GLYCOSYL TRANSFERASES AND THEIR USES
20170204380 ยท 2017-07-20
Assignee
Inventors
Cpc classification
C07H15/10
CHEMISTRY; METALLURGY
C12P19/44
CHEMISTRY; METALLURGY
C12N15/8245
CHEMISTRY; METALLURGY
C12N15/8242
CHEMISTRY; METALLURGY
International classification
C07H15/10
CHEMISTRY; METALLURGY
C12P19/44
CHEMISTRY; METALLURGY
Abstract
The present invention relates to novel glycosyl transferases from Vitis vinifera that are capable of catalyzing the formation of certain glycosides with high efficiency, to nucleic acid molecules encoding such glycosyl transferases, to vectors, host cells and transgenic plants comprising nucleic acid sequences coding for such glycosyl transferases, and to methods for preparing and uses of such glycosyl transferases.
Claims
1. A glycosyl transferase having an amino acid sequence that a) comprises the sequence of SEQ ID NO:1; or b) comprises a sequence that is at least 90% identical to SEQ ID NO:1; or c) comprises a part of the sequence of SEQ ID NO:1 that is at least 50 amino acids in length; or d) comprises a sequence that is at least 90% identical to a part of the sequence of SEQ ID NO:1, wherein the part of the sequence of SEQ ID NO:1 is at least 50 amino acids in length; e) comprises the sequence of SEQ ID NO:2; or f) comprises a sequence that is at least 90% identical to SEQ ID NO:2; or g) comprises a part of the sequence of SEQ ID NO:2 that is at least 50 amino acids in length; or h) comprises a sequence that is at least 90% identical to a part of the sequence of SEQ ID NO:2, wherein the part of the sequence of SEQ ID NO:2 is at least 50 amino acids in length.
2. The glycosyl transferase of claim 1, wherein the glycosyl transferase is a terpene glycosyl transferase.
3. The glycosyl transferase of claim 1, wherein the glycosyl transferase catalyzes the formation of a glycoside in which a sugar is linked to a hydroxy-containing terpene through a -D-glycosyl linkage and/or formation of a glycose ester in which a sugar is linked to a carboxy-containing terpene through a -D-glycose ester linkage.
4. The glycosyl transferase of claim 1, wherein the glycosyl transferase uses UDP-glucose as a sugar donor.
5. The glycosyl transferase of claim 1, wherein the glycosyl transferase catalyzes glycosylation of geraniol, linalool, citronellol, nerol, 8-hydroxylinalool, farnesol, furaneol, hexanol and/or octanol.
6. A nucleic acid molecule encoding the glycosyl transferase of claim 1.
7. A vector comprising a DNA sequence encoding the glycosyl transferase of claim 1.
8. A host cell containing or transfected with the nucleic acid molecule of claim 6.
9. The host cell of claim 8, wherein the host cell produces the glycosyl transferase of claim 1.
10. A transgenic plant comprising the nucleic acid molecule of claim 6 with the proviso that the plant is not a Vitis vinifera plant.
11. The transgenic plant of claim 10, wherein the transgenic plant produces the glycosyl transferase of claim 1.
12. (canceled)
13. A method of forming a terpene glycoside in which a hydroxy-containing terpene is covalently linked to a sugar group through a glycosidic bond; a terpene glycose ester in which a carboxy-containing terpene is covalently linked to a sugar group through a glycose ester bond; an octanyl glycoside in which octanol is covalently linked to a sugar group through a glycosidic bond; a furaneyl glycoside in which furaneol is covalently linked to a sugar group through a glycosidic bond; or a hexanyl glycoside in which hexanol is covalently linked to a sugar group through a glycosidic bond, the method comprising contacting a hydroxyl-containing terpene, a carboxy-containing terpene, octanol, furaneol, or hexanol with a sugar donor and the glycosyl transferase of claim 1 under conditions permitting the transfer of a sugar group of the sugar donor to a hydroxyl group of the hydroxy-containing terpene; a carboxyl group of the carboxy-containing terpene or a hydroxyl group of the octanol, furaneol, or hexanol; under formation of a glycosidic bond between the terpene and the sugar group; an ester bond between the terpene and the sugar group; a glycosidic bond between octanol and the sugar group; a glycosidic bond between furaneol and the sugar group; or a glycosidic bond between hexanol and the sugar group, respectively, thereby forming the terpene glycoside, the terpene glycose ester, the octanyl glycoside, the furaneyl glycoside or the hexanyl glycoside, respectively.
14. A method of producing a terpene glycoside, terpene glycose ester, octanyl glycoside, furaneyl glycoside or hexanyl glycoside, the method comprising the steps of: a) culturing or growing the host cell of claim 8; and b) collecting from the host cell the terpene glycoside, terpene glycose ester, octanyl glycoside, furaneyl glycoside or hexanyl glycoside.
15. A method of producing a protein having glycosyl transferase activity, the method comprising the steps of: a) culturing or growing the host cell; and b) collecting from the host cell a protein having glycosyl transferase activity.
16. (canceled)
17. A terpene glycoside, terpene glycose ester, octanyl glycoside, furaneyl glycoside or hexanyl glycoside made by the method of claim 14.
18. A host cell containing or transfected with the vector of claim 7.
19. A transgenic plant containing or transfected with the vector of claim 7.
20. A method of producing a terpene glycoside, terpene glycose ester, octanyl glycoside, furaneyl glycoside or hexanyl glycoside, the method comprising the steps of: a) culturing or growing the transgenic plant of claim 10; and b) collecting from the transgenic plant the terpene glycoside, terpene glycose ester, octanyl glycoside, furaneyl glycoside or hexanyl glycoside.
21. A method of producing a protein having glycosyl transferase activity, the-method comprising the steps of: a) culturing or growing the transgenic plant of claim 10; and b) collecting from the transgenic plant a protein having glycosyl transferase activity.
Description
[0185] In the following, reference is made to the figures:
[0186] All methods mentioned in the figure descriptions below were carried out as described in detail in the examples.
[0187]
[0188] The relative expression was quantified in Gewurztraminer 11-18 Gm (black bars) and White Riesling 239-34 Gm (grey bars). Sampled tissues: Inflorescences four weeks (I1) and two weeks (I2) before flowering and at full bloom (I3), leaves at the age of approximately one week (L1), three weeks (L2) and five weeks (L3) and roots (R). The mean values+SD of three independent experiments are shown, o.o.r. out of range.
[0189]
[0190] Different stages of berry development are given as weeks post flowering. Expression was determined in berry skins (exocarp) of five different varieties and clones. Mean valuesSD of three independent experiments are shown, o.o.r. out of range.
[0191]
[0192] The relative activities refer to the highest level of extractable radioactivity which was measured for the conversion of geraniol (100%) in case of VvGT14a and VvGT15a-c (order of the columns 15c, 15b, 15a) and benzyl alcohol (100%) in the case of VvGT16. Data for two biological and two technical replicates are shown. Black and white bars represent monoterpenoids and non-monoterpenoids, respectively. (D): Chemical structures of geraniol, nerol, 3S-citronellol, -terpineol and 3S-linalool.
[0193]
[0194] LC-MS analysis of citronellyl B-D-glucoside (A), geranyl -D-glucoside (B), neryl -D-glucoside (C), linaloyl -D-glucoside (D) formed by VvGT14a, VvGT15a and VvGT16 and a mixture of synthesized monoterpenyl -D-glucosides (E); chromatograms display an overlay of single product measurements, traces show the total ion current of the characteristic transitions (refer to Example 1), Gaussian smoothing was partly applied.
[0195]
[0196] A) Racemic mixture of R,S-citronellol was used as substrate for VvGT14a and VvGT15a, enantiomerically pure R-citronellol was used as reference.
[0197] B, C) racemic citronellol is released by acid catalyzed hydrolysis of citronellyl--D-glucoside formed by VvGT14a and VvGT15a. Signals labeled with x are hydrolysis by-products. Chromatograms are shown in SIM mode by using the characteristic ion traces m/z 69, 81 and 123 for citronellol.
[0198] D) Racemic mixture of R,S-linalool was used as substrate for VvGT14a.
[0199] E) Enantiomerically pure R-linalool was used as reference material.
[0200] F) A slight preference for the R-linalool is revealed after enzymatic hydrolysis with AR 2000. Chromatograms are shown in SIM mode (m/z 71, 93).
[0201]
[0202]
[0203] Radio-TLC analysis (A) of products formed by VvGT14a (1,2,3), VvGT15a (4,5,6) and VvGT16 (7,8,9) after incubation with the aglycone library obtained from grape berries of Gewurztraminer 11-18 Gm (1,4,7); Positive control: geraniol (2,5,8); negative control: no acceptor molecule (3,6); UDP [.sup.14C]-glucose (9; approximately: 3000 dpm). The plates were analyzed by digital autoradiograph. The products formed from citronellol, geraniol and nerol were verified by LC-MS analysis. GC-MS analysis (B, total ion chromatogram) of volatiles that were enzymatically released from glucosides which were formed by incubation of an aglycone library obtained from grape berries of Gewurztraminer 11-18 Gm with UDP-glucose and VvGT14 (gray) or heat-inactivated VvGT14a (black) as control 1: linalool; 2: citronellol; 3: nerol; 4: geraniol; 5: benzyl alcohol; 6: phenylethanol.
[0204]
[0205]
[0206]
[0207]
[0208]
[0209]
[0210]
[0211] In the following, reference is made to the examples, which are given to illustrate, not to limit the present invention.
EXAMPLES
Example 1
[0212] Plant Material
[0213] Vitis vinifera grapevines of cultivars Gewurztraminer 11-18 Gm, Gewurztraminer FR 46-107, White Riesling 239-34 Gm, White Riesling 24-196 Gm and Muscat a petit grains blancs FR 90 were grown during vintages 2011 and 2012. Grape berries, leaves, inflorescences and roots were collected. Sampling was conducted for a total of six dates between 6 and 17 weeks after bloom including berries from pea-size to harvest ripeness. Muscat a petit grains blancs FR 90 was additionally sampled every two weeks from week 4 to week 18 after bloom.
[0214] After veraison (the onset of ripening) 100 berries were collected for the determination of ripening related parameters like sugar content. For terpenoid analysis 250 g of berries were stored at 20 C., while three replicates consisting of ten berries were peeled and skins immediately frozen in liquid nitrogen for subsequent RNA extraction. Roots were obtained from scions of White Riesling 239-34 Gm and Gewurztraminer 11-18 Gm grown in the greenhouse. Leaves were sampled from the same cultivars at the approximate age of one, three and five weeks. In addition, inflorescences four and two weeks before flowering and at full bloom were collected. Samples were stored at 20 C. until work-up.
[0215] Chemicals
[0216] UDP-[.sup.14C]glucose (300 mCi/mmol, 0.1 mCi/mL) was obtained from American Radiolabelled Compounds (St Louis, Mo., USA). (R,S)-3,7-dimethyl-1,6-octadien-3-ol (linalool) and (E)-3,7-dimethyl-2,6-octadien-1-ol (geraniol) were obtained from Roth (Karlsruhe, Germany). (R,S)-3,7-dimethyl-6-octen-1-ol (citronellol) and pure (R)-(+)-B-citronellol were purchased from Sigma Aldrich (Steinheim, Germany). (Z)-3,7-dimethyl-2,6-octadien-1-ol (nerol) was purchased from Alfa Aesar (Karlsruhe, Germany). (R,S)-3,7-dimethyl-6-octenyl -D-glucopyranoside (citronellyl -D-glucoside), (Z)-3,7-dimethyl-2,6-octadienyl -D-glucopyranoside (neryl -D-glucoside) and (E)-3,7-dimethyl-2,6-octadienyl -D-glucopyranoside (geranyl -D-glucoside) were synthesized according to the Koenigs-Knorr-procedure, (R,S)-3,7-dimethyl-1,6-octadienyl B-D-glucopyranoside (linaloyl -D-glucoside), according to a modified Koenigs-Knorr-procedure.
[0217] Sample Preparation for Metabolite Analysis
[0218] Grapes berries were peeled and 10 g (fresh weight) of the grape skins were taken for one analysis. In case of root, leaf and inflorescence, 4 g plant material was taken per analysis. The material was frozen in liquid nitrogen, ground and extracted with a mixture of phosphate buffer (0.1 M, pH 7) and 13% ethanol for 24 h under nitrogen with exclusion of light (Jess Ibarz et al., 2006). 2-Octanol was used as internal standard for the determination of free monoterpenes. For the determination of monoterpenyl -D-glucosides, stable isotope dilution analysis (SIDA) was applied, using [.sup.2H.sub.2]-citronellyl -D-glucoside as a labeled, internal standard. The concentration of the internal standards was adapted for the variety, the tissue and the ripening stage of the plant material. 2-Octanol was added in a range of 0.3 to 6.8 mg/kg plant material, [.sup.2H.sub.2]-citronellyl--D-glucoside in a range of 0.1 to 3.5 mg/kg plant material.
[0219] To purify the sample, Carrez reagents (Merck Millipore, Darmstadt, Germany) were added (1 mL each) and the sample was then centrifuged at 14500 rpm for 20 min at 5 C. The supernatant was taken for subsequent solid phase extraction (SPE) to isolate and separate free monoterpenes from glycosidically bound monoterpenes. Therefore, a 200 mg Lichrolut EN column (Merck, Darmstadt, Germany) was conditioned as described (Pieiro et al., 2004). Free monoterpenols were eluted with dichloromethane and glycosidically bound monoterpenols with methanol.
[0220] For GC-MS detection, the dichloromethane fractions were dried with Na.sub.2SO.sub.4, concentrated using nitrogen to 200 L and analyzed. For LC-MS detection, the methanolic fractions were concentrated under reduced pressure and the residues were dissolved in water/acetonitrile (7/3; v:v). The samples were analyzed by LC-MS.
[0221] Nucleic Acid Extraction
[0222] For total RNA extraction plant material was ground to a fine powder in liquid nitrogen using mortar and pestle. One g of the powder was used for RNA extraction with the CTAB (cetyltrimethylammonium bromide) method following an established protocol (Zeng and Yang, 2002, adapted by Reid et al. 2006) to meet the requirements of different grape tissues. Remaining genomic DNA was digested by DNase I and cleaned up with the High Pure RNA Isolation kit (Roche, Mannheim, Germany).
[0223] Transcription Analysis
[0224] Transcription analysis was performed using the Genome Lab GeXP Genetic Analysis System (Beckman Coulter, Krefeld, Germany), a multiplex quantitative gene expression analysis system. The gene expression patterns of the VvGT genes VvGT14, VvGT15 and VvGT16 and five reference genes (VvActin, VvAP47, VvPP2A, VvSAND, and VvTIP41) were analyzed simultaneously from one sample of total RNA.
[0225] Reverse transcription was carried out with the GenomeLab GeXP Start kit (Beckman Coulter) following the manufacturer's instructions. As an internal control gene KAN.sup.r RNA was co-reverse transcribed and subsequently amplified together with the reference genes and genes of interest. The gene specific primers for reverse transcription are chimeric, providing a 19 nt universal tag for the binding of universal reverse primers in the subsequent PCR reaction. The final concentration of the primers ranged from 0.1 nM to 100 nM to compensate for the different transcription levels of the analyzed genes (Table 3). Multiplex PCR reactions were conducted with Thermo-Start DNA Polymerase (Thermo Fisher Scientific, Dreieich, Germany). Each reaction contained 9.3 L of reverse transcription products as template and 10.7 L of a PCR reaction mix including gene specific forward primers providing an 18 nt universal tag (Table 3). The universal forward primer is labeled with a fluorescent dye for detection during subsequent capillary electrophoresis. Primer pairs were designed to yield PCR products ranging from 119 bp to 374 bp and differing in size by at least 8 bp. Of each PCR product, 4 L were separated by capillary electrophoresis using the GenomeLab Genetic Analysis System (Beckman Coulter).
[0226] Individual standard curves for each gene in the multiplex were performed with serial two-fold dilutions ranging from 3.91 ng to 500 ng of an RNA mixture from all samples. Raw data were analyzed using the fragment analysis tool. The fragment data of the standard curves and samples were then normalized to the peak area of KAN.sup.r RNA with the express analysis tool. Subsequently, the relative signal level of each sample replicate was interpolated from the standard curve. The data was further normalized to the geometric mean of the five reference genes with quant tool. All software for GeXP data analysis was purchased from Beckman Coulter.
[0227] Cloning of VvGT14, VvGT15 and VvGT16 DNA Sequences from Vitis vinifera
[0228] The reference genome of Vitis vinifera sequenced genome PN40024 was used to design gene specific primers in the untranslated regions of the three putative VvGT genes, VvGT14, VvGT15, and VvGT16 using the tool Primer-BLAST. Primers (Table 4) were purchased from Eurofins MWG Operon (Ebersberg, Germany). The cDNA-synthesis was performed with the SuperScript III First-Strand Synthesis SuperMix (Life Technologies, Darmstadt, Germany) following the manufacturer's instructions. The template for cDNA-synthesis was total RNA, extracted from grape exocarp. The cDNA was used as template in the following PCR-reaction. PCR was performed with Phusion DNA Polymerase (Thermo Fisher Scientific, Dreieich, Germany) using high-fidelity (HF)-buffer and the following thermal cycling conditions: 98 C. for 30 s followed by 32 cycles consisting of 98 C. for 5 s, 60 C. for 5 s and 72 C. for 30 s and a final elongation step of 72 C. for 1 min.
[0229] PCR products were gel purified with the Wizard SV Gel and PCR Clean-Up System (Promega, Madison, USA). A-tailing of purified PCR-products was performed with Taq DNA Polymerase (Thermo Fisher Scientific). A-tailed PCR-products were ligated into pGEM-T Easy vector (Promega, Madison, USA) and cloned in One Shot TOP10 Chemically Competent E. Coli (Life Technologies, Darmstadt, Germany). Plasmids were isolated with the PureYield Plasmid Miniprep System (Promega, Madison, USA) and sequenced with the vector specific primers M13 uni (21) and M13 rev (29) on an ABI 3730 capillary sequencer (StarSEQ, Mainz, Germany). Raw data was edited with the FinchTV software (Geospiza, Seattle, USA). Sequences were assembled with SeqMan and aligned with MegAlign (DNASTAR, Madison, USA).
[0230] Construction of Expression Plasmids
[0231] The full-length ORFs of the VvGT sequences were subcloned into the pGEM-Teasy vector (Promega, Madison, Wis., USA). All genes were amplified with primer introducing BamHI and Notl restriction sites. Subsequently, the genes were cloned in frame with the N-terminal GST-tag into the pGEX-4T-1 expression vector (Amersham Bioscience, Freiburg, Germany). The gene identity was confirmed by sequencing (Eurofins MWG Operon, Ebersberg, Germany).
[0232] Heterologous Protein Expression
[0233] Recombinant protein was expressed in E. coli BL21 (DE3) pLysS (Novagen, Schwalbach, Germany). Pre-cultures were grown overnight at 37 C. in Luria Bertani medium containing 100 g/mL ampicillin and 23 g/mL chloramphenicol. The next day, 1 L Luria Bertani solution containing the appropriate antibiotics was inoculated with 50 mL of the pre-culture. The culture was grown at 37 C. at 160 rpm until OD.sub.600 reached 0.6-0.8. After cooling the culture to 16 C., 1 mM IPTG was added to induce protein expression. Cultures were incubated over night at 16-18 C. at 160 rpm. Cells were harvested by centrifugation and stored at 80 C. Negative controls were carried out with E. coli BL21 (DE3) pLysS cells containing the empty expression vector pGEX-4T-1.
[0234] Cell Lysis and Purification
[0235] Recombinant GST-fusion proteins were purified by GST Bind resin (Novagen) following the manufacturer's instructions. Briefly, the cells were re-suspended in the binding buffer containing 10 mM 2-mercaptoethanol. Cells were disrupted by sonication. The crude protein extract was incubated for 2 h with the GST Bind resin to bind GST fusion protein. The recombinant protein was eluted with GST elution buffer containing reduced glutathione and quantified by Bradford solution (Sigma-Aldrich, Steinheim, Germany). The presence of the expressed proteins was confirmed by SDS-PAGE and Western Blot using anti-GST antibody.
[0236] Activity Assay and Kinetics
[0237] In the initial screening, each reaction mixture (200 L in total) contained Tris-HCl buffer (100 mM, pH 8, 10 mM 2-mercaptoethanol), 37 pmol UDP-[.sup.14C]glucose (0.01 Ci, Biotrend, Kln, Germany), substrate (50 L of a 1 mg/mL stock solution) and purified protein (0.5-0.8 g/L). The reaction mixture was incubated at 30 C. for 18.5 hours. The assays were stopped by adding 1 L 24% trichloroacetic acid and extracted with 500 L water-saturated 1-butanol. The organic phase was mixed with 2 mL Pro Flow P+ cocktail (Meridian Biotechnologies Ltd., Epsom, UK) and radioactivity was determined by liquid scintillation counting (LSC, Tri-Carb 2800TR, Perkin Elmer, Waltham Mass., USA). Additionally, negative controls without substrate were performed. After determining the optimal conditions for the best substrate of each gene, the substrate screening was repeated under these conditions.
[0238] The kinetic data were determined with increasing concentrations of the substrates (VvGT14a: citronellol, geraniol, 8-hydroxylinalool, linalool, nerol and terpineol; VvGT15a-c: S-citronellol, geraniol, 8-hydroxylinalool and nerol; VvGT16: citronellol, geraniol and nerol) from 1 M to 100 M (VvGT14a and VvGT15a-c) or 50 M to 500 M (VvGT16) and a fixed UDP-glucose concentration of 108 M (100 M unlabeled UDP-glucose and 8 M UDP-[.sup.14C] glucose; VvGT14a), 833 M (825 M unlabeled UDP-glucose and 8 M UDP-[.sup.14C] glucose;VvGT15a-c) or 512.5 M (500 M unlabeled UDP-glucose and 12.5 M UDP-[.sup.14C] glucose; VvGT16). The total volume was 40 L and 0.2 g (VvGT14a), 0.5 g (VvGT15a-c) or 5 g (VvGT16) of purified protein. The measurements were performed under the following conditions. The assays were carried out at 30 C. for 1.5 h using a Tris-HCl buffer (100 mM, 10 mM 2-mercaptoethanol, pH 8.5 for VvGT14a and VvGT16). The assay of VvGT15a-c was performed at 30 C. using a Tris-HCl buffer (100 mM, 10 mM 2-mercaptoethanol, pH 7.5) and 10 min (VvGT15c) or 30 min (VvGT15a-b) of incubation for the best substrates. The amount of the purified enzyme and the incubation time were adapted depending on the counting sensibility. The reaction was stopped by adding 1 L 24% trichloroacetic acid and glucosides were extracted with 100 L ethyl acetate. Radioactivity was determined by LSC.
[0239] To determine the kinetic data of UDP-glucose, the value of geraniol was fixed (1.25 mM for VvGT15a-c and VvGT16; 0.1 mM for VvGT14a) and UDP-[.sup.14C] glucose was mixed with non-radiolabeled UDP-glucose to obtain concentrations ranging from 5 M to 100 M (VvGT14a and VvGT15a-c) or 25 M to 500 M (VvGT16). The K.sub.M- and v.sub.max-values were calculated from Lineweaver-Burk plots, Hanes-Woolf plots and non-linear fitting of the experimental data.
[0240] Preparation of Aglycone Libraries
[0241] For the preparation of aglycone extracts 50 g (fresh weight) grape skins or 4 g (fresh weight) inflorescences of Gewurztraminer Gm 11-18 were ground to a fine powder in liquid nitrogen. The isolation of glycosides was carried out as described above (see metabolite analysis). The methanolic fraction, which was obtained after SPE, was enzymatically hydrolysed. Therefore, the dried sample was dissolved in citric-acid buffer (0.1 M, pH 4), 50 mg AR 2000 (an enzyme preparation with glucosidase activity prepared from Aspergillus niger; DSM Food Specialties Beverage Ingredients, Delft, Netherlands) was added and incubated for 24 h with exclusion of light. The liberated aglycones were extracted by 20 mL methyl-tert-butyl ether and the organic phase was reduced to 1000 L using a gentle stream of nitrogen.
[0242] Activity Based Profiling using a Physiologic Aglycone Library
[0243] Aliquots of this aglycone extract were incubated with UDP-glucose and various VvGT-enzymes. Optimum conditions at 30 C. for 24 hours were applied. Each solution contained 100 L purified enzyme, 100-150 L Tris-HCl buffer (100 mM, pH7.5 or 8.5, 10 mM 2-mercaptoethanol), 37 pmol UDP-[.sup.14C]glucose (0.01 CD and 50-100 L extract (dissolved in methyl-tert-butylether). The buffer was mixed with the extract and the organic solvent was gently vaporized with nitrogen. The missing volume was adjusted with buffer before the enzyme was added. The reaction was stopped by adding 1 L 24% trichloroacetic acid and extracted with 500 L ethyl acetate. After termination of the reaction free aglycones, which were not converted by VvGT14 and VvGT15, were measured via SPME-(Solid Phase Microextraction)-GC-MS. These residual, free aglycones were completely removed by extraction with dichloromethane. Enzymatically formed glucosides were extracted by ethyl acetate, which was removed under nitrogen. The residue was dissolved in methanol and analyzed by LC-MS to detect the generated monoterpenol glucosides. Enzymatic hydrolysis of the glucosides was performed using AR 2000 and 2 mL citric-acid-buffer. After hydrolysis, a 100 L aliquot was used to detect volatile aglycones via SPME-GC-MS. The remaining solution was extracted with methyl-tert-butyl ether and reduced under nitrogen to approximately 200 L. One L were measured by GC-MS via liquid injection.
[0244] Enantioselectivity of VvGT14a, VvGT15a-c
[0245] To determine the enantioselectivity of VvGT14 and VvGT15 the enantiomeric ratio of glucosidically bound citronellol and linalool was determined by enantioselective GC-MS. Following the incubation, residual citronellol and linalool were completely removed by extraction with dichloromethane. Chronellyl -D-glucoside which remained in the aqueous phase was hydrolyzed by HCl (2 mL, 0.1 M, pH 1) for one hour at 100 C. to release citronellol (Skouroumounis and Sefton, 2000). In case of linalyl -D-glucoside an enzymatic hydrolysis (AR 2000, citric acid buffer pH 4, 24 h) was applied due to the instability of linalool in acid solutions (Williams et al., 1982). Hydrolysis of a synthetic 1:1 mixture of R- and S-linalyl -D-glucoside revealed that AR 2000 does not discriminate between the two diastereomeric glucosides. After hydrolysis, citronellol and linalool were analyzed by SPME-GC-MS as described above.
[0246] LC-MS Analysis
[0247] For LC-MS analysis of monoterpenyl -D-glucosides a Shimadzu LC2OAD HPLC system coupled to an API 2000 (Applied Biosystems, AB Sciex, Framingham, USA) triple-quadrupol-MS was used. Data acquisition was performed using Analyst software version 1.6.1. (Applied Biosystems, AB Sciex, Framingham, USA). The column (Phenomenex Gemini-NX 5u C18, 2503 mm, Aschaffenburg, Germany) was eluted with a linear gradient starting at water/acetonitrile (7/3; v:v) containing 0.2% ammonia till 12 min to water/acetonitrile (4/6; v:v; 0.2% ammonia) at 18 min. The column temperature was maintained at 40 C. The mass spectrometer was operated in ESI-MRM negative ion mode. Nitrogen was used as curtain (setting 20), nebulizing and collision gas (collision energy was 20 eV). Monoterpenyl -D-glucosides were identified by the following, characteristic MRM transitions {LinGlc: m/z 315.fwdarw.161(Glu), 315.fwdarw.113(Glu); NerGlc: m/z 315.fwdarw.119(Glu), 315.fwdarw.113(Glu); GerGlc: m/z 315.fwdarw.119(Glu), 315.fwdarw.113(Glu); CitrGlc: m/z 317.fwdarw.101(Glu), 317.fwdarw.161(Glu)} (Cole et al., 1989; Domon and Costello, 1988; Salles et al., 1991).
[0248] GC-MS Analysis
[0249] GC-MS analysis was performed with a Varian GC-450 coupled to a Varian MS-240 ion-trap employing a Phenomenex Zebron ZB-WAXplus column (30 m0.25 mm0.25 m, Aschaffenburg, Germany). Helium flow rate was 1 mL/min. The analysis was carried out in split mode (liquid injections) or splitless mode (SPME measurements) with 220 C. injector temperature. EI (electron impact ionization)-MS spectra were recorded from m/z 40 to 300 (ionization energy 70 eV; trap temperature 170 C.). The oven temperature program was 60 C. (3 min), 10 C./min up to 250 C. (5 min). In case of SPME measurements, liberated aglycones were isolated for 10 min at 60 C. using a fiber coated with a 85 m film of polyacrylate (SUPELCO, Bellefonte, USA). After extraction the SPME fiber was desorbed for 10 min at 250 C. in the injection port of the GC-MS system and the column oven program was carried out as described above. Enantioselective GC-MS analysis was performed with a Varian GC-450 coupled to a Varian MS-240 ion-trap. The column was a DiAcB (heptakis-(2,3-di-O-acetyl-6-O-tert.-butyldimethylsilyl)-B-cyclodextrin), 26 m0.32 mm i.d. with a 0.1 m film. Helium was used as carrier gas at a flow rate of 1 mL/min, injector temperature was 250 C. with a split ratio of 1/100 (liquid injections), or splitless (SPME measurement). The oven temperature program was 70 C. (3 min), 0.5 C./min to 130 C. 20 C./min up to 200 C. (3 min). GC-MS measurements were recorded in full scan mode. Selected ion monitoring (SIM) mode was used for quantification.
[0250] Radio-TLC Analysis
[0251] Assays containing UDP-[.sup.14C]glucose and aglycone libraries or substrates were performed as described above and subsequently extracted with 500 L ethyl acetate. The organic solvent was vaporized and the pellet was re-suspended in 10 L methanol and was applied on Silica Gel 60 F254 plates (Merck, Darmstadt, Germany). The dried plates were developed in a solvent system chloroform:acetic acid:water (50/45/5, v:v:v). Plates were dried and analyzed by digital autoradiograph (digital autoradiograph, EG&G Berthold, Wildbad, Germany).
Example 2
Expression AnalysisTemporal and Spatial
[0252] All methods mentioned in this example were carried out as described in Example 1.
[0253] The transcript levels of VvGT genes VvGT14 (designation in Vitis vinifera genome project: VIT_18s0001g06060), VvGT15 (VIT_06s0004g05780) and VvGT16 (VIT_03s0017g01130) of Vitis vinifera cv. Pinot noir were analyzed using GeXP profiling in up to five cultivars in three different tissues (
[0254] The same is true for the ripening related parameters such as sugar content and pH value. Thus, VvGT14-16 appear to play an important role in grape berry ripening as their expression levels peak after veraison and they are barely expressed in other tissues, except VvGT16.
Example 3
Metabolite Profiling
[0255] All methods mentioned in this example were carried out as described in Example 1.
[0256] To correlate the expression profiles of putative UGTs with terpenyl glucoside concentration metabolite analysis was performed in five cultivars during grape ripening (Table 1). Solid phase extraction was used to isolate free (non-glycosylated) and glycosylated monoterpenes from grape skins (exocarp) of various grapevine cultivars (Gunata et al., 1988; Mateo and Jimenez, 2000). Since grape skins (exocarp) accumulate the majority of terpene metabolites detected in grape berries they were separated from the flesh and extracted (Wilson et al., 1986). Geraniol, nerol, linalool and citronellol were quantified by GC-MS analysis whereas their non-volatile monoterpenyl glucosides were determined by a stable isotope dilution analysis (SIDA) method using LC-MS. Isotopically labelled internal standards were chemically synthesized.
[0257] Grape berries of the V. vinifera cultivars differed not only in their amounts of total terpenes, but also in their terpene profiles at different developmental stages (Table 1). Monoterpenols (free and glucosidically bound) were hardly detected (less than 0.25 mg/kg grape skins) in grape exocarp of Gewurztraminer FR 46-107, probably due to impaired monoterpene biosynthesis of this clone. Gewurztraminer 11-18 Gm and Muscat a petits grains blanc FR 90 skins accumulated significant levels of geraniol, citronellol and nerol derivatives (up to 5.5 mg/kg grape skins) and displayed a heterogenous spectrum of monoterpenes at every stage of ripening. Both Riesling clones produced smaller amounts of the metabolites that were mainly observed at weeks 15-17. In general, the highest concentration of free and bound terpenols was found in the late stages of ripening in all investigated cultivars, whereupon geraniol and its -D-glucoside were the predominant terpene metabolites. The ratios of the amount of free to glucosidically bound forms of individual monoterpenes varied considerably at week 15 and 17 post flowering. These values provide a first indication of variable UGT activity in different varieties and/or differential preference of the UGTs for their monoterpene substrates.
[0258] Notably, the evolution of monoterpenyl -D-glucosides in grape exocarp of the Riesling clones (Table 1) correlated well with the expression pattern of VvGT14 in the same tissue (
Example 4
Heterologous Expression of VvGT14, VvGT15 and VvGT16 and Enzymatic Activity
[0259] All methods mentioned in this example were carried out as described in Example 1.
[0260] The alleles of VvGT14a-c, 15a-c and 16 were isolated from V. vinifera cultivars and cloned in the expression vector pGEX-4T-1. The recombinant proteins were expressed with an N-terminal GST-tag, affinity purified and verified by SDS-PAGE and Western Blot using GST-specific antibody. Enzyme activity studies were performed with UDP-[.sup.14C]glucose and various putative substrates (terpenols, flavonoids and different mono-alcohols) that are known to be glycosidically bound and present in grapes (Gunata et al., 1988).
[0261] Recombinant VvGT14a, VvGT15a-c and VvGT16 converted several of the tested substrates (
[0262] The K.sub.M and k.sub.cat values of VvGT14a for geraniol (9 M; 0.02 sec.sup.1), citronellol (9 M; 0.02 sec.sup.'1), nerol (10 M; 0.02 sec.sup.1) and UDP-glucose (16 M; 0.03 sec.sup.1) were alike (Table 2) and resembled the kinetic data of VvGT1 (Offen et al., 2006) and CaUGT2 (Catharanthus roseus) (Masada et al., 2007) for their natural substrates quercetin (31 M; 0.075 sec.sup.1) and curcumin (43.9 M; 0.0165 sec.sup.1), respectively. The data were also similar to those of VvGT5 (5.6 M; 7.16 sec.sup.1), VvGT6 (9.24 M; 0.76) and UGT71G1 (57 M; 0.0175 sec.sup.1) from Medicago truncatula (He et al., 2006) for the conversion of quercetin (Ono et al., 2010). Hence, the specificity constants (k.sub.cat/K.sub.m) identified the monoterpenols as most probable in vivo substrates of VvGT14a as the k.sub.cat/K.sub.M values of geraniol, citronellol and nerol are 4, 4, and 40 fold higher, respectively than the values of the monoterpenols for UGT85B1 from Sorghum bicolor (Hansen et al., 2003) (see Table 5). Thus, VvGT14a shows unprecedented glucosyltransferase activity toward geraniol, citronellol and nerol.
[0263] The sequence comparison of the active VvGT14a allele with the two inactive alleles showed one point mutation at position 391 (P391L) in VvGT14b and a deletion of 21 aa at position 165 in VvGT14c rendering them inactive (
[0264] The allelic forms of VvGT15a-c showed a similar substrate spectrum (
[0265] Notably, the glucosylation of monoterpenols by UGT85B1, the cyanohydrins (mandelonitrile) GT from Sorghum bicolor, can be seen as promiscuous activity (Hansen et al., 2003). However, the K.sub.M data of VvGT14a and VvGT15a-c were 1.6 to 125-fold lower and the k.sub.cat/K.sub.M values up to 78 times higher than the data obtained for the glucosylation of terpenoids by UGT85B1. Mandelonitrile was only a poor substrate of VvGT14a and was not accepted at all by VvGT15a-c.
[0266] VvGT16 glucosylated monoterpenols, some short-chained and aromatic alcohols, albeit with low efficiency (
[0267] The formation of monoterpenyl glucosides was confirmed by LC-MS analysis in comparison with chemically synthesized glucosides (
[0268] Besides, selected glucosides of the transformed terpenoids were visualized by radio-TLC (
Example 5
Enantioselectivity of VvGT14a, VvGT15a-c and VvGT16
[0269] All methods mentioned in this example were carried out as described in Example 1.
[0270] Grape berries accumulate free and bound S-citronellol and S-linalool, albeit in lower levels than nerol and geraniol (Table 1). To elucidate the enantiomeric preference of VvGT14a and VvGT15a, racemic citronellol was used as substrate and racemic linalool was transformed by VvGT14a. Chiral phase GC-MS analysis of liberated citronellol after acid hydrolysis of citronellyl B-D-glucoside demonstrated no enantio-discrimination by VvGT14a and 15a if the reaction mixture is incubated for a prolonged time (24 h;
[0271] Furthermore, liberated linalool, after enzymatic hydrolysis of linaloyl -D-glucoside (formed by VvGT14a), showed a slight enrichment of the R-enantiomer (
[0272] While VvGT14a and VvGT15a-c preferentially glucosylated S-citronellol in short time assays enantioselectivity of these enzymes for citronellol was not observe in long tend studies (
Example 6
Biochemical Characterization of VvGT14a, VvGT15a-c and VvGT16
[0273] All methods mentioned in this example were carried out as described in Example 1.
[0274] The assay conditions were optimized for the conversion of geraniol to determine the kinetic constants of the active enzymes. The highest activity of VvGT14a, 15a-c and 16 was found in Tris-HCl buffer (pH 8.5, 7.5 and 8.5, respectively) at 30 C. The product formation of VvGT14a (0.2 g purified enzyme) was linear for at least 90 minutes. K.sub.M and k.sub.cat values were obtained for geraniol, citronellol, nerol, terpineol, 8-hydroxylinalool, and linalool with a constant UDP-glucose level (108 M) and for UDP-glucose with a fixed geraniol concentration (100 M; Table 2). The kinetic parameters were deteiiiiined from a hyperbolic Michaelis-Menten saturation curves. Due to the low conversion rates of 8-hydroxylinalool, terpineol and linalool, the amount of purified enzyme was increased (2, 2, and 10 g protein, respectively).
[0275] Interestingly, the K.sub.M and k.sub.cat value of VvGT14a for citronellol. geraniol, nerol and UDP-glucose was quite similar (K.sub.M 9-10 M; k.sub.cat 0.02 sec.sup.1; k.sub.cat/K.sub.m 2.0-2.6 sec.sup.1 mM.sup.1), while the kinetic data for 8-hydroxylinalool, terpineol and linalool explained the significantly lower enzyme activity towards these substrates. The kinetic data of VvGT15a-c (0.5 or 1 g purified enzyme) were maintained for geraniol, S-citronellol, nerol and 8-hydroxylinalool with a fixed UDP-glucose amount (833 M) and for UDP-glucose with a constant geraniol concentration (1.25 mM; Table 2). The formation of geranyl, neryl, and citronellyl -D-glucoside was linear for at least 10 minutes (VvGT15c) and 20 minutes (VvGT15a and b), but was extended for 8-hydroxylinaloyl -D-glucoside up to 30 min (VvGT15c) and 60 min (VvGT15a and b). The kinetic data confirmed the high enzymatic activity of the VvGT15 alleles towards geraniol and UDP-glucose. The K.sub.M and k.sub.cat value for S-citronellol and nerol was similar, whereas 8-hydroxylinalool was a poor substrate. Furthermore, the data illustrated that VGT15c is superior to VvGT15a and b. Kinetics of VvGT16 were calculated for geraniol, citronellol and nerol (Table 2). Product formation of VvGT16 (5 g purified protein) was linear for at least 4 hours. K.sub.M and k.sub.cat values were obtained for the monoterpenes with a constant UDP-glucose level (512.5 M) and for UDP-glucose with a fixed geraniol concentration (1.25 mM). VvGT16 exhibited the lowest enzymatic activity towards the substrates of the tested UGTs.
Example 7
Identification of the Natural Substrates of VvGT14a, VvGT15a-c and VvGT16
[0276] All methods mentioned in this example were carried out as described in Example 1.
[0277] To reveal the natural substrates of VvGT14a, VvGT15a-c and VvGT16 (
[0278] Initially, the aglycone extracts were incubated with the purified recombinant enzymes (VvGT14a, 15a, and 16) using radiolabeled UDP-[.sup.14C] glucose. Formed products were extracted; radioactivity was quantified by liquid scintillation counting and analyzed by radio-TLC (
[0279] VvGT14a and VvGT15a-c readily formed radiolabeled products when incubated with an aglycone library obtained from grape skins of Gewurztraminer 11-18 Gm (
[0280] The features of the present invention disclosed in the specification, the claims, and/or in the accompanying drawings may, both separately and in any combination thereof, be material for realizing the invention in various forms thereof.
TABLE-US-00001 TABLE 1 Amounts of free Monoterpenes and Monoterpene--D-Glucosides in Grape Skins during Grape Ripening Weeks post flowering 6 9 11 13 15 17 White Riesling 239-34 Gm Linalool free n.d. n.d. n.d. n.d. 0.13 0.18 n.d. -D-Glucosides n.d. n.d. n.d. 0.10 0.08 0.17 0.01 1.71 0.54 Nerol free n.d. n.d. n.d. n.d. n.d. n.d. -D-Glucosides n.d. n.d. n.d. n.d. n.d. 0.05 0.03 Geraniol free n.d. n.d. 0.09 0.01 0.25 0 0.26 0.15 n.d. -D-Glucosides n.d. n.d. n.d. n.d. 0.06 0.02 0.14 0.06 Citronellol free n.d. n.d. 0.03 0.01 0.05 0.01 n.d. n.d. -D-Glucosides n.d. n.d. n.d. 0.03 0.02 n.d. n.d. White Riesling 24-196 Gm Linalool free n.d. n.d. n.d. n.d. 0.11 0 n.d. -D-Glucosides n.d. n.d. n.d. 0.07 0.02 0.27 0.02 0.61 0.1 Nerol free n.d. n.d. n.d. n.d. 0.08 0 n.d. -D-Glucosides n.d. n.d. n.d. n.d. 0.01 0.01 n.d. Geraniol free 0.11 0.03 0.06 0 0.17 0 0.24 0.02 0.48 0.01 0.67 0.04 -D-Glucosides n.d. n.d. n.d. 0.02 0 0.07 0.02 0.14 0.02 Citronellol free 0.05 0 n.d. n.d. 0.06 0.02 0.09 0.01 n.d. -D-Glucosides n.d. n.d. n.d. n.d. n.d. n.d. Gewurztraminer FR 46-107 Linalool free n.d. n.d. n.d. n.d. -D-Glucosides n.d. n.d. n.d. n.d. Nerol free n.d. n.d. n.d. n.d. -D-Glucosides n.d. n.d. n.d. 0.01 0.01 Geraniol free n.d. 0.11 0.01 n.d. 0.20 0.01 -D-Glucosides 0.02 0.02 n.d. 0.01 0.002 0.03 0.04 Citronellol free n.d. n.d. n.d. n.d. -D-Glucosides n.d. n.d. n.d. n.d. Gewurztraminer Linalool free n.d. n.d. n.d. n.d. n.d. n.d. 11-18 Gm -D-Glucosides n.d. 0.1 0.04 n.d. n.d. n.d. n.d. Nerol free n.d. n.d. 0.13 0.02 0.71 0.04 1.25 0.15 1.75 0.05 -D-Glucosides n.d. n.d. 0.06 0.01 0.23 0.11 0.72 0.22 0.87 0.2 Geraniol free 0.44 0.06 0.88 0.06 0.81 0.07 2.62 0.38 3.47 0.66 5.26 0.52 -D-Glucosides 0.08 0 0.04 0.01 0.18 0.01 0.55 0.16 1.72 0.18 1.53 0.4 Citronellol free 0.12 0.03 0.31 0.01 0.27 0.02 0.49 0.01 0.48 0.1 0.51 0.02 -D-Glucosides 0.09 0.01 0.08 0.02 0.12 0.01 0.21 0.06 0.48 0.02 0.29 0.06 Muscat a petits grains blanc FR 90 Linalool free 0.06 0.02 n.d. n.d. 0.13 0.02 3.03 0.01 0.62 0.12 -D-Glucosides 0.11 0 0.12 0.03 n.d. 0.05 0.01 0.27 0.10 0.37 0.16 Nerol free n.d. n.d. 0.16 0.03 0.31 0.04 0.78 0.15 0.94 0.05 -D-Glucosides 0.03 0 0.04 0.02 n.d. 0.09 0.02 0.47 0.05 0.57 0.10 Geraniol free 0.18 0.04 0.53 0.06 1.64 0.62 1.00 0.21 1.20 0.21 1.21 0.13 -D-Glucosides 0.03 0 0.07 0.03 0.05 0.03 0.09 0.02 0.45 0.09 0.24 0.08 Citronellol free 0.09 0.03 0.11 0.01 0.20 0.06 0.15 0.01 0.21 0 0.23 0 -D-Glucosides n.d. 0.07 0.04 0.04 0.02 0.04 0.01 0.12 0.05 n.d. Plant material was prepared and analyzed as described in Methods. Grapes were collected during grape ripening at the indicated weeks post flowering. n.d.: not detected, : not determined, Amounts are listed in mg/kg grape skins. n = 2
TABLE-US-00002 TABLE 2 Kinetics of VvGT14, 15a-c and 16. K.sub.M k.sub.cat k.sub.cat/K.sub.M enzyme Substrate [M] [sec.sup.1] [sec.sup.1 mM.sup.1] VvGT14 citronellol (rac) 9 0.3 0.02 2.5 Geraniol 9 1.2 0.02 2.6 Nerol 10 0.7 0.02 2.0 8-hydroxylinalool 48 2.0 0.002 0.03 Terpineol 33 4.4 0.003 0.1 linalool (rac) 47 0.1 0.0003 0.01 UDP-glucose 16 0.03 0.03 1.6 VvGT15a S-citronellol 29 3.0 0.02 0.9 Geraniol 63 2.4 0.12 1.9 Nerol 48 1.7 0.04 0.7 8-hydroxylinalool 32 1.4 0.003 0.1 UDP-glucose 49 12.0 0.18 3.7 VvGT15b S-citronellol 55 1.3 0.03 0.6 Geraniol 81 1.0 0.10 1.2 Nerol 40 3.7 0.03 0.8 8-hydroxylinalool 33 1.8 0.003 0.1 UDP-glucose 43 1.0 0.17 4.1 VvGT15c S-citronellol 20 1.6 0.03 1.8 Geraniol 43 0.7 0.17 3.9 Nerol 28 0.9 0.06 2.2 8-hydroxylinalool 17 0.2 0.004 0.3 UDP-glucose 51 1.6 0.26 5.0 VvGT16 citronellol (rac) 108 2.5 0.008 0.07 Geraniol 355 14.sup. 0.015 0.04 Nerol 118 4.7 0.009 0.08 UDP-glucose 149 10.sup. 0.013 0.09
TABLE-US-00003 TABLE3 GenespecificprimersusedforGeXP. Allprimersarechimericcontainingauniversaltagsequence attheir5-end(uncapitalized).Thefinalconcentrationof eachreverseprimerintheGeXPreversetranscription reactionisgivenunderconc.TheCRIBI-Genomicsaccessionnumbers (http://genomes.cribi.unipd.it)aregivenunderlocusID. gene locusID primer Sequence conc. product SEQIDNO VvActin VIT_04s0044g00580 for aggtgacactatagaataCTTG 0.1nM 119bp SEQIDNO:3 CATCCCTCAGCACCTT VvActin VIT_04s0044g00580 rev gtacgactcactatagggaTCC SEQIDNO:4 TGTGGACAATGGATGGA VvAP47 VIT_02s0012g00910 for aggtgacactatagaataTGTT 1nM 304bp SEQIDNO:5 GTTGAGGCTGTTGCGCTGT VvAP47 VIT_02s0012g00910 rev gtacgactcactatagggaAGG SEQIDNO:6 CCCTCTCTCCTCCAACCAA VvPP2A VIT_01s0011g03280 for aggtgacactatagaataAGGG 2nM 152bp SEQIDNO:7 TTGTGCCACACTGGGC VvPP2A VIT_0ls0011g03280 rev gtacgactcactatagggaGCA SEQIDNO:8 ACCATGTAGCGAACACGCC VvSAND VIT_06s0004g02820 for aggtgacactatagaataACCC 2nM 166bp SEQIDNO:9 CTTTGCTCGGAGGAACAGA VvSAND VIT_06s0004g02820 rev gtacgactcactatagggaACC SEQIDNO:10 TGAAGCTTGCCTTGTCGC VvTIP41 VIT_03s0091g00270 for aggtgacactatagaataGCTA 1nM 144bp SEQIDNO:11 CCGGAAACCAGCGGGC VvTIP41 VIT_03s0091g00270 rev gtacgactcactatagggaGCA SEQIDNO:12 ATCCATGCCGTCCATCCGT VvGT14 VIT_18s0001g06060 for aggtgacactatagaataTGTG 12.5nM 374bp SEQIDNO:13 GCTTCATGGCCTATGTGCA VvGT14 VIT_18s0001g06060 rev gtacgactcactatagggaCCG SEQIDNO:14 GAAGTAGCTGAAGAGGACCA VvGT15 VIT_06s0004g05780 for aggtgacactatagaataTCCG 50nM 363bp SEQIDNO:15 GACGGCTTATCTGATGGCC VvGT15 VIT_06s0004g05780 rev gtacgactcactatagggaTGA SEQIDNO:16 GGGGATGAAGCTCAGGCACTG VvGT16 VIT_03s0017g01130 for aggtgacactatagaataGCAG 50nM 248bp SEQIDNO:17 TTTCGCCCTCTTATTGATGGA VvGT16 VIT_03s0017g01130 rev gtacgactcactatagggaAGC SEQIDNO:18 TTTGGAAGCACTGTCCGTT
TABLE-US-00004 TABLE4 PrimersusedinPCRforsubsequentcloning andsequencing.TheCRIBI-Genomicsaccession numbers(http://genomes.cribi.unipd.it) aregivenunderlocusID. SEQID gene locusID primer sequence NO VvGT14 VIT_18s0001g06060 for AATGGGTT SEQID CCATGGAG NO:19 AAGCC VvGT14 VIT_18s0001g06060 rev GGAAAGTT SEQID GAGATCTA NO:20 GAGAAGC VvGT15 VIT_06s0004g05780 for TCACCTCT SEQID CAACTCTT NO:21 CCACG VvGT15 VIT_06s0004g05780 rev GAGTTTGG SEQID TTGTACAC NO:22 AACTCTG VvGT16 VIT_03s0017g01130 for TCCTCCCC SEQID AGAGTGCA NO:23 AG VvGT16 VIT_03s0017g01130 rev TGACCAAC SEQID TCCTATAA NO:24 CAG
TABLE-US-00005 TABLE 5 Comparison of different plant glycosyl transferases with respect to their glucosyl transferase activity (k.sub.cat/K.sub.M [s.sup.1M.sup.1]) for nerol, geraniol and citronellol. Glycosyl k.sub.cat/K.sub.M transferase Organism Substrate [s.sup.1M.sup.1] VvGT7 V. vinifera Nerol 7.0 Geraniol 1.0 Citronellol 1.0 VvGT14 V. vinifera Nerol 2000 Geraniol 2600 Citronellol 2500 VvGT15 V. vinifera Nerol 2200 Geraniol 3900 Citronellol 1800 VvGT16 V. vinifera Nerol 0.08 Geraniol 0.04 Citronellol 0.07 UGT85B1 Sorghum bicolor Nerol 50 (millet) Geraniol 690 Citronellol 690 (Recombinant VvGT7 glycosyl transferase protein (VIT_16s0050g01580) was prepared and analyzed by the same methods as described above for VvGT14-16.)
REFERENCES
[0281] Bowles, D., Lim, E. K., Poppenberger, B., Vaistij, F. E. (2006) Glycosyltransferases of lipophilic small molecules. Annu. Rev. Plant Biol. 57: 567-597.
[0282] Cole, R. B., Tabet, J. C., Salles, C., and Crouzet, J. (1989). Structural memory effects influencing decompositions of glucose alkoxide anions produced from monoterpene glycoside isomers in tandem mass spectrometry. Rapid Commun. Mass Spectrom. 3: 59-61.
[0283] Domon, B. and Costello, C. E. (1988). A systematic nomenclature for carbohydrate fragmentations in FAB-MS/MS spectra of glycoconjugates. Glycoconjugate 5: 397-409.
[0284] Gunata, Z., Bitteur, S. M., Brillouet, J.-M., Bayonove, C. L., and Cordonnier, R. (1988). Sequential enzymic hydrolysis of potenially aromatic glycosides from grape. Carbohydr. Res. 184: 139-149.
[0285] Hansen, K. S., Kristensen, C., Tattersall, D. B., Jones, P. R., Olsen, C.E., Bak, S., and Moller, B. L. (2003). The in vitro substrate regiospecificity of recombinant UGT85B1, the cyanohydrin glucosyltransferase from Sorghum bicolor. Phytochemistry 64: 143-151.
[0286] He, X. Z., Wang, X., and Dixon, R. A. (2006). Mutational analysis of the Medicago glycosyltransferase UGT71G1 reveals residues that control regioselectivity for (iso)flavonoid glycosylation. J. Biol. Chem. 281: 34441-34447.
[0287] Jess Ibarz, M., Ferreira, V., Hernndez-Orte, P., Loscos, N., and Cacho, J. (2006). Optimization and evaluation of a procedure for the gas chromatographic-mass spectrometric analysis of the aromas generated by fast acid hydrolysis of flavor precursors extracted from grapes. J. Chromatogr. A 1116: 217-229.
[0288] Masada, S., Terasaka, K., and Mizukami, H. (2007). A single amino acid in the PSPG-box plays an important role in the catalytic function of CaUGT2 (Curcumin glucosyltransferase), a Group D Family 1 glucosyltransferase from Catharanthus roseus. FEBS Lett. 581: 2605-2610.
[0289] Mateo, J., and Jimenez, M. (2000). Monoterpenes in grape juice and wines. J. Chromatogr. A 881: 557-567.
[0290] Offen, W., Martinez-Fleites, C., Yang, M., Kiat-Lim, E., Davis, B. G., Tarling, C. A., Ford, C. M., Bowles, D. J., and Davies, G. J. (2006). Structure of a flavonoid glucosyltransferase reveals the basis for plant natural product modification. EMBO J. 25: 1396-1405.
[0291] Ono, E., Homma, Y., Horikawa, M., Kunikane-Doi, S., Imai, H., Takahashi, S., Kawai, Y., Ishiguro, M., Fukui, Y., and Nakayama, T. (2010). Functional differentiation of the glycosyltransferases that contribute to the chemical diversity of bioactive flavonol glycosides in grapevines (Vitis vinifera). Plant Cell 22: 2856-2871.
[0292] Pieiro, Z., Palma, M., and Barroso, C. G. (2004). Determination of terpenoids in wines by solid phase extraction and gas chromatography. Anal. Chim. Acta 513: 209-214.
[0293] Reid, K. E., Olsson, N., Schlosser, J., Peng, F., and Lund, S. T. (2006). An optimized grapevine RNA isolation procedure and statistical determination of reference genes for real-time RT-PCR during berry development. BMC Plant Biol. 6: 27.
[0294] Salles, C., Jallageas, J.-C., Beziat, Y., and Cristau, H.-J. (1991). Synthesis of 4- and 10-deuterated neryl and geranyl--D-glucosides and their use in corroboration of a mechanism proposed for the fragmentation of heterosides in tandem mass spectrometry. J. Label. Compd. Radiopharm. 31: 11-22.
[0295] Skouroumounis, G. K. and Sefton, M. A. (2000). Acid-catalyzed hydrolysis of alcohols and their -D-glucopyranosides. J. Agric. Food Chem. 48: 2033-2039.
[0296] Williams, P. J., Strauss, C. R., Wilson, B., and Massy-Westropp, R. A. (1982). Studies on the hydrolysis of Vitis vinifera monoterpene precursor compounds and model monoterpene -D-glucosides rationalizing the monoterpene composition of grapes. J. Agric. Food Chem. 30: 1219-1223.
[0297] Wilson, B, Strauss, C. R. and Williams, P. J. (1986). The distribution of free and glycosidically bound monoterpenes among skin, juice, and pulp fractions of some white grape varieties. Am. J. Enol. Vitic. 37: 107-111.
[0298] Zeng, Y., and Yang, T. (2002). RNA isolation from highly viscous samples rich in polyphenols and polysaccharides. Plant Mol. Biol. Rep. 20: 417.