Method for promoting growth of <i>Akkermansia muciniphila </i>using <i>musa </i>ferments

Abstract

Provided is a method of promoting the growth of Akkermansia muciniphila, including contacting A. muciniphila with an effective amount of a prebiotic composition including a Musa ferment. Also provided is a prebiotic composition including a Musa ferment. The prebiotic composition promotes the growth of A. muciniphila in the intestine, and reduces the body weight, fat percentage, waist circumference, and hip circumference of obese individuals.

Claims

1. A method of promoting the growth of Akkermansia muciniphila, comprising contacting the A. muciniphila with an effective amount of a prebiotic composition comprising a Musa ferment, oligosaccharides, and a sugar alcohol, wherein the oligosaccharides are xylooligosaccharides, the sugar alcohol is lactitol, and the weight ratio of the Musa ferment, the xylooligosaccharides, and the lactitol is 4:3:3.

2. The method of claim 1, wherein the Musa ferment is obtained by a first fermentation and a second fermentation of a mixture of Musa fruit flesh and water, wherein the first fermentation is carried out with Streptococcus thermophilus and Saccharomyces cerevisiae, and the second fermentation is carried out with Acetobacter aceti.

3. The method of claim 2, wherein the mixture of the Musa fruit flesh and water is prepared by mixing the Musa fruit flesh and water at a weight ratio ranging from 1:1 to 1:20.

4. The method of claim 2, wherein 0.1% to 0.4% (w/v) of the S. thermophilus and 0.2% to 0.5% (w/v) of the S. cerevisiae are inoculated into the first fermentation, and wherein 2% to, and 2% to 5% (w/v) of the A. aceti is inoculated into the second fermentation.

5. A prebiotic composition for promoting the growth of Akkermansia muciniphila, comprising a Musa ferment, oligosaccharides, and a sugar alcohol, wherein the oligosaccharides are xylooligosaccharides, the sugar alcohol is lactitol, and the weight ratio of the Musa ferment, the xylooligosaccharides, and the lactitol is 4:3:3.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 shows the relative bacterial count of Akkermansia muciniphila after 48 hours of anaerobic incubation in a culture medium with or without a single candidate probiotic;

(2) FIG. 2 shows the relative bacterial count of A. muciniphila after 48 hours of anaerobic incubation in a culture medium with or without the indicated prebiotic composition;

(3) FIG. 3A shows the percentage of the subjects with or without increased proportion of A. muciniphila in the intestinal tract after administration for four weeks of a prebiotic composition according to one embodiment of the present invention;

(4) FIG. 3B shows the relative bacterial count of A. muciniphila in the intestine of the subjects shown in FIG. 3A that had increased proportion of A. muciniphila;

(5) FIG. 4 shows the change in the body weight of participants after administration for four weeks of a prebiotic composition according to one embodiment of the present invention;

(6) FIG. 5 shows the change in the body fat percentage of participants after administration for four weeks of a prebiotic composition according to one embodiment of the present invention;

(7) FIG. 6 shows the change in the trunk fat percentage of participants after administration for four weeks of a prebiotic composition according to one embodiment of the present invention;

(8) FIG. 7 shows the change in the waist circumference of participants after administration for four weeks of a prebiotic composition according to one embodiment of the present invention; and

(9) FIG. 8 shows the change in the hip circumference of participants after administration for four weeks of a prebiotic composition according to one embodiment of the present invention.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENT

(10) The present invention provides a method of promoting growth of A. muciniphila, including contacting the A. muciniphila with an effective amount of a prebiotic composition including a Musa ferment. In addition to the Musa ferment, the prebiotic composition may further include oligosaccharides selected from the group consisting of xylooligosaccharides, isomaltooligosaccharides, and combinations thereof, and a sugar alcohol such as sorbitol, mannitol, erythritol, maltitol, lactitol, and xylitol. The prebiotic composition preferably includes the Musa ferment, xylooligosaccharides, and lactitol, and the weight ratio of the Musa ferment, the xylooligosaccharides, and the lactitol is 3-5: 2-4: 2-4. The following examples show the promoting effects of the components of the prebiotic composition and their combinations on the growth of A. muciniphila, as well as the ability of the prebiotic composition to reduce the body weight, body or trunk fat percentage, waist circumference, and hip circumference of the obese subjects.

(11) Definition

(12) Numerical quantities provided herein are approximated, experimental values that may vary within 20 percent, preferably within 10 percent, and most preferably within 5 percent. Thus, the terms “about” and “approximately” refer to within 20 percent, preferably within 10 percent, and most preferably within 5 percent of a given value or range.

(13) The term “Musa” as used herein refers to all species belonging to the Musa genus, including Musa paradisiaca (bananas, also known as plantains), Musa acuminata, and Musa balbisiana.

(14) The term “xylooligosaccharides” as used herein refers to oligosaccharides containing 3 to 10 xylose units. They may be derived from plants, or prepared by microbial fermentation, enzyme transformation, or chemical synthesis.

(15) The expression “an effective amount” as used herein refers to the amount of a composition required to elicit a particular effect in a subject. As appreciated by those skilled in the art, the effective amount will vary depending on the route of administration, the use of excipients, and the possible co-administration with other substances.

(16) Materials and Methods

(17) Preparation of Musa Ferments

(18) Musa species are rich in phenols and pectin. Fermentation of Musa species will produce a ferment with more abundant constituents.

(19) The Musa ferment used in Examples 1-3 is a banana ferment, the preparation of which is briefly described below. The banana fruit flesh and water are first mixed at a weight ratio of 1:1 to 1:20, preferably 1:1 to 1:5, to serve as a basal medium. After pasteurized, the basal medium is inoculated with Streptococcus thermophilus and Saccharomyces cerevisiae cells to obtain a first fermentation broth, and a first fermentation is carried out at 29° C. to 31° C. for 72 hours. In the first fermentation, 0.1% to 0.4% (w/v) of the Streptococcus thermophilus and 0.2% to 0.5% (w/v) of the Saccharomyces cerevisiae are inoculated. Thereafter, the first fermentation broth is inoculated with 0.5% to 1% (w/v) of Acetobacter aceti, and a second fermentation is carried out at 29° C. to 31° C. for 21 days to obtain the banana ferment. The banana ferment can be made into a powdery product by drying processes such as vacuum drying and spray drying.

(20) In one embodiment, the S. thermophilus is the S. thermophilus BCRC 910636 strain (a deposited strain described in the Taiwan Patent I519644) purchased from Bioresource Collection and Research Center (BCRC) at the Food Industry Research and Development Institute. In another embodiment, the S. cerevisiae is the S. cerevisiae BCRC 21494 strain purchased from BCRC (also deposited under American Type Culture Collection (ATCC) 4126). In yet another embodiment, the A. aceti is the A. aceti BCRC 11688 strain purchased from BCRC (also deposited under ATCC 15973) or the Acetobacter BCRC 12324 strain.

(21) Oligosaccharides, Polysaccharides and Sugar Alcohols

(22) The oligosaccharides used in the Examples described herein include xylooligosaccharides (purchased from Shandong Longli Biotechnology Co., Ltd., China), isomaltooligosaccharides (purchased from Shandong Bailong Chuangyuan Biotechnology Co., Ltd., China), and fructooligosaccharides (purchased from MEIJI CO., Ltd). The polysaccharides used herein include inulin (purchased from Cosucra Groupe Warcoing SA). The sugar alcohols used herein include lactitol (purchased from Hongwei Biotechnology Co., Ltd, Taiwan), sorbitol, mannitol, erythritol, maltitol, and xylitol.

(23) Bacterial Culture

(24) The Akkermansia muciniphila used in the Examples described herein is the Akkermansia muciniphila BCRC 81048 strain purchased from BCRC at the Food Industry Research and Development Institute (also deposited under ATCC BAA-835). For subsequent use in the prebiotic test, the A. muciniphila strain, after thawed and activation, was inoculated at 3% and pre-cultured in BHI medium (15 g BD Difco Brain Heart Infusion broth (Thermo Fischer Scientific) dissolved in 1 L deionized water at a pH value of about 7.0) at 37° C. under an anaerobic condition (10% carbon dioxide, 10% hydrogen, and 80% nitrogen) for 48 hours.

(25) Determination of Intestinal Bacterial Proportions

(26) The feces of the participants were collected, and fecal genomic DNA samples were prepared using the Stool Genomic DNA Extraction kit (Biotools) according to the manufacturer's instructions. The DNA concentration of the samples was determined with a Nanodrop Spectrometer (Thermo Fisher Scientific). Thereafter, DNA content of each of the target bacteria in the samples was measured based on quantitative polymerase chain reaction (qPCR). Briefly, the DNA samples were subjected to qPCR on a PCR thermocycler (Step One Plus Real-Time PCR system; Applied Biosystems) using KAPA CYBR FAST qPCR Kit (2X) (KAPA Biosystems) and the primers for the indicative DNA sequences and the 16S ribosomal RNA (16S rRNA) gene of the target bacteria (Table 1). The cycle threshold (C.sub.T) values were obtained for the indicative DNA sequences and the 16S rRNA gene of the target bacteria, and the difference between C.sub.T values was used to calculate fold change according to the 2.sup.−ΔCT formula. The proportion of a specific bacterial population in the intestine is expressed as a percentage and estimated as the ratio of the average fold change (obtained from repeated experiments) for a specific population's indicative DNA sequence to the sum of all populations' average fold changes.

(27) TABLE-US-00001 TABLE 1 SEQ Target Nucleotide sequence of forward ID bacteria (F) and reverse (R) primers NO Firmicutes F: GGAGYATGTGGTTTAATTCGAAGCA 1 R: AGCTGACGACAACCATGCAC 2 Bacteroidetes F: GGARCATGTGGTTTAATTCGATGAT 3 R: AGCTGACGACAACCATGCAG 4 Proteobacteria F: ACTCCTACGGGAGGCAGCAG 5 R: TCTACGRATTTCACCYCTAC 6 Actinobacteria F: TACGGCCGCAAGGCTA 7 R: TCRTCCCCACCTTCCTCCG 8 Bifidobacteria F: CGCGTCYGGTGTGAAAG 9 R: CCCCACATCCAGCATCCA 10 Lactobacillus F: GAGGCAGCAGTAGGGAATCTTC 11 R: GGCCAGTTACTACCTCTATCCTTCTTC 12 Alistipes F: ACGGCTCACCAAGGCTACGATACATAG 13 R: CCTCCGTATTACCGCGGCTGCT 14 Prevotella F: TCGTGGGGTCGGGTTGCAGACC 15 R: CAGTTGCCATCGGGTGATGCCG 16 Faecali- F: CCATGAATTGCCTTCAAAACTGTT 17 bacterium R: GAGCCTCAGCGTCAGTTGGT 18 prausnitzii A. muciniphila F: GCGGACGGCACATGATACTGCGAG 19 R: GCTTAACGCGTTAGCTCCGGCAC 20 Fusobacterium F: GCGCGTCTAGGTGGTTATGTAAGTCTG 21 nucleatum ATGTG 22 R: TTTGCTACCCACGCTTTCGCGC Roseburia F: TGCAAGTCGAACGAAGC 23 hominis R: CGGCTACTGATCGTCG 24 Clostridium F: GGTAAAGAGCGGCGGACGGG 25 difficile R: CTGATCGTCGCCTTGGTAAGCCG 26 Helicobacter F: GCGGGACAAGCAGCTAGCCC 27 pylori R: GCTGATCGCCCTGCTCCAC 28 CagA gene Conservative F: ACTCCTACGGGAGGCAGCAG 29 sequence of R: ATTACCGCGGCTGCTGG 30 16S rRNA gene

EXAMPLE 1

(28) Prebiotic Test for A. muciniphila

(29) In order to identify the nutrients beneficial to the growth of A. muciniphila, pre-cultured A. muciniphila was inoculated at 3% in BHI medium containing 1% (w/w) of the candidate prebiotics and incubated at 37° C. under anaerobic conditions for 48 hours. The bacterial culture was then spread on BHI agar plates and incubated for 72 hours for bacterial counting. The candidate prebiotic was selected from xylooligosaccharides, isomaltooligosaccharides, lactitol, inulin, fructooligosaccharides, and a banana ferment. For comparison, A. muciniphila was alternatively incubated in BHI medium without candidate prebiotics (control group).

(30) FIG. 1 shows the effects of the various candidate prebiotics on the growth of A. muciniphila; and the relative bacterial count for the control group was defined as 100%. According to FIG. 1, the prebiotics that significantly increased the bacteria count, compared with the control group, include the banana ferment, xylooligosaccharides, isomaltooligosaccharides, and lactitol, which resulted in the relative bacterial counts of about 283%, 266%, 276%, and 258%, respectively. In contrast, inulin and fructooligosaccharides, well-known to promote the growth of Lactobacillus and Bifidobacteria, respectively, cannot significantly enhance the growth of A. muciniphila, and the relative bacterial counts after applications of these two sugars were about 110% (data not shown). The results indicate that each of the banana ferment, xylooligosacchandes, isomaltooligosaccharides, and lactitol can be used as prebiotics for A. muciniphila, but not any prebiotics beneficial for the Lactobacillus (such as fructooligosaccharides and inulin) can effectively promote the growth of A. muciniphila.

EXAMPLE 2

(31) Prebiotic Composition for Promoting Growth of A. muciniphila

(32) In order to assess the promoting effect of different combinations of the aforementioned A. muciniphila prebiotics on the growth of A. muciniphila, pre-cultured A. muciniphila was inoculated at 3% in BHI medium supplemented with different prebiotic compositions and incubated at 37° C. under anaerobic conditions for 48 hours. The bacterial culture was then spread on BHI agar plates and incubated for 72 hours for bacterial counting. The constituents (w/w %) for each prebiotic compositions added to the BHI medium are provided below: (a) 0.25% banana ferment, 0.25% isomaltooligosaccharides, 0.25% xylooligosaccharides, and 0.25% lactitol; (b) 0.4% banana ferment, 0.3% xylooligosaccharides, and 0.3% lactitol; (c) 0.4% banana ferment, 0.3% isomaltooligosaccharides, and 0.3% lactitol; or (d) 0.4% banana ferment, 0.3% isomaltooligosaccharides, and 0.3% xylooligosaccharides. For comparison, A. muciniphila was alternatively incubated in BHI medium without prebiotics (control group).

(33) FIG. 2 shows the effects of the aforementioned prebiotic combinations on the growth of A. muciniphila; and the relative bacterial count for the control group was defined as 100%. According to FIG. 2, the addition of the prebiotic composition (a), (b), (c), or (d) to the medium significantly increased the relative counts of A. muciniphila to approximately 289%, 331%, 298%, and 294%, respectively, compared with the control group. Particularly, the combination of the banana ferment, xylooligosaccharides, and lactitol promotes the growth of A. muciniphila most effectively at the weight ratio of 3-5: 2-4: 2-4, even though lactitol was least effective in promoting growth as shown in FIG. 1.

EXAMPLE 3

(34) Physiological Effects of the Prebiotic Composition

(35) In this example, the physiological effects of continuous administration of the prebiotic composition described herein on obese participants were investigated. Seven obese participants aged 20 to 55 (including male and female) were orally administered for four weeks a prebiotic composition in capsule form containing 200 mg of banana ferment, 150 mg of xylooligosaccharides, and 150 mg of lactitol (i.e., daily dosage of 500 mg/per person/per day) after lunch. These participants were examined before and after four weeks for the proportion of A. muciniphila in the intestine. In addition, a body composition monitor (TANITA BC-601FS) was used to measure the body weight, body fat percentage, trunk fat percentage, waist circumference, and hip circumference. The obese participants are individuals with a body mass index (BMI) greater than 24 and a body fat percentage greater than 25% (for male) or greater than 30% (for female).

(36) According to FIGS. 3A and 3B, 85.7% of the participants were found to have a significantly increased proportion of A. muciniphila in the intestine after administration of the prebiotic composition for four weeks, and the number of A. muciniphila increased by about 80% with respect to before the administration. The results demonstrate that the prebiotic composition described herein can promote the growth of A. muciniphila in the intestine of living subjects.

(37) According to FIG. 4 to FIG. 8, administration of the prebiotic composition for four weeks cause, on average, a decrease of approximately 0.39 kg in the body weight, a decrease of about 0.4% in the body fat percentage, a significant decrease of about 0.5% in the trunk fat percentage, a significant decrease of approximately 1.8 cm in the waist circumference, and a significant decrease of about 0.5 cm in the hip circumference, compared with before administration. The results show that long-term use of the prebiotic composition of the present invention can improve physical conditions of obese subjects.

(38) In conclusion, the present invention discloses a variety of prebiotics and combinations thereof that benefit the growth of A. muciniphila. The combination of these prebiotics can be used to prepare a prebiotic composition that effectively promotes the growth of A. muciniphila, for example, a culture medium supplement for in vitro bacterial culture, or a prebiotic product that enhances A. muciniphila proliferation in the human intestine. The prebiotic composition may be in the form of powders, granules, solutions, or capsules, and may be manufactured as a medicament, food, drink, or nutritional supplement that may be administered to a subject orally.

(39) The present invention has been described with reference to the above preferred embodiments. However, it will be apparent to those skilled in the art that modifications and changes in form and detail may be made without departing from the scope of the present invention defined by the appended claims.