Suppression of Diseases and Abiotic Stress in Rice and Other Plants by Treatment with Avirulent Burkholderia glumae
20250040500 ยท 2025-02-06
Assignee
Inventors
Cpc classification
C12R2001/01
CHEMISTRY; METALLURGY
International classification
Abstract
The avirulent strain A257 of the bacterial rice pathogen Burkholderia glumae is an effective priming material to reduce or suppress major diseases in rice and other plants. Protection includes that against bacterial panicle blight, sheath blight, and narrow brown leaf spot. A mutant derivative of A257, A257qsmR, significantly reduces the risk that the priming agent might potentially revert to wild-type pathogenicity.
Claims
1. A strain of Burkholderia glumae, wherein said strain is an A257-derived strain in which the qsmR gene has been artificially deleted or otherwise artificially inactivated.
2. The strain of claim 1, wherein said strain is the strain A257qsmR.
3. The strain of claim 1, wherein the qsmR gene has been artificially deleted.
4. The strain of claim 1, wherein the qsmR gene has been artificially inactivated.
5. A method for enhancing the resistance of rice plants to disease or abiotic stress, said method comprising treating rice plants or rice seeds with the strain of claim 1, or with Burkholderia glumae strain A257.
6. The method of claim 5, wherein the strain is the strain A257.
7. The method of claim 5, wherein the strain is the strain A257qsmR.
8. The method of claim 5, wherein said treating step comprises spraying leaves of rice plants.
9. The method of claim 5, wherein said treating step comprises inoculating rice seeds.
10. The method of claim 5, wherein said method enhances the resistance of rice plants against the disease bacterial panicle blight.
11. The method of claim 5, wherein said method enhances the resistance of rice plants against the disease sheath blight.
12. The method of claim 5, wherein said method enhances the resistance of rice plants against the disease narrow brown leaf spot.
13. The method of claim 5, wherein said method enhances the resistance of rice plants against the disease kernel smut.
14. The method of claim 5, wherein said method enhances the resistance of rice plants against the disease false smut.
15. The method of claim 5, wherein said method enhances the resistance of rice plants against the disease blast.
16. The method of claim 5, wherein said method additionally enhances the resistance of rice plants against damage by insects.
17. The method of claim 5, wherein said method enhances the resistance of rice plants to drought.
18. A method for enhancing the resistance of plants to disease or abiotic stress, said method comprising treating plants or seeds with the strain of claim 1, or with Burkholderia glumae strain A257.
19. The method of claim 18, wherein the plants or seeds are soybeans.
20. The method of claim 18, wherein the plants or seeds are selected from the group consisting of maize, wheat, cotton, tomato, and pepper.
21. The method of claim 18, wherein the strain is the strain A257qsmR.
22. The method of claim 18, wherein the strain is the strain A257.
23. A composition of matter comprising rice seeds, maize seeds, wheat seeds, cotton seeds, soybean seeds, tomato seeds, or pepper seeds inoculated with the strain of claim 1.
24. The composition of claim 23, wherein said seeds comprise rice seeds inoculated with the strain of claim 1.
25. The composition of claim 23, wherein said seeds comprise soybean seeds inoculated with the strain of claim 1.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
MODES FOR CARRYING OUT THE INVENTION
[0032] In some embodiments, the strain A257 is used as a biological agent to suppress ShB and BPB disease severity in rice, without negative side-effects on overall plant growth and yield. Routes of application may be any of those known in the art, including for example foliar spraying or seed treatment. Results have shown that A257 treatment (by foliar spray or seed treatment) is effective to induce defense-priming in rice plants, so that they elicit more robust defense responses (e.g., expression of defense related genes and enzymes) upon pathogen attack.
[0033] For a BPB experiment conducted in 2020, A257 was applied as spray treatment to the rice varieties Bengal and CL111 one day before inoculation with a virulent strain of B. glumae. The rice plants that had been treated with A257 one day before inoculation showed significantly reduced disease symptoms as compared to untreated plants. Similar results were seen in 2021, when plants sprayed with A257 either one day before or one day after inoculation showed significantly lower disease rates as compared to untreated plants. In 2020 and 2021 field trials, the application of A257, whether as a foliar spray treatment alone or in combination with seed treatment, did not significantly affect yields. In 2020, Bengal plants that had been sprayed with A257 one day before inoculation with B. glumae showed a significantly higher yield as compared to untreated plants. Although the results were not statistically significant, CL111 plants pre-treated with A257 had higher yields compared to untreated plants in 2021 trials.
[0034] The efficacy of A257 as a seed treatment against ShB was evaluated in both greenhouse and field trials in 2021 and 2022. In these trials, rice plants grown from seeds treated with A257 showed significantly lower disease severity as compared to plants without seed treatment. In 2022, disease severity was scored separately for the sheath and panicle components. Even though the sheaths of the A257 seed-treated rice plants showed apparently lower disease scores, the scores were not statistically different as compared to the untreated plants. However, the panicles of the same plants showed a visually obvious and statistically significant difference; the A257 seed-treated plants exhibited lower panicle disease symptoms compared with the untreated plants.
[0035] Surprisingly, seed treatment with A257 also substantially reduced disease severity from natural NBLS infections during the 2021 growing season, when that fungal disease was prevalent in Louisiana rice fields. The experimental observations showed that A257 seed treatment can protect rice plants against a broad range of fungal pathogens responsible for major rice diseases throughout the growth cycle, from the early vegetative stage to the late reproductive stage of growth.
[0036] I hypothesize that defense-priming mediated by A257 will also be effective against one or more additional rice diseases (e.g., blast) and against insect damage (e.g., from rice water weevils and stemborers). I further hypothesize that A257 will also be effective to protect plants from abiotic stresses, such as drought. I further hypothesize that defense-priming mediated by A257 will also be effective in other crops, e.g., maize, wheat, and soybeans. Future greenhouse and field experiments, otherwise generally similar to those described herein, will be conducted to verify these hypothesesPreliminary results from 2023 field trials with A257 seed treatments on soybeans appeared to show success in field trials against two fungal diseases, Cercospora leaf blight and Septoria brown spot (data not shown).
[0037] A preferred strain for use in this invention is A257qsmR. This invention may also be practiced with other A257 variants in which the qsmR gene has been artificially deleted or otherwise artificially inactivated through methods known in the art, preferably with methods that minimize the likelihood of spontaneous reversion to a virulent genotype/phenotype. Other strains of the rice pathogen Burkholderia glumae may also be used in practicing this invention, wherein the qsmR gene has been artificially deleted or otherwise artificially inactivated through methods known in the art, preferably with methods that minimize the likelihood of spontaneous reversion to a virulent genotype/phenotype.
[0038] As used herein artificially deleted or otherwise artificially inactivated refers to a process, method, gene, nucleic acid, or strain in which direct or indirect human intervention has induced the deletion or inactivation of a gene or other nucleic acid sequence. The term artificially deleted or otherwise artificially inactivated is specifically intended to exclude products of nature. As two examples: (1) The strain A257 was originally discovered occurring naturally in a rice field. The unmodified strain A257 would not itself be considered to contain a gene that had been artificially deleted or otherwise artificially inactivated. (2) By contrast, the strain A257qsmR was intentionally designed and artificially prepared in the laboratory using molecular techniques to remove the qsmR gene from the genome. The resulting A257qsmR strain is therefore considered to be a strain in which the qsmR gene has been artificially deleted or otherwise artificially inactivated.
Materials and Methods
Rice Cultivars
[0039] Two rice (Oryza sativa) varieties, CL111 and Bengal, were used in various experiments in 2020, 2021, and 2022. Both of these varieties are susceptible both to bacterial panicle blight (BPB) and to sheath blight (ShB). CL111 is a very early, short-stature, long-grain, herbicide-tolerant (Clearfield) variety. Bengal is an early-maturing, semidwarf, medium-grain, conventional (non-herbicide-tolerant) variety. The rice seeds were obtained from the LSU AgCenter H. Rouse Caffey Rice Research Station (HRCRRS), where both of these varieties had initially been developed.
Bacterial Strains and Culture Conditions
[0040] A257 and A257qsmR cultures were stored at 80 C. until used. After thawing, the strains were first grown on LB agar at 37 C. The bacterial cells were then inoculated in LB broth or LB agar for preparation of a cell suspension.
Foliar Spraying with A257
[0041] In 2020 and 2021 field studies, A257 was tested for its efficacy in suppressing BPB by foliar spraying on rice panicles, prior to pathogen inoculation. The A257 strain was grown overnight on LB agar plates at 37 C. A bacterial suspension at a concentration of OD.sub.600=0.2 (1.010.sup.8 CFU/mL) was prepared by collecting the cell culture from LB agar plates and suspending it in 1 L of 10 mM MgCl.sub.2 buffer. Then Tween 20 was added to the inoculum suspension at a 0.2% concentration (v/v). The suspension was then applied to Bengal and CL111 rice plants one day before or after the plants were inoculated with the pathogenic strain Burkholderia glumae 336 gr-1.
Bio-Priming of Rice Seeds with A257
[0042] In 2021 and 2022, A257 was evaluated in field trials with rice variety CL111. Its disease-suppressing (defense-priming) efficacy against BPB and ShB was assessed.
[0043] Prior to treatment with A257, the CL111 seeds were surface-sterilized by: soaking in 95% ethanol for 3-5 min, rinsing with sterile distilled water 5 times, soaking in 3% hydrogen peroxide for 30 sec, and a final rinsing with sterile distilled water 5 times. The surface-sterilized seeds were then air-dried for 30 min. For the seed treatment preparation, the A257 strain was initially grown on a freshly prepared LB agar plate for 24 h. Then a loopful of the grown bacteria was transferred to sterilized LB broth and incubated overnight in a shaking incubator at 37 C. at 190 rpm. Following incubation, the culture was resuspended in 10 mM MgCl.sub.2 buffer, adjusting the final concentration to OD.sub.600=2 (10.sup.9 CFU/ml). The surface-sterilized seeds were soaked in the bacterial suspension for 1 hour. The soaked seeds were air-dried for 1-4 days. The seed drying step helps prevent pre-germination. The treated seeds are ready to be planted once they are dried. The same procedure, using the 10 mM MgCl.sub.2 buffer alone, was used as a negative control. The same procedure was used for both the A257 and A257qsmR strains.
[0044] The elapsed interval between seed treatment and planting depended on the weather. At times when it was impractical to plant seeds immediately following overnight drying, the seeds were kept on a laboratory bench for 4 days to dry and inhibit possible decay. In the 2021 field study, all treated rice seeds were planted in the field 32 days after a 4-day drying period.
[0045] In 2022, the same seed treatments were again used with CL111 rice seeds. The A257-treated and -untreated seeds (control) were planted in the field 8 days after a 4-day dying period. Greenhouse tests were conducted with the seeds after overnight drying.
Inoculum Preparation and Inoculation
[0046] A pure culture of overnight-grown B. glumae 336 gr-1 (a virulent strain) was used to inoculate CL111 and Bengal rice plants in the field in 2020. Two inoculation methods were used. For the CL111 variety, a pathogen inoculum suspension at a concentration of OD.sub.600=0.1 (0.510.sup.8 CFU/ml) was sprayed onto plants at the 30% heading stage. Each plot (1.2 m4.3 m) was sprayed with approximately 500 mL of the B. glumae suspension. The same concentration of the inoculum was applied to rice plants of Bengal variety during the booting stage using a metal brush dipped in the inoculum suspension. These plants were wounded from the stem through the tip of the leaves. Uninoculated plants of CL111 and Bengal varieties were used as controls.
[0047] For sheath blight testing, an inoculum of the fungal pathogen Rhizoctonia solani was prepared according to the method of Shrestha, B. K., Karki et al. (2016). Biological Control Activities of Rice-Associated Bacillus sp Strains against Sheath Blight and Bacterial Panicle Blight of Rice. PLOS One, 11 (1). Briefly, a pure culture of R. solani was initially grown on potato dextrose agar (PDA) plates for 7 days at 30 C. The PDA culture was then added to a rice hull medium. To prepare the rice hull medium, 1.5 L of a 1:2 (v/v) rice grain:hull mixture was saturated with tap water in a 2 L flask, and the mixture was autoclaved at 15 psi for 30 min at 121 C. The sterilized rice hull medium in a 2 L-flask was then mixed with a 16 cm.sup.2 PDA plug containing 7-day old R. solani mycelia, followed by incubation at 25 C. for 10 days. After ten days, 1-2 volume of a new sterilized rice grain:hull (1:2 v/v) mixture was added to the culture, and the culture was then spread uniformly over a clean brown paper and covered with a clean plastic sheet at room temperature. This culture was then used for field inoculation after 24 h incubation. The inoculum of R. solani was applied by hand, sprinkling it near the base of the rice plants at the tillering stage of growth. For greenhouse tests, PDA plugs 1 cm.sup.2 from a 7-day old R. solani culture were attached to the rice sheath, and wrapped with a piece of aluminum foil. Then the inoculated plants were kept in a humid chamber in a greenhouse for 48 hours.
Field Experiments
[0048] The defense-priming efficacy of A257 against ShB and BPB was evaluated as a foliar spray or a seed treatment for three consecutive years (2020-2022) in field trials at the H. Rouse Caffey Rice Research Station (Rayne, LA). The field trials were arranged in a randomized complete block design with 4 replications/blocks per treatment. Each plot measured 1.2 m4.3 m. 70 grams of seeds were drill-seeded in each plot. The design of these trials is summarized in Table 1.
TABLE-US-00001 TABLE 1 Overview of Field Trials 2020-2022. Application (Days after Year Activity sowing (DAS)) 2020 Fertilization (Pre-flooding) 49 DAS Herbicide applications 21, 28, 48, and 85 DAS Insecticide Seed-treatment 2021 Fertilization (Pre-flooding) 52 DAS Herbicide applications 23 and 52 DAS Insecticide 1 DAS 2022 Fertilization (Pre-flooding) 37 DAS Herbicide applications 2 and 24 DAS Insecticide Seed-treatment
Disease Severity Assessment
[0049] For BPB, disease severity was scored for the same two cultivars from one to three weeks after pathogen inoculation, using the 0-9 scale of Shahjahan, A. et al. (2000). Panicle blight. Rice J, 15, 26-29; in which 0=no symptoms, 1=spikelet discoloration limited to of the panicle, 3=spikelet discoloration limited to of the panicle, 5=spikelet discoloration more than of the panicle, 7=spikelet discoloration 75% of the panicle, and 9=spikelet discoloration more than 90% of the panicle, erected and unfilled panicle. Disease severity data were collected every week following inoculation. Thus in each plot disease scores were recorded four times. The disease severity score was calculated as the mean score per panicle.
[0050] For assessing ShB disease severity, symptoms were evaluated beginning one to three weeks after inoculation and continuing until maturity, using the 0-9 scale in which 0=no disease symptoms, 1=<1% sheath area affected, 3=1-5% sheath area affected, 5=6-25% sheath area affected, 7=26-50% sheath area affected, and 9=51-100% sheath area affected, per IRRI (2002). Standard Evaluation System for Rice. International Rice Research Institute, Manila, Philippines. Disease severity data were collected every week. Thus four disease scores were recorded for each plot. The disease severity score was calculated as the mean score per plant.
[0051] Disease severity data for greenhouse experiments were gathered using the same disease scoring systems.
Statistical Design and Analysis
[0052] The field experiments were arranged in a randomized complete block design, with 4 replications/blocks per treatment. Greenhouse experiments were arranged in a complete randomized design, with three replications per treatment.
[0053] Comparisons of mean disease severity and yield data were analyzed either by T-test or Analysis of Variance (ANOVA). Post-hoc testing was done using Tukey's HSD at a significance level of 0.05. All data were statistically analyzed in R, and the figures were generated with ggplot2.
Deletion of the qsmR Gene from the Strain A257 to Generate the Mutant Strain A257qsmR
[0054] To minimize the risk of reversion to a wild-type, virulent phenotype, I designed a variant of the A257 strain in which the qsmR gene had been deleted. The qsmR deletion mutant A257qsmR was generated through double-crossover homologous recombination in the flanking regions of the qsmR gene. The genomes of three virulent strains and of the 257-sh1 (=A257) nonpathogenic strain of B. glumae are reported in Lee, H. H et al. (2021). Complete Genome Sequence Data of Four Burkholderia glumae Strains Isolated from Rice Fields in the United States. Mol Plant Microbe Interact, 34 (11), 1324-1327.
[0055] A DNA construct used for deletion of qsmR, pKKSacBqsmR, was prepared. A 458-bp upstream region and a 469-bp downstream region were amplified with the primer sets qsmrBamHIUL/qsmrSpeIUR and qsmrSpeIDL/qsmrXbaIIDR1 (Table 2). The resulting upstream and downstream PCR products were then cloned into the plasmid pSC-A-amp/kan to generate pSCqsmRU and pSCqsmRD, respectively. The upstream region in pSCqsmRU was further cloned into pKKSacB using the BamHI and SpeI restriction sites to generate pKKqsmRU. The qsmR downstream region in pSCqsmRD was cloned into pKKqsmRU using the SpeI and Xba/I restriction sites to obtain pKKSacBqsmR. This DNA construct was transformed into E. coli S17-1pir through electroporation, and then introduced into B. glumae A257 via triparental mating, using the helper strain E. coli HB101 (pRK2013:Tn7). After this transformation step to introduce pKKSacBqsmRD into A257 cells, the qsmR deletion mutant derivative of A257, A257qsmR, was obtained through selection using kanamycin resistance and sucrose sensitivity marker genes. The complete deletion of the qsmR gene was confirmed by PCR using the primer set qsmrDLcheckF and qsmrDLcheckR (Table 2).
[0056] Essentially the same procedures may also be employed to generate qsmR deletion mutants of other B. glumae strains, which then may also be used in practicing this invention.
TABLE-US-00002 TABLE2 DNAprimersusedfortheDNAconstruct (pKKSacBqsmR)togenerateaqsmRdeletionmutant ofA257. Name Sequence(5-3) SEQIDNO qsmrBamHIUL GGATCCGGGATCCGTCGATTT SEQIDNO1 CATCGCCAATTT qsmrSpeIUR ACTAGTGGGACTAGTCGGTCG SEQIDNO2 CTGCTTTATTCAGT qsmrSpeIDL ACTAGTGGGACTAGTGAATGG SEQIDNO3 CTGCTCGAGACT qsmrXbaIIDR1 TCTAGAGGGTCTAGATCATGT SEQIDNO4 TCGATCTGGCTGAC qsmrDLcheckF CGTGCTAGAACCTGAGAGAC SEQIDNO5 qsmrDLcheckR ATCGTCCAGAGCACTTTCT SEQIDNO6
Results
Effects of A257 Treatment on BPB
2020 Data on BPB (Effects of A257 Foliar Spray)
[0057] The symptoms of bacterial panicle blight disease, such as panicle discoloration and unfilled grains, are typically observed around 21 days post-inoculation (dpi). The application of A257 by foliar spraying, one day before pathogen inoculation, resulted in significantly lower disease severity for treated plants as compared to untreated plants, for both the Bengal and CL111 varieties. See
[0058] Plants that had been treated with A257 by foliar spraying showed clean panicles, similar in appearance to those of uninoculated rice plants. By contrast, untreated plants inoculated with the pathogen exhibited BPB symptoms such as discolored grains, erected and mostly unfilled panicles.
[0059] In these trials, the foliar application of A257 appeared to provide greater benefit to Bengal than to CL111. The Bengal variety treated with A257 showed significantly higher yield (9182 kilograms per hectare, kg/ha) compared to that for untreated (control) plants (6890 kg/ha). See
[0060]
2021 Data on BPB (Effects of Foliar Spraying, and Effects of Foliar Spraying Plus Seed Treatment)
[0061] In 2021, the effects of A257 on BPB disease under field conditions were investigated following foliar-only spraying, or following a combination of foliar spraying plus seed treatment. In 2021, disease pressure from BPB in the field was low overall. Applying A257 as a foliar spray alone (
Effects of A257 Treatment on ShB
[0062] The effects of A257 seed treatment in suppressing sheath blight were evaluated in 2021 and 2022, under both greenhouse and field conditions. As with the bacterial panicle blight experiments, these experiments were conducted in the greenhouses and rice fields of the H. Rouse Caffey Rice Research Station (Rayne, Louisiana). The CL111 rice variety was used for the field trials, and the Bengal variety was used for the greenhouse experiments.
[0063] In the greenhouse trials, the seed-treated plants exhibited significantly lower ShB disease severity as compared to the untreated control plants (
[0064] Similar to the findings of the greenhouse trial, the A257 seed-treated plants in the field also showed significantly lower disease severity as compared to untreated plants 5 weeks after inoculation (
[0065] In 2022, a field trial was conducted at the H. Rouse Caffey Rice Research Station to evaluate the efficacy of A257 seed treatment against ShB disease. We observed that the A257 seed-treated plants exhibited lower disease symptoms. However, the differences in disease severity on rice sheaths was not statistically significant. (
[0066] Unfortunately, we did not obtain reliable yield data for the 2022 field trials, due to an error in plot identification while operating the harvesting machine.
Effect of A257 Seed Treatment on Narrow Brown Leaf Spot (NBLS) Disease
[0067] In 2021 there was an unexpectedly severe outbreak of NBLS at the H. Rouse Caffey Rice Research Station test plots. NBLS is a chronic rice disease worldwide, and is becoming more serious in the southeastern U.S. NBLS is caused by the fungal pathogen Cercospora janseana. Surprisingly, the A257-treated CL111 rice plants suffered much less damage from the 2021 NBLS epidemic as compared to untreated plants.
Generation of a Mutant Derivative of A257 Lacking the qsmR Gene
[0068] Genetic analysis of A257 revealed a variation in the qsmR gene thought to be of particular significance. The qsmR gene is a key regulatory gene in B. glumae that is essential for pathogenesis. A single point mutation in the qsmR gene is believed to be responsible for the avirulence phenotype in the A257 strain, a mutation resulting in the substitution of threonine with lysine at position 50. (See priority application Ser. No. 63/530,287, FIG. 10 and the accompanying text.) However, the phenotype reverted to strong virulence if a copy of the qsmR gene from the virulent strain 336 gr-1 was introduced into A257. These observations suggest that simply applying the unmodified A257 strain to rice seeds runs the risk of possible spontaneous reversion to wild-type virulence, with only a single nucleotide shift. To substantially reduce the likelihood of such spontaneous reversion, I designed a mutant derivative of A257 lacking the entire qsmR coding region. The qsmR gene was deleted by inducing a double homologous recombination with a purpose-made DNA construct, to produce the mutant A257qsmR. This mutant of A257 has a precise deletion of the qsmR gene.
[0069] Preliminary seed treatment experiments in the greenhouse showed that A257qsmR induced a similar protective effect in rice plants as did A257.
2023 Field Data
[0070] In 2023, the effect of A257 seed treatment was evaluated against both bacterial panicle blight (BPB) and sheath blight (ShB) in field trials at the H. Caffey Rouse Rice Research Station. As of Jul. 20, 2023 (shortly before the priority provisional filing date) significant protective effects had been seen against both diseases. See
Effect of A257 Seed Treatment on Drought Tolerance
[0071] Following a 7-day drought stress, rice plants grown from A257-treated seeds recovered from drought damage, while plants grown from untreated seeds did not. The drought condition was imposed unintentionally due to an accidental leakage of a container that held rice pots and water. This observation suggests that seed treatment with A257 is also effective to increase the tolerance of rice plants to drought, and perhaps other abiotic stresses as well. Similar results are also expected with strains of Burkholderia glumae wherein the qsmR gene has been artificially deleted or otherwise artificially inactivated, for example strain A257qsmR.
Miscellaneous
[0072] The complete disclosures of all references cited herein are hereby incorporated by reference in their entirety. Also incorporated by reference is the complete disclosure of provisional priority application 63/530,287. Also incorporated by reference are the following two works by the inventor and colleagues: J. Bruno et al., Development of alternative materials and strategies for enhancing rice health (Abstract), Plant Health 2022 Conference (Aug. 6-10, 2022); and J. Bruno et al., Development of alternative materials and strategies for enhancing rice health (poster), Plant Health 2022 Conference (Aug. 6-10, 2022) In the event of an otherwise irreconcilable conflict, however, the present specification shall control over material that is incorporated by reference.
[0073] The complete genome of strain A257 was described in in Lee, H. H., Lelis, T., Ontoy, J., Bruno, J., Ham, J. H., & Seo, Y. S. (2021). Complete Genome Sequence Data of Four Burkholderia glumae Strains Isolated from Rice Fields in the United States. Mol Plant Microbe Interact, 34 (11), 1324-1327. Furthermore, the complete primers and protocols used to prepare strain A257qsmR from the A257 strain are described in this specification. It is therefore believed that formal deposits of these strains with a depositary should not be required under the patent statute. However, if the USPTO should determine otherwise, then Applicant stands ready to deposit either or both of these strains with a depositary recognized under the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure. Both strains will be maintained by the Applicant in the interim, and have been maintained by the Applicant since prior to the provisional priority date for this application.