GENETIC CONSTRUCT FOR TRACKING AND/OR ABLATING QUIESCENT CELLS
20250043305 ยท 2025-02-06
Assignee
Inventors
Cpc classification
C07K14/721
CHEMISTRY; METALLURGY
International classification
C12N9/12
CHEMISTRY; METALLURGY
Abstract
A genetic construct is described having a nucleotide sequence A (Cre+ERT2) with a nucleotide sequence SEQ ID NO. 1 coding for an enzyme recombinase Cre and a sequence SEQ ID NO. 2 coding for a mutated receptor for estrogen ERT2; or a nucleotide sequence A with a nucleotide sequence SEQ ID NO. 3 coding for the fragment A of the diphtheria toxin (DTA); and a nucleotide sequence B with a nucleotide sequence SEQ ID NO. 4 coding for the inhibitor of a mutant cyclin dependent kinase (CDK) p27K.
Claims
1. A genetic construct comprising: a)a nucleotide sequence A (Cre+ ERT2) comprising a nucleotide sequence SEQ ID NO. 1 coding for an enzyme recombinase Cre and a sequence SEQ ID NO. 2 coding for a mutated receptor for estrogen ERT2; or a nucleotide sequence A comprising a nucleotide sequence SEQ ID NO. 3 coding for the fragment A of the diphtheria toxin (DTA); and b)a nucleotide sequence B comprising a nucleotide sequence SEQ ID NO. 4 coding for the inhibitor of a mutant cyclin dependent kinase (CDK) p27K.
2. The genetic construct according to claim 1, further comprising a linker sequence which mutually binds the nucleotide sequences A and B, wherein the linker sequence is preferably the sequence SEQ ID NO 5.
3. The genetic construct according to claim 1, further comprising a linker sequence which mutually binds the nucleotide sequences A and B.
4. The genetic construct according to claim 1, further comprising a linker sequence SEQ ID NO 6 which mutually binds the sequences SEQ ID NO 1 and SEQ ID NO. 2.
5. The genetic construct according to claim 1, wherein said construct is included inside a vector chosen among plasmid, viral vector, transposon.
6. A fusion protein comprising: a)an amino acid sequence A (Cre+ ERT2) comprising an amino acid sequence SEQ ID NO. 8 related to the enzyme recombinase Cre and an amino acid sequence SEQ ID NO. 9 of a mutated receptor for estrogen ERT2; or an amino acid sequence A comprising an amino acid sequence SEQ ID NO. 10 related to the fragment A of the diphtheria toxin (DTA); and b)an amino acid sequence B comprising an amino acid sequence SEQ ID NO. 11 related to the inhibitor of a mutant cyclin dependent kinase (CDK) p27K.
7. The fusion protein according to claim 6, further comprising a linker sequence which mutually binds the amino acid sequences A and B, wherein the linker sequence is the sequence SEQ ID NO 12.
8. The fusion protein according to claim 6, further comprising a linker sequence which mutually binds the amino acid sequences A and B, wherein the linker sequence is the sequence SEQ ID NO 13.
9. The fusion protein according to claim 6, further comprising a linker sequence SEQ ID NO 14 which mutually binds the sequences SEQ ID NO 8 and SEQ ID NO. 9.
10. (canceled)
11. A method for the tracking of quiescent cells, comprising providing to the quiescent cells the genetic construct according to claim 1, said genetic construct comprising: a)nucleotide sequence A (Cre+ ERT2) comprising a nucleotide sequence SEQ ID NO. 1 coding for an enzyme recombinase Cre and a sequence SEQ ID NO. 2 coding for a mutated receptor for estrogen ERT2; and b)a nucleotide sequence B comprising a nucleotide sequence SEQ ID NO. 4 coding for the inhibitor of a mutant cyclin dependent kinase (CDK) p27K and a selective modulator of the receptor of the estrogen ERT2 and thereafter tracking the quiescent cells.
12. A method for ablating quiescent cells, comprising providing the quiescent cells with the genetic construct according to claim 1, the genetic construct comprising: a)nucleotide sequence A comprising a nucleotide sequence SEQ ID NO. 3 coding for the fragment A of the diphtheria toxin (DTA); and b)a nucleotide sequence B comprising a nucleotide sequence SEQ ID NO. 4 coding for the inhibitor of a mutant cyclin dependent kinase (CDK) p27K and thereafter ablating the quiescent cells.
13. The method of claim 11, wherein the quiescent cells are quiescent stem cells.
14. The method of claim 11, wherein the quiescent cells are healthy or tumour cells.
15. The method of claim 11, wherein the modulator is Tamoxifene.
16. A composition comprising a fusion protein according to claim 6 and Tamoxifene.
17. (canceled)
18. A kit for use in tracking and/or ablating quiescent cells comprising a fusion protein according to claim 6 and Tamoxifene.
19. The genetic construct according to claim 2, wherein the linker sequence is SEQ ID NO 5.
20. The genetic construct according to claim 4, wherein the linker sequence is SEQ ID NO 7.
21. A method for the tracking of quiescent cells comprising providing to the quiescent cells a fusion protein comprising: a)an amino acid sequence A (Cre+ ERT2) comprising an amino acid sequence SEQ ID NO. 8 related to the enzyme recombinase Cre and an amino acid sequence SEQ ID NO. 9 of a mutated receptor for estrogen ERT2; and b)an amino acid sequence B comprising an amino acid sequence SEQ ID NO. 11 related to the inhibitor of a mutant cyclin dependent kinase (CDK) p27K and a selective modulator of a receptor of the estrogen ERT2 and thereafter tracking the quiescent cells.
22. A method for ablating quiescent cells, comprising providing the quiescent cells with the fusion protein according to claim 8 comprising: a)an amino acid sequence A comprising an amino acid sequence SEQ ID NO. 10 related to the fragment A of the diphtheria toxin (DTA); and b)an amino acid sequence B comprising an amino acid sequence SEQ ID NO. 11 related to the inhibitor of a mutant cyclin dependent kinase (CDK) p27K and thereafter ablating the quiescent cells.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0012]
[0013]
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
DETAILED DESCRIPTION OF THE INVENTION
[0026] For the purposes of the invention, herein below definitions will be provided of some terms used in the present description and in the enclosed claims.
[0027] The term tracking means the activation of the transcription of a reporter system (for example coding gene for fluorescent protein) through the action of an enzyme called Cre recombinase which removes a gene cassette or sequence called Lox-stop-Lox this one responsible for blocking the expression of the reporter gene. The expression of the fluorescent reporter protein allows displaying/marking a certain cell and its progeny in time and in space. The expression of Cre in a certain cellular type (through a specific promoter) allows activating the tracking only in specific cellular types (for example, if the expression of Cre is activated through a promoter of the gene Prominin-1 or Sox2, it is possible to track the stem cells). If the Cre is fused ERT2, it allows its control and therefore activation only at the presence of Tamoxifene; CreERT2 in fact is expressed but not active. The activation can occur only through Tamoxifene, which, binding itself to ERT2, allows the Cre to perform its removal function of the cassette Los-stop-Lox. This allows activating the tracking system in specific cellular types (through a promoter) from a certain time (through Tamoxifene).
[0028] The term ablating or cellular removal means the activation or expression of a toxin (for example Toxin of the diphtheriaDTA) which induces inside the cell the inhibition of the protein synthesis which consequently brings about the cellular death. The expression of the DTA toxin in cellular sub-types and therefore the selective ablation of specific cellular types can be allowed through the use of specific promoters (for example Prominin-1 for stem cells). Moreover, the ablation can be induced in specific cellular types and starting from a certain time by combining the tracking system with ablating. If the expression of the DTA toxin is prevented by the cassette Lox-stop-Lox, only the combination with the system CreERT2 allows its activation in specific cellular typed (specific promoters which control CreERT2) and from a certain time (through treatment with Tamoxifene). In the present invention, as regards the tracking activity, it is performed through the construct CreERT2-p27K.sup. and related protein fusion product.
[0029] The genetic construct according to the invention codes for the enzyme inducible recombinase Cre (CreERT2) fused with p27K (mutant form lacking association sites to CDK), which requires the presence of Tamoxifene to have activity, can be obtained from the fusion of the sequence of the enzyme inducible recombinase Cre (CreERT2) with p27 (mutant form lacking association sites to CDK), where ERT2 is a mutated receptor for estrogen. Tamoxifene, as meant in all aspects described in the present document, can be provided through injection or supplemented to the cellular culture medium.
[0030] In the present invention, as regards the ablating activity, it is performed through the construct DTA-p27K and related protein fusion product.
[0031] Therefore, a first aspect of the present invention is a genetic construct comprising: [0032] a nucleotide sequence A (Cre+ ERT2) comprising a nucleotide sequence SEQ ID NO. 1 coding for an enzyme recombinase Cre and a nucleotide sequence SEQ ID NO. 2 coding for a mutated receptor for estrogen ERT2; or [0033] a nucleotide sequence A comprising a nucleotide sequence SEQ ID NO. 3 coding for the fragment A of the diphtheria toxin (DTA); and comprising [0034] a nucleotide sequence B comprising a nucleotide sequence SEQ ID NO. 4 coding for the inhibitor of a mutant cyclin dependent kinase (CDK) p27K.
[0035] The above nucleotide sequences A or A and B can be connected by a linker sequence. Similarly, the sequences composing the nucleotide sequence A can be connected by a linker sequence.
[0036] The genetic construct can further comprise a linker sequence which mutually binds the nucleotide sequences A and B, wherein the linker sequence is preferably the sequence SEQ ID NO 5 (gctggatatccatcacactggcggccgctcgaggccacc).
[0037] The genetic construct can further comprise a linker sequence which mutually binds the nucleotide sequences A and B, wherein the linker sequence is preferably the sequence SEQ ID NO 7 (ggatatccatcacactggcggccgctcgag).
[0038] Moreover, the genetic construct according to the invention can further comprise a linker sequence SEQ ID NO 6 (ctcgagccatct) which mutually binds the sequences SEQ ID NO 1 and SEQ ID NO. 2.
[0039] As understood by a skilled person in the art, all these variations in the order of sequences included in the present document which bring about fusion proteins substantially equivalent in functional terms, must be intended as included within the scope of the present invention.
[0040] According to a preferred embodiment, the genetic construct is included inside a vector. The term vector, in the present document, means a vector known to a skilled person in the art, for example a vector chosen among plasmid, viral vector or transposon.
[0041] A further aspect of the present invention is a fusion protein comprising: [0042] an amino acid sequence A (Cre+ ERT2) comprising an amino acid sequence SEQ ID NO. 8 related to the enzyme recombinase Cre and an amino acid sequence SEQ ID NO. 9 of a mutated receptor for estrogen ERT2; or [0043] an amino acid sequence A comprising an amino acid sequence SEQ ID NO. 10 related to the fragment A of the diphtheria toxin (DTA); and [0044] an amino acid sequence B comprising an amino acid sequence SEQ ID NO. 11 related to the inhibitor of a mutant cyclin dependent kinase (CDK) p27K.sup..
[0045] The fusion protein can further comprise a linker sequence which mutually binds the amino acid sequences A and B, wherein the linker sequence is the sequence SEQ ID NO 12 (AGYPSHWRPLEAT).
[0046] The fusion protein can further comprise a linker sequence which mutually binds the amino acid sequences A and B, wherein the linker sequence is the sequence SEQ ID NO 13 (SGYPSHWRPLE).
[0047] According to a preferred embodiment, the fusion protein further comprises a linker sequence SEQ ID NO 14 (LEPS) which mutually binds the sequences SEQ ID NO 8 and SEQ ID NO. 9.
[0048] A further aspect of the present invention deals with a genetic construct or a fusion protein as defined in any one of the previous aspects for use as a medicament.
[0049] A further object of the present invention deals with a genetic construct or a fusion protein as defined above for use in the tracking or ablating of quiescent cells. According to a preferred aspect, the quiescent cells are quiescent stem cells. Preferably, the quiescent cells are healthy or tumour cells.
[0050] According to a preferred aspect, it is provided to use a selective modulator of the receptor of the estrogen ERT2. Preferably, the modulator is Tamoxifene.
[0051] A further aspect of the present invention deals with a pharmaceutical composition comprising a fusion protein as defined above and Tamoxifene. Such pharmaceutical composition can further comprise one or more pharmaceutically acceptable excipients.
[0052] A further aspect of the present invention deals with a kit to be used in the tracking and/or ablating of quiescent cells comprising a fusion protein as defined above and Tamoxifene.
[0053] What is included in the present document must be intended as a non-limiting example. Moreover, the skilled person in the art will be able to understand that modifications can be performed without departing from the scope of the present invention as defined in the attached claims.
Examples
Experimental Part
In Vivo Tracking of Quiescent Stem Cells of Glioma
[0054] Here we have developed an inducible recombinase Cre (CreERT2) fused with p27K, under the control of SOX2 and Prom1 promoters. The specificity of the approach has been confirmed by the labelling combined with EdU during or 1 day before the activation of the Cre through Tamoxifene (Tam), demonstrating that our new system marks the cellular progeny of the quiescent cells (
[0055] First of all, we confirmed the lack of mVenus+ with Tam absent (
In Vivo Ablating of Quiescent Stem Cells in the Glioma
[0056] Afterwards, we tried to study the role of the cells qProm1 in the TP-mediated tumorigenesis through ablating by using the fragment A of the diphtheria toxin (DTA) fused to the isoform p27K (DTA-p27). The ablating efficiency has been verified in the neonatal area SVZ-VZ with pPB-CAG-mCherry, PB-mProml-mVenus-p27K- and pPB-mProml-DTA-p27K-(
Imaging of Living Infiltrating Quiescent Stem Cells in the Organoids of Human Paediatric Brain Tumours
[0057] These data point out that, in brain mouse tumours, quiescent cells are necessary for the tumour invasiveness; therefore, we have validated our results also in human tumours. To reply to this question, we have developed a new model of cancer organoid of human brain. TP-Cherry (or Cherry as control) has been electroporated in organoids of the dorsal forebrain differentiated by pluripotent induced human stem cells (hiPSC) (
DISCUSSION
[0058] In spite of the fact that the presence of quiescent stem cells has already been demonstrated, their role in cancer infiltration remains unclear. Here, we created a new murine model of brain cancer which expressed TPR-MET and p53 mutant together with a known phase sensor of cellular cycle G0 (mVenus-p27K). This allowed to directly visualize the quiescent cells Proml+ or Sox2+ inside the tumour and characterize their localization in core or infiltrating tumour areas. Moreover, in the infiltrating edge, they show a mesenchymal/migratory morphology with a strong accumulation of N-cadherin upon the cell-cell contact. Though it has been suggested that quiescent tumour stem cells contribute to the tumour re-growth after chemotherapy, here we have not observed an increase of the proliferation in the progeny qProm1 after the treatment with TMZ, may be due to the time window used in our study. We have not fixed a following time point, due to the high lethality of the tumour. It is interesting to note that, in our study, the treatment with TMZ increased the percentage of cells derived from qProm1 which express OLIG2 in the core areas of the tumour (
[0059] Finally, we created a new type of human brain tumour organoid to visualize and study the infiltration of quiescent cells. We demonstrated that quiescent stem cells can be displayed in cancer organoids of the human brain and have an infiltration potential in vivo after injection in nude mice. Moreover, we have been able to visualize in real time quiescent tumour cells which invade a normal brain organoid in co-culture experiments. The impact of these tools resides in the chance of studying the interaction of qCSC (quiescent cancer stem cells) inside the tumour micro-environment and of having a platform to test new therapeutic strategies to block the tumour diffusion, which can be easily exploited also in other models of human and murine cancer.
Methods
Cloning
[0060] The hyperactive form of the transposase piggyBac (pCMV-Hahy-pBase, pPBase) has been donated by the Wellcome Sanger Institute. The plasmid pPB-CAG-MCS-ires-mCherry has been used as donor plasmid piggyBac in which to clone through PCR other coding sequences. It has been generated by amplifying the sequence IRES and the sequence coding for mCherry and then joining them through overlapping PCR. Ires-mCherry has then been cloned in the plasmid piggyBac pPB-CAG-MCS-ires-mVenus creating pPB-CAG-MCS-ires-mCherry. TPR-MET has been amplified through PCR pBABE-pure-TPR-MET (Addgene, 10902). P53 (R273C) has been cloned from pCMV-Neo-Bam-p53R273C (donated by Alberto Inga). mVenus-p27K-has been amplified through PCR from pMXs-IP-mVenus-p27K-(as a gift from Toshihiko Oki and Toshio Kitamura). The human promoter Sox2 (hSOX2) has been sub-cloned from the plasmid pGL3-SOX2 (Addgene, 101761) in the plasmid piggyBac replacing the promoter CAG (generating pPB-hSOX2). The promoter of Mouse Prom1 (mProml) has been amplified through PCR starting from genomic mouse DNA and cloned in the vector piggyBac (generating pPB-mProml). The following primers have been used to amplify the element P2 of the murine promoter Prominin1, as previously described: Fw: TTCTTTGATATCGGTACCGGTCCAATCAGTGCGCTCAGAC (SEQ ID NO. 15); Verse: TTTCTTTCTCGAAGCTTCCTCTCCGGTCCAGCTCTCCT (SEQ ID NO. 16).
[0061] CreERT2-p27K-has been generated amplifying CreERT2 (from pPB-hSynI-creER-IRES-Venus) and p27K-(da pPB-CAG-mVenus-p27K) and then joining them through overlapping PCR. CreERT2-p27K-has then been cloned in the plasmid vector piggyBac pPB-CAG. mVenus-p27K- or CreERT2-p27K-have been cloned from the respective pPB-CAG in pPB-hSOX2 or pPB-mProml. DTA-p27K-has been generated amplifying DTA (from pDTA-TK, Addgene 22677) and p27K-(from pPB-CAG-mVenus-p27K) and then joining them through overlapping PCR. DTA-p27K-has then been cloned in the plasmid piggyBac pPB-mProml or pPB-hSOX2. The sequences of primer used to generate the fusion proteins are listed below:
TABLE-US-00001 CreERT2-p27K.sup. CreERT2:Fw(NheI): (SEQIDNO.17) 5-TTCTTTGCTAGCGCCACCATGTCCAATTTACTGACCGTACA-3; Rev: (SEQIDNO.18) 5-CGCCAGTGTGATGGATATCCAGCTGTGGCAGGGAAACC-3 p27K.sup.Fw: (SEQIDNO.19) 5-GGTTTCCCTGCCACAGCTGGATATCCATCACACTGGCG-3 Rev(EcoRI): (SEQIDNO.20) 5-TTCTTTGAATTCTCATTACGTCTGGCGTCGAA-3 DTA-p27K.sup. DTAFw(NheI): (SEQIDNO.21) 5-TTTCTTGCTAGCGCCACCATGGATGATGTTGTTGATTCTTCTAAA TC-3 Rev: (SEQIDNO.22) 5-CGCCAGTGTGATGGATATCCAGATCGCCTGACACGATTTCC-3 p27K.sup.Fw: (SEQIDNO.23) 5-GAAATCGTGTCAGGCGATCTGGATATCCATCACACTGGCG-3 Rev(EcoRI): (SEQIDNO.24) 5-TTCTTTGAATTCTCATTACGTCTGGCGTCGAA-3
[0062] The plasmid pPB-CAG-LSL-MCS, used as vector in which other coding sequences are cloned, has been generated by inserting a cassette loxP-STOP-loxP (LSL) between the promoter CAG and the multiple cloning sites (MCS). DTA and mVenus have been cloned through PCR respectively generating pPB-CAG-LSL-DTA and pPB-CAG-LSL-mVenus. All constructs have been verified through DNA sequencing.
Mice Breeding
[0063] Mice have been bred in a structure for animals certified in compliance with European Guidelines. Experiments have been approved by the Italian Ministry of Health as complying with the related regulatory standards. CD1 and CD1-Nude mice have been purchased from Charles River Laboratories. Prom1CreERT2 (JAX #017743) mice have been purchased from the Jackson Laboratory. Temozolomide (Sigma-Aldrich, T2577) has been injected intraperitoneally at 82.5 mg/kg/days for five days. Tamoxifene (Alfa Aesar, J63509) has been injected intraperitoneally at 50 mg/kg/days. EdU (Life Technologies, A10044) has been injected intraperitoneally at 50 mg/kg. Mice have been sacrificed as soon as they showed signs of pain or distress (human endpoint) or otherwise mentioned in the text or in the figures.
In Vivo Electroporation
[0064] CD1 mice at the second days after birth (P2) have been anesthetized in ice for 2 minutes, placed on a support in a stereo-taxic apparatus and injected at the following coordinates (from lambda):-1.5 D/V, + 0.8 M/L, + 1.5 A/P. The mixture of DNA has been prepared at a concentration of 5 g/l, with the pPBase and the donor plasmids piggyBac mixed at a ratio 1:4. 2 l of DNA mix have been injected using a glass capillary and a micro-injector FemtoJet (Eppendorf). The electroporation of DNA has been performed with tweezers-type electrodes using the following parameters: 100 V, 50 msec/pulse, intervals of 1000 msec, 5 electric square pulses.
Preparation of Tissues and Immunofluorescence
[0065] Mice have been perfused through intraventricular injection of paraformaldehyde (PFA) at 4%, brains have been sectioned and post-fixed for the following 24 houses. Mouse brains have afterwards been washed in PBS IX, included in agarose at 5% and sectioned using the vibratome Leica VT 1200 at a thickness of 60 m. The brain sections have then been washed with 0.3% Triton X-100 (Sigma) in PBS 1 and permeabilized in sodium dodecyl sulphate 1 for 15 minutes. The primary antibodies have been diluted in a solution composed of C.3% of Triton X-100 and 3 of goat serum (Sigma, G6767) in PBS 1 and incubated overnight. The secondary antibodies have been incubated for 90 minutes at ambient temperature, diluted in the same solution and the cores have been coloured with 1 g/ml of DAPI (Sigma).
[0066] The detection of EdU has been performed after immune-coloration. Briefly, after incubation with the secondary antibody, the brain sections have been post-fixed with 400 PFA for 15 minutes at ambient temperature, washed with 3% of bovine serum albumin (BSA) (Seqens IVD, 1000-70) in PBS 1 for 10 minutes and permeabilized with 0.500 Triton X-100 for 20 minutes. The sections have then been incubated for 30 minutes with a reaction mixture containing PBS 1X, CuSO4 4 mM, Alexa Fluor 647 Azide (Life Technologies, A10277) and sodium ascorbate 100 mM (Sigma). The sections have been washed and the cores have been coloured with 1 g/ml of DA-PI. The antibodies used for immunofluorescence are listed below:
TABLE-US-00002 Antibodies Species Dilution Company Cat. N. GFP Chicken 1:1500 Abcam ab13970 Ki67 Rabbit 1:500 Abcam ab15580 Sox2 Rabbit 1:500 Abcam ab97959 Olig2 Rabbit 1:1500 Sigma Aldrich AB9610 NeuN Mouse 1:500 Sigma Aldrich MAB377 N-cadherin Rabbit 1:1000 Abcam Ab18203 Alexa Fluor 488 goat Goat 1:500 Invitrogen A11039 anti-chicken IgY Alexa Fluor 546 goat Goat 1:500 Invitrogen A11030 anti-mouse IgG Alexa Fluor 546 goat Goat 1:500 Invitrogen A11035 anti-rabbit IgG Alexa Fluor 647 goat Goat 1:500 Invitrogen A21235 anti-mouse IgG Alexa Fluor 647 goat Goat 1:500 Invitrogen A21245 anti-rabbit IgG
RNA Extraction and RNA Sequencing
[0067] Brains have been sectioned and tumour tissues have been accurately insulated with a fluorescent binocular microscope, frozen in liquid nitrogen and stored at 80 C. The total RNA has been insulated from the tissues with TRIzol Reagent (Invitrogen, 15596018) according to the manufacturer's instructions, Then, the RNA quality has been checked with the high-sensitivity RNA specimen by the bioanalyzer 2100 (Agilent, G2939BA) and the extracted RNA has been stored at 80 C. till the RNA-seq analysis. The sequencing has been performed on the platform HiSeq2500 Illumina using a single-end protocol with readings of length 100 bp. The sequencing readings from the FASTQ files have been aligned on the reference genome of the mouse mm10 (Ensembl Mus musculus release 102) using the transcription abundance quantifier Salmon version 1.4.0. The package R tximeta has then been used to import the transcription quantification from Salmon and perform the summary of counts at gene level. Counts have then been resized to take into account the gene length and the library size, normalized (cut mean of values M) and filtered for a low expression with the package edgeR R (PMID:19910308), converted into CPM (Counts per million) and finally the batch has been corrected with the function ComBat of the package R sva (PMID:22257669). The package stats R has then been used for performing both the analysis of the main components and the hierarchical clustering.
Culture, Electroporation and Transplant of Brain Organoids
[0068] Human induced pluripotent stem cells (hiPSCs, donated by Domenico Delia) have been grown on a layer of Geltrex (Gibco, A14133-01), in Essential 8 Basal Medium (Gibco, A15169-01) supplemented with E8 Supplement (Gibco, A15171-01) and P/S (penicillin 100 units/ml, streptomycin 100 g/ml, GIBCO, 15140-122). All cells were lacking mycoplasmas. iPSC have been dissociated with EDTA (Invitrogen, 15575-038) 0.5 mM, pH 8.0, to keep the clusters of cells. The organoids of the dorsal forebrain have been generated modifying a previously described protocol for the differentiation of the dorsal forebrain. In particular, the brain organoids have been cultivated in 60-mm plates not treated with tissue (Sarstedt, 82.1194.500) in a cortical differentiation medium (CDM3 or CDM4, depending on the protocol guidelines) integrated with 1% Matrigel from day 35 onwards. At day 35, the organoids have been electroporated with several combinations of plasmids as previously described. Specifically, 15-20 organoids per condition have been electroporated with 100 g of DNA mix containing the transposase piggyBac and the donor plasmids mixed in a ration 1:4 diluted in 100 l of Buffer 5.
[0069] For the co-culture experiment, an organoid at 30 days after electroporation (D35+ 30) has been cultivated in narrow contact with a non-electroporated organoid in a plate with 96 black wells (Ibidi, 89621). The co-cultures have been monitored and acquired every day for 1 month with a daily mean change. The organoids have been fixed overnight with PFA at 4% at D35+ 30 or D35+ 60 (for co-culture experiments), then cryo-stored with sucrose at 30% overnight and included in the Frozen Section Compound (Leica, 3801480). The organoids have been sectioned at 20 m using the cryostat Thermo Scientific HM525 NX. The immunofluorescence has been performed as previously described for the mouse sections.
[0070] For transplant experiments, three organoids D35+ 30 have been mechanically dissociated in 200 l of CDM3 and 8 l of solution have been injected with a syringe Hamilton calibre 26s (80300/00). Nude mice at 5 days after birth (P5) have been anesthetized in ice for 2 minutes, placed on a support in a stereotaxic apparatus and injected at the following coordinates (from lambda):-1.5 D/V, + 1.2 M/L, + 1.5 A/P. The animals have been sacrificed as soon as they show signs of pain or distress (human endpoint).
Extraction of Genomic DNA and Methylation Analysis
[0071] Transplanted brains have been dissected, tumours have been separated from the brain tissue through a fluorescence binocular microscope. Tumour biopsies have been frozen in liquid nitrogen and stored at 80 C. Tumour biopsies have been lysed in a lysis buffer (20 m EDTA, 10 m Tris, 200 m NaCl, 0.2% Triton X-100, 100 g/ml proteinase K, pH 8.0) for 2 hours at 37 C. The genomic DNA has been extracted with phenol-chloroform and precipitated with isopropanol. The DNA methylation profile has been performed as previously described (ref 27 of the manuscript).
Image Acquisition with a Microscope
[0072] Brain and organoid sections have been acquitted on Leica TCS Sp8 or Nikon Eclipse Ti2 equipped with a rotary disk CREST Optics X-Light V2. The co-cultivated organoids have been acquired on Nikon Eclipse Ti2 equipped with CREST Optics X-Light V2 Spinning Disk. Images are presented as projection images at maximum intensity or as a single stack Z. Images have been processed using the ImageJ software.
Quantification of Infiltrated Area and Cells in Mouse Brain Sections
[0073] For the quantification of the area mVenus+, Cherry+ and DAPI+, whole brain sections have been acquired with Nikon Eclipse Ti2 equipped with CREST Optics X-Light V2 Spinning Disk generating mosaic-type images. A defined threshold has been applied to each separate channel to create binary images. The area measures have been limited to the threshold. At least 3 sections have been used for the brain (the numbers of analysed mice are included in the related keys of the figures). For the quantification of the cells infiltrated with mVenus+ or Cherry+, the distance has been measured between the infiltrated cells and the tumour edge for at least 6 cells and the 3 furthest cells for each section have been taken into account. All image measures have been performed with the ImageJ software.
Statistical Analyses
[0074] All statistical analyses have been performed with the GraphPad Prism 9 software. Quantitative data have been presented as means.e.m. or as violin-type graphs with median and quartiles as mentioned in the keys of the figures. Before the statistical significance test, data have been tested for the normal distribution. For normally distributed data, the Student test has been used for 2 groups. For data which do not follow a normal distribution, the non-parametric Mann-Whitney test has been used for 2 groups, with the Kruskal-Wallis test followed by the Dunn test used for more than 2 groups. The survival curve of Kaplan-Meier followed by the Log-rank (Mantel-Cox) test has been used for testing the difference in the survival of mice.