second library strands hybridise by their 3 primer-binding sequences to the first and second immobilised primers.
[0276] In a further embodiment, the method comprises displacing or de-hybridising the (non-immobilised) library strands from the first or second immobilised strands and hybridising the first immobilised template strand to the 5 end of the second immobilised strand (which comprises a 5 primer sequence) or hybridising the second immobilised template strand to the 5 end of the first immobilised strand (which also comprises a 5 primer sequence). This allows extension of the second or first immobilised strands using the bridged first extension strand as a template. This step is referred to as clustering. In one embodiment, the cluster is generated by bridge amplification.
[0277] In a further embodiment, the method comprises hybridising the first immobilised template strand to the 5 end of the second immobilised strand (which comprises a 5 primer sequence) and hybridising the second immobilised template strand to the 5 end of the first immobilised strand (which also comprises a 5 primer sequence). This structure may be referred to herein as a sequence bridge. The sequence bridge is hybridised at a least three places: (1) the 5 primer of the first extended strand is hybridised to the 3 primer-binding region of the second extended strand (e.g. P5); (2) the loop sequences of both the first and second extended strands and (3) the 5 primer of the second extended strand (e.g. P7) is hybridised to 3 primer-binding region of the first extended strand (e.g. P7). Accordingly, this structure may be referred to herein as a loop-hybridised sequence bridge.
[0278] In a further embodiment, the method comprises applying (i.e. adding/flowing over the surface of the solid support), a first nicking enzyme. In one example, the nicking enzyme cleaves the first or second restriction sites within the template strand.
[0279] In one embodiment, the first nicking enzyme cleaves the first restriction sites. These are the restriction sites within the first adaptor (or present originally in the adaptor). In one embodiment, the first restriction site is in the loop sequence. In an alternative embodiment, the second restriction site is in the base-paired stem (that flank the loop sequence).
[0280] In another embodiment, the first nicking enzyme cleaves the second restriction sites. These are the restriction sites within the second adaptor. In one embodiment, the second restriction site is in base-paired stem (at the 3 end of the second adaptor sequences in the single stranded template).
[0281] In one embodiment, following cleavage the sequences located 3 of the cleaved sequence are de-hybridised and washed off.
[0282] In a further embodiment, the method comprises carrying out a first sequencing read to determine the sequence of the first and second immobilised strands simultaneously, such as by a sequencing-by-synthesis technique or by a sequencingby ligation technique.
[0283] An example of a method of sequencing an inverted-repeat tandem-insert library strand is shown in
[0284] Following extension of the lawn primers to generate the first and second extended strands, the 3 ends of each extended strand bend over to bind to the other, non-bound lawn adaptor (P7 or P5) to form a sequence bridge. As described above, this sequence bridge differs from conventional sequence bridges, as the sequence bridge is hybridised at at least three places-(1) the 5 primer (e.g. P5) of the first extended strand is hybridised to the 3 primer-binding region of the second extended strand (e.g. P5); (2) the loop sequences of both the first and second extended strands and (3) the 5 primer of the second extended strand (e.g. P7) is hybridised to 3 primer-binding region of the first extended strand (e.g. P7). As described above, this structure may be referred to herein as a loop-hybridised sequence bridge. The sequence bridge may be further hybridised within the regions to be identified.
[0285] In the next step, nicking enzymes are added. The nicking enzymes may be flowed across the solid support following clustering and formation of the loop-hybridised sequence bridge as described above.
[0286] As shown in
[0287] In standard SBS sequencing, the non-immobilised sequencesthat is, the sequences 3 of the nicked siteare washed off before addition of a read 1.1 (SBS-R1.2) and read 1.2 (SBS-R1.2) sequencing primer, which anneal to the nicked sites in the loop sequence of the first and second extended strands respectively, and a polymerase. As shown in
[0288] In double-stranded SBS (e.g. strand displacement SBS), the non-immobilised sequences 3 of the nicked site are not washed off.
[0289] Single-strand displacement SBS is an effective method for the sequencing of the prepared duplex. This method requires a nick in the duplex sequence and primers for DNA polymerase to utilise, to incorporate reversibly-terminated labelled dNTPs into a complementary strand of one strand of the template.
[0290] Single-strand displacement SBS combines the principles of single strand replication and sequencing-by-synthesis technologies to sequence duplexes. In single-strand displacement SBS, a DNA polymerase capable of strand-displacement but lacking exonuclease activity, such as phi29 DNA polymerase, is utilised. DNA polymerases lacking exonuclease activity in both the 5-3 and 3-5 direction are required, to allow for both Reads 1 and 2. The nick site within the duplex target and annealed primer provides a binding site for such a DNA polymerase to bind. After docking, the DNA polymerase extends the primer adjacent to the nick site to generate a sequencing strand. The sequencing strand is formed by incorporating labelled deoxynucleoside triphosphates (dNTP), complementary to the relevant template strand. The labelled dNTPs act as a terminator for polymerization, so after each dNTP incorporation, the fluorescent dye is imaged to identify the base and then enzymatically cleaved to allow incorporation of the next nucleotide. Since all four reversible terminator-bound dNTPs (A, C, T, G) are present as single, separate molecules, natural competition minimizes incorporation bias. Simultaneous to polymerising a complementary strand, the DNA polymerase uses its strand displacement activity to displace the other non-template strand for access. In this invention, this workflow occurs simultaneously for each read (R1.1 and R1.2/R2.1 and R2.2).
[0291]
[0292] As shown in
[0293] The method described herein can also be used to simultaneously sequence genomic and epigenetic data. Following preparation of the polynucleotide library strand, an epigenetic conversion is applied. The modified library strand can then be sequenced as described above and the sequences of the duplex strands read simultaneously. A 9 QaM system is used to decode the simultaneously-received read signals. Depending on which technology for epigenetic conversion is used, the C/C cloud may either represent a mC (Bisulfite/EM-Seq) or accurate C call (TAPS) and vice versa, the C/T cloud will represent the mC or accurate C calls respectively (
[0294] Following sequencing of one strand of the duplex (i.e. read 1) as described above, sequencing of the other, second strand of the duplex can be carried out using either single stranded or double stranded SBS.
[0295] In one example, as shown in
[0296] Suitable blocking groups include a hairpin loop (e.g. a polynucleotide attached to the 3-end, comprising in a 5 to 3 direction, a cleavable site such as a nucleotide comprising uracil, a loop portion, and a complement portion, wherein the complement portion is substantially complementary to all or a portion of the lawn primer), a hydrogen atom instead of a 3-OH group, a phosphate group, a propyl spacer (e.g. O(CH.sub.2).sub.3OH instead of a 3-OH group), a modification blocking the 3-hydroxyl group (e.g. hydroxyl protecting groups, such as silyl ether groups (e.g. trimethylsilyl, triethylsilyl, triisopropylsilyl, t-butyl (dimethyl) silyl, t-butyl(diphenyl) silyl), ether groups (e.g. benzyl, allyl, t-butyl, methoxymethyl (MOM), 2-methoxyethoxymethyl (MEM), tetrahydropyranyl), or acyl groups (e.g. acetyl, benzoyl)), or an inverted nucleobase. However, the blocking group may be any modification that prevents extension (i.e. elongation) of the free end by a polymerase. Alternatively, instead of blocking the free ends, these strands are extended to regenerate the polynucleotide strand (i.e. to resynthesized to generate the 3 primer-binding sequences).
[0297] In the next step, nicking enzymes may be applied to nick the sequence bridges at the restriction sites within the loop sequence (or loop complement sequence), using an alternative recognition site to the first nicking event. That is, nicking occurs at the restriction sites at the 3 end of the loop sequence. As shown in
[0298] The two reads, each with simultaneous sequencing of two strandsas described for example in
[0299] The order of nicking reactions can also be reversed. For example, the first nicking step may be nicking of the loop sequence and the second nicking step may be nicking of the 3 end of the primer sequence. This is shown, for example in
[0300] As shown in
[0301] The sequenced strands are then extended (i.e. resynthesized) to regenerate the 3 primer-binding sequences. In the next step, nicking enzymes may be applied to nick the sequence bridges at the 3 end of the primer sequences (as described, for example, in
[0302] Accordingly, in a further embodiment, following read 1, the method comprises blocking all or substantially all free 3 ends of the immobilised strands. Alternatively, following read 1, each immobilised strand is extended to regenerate the loop-hybridised sequence bridge described (as shown in
[0303] In a further embodiment, the method further comprises applying (i.e. adding/flowing over the surface of the solid support), a second nicking enzyme. In one embodiment, the second nicking enzyme cleaves the first or second restriction sites within the template strand. In another embodiment, the second nicking enzyme cleaves a different restriction site from the first nicking enzyme. Accordingly, where the first nicking enzyme cleaves the first restriction site, the second nicking enzyme cleaves the second restriction site (as shown in
[0304] In one embodiment, following read 1, and where the first nicking enzyme has cleaved the second restriction site, the method comprises blocking all or substantially all free 3 ends of the immobilised strands, and applying a second nicking enzyme where the second nicking enzyme cleaves the first restriction site (as shown in
[0305] In an alternative embodiment, following read 1, and where the first nicking enzyme has cleaved the first restriction site, the method comprises carrying out an extension reaction to extend the immobilised strands, and applying a second nicking enzyme where the second nicking enzyme cleaves the second restriction site as shown in
[0306] In a further embodiment, the method comprises carrying out a second sequencing read to determine the sequence of the first and second immobilised strands simultaneously, such as by a sequencing-by-synthesis technique or by a sequencingby ligation technique. This sequence read is read 2.
[0307] In an alternative embodiment, the method comprises generating a sequence bridge, as described above, and simultaneously cleaving both strands of the bridge. This is possible if the first restriction site is in the middle of the loop or substantially the middle of the loop.
[0308] In one embodiment, the endonuclease is a double strand restriction endonuclease or restriction enzyme. By either of these terms is meant an enzyme that can hydrolyze both strands of the double-stranded polynucleotide (duplex), to produce DNA molecules that are cleaved on both strands. In one embodiment, the restriction enzyme is a type II restriction enzyme. In one example, the type II restriction enzyme is EcoRI and the restriction enzyme is G/AATTC wherein EcoRI catalyzes a double stranded break within the recognition site. In another example, the type II restriction enzyme is Bg1II and the restriction site is A/GATCT, wherein Bg1II catalyzes a double stranded break within the recognition site. In a further example, the type II restriction enzyme is Notl and the restriction site is GC/GGCCGC, wherein Notl catalyses a double stranded break within the recognition site.
[0309] Furthermore, in this embodiment, the loop sequence in the first adaptor will comprise the following structure: first sequencing primer-binding sequence-restriction site-complement of a second sequencing primer-binding sequence. As a result, the first immobilised template (within the loop sequence) will comprise a first sequencing primer-binding sequence, a restriction site and a complement of a second sequencing primer-binding sequence, and the second immobilised template will comprise a complement of a first sequencing primer-binding sequence, a restriction site and a complement of a second sequencing primer-binding sequence. The first and second sequencing primer-binding sequences bind a sequencing primer, which may be the same sequence. That is, they bind the same sequencing primer. Alternatively, the first and second sequencing primer-binding sequences are different. That is, they bind different sequencing primers.
[0310] The sequencing primer-binding sequences may be in the base-paired stem of the loop sequence.
[0311] Following nicking of the loop sequence two immobilised extended strands are generateda first immobilised extended strand and a second immobilised extended strand, as shown in
[0312] Binding of a first sequencing primer to the first sequencing primer-binding sequence will allow sequencing of read 1.1. As shown in
[0313] Binding of a second sequencing primer to the second sequencing primer-binding sequence will allow sequencing of read 1.2. As shown in
[0314] In one embodiment, binding of first sequencing primers to the first sequencing primer-binding sequence generates a first signal and binding of second sequencing primers to the second sequencing primer-binding sequence generates a second signal, where the intensity of the first signal is greater than the intensity of the second signal. This allows read 1.1 and 1.2 to be read simultaneously. This is achieved using a mixed population of blocked and unblocked second sequencing primers that bind the second sequencing primer-binding site. Any ratio of blocked:unblocked second primers can be used that generates a second signal that is of a lower intensity than the first signal, for example, the ratio of blocked:unblocked primers may be: 20:80 to 80:20, or 1:2 to 2:1. In one embodiment, a ratio of 50:50 of blocked:unblocked second primers is used, which in turn generates a second signal that is around 50% of the intensity of the first signal.
[0315] The first and second sequencing primers may be added to the flow cell at the same time, or separately but sequentially.
[0316] By blocked is meant that the sequencing primer comprises a blocking group at a 3 end of the sequencing primer. Suitable blocking groups include a hairpin loop (e.g. a polynucleotide attached to the 3-end, comprising in a 5 to 3 direction, a cleavable site such as a nucleotide comprising uracil, a loop portion, and a complement portion, wherein the complement portion is substantially complementary to all or a portion of the immobilised primer), a deoxynucleotide, a deoxyribonucleotide, a hydrogen atom instead of a 3-OH group, a phosphate group, a phosphorothioate group, a propyl spacer (e.g. O(CH.sub.2).sub.3OH instead of a 3-OH group), a modification blocking the 3-hydroxyl group (e.g. hydroxyl protecting groups, such as silyl ether groups (e.g. trimethylsilyl, triethylsilyl, triisopropylsilyl, t-butyl(dimethyl) silyl, t-butyl(diphenyl) silyl), ether groups (e.g. benzyl, allyl, t-butyl, methoxymethyl (MOM), 2-methoxyethoxymethyl (MEM), tetrahydropyranyl), or acyl groups (e.g. acetyl, benzoyl)), or an inverted nucleobase. However, the blocking group may be any modification that prevents extension (i.e. elongation) of the primer by a polymerase.
[0317] The sequence of the sequencing primers and the sequence primer binding sites are not material to the methods of the invention, as long as the sequencing primers are able to bind to the sequence primer-binding site to enable amplification and sequencing of the regions to be identified.
[0318] In summary, the above-described example would allow spatially separated clusters to be read in a temporally simultaneous manner through the generation of an optically unresolved signal that can be analytically separated using 16 QaM.
[0319] In a further embodiment, the method may additionally comprise generating a complement of the read 1 sequences (i.e. a complement of the halves the tandem insert shown in
[0320] Accordingly, in an alternative embodiment, the method of identifying a polynucleotide, comprises applying (i.e. adding/flowing over the surface of the solid support), a first restriction enzyme, wherein the restriction enzyme cleaves the first restriction site, wherein the first restriction site is in the loop sequence of the first adaptor. In one embodiment, following cleavage the sequences 3 of the cleaved sequence are de-hybridised and washed off.
[0321] In a further embodiment, the method comprises carrying out a first sequencing read to determine the sequence of the first and second immobilised strands simultaneously, such as by a sequencing-by-synthesis technique or by a sequencingby ligation technique.
Kits
[0322] In another aspect of the invention, there is provided a library preparation kit, wherein the kit comprises a plurality of first adaptors, a plurality of second adaptors. In one embodiment, the kits further comprises instructions for use. In a further embodiment, the kit may further comprise at least one single-stranded endonuclease or restriction endonuclease. In one aspect, the endonuclease is selected from Nt. BspQI, Cas9 D10A and Cas9 H840A.
[0323] In another embodiment, the kit may additionally comprise an agent for epigenetic conversion. For example, the agent for epigenetic conversion may be a conversion agent as described herein Non-limiting examples of conversion reagents include sulfites (e.g. bisulfite), cytidine deaminases (e.g. wild-type or mutant enzymes of the APOBEC family), and boron-based reducing agents (e.g. amine-borane compounds or azine-borane compounds, such as t-butylamine borane, ammonia borane, ethylenediamine borane, dimethylamine borane, pyridine borane and 2-picoline borane).
[0324] In another embodiment the kit may additionally comprise a uracil glycosylase or USER enzyme mix (which is a cocktail of uracil glycosylase and endonuclease VIII).
[0325] In another aspect of the invention there is provided a solid support comprising a plurality of a third and/or fourth primer immobilised thereon, as described above.
[0326] The terms about or approximate and the like are synonymous and are used to indicate that the value modified by the term has an understood range associated with it, where the range can be 20%, 15%, 10%, 5%, or 1%. The term substantially is used to indicate that a result (e.g., measurement value) is close to a targeted value, where close can mean, for example, the result is within 80% of the value, within 90% of the value, within 95% of the value, or within 99% of the value. The term partially is used to indicate that an effect is only in part or to a limited extent.
[0327] Unless otherwise explicitly stated, articles such as a or an should generally be interpreted to include one or more described items.
[0328] While the above detailed description has shown, described, and pointed out novel features as applied to illustrative embodiments, it will be understood that various omissions, substitutions, and changes in the form and details of the devices or algorithms illustrated can be made without departing from the spirit of the disclosure. As will be recognized, certain embodiments described herein can be embodied within a form that does not provide all of the features and benefits set forth herein, as some features can be used or practiced separately from others. All changes which come within the meaning and range of equivalency of the claims are to be embraced within their scope.
[0329] It should be appreciated that all combinations of the foregoing concepts (provided such concepts are not mutually inconsistent) are contemplated as being part of the inventive subject matter disclosed herein. In particular, all combinations of claimed subject matter appearing at the end of this disclosure are contemplated as being part of the inventive subject matter disclosed herein.
[0330] The present invention will now be described by way of the following non-limiting examples.
EXAMPLES
Example 1Mismatched Base Pair Analysis on NA12878 Sample Using 9 QaM
Oligo Sequences:
[0331] Asterisk (*) indicates a phosphorothioate linkage.
[0332] Bold indicates nicking restriction site (or its complement) of Nt.BspQI, which recognises the following sequence (nicking site is indicated by arrow):
TABLE-US-00001 5...GCTCTTCN.sup..Math....3 3...CGAGAAGN...5
[0333] [Biotin-T] indicates the following structure:
##STR00002##
TABLE-US-00002 P5_BbvCI_P7(SEQIDNO:7): GCTGAGGATCTCGTATGCCGTCTTCTGCTTGUAATGATACGGCGACCACC GAGATCTACACTCCTCAGC*T BspQI_iSce_Loop(SEQIDNO:8): GAAGAGCACACGTCTGAACTCCAGTCACTAGGGA[Biotin-T]AACAG GGTAATCTTTCCCTACACGACGCTCTTC*T
Adaptor Annealing:
[0334] 1. A mixture of 4 l of 100 M P5_BbvCI_P7 oligo, 11 l water, 2 l 10 TEN buffer (Illumina) and 3 l IDTE buffer was heated to 98 C for 30 s, then a slow cool to room temperature (eg. 0.1 C/s ramp down to RT). This gives a 20 M stock of annealed P5_BbvCI_P7 adaptor. [0335] 2. Separately, a mixture of 4 l of 100M BspQI_iSce_Loop oligo, 11 l water, 2 l 10 TEN buffer (Illumina) and 3 l IDTE buffer was heated to 98 C for 30 s, then a slow cool to room temperature (eg. 0.1 C/s ramp down to RT). This gives a 20 M stock of annealed BspQI_iSce_Loop adaptor. [0336] 3. Equal volumes of the 20 M stock of annealed P5_BbvCI_P7 adaptor from step 1 and 20 M stock of annealed BspQI_iSce_Loop adaptor from step 2 are mixed together, giving a stock solution with 10 M each of annealed P5_BbvCI_P7 adaptor and annealed BspQI_iSce_Loop adaptor.
Preparation of Library:
[0337] 1. NEB Ultra II FS reagents were thawed at room temperature and kept on ice until use. [0338] 2. The Ultra II FS Enzyme mix was vortexed for 5-8 seconds prior to use and placed on ice. [0339] 3. In a 0.2 ml PCR tube on ice, 26 l DNA (100 ng of input DNA (NA12878 sample) diluted to 26 l with Milli-Q grade water), 7 l of NEBNext Ultra II FS Reaction Buffer and 2 l of NEBNext Ultra II FS Enzyme Mix were added, briefly vortexed and spun in a microcentrifuge to mix. [0340] 4. In a Thermocycler with the heated lid set to 75 C, the tubes were incubated for 5 mins at 37 C, then 30 mins at 65 C then held at 4 C. [0341] 5. The following were added to the FS reaction mixture from step 4: 30 l of NEBNext Ultra II Ligation Master Mix, 1 l of NEBNext Ligation Enhancer and 2.5 l of the loop adaptors P5_BbvCI_P7 and BspQI_iSce_Loop (10 M each) prepared from step 3 of Adaptor annealing. [0342] 6. The entire volume was pipetted up and down 10 to mix, followed by a brief spin in a microcentrifuge. [0343] 7. The mixture was incubated at 20 C for 15 mins in a thermocycler with the heated lid off. [0344] 8. 3 l of USER Enzyme (NEB) was added to the ligation mix. [0345] 9. The mixture was mixed well and incubated at 37 C for 15 mins with the heated lid set to >47 C. [0346] 10. Adaptor ligated DNA was then size selected via a 0.8 SPRI (iTune beads) selection: 40 l iTune beads (ILMN) were added to 68.5 l of ligation reaction, mixed and incubated at RT for 5 mins. [0347] 11. The mixture was placed on a magnet for 5 mins, and the supernatant was discarded. [0348] 12. The beads were washed twice with 200 l of 80% ethanol-200 l 80% ethanol was added with beads on the magnet, followed by a 30 s wait, and ethanol was removed, then the wash was repeated once more. [0349] 13. The last remnants of ethanol were removed with a P10 pipette and tip. [0350] 14. Beads were then air dried for 5 mins. [0351] 15. DNA was eluted from beads with 40 l of 0.1 TE buffer. [0352] 16. A second size selection was conducted via another 0.8 SPRI (iTune beads) selection: 20 l iTune beads (ILMN) were added to 68.5 l of ligation reaction, mixed and incubated at RT for 5 mins. [0353] 17. The mixture was placed on a magnet for 5 mins, and the supernatant was discarded. [0354] 18. The beads were washed twice with 200 l of 80% ethanol-200 l 80% ethanol was added with beads on the magnet, followed by a 30 s wait, and ethanol was removed, then the wash was repeated once more. [0355] 19. The last remnants of ethanol were removed with a P10 pipette and tip. [0356] 20. Beads were then air dried for 5 mins. [0357] 21. DNA was eluted from beads with 15 l of 0.1 TE buffer, of which 7.5 l was taken forward to the next step. [0358] 22. 175 l of HT1 buffer (ILMN Hybridisation buffer) and 10 l of HT1 washed MyOne Streptavidin T1 beads (Thermofisher) were added. The tubes were incubated on a rocker at RT for 30 mins. (This step selects for material which has the biotinylated loop adaptor, and removes the material which has the P5/P7 adaptors on both ends). [0359] 23. The tubes were placed on a magnet until the beads pelleted. [0360] 24. The beads were washed twice with 200 l of Tagmentation Wash Buffer (TWB, Illumina). [0361] 25. The beads were then washed once with 200 l of Resuspension Buffer (RSB, Illumina). [0362] 26. The beads were resuspended in 20 l of Milli-Q grade water and transferred to 0.2 ml tubes for the final PCR. [0363] 27. 20 l of beads+DNA were combined with 25 l of Illumina Enhanced PCR Mix (EPM) and 5 l of PPC (PCR Primer Cocktail, Illumina). [0364] 28. The mixture was amplified by PCR: cycling procedure-98 C for 3 min followed by 12 cycles of (98 C 45 s, 60 C 2 min, 68 C 2 min), then 68 C for 5 mins and then hold at 4 C. [0365] 29. PCR products were analysed by TapeStation D1000 (Agilent), and then subjected to a further SPRI clean-up before quantification using a Qubit Broad Range dsDNA assay kit (Thermofisher).
Sequencing:
[0366] Sequencing was conducted on the MiniSeq. [0367] 1. 400 l BspQI mix was made up-360 l Milli-Q grade water, 40 l of rNEB3.1 buffer (NEB) and 8 l of Nt.BspQI (NEB were combined). The mixture was vortexed to mix and briefly spun down. The mixture was pipetted into the EXT position of the MiniSeq cartridge (position to the left of the Custom Primer positions). [0368] 2. The library was denatured (0.1N NaOH) and diluted to 0.5 pM final concentration in HT1 buffer according to Illumina protocol. 500 l was loaded into the Library position of the MiniSeq cartridge. [0369] 3. Setup was run using MiniSeq Control Software, using a standard MiniSeq run.
[0370] The 9 QaM results are shown in
[0371] Overall, these results show that analysis can be conducted on polynucleotide sequences to identify mismatched base pairs. In particular, by enabling concurrent sequencing of the forward and reverse complement strands of the template (or reverse and forward complement strands of the template), mismatched base pairs can be identified quickly and accurately. Such a process is made viable by using the methods of preparing polynucleotide libraries as described herein.
Example 2Methylation Analysis on Methylated pUC19 Sample Using 9 QaM
Oligo Sequences:
[0372] Asterisk (*) indicates a phosphorothioate linkage.
[0373] Underline indicates 5-methylcytosine instead of cytosine (in P5_BbvCI_P7-methylated and BspQI_iSce_Loop-methylated, all cytosines are replaced with 5-methylcytosines to prevent unwanted conversion of cytosine to uracil in the adaptor sequence during bisulfite conversion).
[0374] Bold indicates nicking restriction site (or its complement) of Nt.BspQI, which recognises the following sequence (nicking site is indicated by arrow):
TABLE-US-00003 5...GCTCTTCN.sup..Math....3 3...CGAGAAGN...5
[0375] [Biotin-T] indicates the following structure:
##STR00003##
TABLE-US-00004 P5_BbvCI_P7(SEQIDNO:7): GCTGAGGATCTCGTATGCCGTCTTCTGCTTGUAATGATACGGCGACCACC GAGATCTACACTCCTCAGC*T BspQI_iSce_Loop(SEQIDNO:8): GAAGAGCACACGTCTGAACTCCAGTCACTAGGGA[Biotin-T]AACAGG GTAATCTTTCCCTACACGACGCTCTTC*T P5_BbvCI_P7-methylated(SEQIDNO:9): GCTGAGGATCTCGTATGCCGTCTTCTGCTTGUAATGATACGGCGACCACC GAGATCTACACTCCTCAGC*T BspQI_iSce_Loop-methylated(SEQIDNO:10): GAAGAGCACACGTCTGAACTCCAGTCACTAGGGA[Biotin-T]AACAGG GTAATCTTTCCCTACACGACGCTCTTC*T
Adaptor Annealing:
[0376] 1. A mixture of 4 l of 100 M P5_BbvCI_P7-methylated oligo, 11 l water, 2 l 10 TEN buffer (Illumina) and 3 l IDTE buffer was heated to 98 C for 30 s, then a slow cool to room temperature (eg. 0.1 C/s ramp down to RT). This gives a 20 M stock of annealed P5_BbvCI_P7-methylated adaptor. [0377] 2. Separately, a mixture of 4 l of 100 M BspQI_iSce_Loop-methylated oligo, 11 l water, 2 l 10 TEN buffer (Illumina) and 3 l IDTE buffer was heated to 98 C for 30 s, then a slow cool to room temperature (eg. 0.1 C/s ramp down to RT). This gives a 20 M stock of annealed BspQI_iSce_Loop-methylated adaptor. [0378] 3. Equal volumes of the 20 M stock of annealed P5_BbvCI_P7-methylated adaptor from step 1 and 20 M stock of annealed BspQI_iSce_Loop-methylated adaptor from step 2 are mixed together, giving a stock solution with 10 M each of annealed P5_BbvCI_P7-methylated adaptor and annealed BspQI_iSce_Loop-methylated adaptor.
Preparation of Library:
[0379] 1. NEB Ultra II FS reagents were thawed at room temperature and kept on ice until use. [0380] 2. The Ultra II FS Enzyme mix was vortexed for 5-8 seconds prior to use and placed on ice. [0381] 3. In a 0.2 ml PCR tube on ice, 26 l DNA (100 ng of input DNA (methylated pUC19 sample) diluted to 26 l with Milli-Q grade water), 7 l of NEBNext Ultra II FS Reaction Buffer and 2 l of NEBNext Ultra II FS Enzyme Mix were added, briefly vortexed and spun in a microcentrifuge to mix. [0382] 4. In a Thermocycler with the heated lid set to 75 C, the tubes were incubated for 5 mins at 37 C, then 30 mins at 65 C then held at 4 C. [0383] 5. The following were added to the FS reaction mixture from step 4: 30 l of NEBNext Ultra II Ligation Master Mix, 1 l of NEBNext Ligation Enhancer and 2.5 l of the loop adaptors P5_BbvCI_P7-methylated and BspQI_iSce_Loop-methylated (10 M each) prepared from step 3 of Adaptor annealing. [0384] 6. The entire volume was pipetted up and down 10 to mix, followed by a brief spin in a microcentrifuge. [0385] 7. The mixture was incubated at 20 C for 15 mins in a thermocycler with the heated lid off. [0386] 8. 3 l of USER Enzyme (NEB) was added to the ligation mix. [0387] 9. The mixture was mixed well and incubated at 37 C for 15 mins with the heated lid set to >47 C. [0388] 10. Adaptor ligated DNA was then size selected via a 0.8 SPRI (iTune beads) selection: 57 l iTune beads (ILMN) were added to 68.5 l of ligation reaction, mixed and incubated at RT for 5 mins. [0389] 11. The mixture was placed on a magnet for 5 mins, and the supernatant was discarded. [0390] 12. The beads were washed twice with 200 l of 80% ethanol-200 l 80% ethanol was added with beads on the magnet, followed by a 30 s wait, and ethanol was removed, then the wash was repeated once more. [0391] 13. The last remnants of ethanol were removed with a P10 pipette and tip. [0392] 14. Beads were then air dried for 5 mins. [0393] 15. DNA was eluted from beads with 40 l of 0.1 TE buffer. At this stage, 20 l was saved as a non-converted control, the remaining 20 l was treated to bisulfite conversion, following the Zymo Research EZ-96 DNA Methylation Gold MagPrep kit (steps 16-25 are taken from the instructions for this kit). [0394] 16. In a 0.2 ml PCR tube, 20 l of 0.8 SPRI selected ligation and 130 l of CT Conversion Reagent (comprises sodium metabisulfite) were added. [0395] 17. The mixture was incubated on a thermocycler at 98 C for 10 mins, then 64 C for 2.5 hours, followed by holding at 4 C for up to 20 hours. [0396] 18. The sample was transferred to 1.7 ml tubes for subsequent steps. 600 l of M-Binding Buffer and 10 l of MagBinding Beads were added. The mixture was vortexed for 30 s. [0397] 19. Incubate at RT for 5 mins, then place on a magnet for 5 mins. [0398] 20. The supernatant was removed and discarded. 400 l of M-Wash buffer was added to the beads, and then vortexed for 30 s. The mixture was placed back on magnet until the beads pelleted. [0399] 21. The supernatant was removed and discarded. [0400] 22. 200 l of M-Desulphonation Buffer was added to the beads, and then vortexed for 30 s. The mixture was incubated at RT for 15-20 mins. The mixture was then placed back on magnet until beads pelleted. [0401] 23. The supernatant was removed and discarded. 400 l of M-Wash buffer was added to the beads, then vortexed for 30 s. The mixture was placed back on magnet until beads pelleted. This wash step was repeated once. [0402] 24. The supernatant after 2nd wash was removed, and the tubes were transferred to a hot block at 55 C to air dry the beads for 20-30 mins and remove residual M-Wash buffer. [0403] 25. 25 l of M-Elution Buffer was added to the dried beads and vortexed for 30 s. The elution mixture was heated at 55 C for 4 mins then the tubes were placed back on the magnet for 1 min (or until the beads pelleted). The eluate was removed and transferred to a new 1.7 ml tube. [0404] 26. 175 l of HT1 buffer (ILMN Hybridisation buffer) and 10 l of HT1 washed MyOne Streptavidin T1 beads (Thermofisher) were added. The tubes were incubated on a rocker at RT for 30 mins. (This step selects for material which has the biotinylated loop adaptor, and removes the material which has the P5/P7 adaptors on both ends). [0405] 27. The tubes were placed on a magnet until the beads pelleted. [0406] 28. The beads were washed twice with 200 l of Tagmentation Wash Buffer (TWB, Illumina). [0407] 29. The beads were then washed once with 200 l of Resuspension Buffer (RSB, Illumina). [0408] 30. The beads were resuspended in 20 l of Milli-Q grade water and transferred to 0.2 ml tubes for the final PCR. [0409] 31. 20 l of beads+DNA were combined with 25 l of Q5U Mastermix (NEB) and 5 l of PPC (PCR Primer Cocktail, Illumina). [0410] 32. The mixture was amplified by PCR: cycling procedure-98 C for 3 min followed by 12 cycles of (98 C 45 s, 60 C 2 min, 68 C 2 min), then 68 C for 5 mins and then hold at 4 C. [0411] 33. PCR products were analysed by TapeStation D1000 (Agilent), and then subjected to a further SPRI clean-up before quantification using a Qubit Broad Range dsDNA assay kit (Thermofisher).
Sequencing:
[0412] Sequencing was conducted on the MiniSeq. [0413] 1. 400 l BspQI mix was made up-360 l Milli-Q grade water, 40 l of rNEB3.1 buffer (NEB) and 8 l of Nt.BspQI (NEB were combined). The mixture was vortexed to mix and briefly spun down. The mixture was pipetted into the EXT position of the MiniSeq cartridge (position to the left of the Custom Primer positions). [0414] 2. The library was denatured (0.1N NaOH) and diluted to 0.5 pM final concentration in HT1 buffer according to Illumina protocol. 500 l was loaded into the Library position of the MiniSeq cartridge. [0415] 3. Setup was run using MiniSeq Control Software, using a standard MiniSeq run. [0416] 4. For a CA dye swap, standard IMX was removed from the IMX position of the MiniSeq cartridge, then the position was washed 5 times with Milli-Q grade water, and replaced with 20 mls of custom IMX, where the standard two-dye system for A (A represented by red and green) and one-dye system for C (C represented by red) is replaced with a two-dye system for C (C represented by red and green) and one-dye system for A (A represented by red).
[0417] The 9 QaM results are shown in
[0418] In addition, if the original strands in the library contained a G-(5mC) base pair (the first base corresponding to the forward strand of the library polynucleotide, and the second base corresponding to the reverse strand of the library polynucleotide), this corresponds to a G-C base pair after bisulfite conversion. As such, the forward strand of the template provides a G read (as the forward strand of the template has a C at the corresponding position), and the reverse complement strand of the template provides a G read too (as the reverse complement strand of the template has a C at the corresponding position too), which therefore appears in the bottom left corner of the plots in
[0419] By contrast, if the original strands in the library contained a C-G base pair (the first base corresponding to the forward strand of the library polynucleotide, and the second base corresponding to the reverse strand of the library polynucleotide), this corresponds to a T-G mismatched base pair after bisulfite conversion (where C is converted to U, and U is read as T). As such, the forward strand of the template provides a T read (as the forward strand of the template has an A at the corresponding position), and the reverse complement strand of the template provides a C read (as the reverse complement strand of the template has a G at the corresponding position), which therefore appears in the top middle portion of the plots in
[0420] If the original strands in the library contained a G-C base pair (the first base corresponding to the forward strand of the library polynucleotide, and the second base corresponding to the reverse strand of the library polynucleotide), this corresponds to a G-T mismatched base pair after bisulfite conversion (where C is converted to U, and U is read as T). As such, the forward strand of the template provides a G read (as the forward strand of the template has a C at the corresponding position), and the reverse complement strand of the template provides an A read (as the reverse complement strand of the template has a T at the corresponding position), which therefore appears in the bottom middle portion of the plots in
[0421] If the original strands in the library contained a T-A base pair (the first base corresponding to the forward strand of the library polynucleotide, and the second base corresponding to the reverse strand of the library polynucleotide), this remains as a T-A base pair after bisulfite conversion. As such, the forward strand of the template provides a T read (as the forward strand of the template has an A at the corresponding position), and the reverse complement strand of the template provides a T read too (as the reverse complement strand of the template has an A at the corresponding position too), which therefore appears in the top left corner of the plots in
[0422] Finally, if the original strands in the library contained an A-T base pair (the first base corresponding to the forward strand of the library polynucleotide, and the second base corresponding to the reverse strand of the library polynucleotide), this remains as an A-T base pair after bisulfite conversion. As such, the forward strand of the template provides an A read (as the forward strand of the template has a T at the corresponding position), and the reverse complement strand of the template provides an A read too (as the reverse complement strand of the template has a T at the corresponding position too), which therefore appears in the bottom right corner of the plots in
TABLE-US-00005 Library Accuracy Sensitivity Specificity Library fragment 1 85/85 (100%) 10/10 (100%) 75/75 (100%) (FIG. 23A) Library fragment 2 72/72 (100%) 10/10 (100%) 62/62 (100%) (FIG. 23B) Library fragment 3 73/73 (100%) 10/10 (100%) 63/63 (100%) (FIG. 23C) Library fragment 4 148/150 (98.67%) 17/18 (94.44%) 133/133 (100%) (FIG. 23D) Library fragment 5 148/150 (98.67%) 14/14 (100%) 136/136 (100%) (FIG. 23E) Library fragment 6 147/150 (98%) 14/14 (100%) 136/136 (100%) (FIG. 23F) (Accuracy = number of correct base calls (GCAT, irrespective of methylation status)/total number of bases; Sensitivity = number of true positive methylated base calls/total number of methylated bases; Specificity = number of true negative methylated base calls/(number of true negative methylated base calls + number of false positive methylated base calls))
[0423] Overall, these results show that methylation analysis can be conducted on polynucleotide sequences to identify modified cytosines. In particular, by enabling concurrent sequencing of the forward and reverse complement strands of the template (or reverse and forward complement strands of the template), modified cytosines can be identified quickly and accurately. Again, such a process is made viable by using the methods of preparing polynucleotide libraries as described herein.
TABLE-US-00006 SEQUENCELISTING SEQIDNO:1:P5sequence AATGATACGGCGACCACCGAGATCTACAC SEQIDNO:2:P7sequence CAAGCAGAAGACGGCATACGAGAT SEQIDNO:3:P5sequence(complementarytoP5) GTGTAGATCTCGGTGGTCGCCGTATCATT SEQIDNO:4:P7sequence(complementarytoP7) ATCTCGTATGCCGTCTTCTGCTTG SEQIDNO:5:AlternativeP5sequence AATGATACGGCGACCGA SEQIDNO:6:AlternativeP5sequence (complementarytoalternativeP5sequence) TCGGTCGCCGTATCATT