METHOD FOR DESIGNING A DRUG REGIME FOR HIV-INFECTED PATIENTS

20170198330 ยท 2017-07-13

    Inventors

    Cpc classification

    International classification

    Abstract

    The instant disclosure describes a novel genotype and phenotype assay to elucidate and/or evaluate new potential HIV integrase inhibitors, but also currently approved and experimental compounds that target protease, reverse transcriptase, and RNaseH. This assay allows studying linked mutations and mutational patterns that occur under HAART and experimental therapies.

    Claims

    1. An in vitro method according to claim 1 for designing a drug regime for an HIV-infected patient by determining the phenotypic susceptibility of HIV to at least one drug, comprising: i) using at least one sample comprising HIV RNA from a patient, wherein the sample comprises the complete HIV reverse transcriptase-integrase coding sequence; ii) reverse-transcribing and amplifying the HIV RNA with primers specific for the complete HIV reverse transcriptase-integrase coding sequence to obtain at least one amplicon comprising the complete HIV reverse transcriptase-integrase coding sequence, wherein at least one primer is selected from SEQ ID NO: 4-7; iii) generating a plasmid comprising a reference HIV sequence with a deletion of the complete HIV reverse transcriptase-integrase coding sequence; iv) preparing at least one recombinant virus by recombination or ligation between at least one amplicon obtained in step ii) and the plasmid comprising the reference HIV sequence with a deletion of the complete HIV reverse transcriptase-integrase coding sequence obtained in step iii), and v) monitoring at least one recombinant virus in the presence of at least one drug to determine the phenotypic susceptibility of HIV to at least one drug, wherein said susceptibility is determined by the cytopathogenicity of said recombinant virus to cells or by determining the replicative capacity of said recombinant virus in the presence of at least one drug.

    2. The method of claim 1 wherein said plasmid is HXB2D_eGFP_delta[RT-INT] (SEQ ID NO:51).

    3. An in vitro method according to claim 1 for designing a drug regime for an HIV-infected patient by determining the phenotypic susceptibility of HIV to at least one drug, comprising: i) using at least one sample comprising HIV DNA, wherein the sample comprises the complete HIV reverse transcriptase-integrase coding sequence; ii) amplifying the HIV DNA with primers specific for the complete HIV reverse transcriptase-integrase coding sequence to obtain at least one amplicon comprising the complete HIV reverse transcriptase-integrase coding sequence, wherein at least one primer is selected from SEQ ID NO: 4-7; iii) generating a plasmid comprising a reference HIV sequence with a deletion of the complete HIV reverse transcriptase-integrase coding sequence; iv) preparing at least one recombinant virus by recombination or ligation between at least one amplicon obtained in step ii) and the plasmid comprising the reference HIV sequence with a deletion of the complete HIV reverse transcriptase-integrase coding sequence obtained in step iii), and v) monitoring at least one recombinant virus in the presence of at least one drug to determine the phenotypic susceptibility of HIV to at least one drug, wherein said susceptibility is determined by the cytopathogenicity of said recombinant virus to cells or by determining the replicative capacity of said recombinant virus in the presence of at least one drug.

    4. The method of claim 3 wherein said plasmid is HXB2D_eGFP_delta[RT-INT] (SEQ ID NO:51).

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0012] FIGS. 1A-1G show a schematic representation for creating the GAG-POL vector backbone based on the HXB2D_eGFP HIV-1 vector. FIGS. 1A-1D, 1F, and 1G illustrate certain digestion/ligation vector manipulations, while FIG. 1E depicts PCR amplification of Fragment A.

    [0013] FIG. 2 provides a more detailed schematic representation of the inverse PCR described for creating the GAG-POL vector backbone based on the HXB2D_eGFP HIV-1 vector.

    [0014] FIG. 3 depicts the primer binding sites for the inverse PCR described for creating the GAG-POL vector backbone based on the HXB2D_eGFP HIV-1 vector.

    [0015] FIGS. 4A-4G show a schematic representation for creating the RT-INT vector backbone based on the HXB2D_eGFP HIV-1 vector. FIGS. 4A-4D, 4F, and 4G illustrate certain digestion/ligation vector manipulations, while FIG. 4E depicts PCR amplification of Fragment X.

    [0016] FIG. 5 provides a more detailed schematic representation of the inverse PCR described for creating the RT-INT vector backbone based on the HXB2D_eGFP HIV-1 vector.

    [0017] FIG. 6 depicts the primer binding sites for the inverse PCR described for creating the RT-INT vector backbone based on the HXB2D_eGFP HIV-1 vector.

    [0018] FIGS. 7A-7G show a schematic representation for creating the GAG-PR vector backbone based on the HXB2D_eGFP HIV-1 vector. FIGS. 7A-7D, 7F, and 7G illustrate certain digestion/ligation vector manipulations, while FIG. 7E depicts PCR amplification of Fragment A.

    [0019] FIG. 8 provides a more detailed schematic representation of the inverse PCR described for creating the GAG-PR vector backbone based on the HXB2D_eGFP HIV-1 vector.

    [0020] FIG. 9 depicts the primer binding sites for the inverse PCR described for creating the GAG-PR vector backbone based on the HXB2D_eGFP HIV-1 vector.

    [0021] FIG. 10 is a flow chart summarizing an experimental process for determining the phenotype of viruses produced using a GAG-POL, GAG-PR or RT-INT vector.

    [0022] FIGS. 11A-11R show the dose-response curves 1 GAG-POL RVS for all drugs tested.

    [0023] FIGS. 12A-12G show a schematic representation for creating the delta[POL] vector backbone based on the HXB2D_eGFP HIV-1 vector. FIGS. 12A-12D, 12F, and 12G illustrate certain digestion/ligation vector manipulations, while FIG. 12E depicts PCR amplification of Fragment A.

    [0024] FIG. 13 depicts the primer binding sites for the inverse PCR described for creating the delta[POL] vector backbone based on the HXB2D_eGFP HIV-1 vector.

    DETAILED DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS

    [0025] In contrast to the amplicon mentioned above as used in the Antivirogram, the amplicon described in the instant invention and referred to as 5 LTR-Vif fragment contains the complete gag and complete pol (PR-RT-INT) coding region (4588 bp in HXB2D, GenBank accession number K03455).

    [0026] Gag is the Group-specific Antigen protein, encoding the structural capsid proteins. The proteins are produced as a GAG precursor polyprotein, which is processed by the viral protease.

    [0027] Other amplicons used in the current invention are the amplicon spanning the Gag cleavage sites p1/p7 and p1/p6, PR, RT, RNaseH and INT (3202 bp), referred to as Pol fragment, the amplicon containing the Gag and PR coding sequence (1980 bp), referred to as Gag-PR fragment, and the amplicon containing the complete RT, RNaseH and INT coding sequence (2898 bp), named RT-INT fragment.

    [0028] The current disclosure describes an in vitro method for designing a drug regimen for an HIV-infected patient by determining the phenotypic susceptibility of HIV to at least one drug, comprising:

    [0029] i) using at least one sample comprising HIV RNA from a patient, wherein the sample comprises the complete HIV gag-pol coding region;

    [0030] ii) reverse-transcribing and amplifying the HIV RNA with primers specific for the complete HIV gag-pol coding region to obtain at least one amplicon comprising the complete HIV gag-pol coding region, wherein at least one primer is selected from SEQ ID NO: 1-4;

    [0031] iii) generating a plasmid comprising a reference HIV sequence with a deletion of the complete HIV gag-pol coding region;

    [0032] iv) preparing at least one recombinant virus by recombination or ligation between at least one amplicon obtained in step ii) and the plasmid comprising the reference HIV sequence with a deletion of the complete HIV gag-pol coding region obtained in step iii), and

    [0033] v) monitoring the at least one recombinant virus in the presence of the at least one drug to determine the phenotypic susceptibility of HIV to at least one drug,

    [0034] wherein said susceptibility is determined by the cytopathogenicity of said recombinant virus to cells or by determining the replicative capacity of said recombinant virus in the presence of at least one drug.

    [0035] The instant disclosure describes an in vitro method for designing a drug regimen for an HIV-infected patient by determining the phenotypic susceptibility of HIV to at least one drug, comprising:

    [0036] i) using at least one sample comprising HIV RNA from a patient, wherein the sample comprises the region spanning the HIV gag-protease coding sequence;

    [0037] ii) reverse-transcribing and amplifying the HIV RNA with primers specific for the region spanning the HIV gag-protease coding sequence to obtain at least one amplicon comprising the region spanning the HIV gag-protease coding sequence, wherein at least one primer is selected from SEQ ID NO: 1 and SEQ ID NO: 8-10;

    [0038] iii) generating a plasmid comprising a reference HIV sequence with a deletion of the region spanning the HIV gag-protease coding sequence;

    [0039] iv) preparing at least one recombinant virus by recombination or ligation between at least one amplicon obtained in step ii) and the plasmid comprising the reference HIV sequence with a deletion of the region spanning the HIV gag-protease coding sequence obtained in step iii), and

    [0040] v) monitoring the at least one recombinant virus in the presence of the at least one drug to determine the phenotypic susceptibility of HIV to at least one drug,

    [0041] wherein said susceptibility is determined by the cytopathogenicity of said recombinant virus to cells or by determining the replicative capacity of said recombinant virus in the presence of at least one drug.

    [0042] Furthermore the present disclosure also comprises an in vitro method for designing a drug regimen for an HIV-infected patient by determining the phenotypic susceptibility of HIV to at least one drug, comprising:

    [0043] i) using at least one sample comprising HIV RNA from a patient, wherein the sample comprises the complete HIV reverse transcriptase-integrase coding sequence;

    [0044] ii) reverse-transcribing and amplifying the HIV RNA with primers specific for the complete HIV reverse transcriptase-integrase coding sequence to obtain at least one amplicon comprising the complete HIV reverse transcriptase-integrase coding sequence, wherein at least one primer is selected from SEQ ID NO: 4-7;

    [0045] iii) generating a plasmid comprising a reference HIV sequence with a deletion of the complete HIV reverse transcriptase-integrase coding sequence;

    [0046] iv) preparing at least one recombinant virus by recombination or ligation between at least one amplicon obtained in step ii) and the plasmid comprising the reference HIV sequence with a deletion of the complete HIV reverse transcriptase-integrase coding sequence obtained in step iii), and

    [0047] v) monitoring the at least one recombinant virus in the presence of the at least one drug to determine the phenotypic susceptibility of HIV to at least one drug,

    [0048] wherein said susceptibility is determined by the cytopathogenicity of said recombinant virus to cells or by determining the replicative capacity of said recombinant virus in the presence of at least one drug.

    [0049] The current invention also applies to an in vitro method for designing a drug regimen for an HIV-infected patient by determining the phenotypic susceptibility of HIV to at least one drug, comprising:

    [0050] i) using at least one sample comprising HIV DNA, wherein the sample comprises the complete HIV gag-pol coding region;

    [0051] ii) amplifying the HIV DNA with primers specific for the complete HIV gag-pol coding region to obtain at least one amplicon comprising the complete HIV gag-pol coding region, wherein at least one primer is selected from SEQ ID NO: 1-4;

    [0052] iii) generating a plasmid comprising a reference HIV sequence with a deletion of the complete HIV gag-pol coding region;

    [0053] iv) preparing at least one recombinant virus by recombination or ligation between at least one amplicon obtained in step ii) and the plasmid comprising the reference HIV sequence with a deletion of the complete HIV gag-pol coding region obtained in step iii), and

    [0054] v) monitoring the at least one recombinant virus in the presence of the at least one drug to determine the phenotypic susceptibility of HIV to at least one drug,

    [0055] wherein said susceptibility is determined by the cytopathogenicity of said recombinant virus to cells or by determining the replicative capacity of said recombinant virus in the presence of at least one drug.

    [0056] In addition the disclosure describes an in vitro method for designing a drug regimen for an HIV-infected patient by determining the phenotypic susceptibility of HIV to at least one drug, comprising:

    [0057] i) using at least one sample comprising HIV DNA, wherein the sample comprises the region spanning the HIV gag-protease coding sequence;

    [0058] ii) amplifying the HIV DNA with primers specific for the region spanning the HIV gag-protease coding sequence to obtain at least one amplicon comprising the region spanning the HIV gag-protease coding sequence, wherein at least one primer is selected from SEQ ID NO: 1 and SEQ ID NO: 8-10;

    [0059] iii) generating a plasmid comprising a reference HIV sequence with a deletion of the region spanning the HIV gag-protease coding sequence;

    [0060] iv) preparing at least one recombinant virus by recombination or ligation between at least one amplicon obtained in step ii) and the plasmid comprising the reference HIV sequence with a deletion of the region spanning the HIV gag-protease coding sequence obtained in step iii), and

    [0061] v) monitoring the at least one recombinant virus in the presence of the at least one drug to determine the phenotypic susceptibility of HIV to at least one drug,

    [0062] wherein said susceptibility is determined by the cytopathogenicity of said recombinant virus to cells or by determining the replicative capacity of said recombinant virus in the presence of at least one drug.

    [0063] The disclosure also comprises an in vitro method for designing a drug regimen for an HIV-infected patient by determining the phenotypic susceptibility of HIV to at least one drug, comprising:

    [0064] i) using at least one sample comprising HIV DNA, wherein the sample comprises the complete HIV reverse transcriptase-integrase coding sequence;

    [0065] ii) amplifying the HIV DNA with primers specific for the complete HIV reverse transcriptase-integrase coding sequence to obtain at least one amplicon comprising the complete HIV reverse transcriptase-integrase coding sequence, wherein at least one primer is selected from SEQ ID NO: 4-7;

    [0066] iii) generating a plasmid comprising a reference HIV sequence with a deletion of the complete HIV reverse transcriptase-integrase coding sequence;

    [0067] iv) preparing at least one recombinant virus by recombination or ligation between at least one amplicon obtained in step ii) and the plasmid comprising the reference HIV sequence with a deletion of the complete HIV reverse transcriptase-integrase coding sequence obtained in step iii), and

    [0068] v) monitoring the at least one recombinant virus in the presence of the at least one drug to determine the phenotypic susceptibility of HIV to at least one drug,

    [0069] wherein said susceptibility is determined by the cytopathogenicity of said recombinant virus to cells or by determining the replicative capacity of said recombinant virus in the presence of at least one drug.

    [0070] A further embodiment of the invention is an in vitro method for determining the phenotypic susceptibility of HIV to at least one drug, comprising:

    [0071] i) using at least one sample comprising HIV RNA from a patient, wherein the sample comprises the complete HIV gag-pol coding region;

    [0072] ii) reverse-transcribing and amplifying said HIV RNA with primers specific for the complete HIV gag-pol coding region to obtain an amplicon comprising the complete HIV gag-pol coding region, wherein at least one primer is selected from SEQ ID NO: 1-4;

    [0073] iii) determining the nucleotide sequence of the amplicon or a portion thereof as obtained in step ii), and

    [0074] iv) comparing the nucleotide sequence of the amplicon with the sequence of sequences whose phenotypic susceptibility is known to estimate the phenotypic susceptibility of HIV to at least one drug,

    [0075] wherein said susceptibility is determined by the cytopathogenicity of said recombinant virus to cells or by determining the replicative capacity of said recombinant virus in the presence of at least one drug.

    [0076] Part of the invention is also wherein the embodiment is an in vitro method for determining the phenotypic susceptibility of HIV to at least one drug, comprising:

    [0077] i) using at least one sample comprising HIV RNA from a patient, wherein the sample comprises the region spanning the HIV gag-protease coding sequence;

    [0078] ii) reverse-transcribing and amplifying said HIV RNA with primers specific for the region spanning the HIV gag-protease coding sequence to obtain an amplicon comprising the region spanning the HIV gag-protease coding region, wherein at least one primer is selected from SEQ ID NO: 1 and SEQ ID NO: 8-10;

    [0079] iii) determining the nucleotide sequence of the amplicon or a portion thereof as obtained in step ii), and

    [0080] iv) comparing the nucleotide sequence of the amplicon with the sequence of sequences whose phenotypic susceptibility is known to estimate the phenotypic susceptibility of HIV to at least one drug,

    [0081] wherein said susceptibility is determined by the cytopathogenicity of said recombinant virus to cells or by determining the replicative capacity of said recombinant virus in the presence of at least one drug.

    [0082] In addition the invention relates to an in vitro method for determining the phenotypic susceptibility of HIV to at least one drug, comprising:

    [0083] i) using at least one sample comprising HIV RNA from a patient, wherein the sample comprises the complete HIV reverse transcriptase-integrase coding sequence;

    [0084] ii) reverse-transcribing and amplifying said HIV RNA with primers specific for the complete HIV reverse transcriptase-integrase coding sequence to obtain an amplicon comprising the complete HIV reverse transcriptase-integrase coding region, wherein at least one primer is selected from SEQ ID NO: 4-7;

    [0085] iii) determining the nucleotide sequence of the amplicon or a portion thereof as obtained in step ii), and

    [0086] iv) comparing the nucleotide sequence of the amplicon with the sequence of sequences whose phenotypic susceptibility is known to estimate the phenotypic susceptibility of HIV to at least one drug,

    [0087] wherein said susceptibility is determined by the cytopathogenicity of said recombinant virus to cells or by determining the replicative capacity of said recombinant virus in the presence of at least one drug.

    [0088] To the invention also belongs an in vitro method for determining the phenotypic susceptibility of HIV to at least one drug, comprising:

    [0089] i) using at least one sample comprising HIV DNA wherein the sample comprises the complete HIV gag-pol coding region;

    [0090] ii) amplifying said HIV DNA with primers specific for the complete HIV gag-pol coding region to obtain an amplicon comprising the complete HIV gag-pol coding region, wherein at least one primer is selected from SEQ ID NO: 1-4;

    [0091] iii) determining the nucleotide sequence of the amplicon or a portion thereof as obtained in step ii), and

    [0092] iv) comparing the nucleotide sequence of the amplicon with the sequence of sequences whose phenotypic susceptibility is known to estimate the phenotypic susceptibility of HIV to at least one drug,

    [0093] wherein said susceptibility is determined by the cytopathogenicity of said recombinant virus to cells or by determining the replicative capacity of said recombinant virus in the presence of at least one drug.

    [0094] The above embodiment of the invention can be extended to an in vitro method for determining the phenotypic susceptibility of HIV to at least one drug using at least one sample comprising HIV DNA wherein the sample comprises the region spanning the HIV gag-protease coding sequence using the appropriate primers SEQ ID NO: 1 and SEQ ID NO: 8-10 or wherein the sample comprises the complete HIV reverse transcriptase-integrase coding region using the appropriate primers selected from SEQ ID NO 4-7 respectively.

    [0095] Part of the invention is also an in vitro method for designing a drug regimen for an HIV-infected patient by determining the phenotypic susceptibility of HIV to at least one drug, comprising:

    [0096] i) using at least one sample comprising HIV RNA from a patient, wherein the sample comprises the complete HIV pol coding region;

    [0097] ii) reverse-transcribing and amplifying the HIV RNA with primers specific for the complete HIV pol coding region to obtain at least one amplicon comprising the complete HIV pol coding region, wherein at least one primer is selected from SEQ ID NO's: 2, 4, 53 and 54;

    [0098] iii) generating a plasmid comprising a reference HIV sequence with a deletion of the complete HIV pol coding region;

    [0099] iv) preparing at least one recombinant virus by recombination or ligation between at least one amplicon obtained in step ii) and the plasmid comprising the reference HIV sequence with a deletion of the complete HIV pol coding region obtained in step iii), and

    [0100] v) monitoring at least one recombinant virus in the presence of at least one drug to determine the phenotypic susceptibility of HIV to at least one drug,

    [0101] wherein said susceptibility is determined by the cytopathogenicity of said recombinant virus to cells or by determining the replicative capacity of said recombinant virus in the presence of at least one drug.

    [0102] In addition also to the invention belongs an in vitro method for designing a drug regime for an HIV-infected patient by determining the phenotypic susceptibility of HIV to at least one drug, comprising:

    [0103] i) using at least one sample comprising HIV DNA, wherein the sample comprises the complete HIV pol coding region;

    [0104] ii) amplifying the HIV DNA with primers specific for the complete HIV pol coding region to obtain at least one amplicon comprising the complete HIV pol coding region, wherein at least one primer is selected from SEQ ID NO: 2, 4, 53 and 54;

    [0105] iii) generating a plasmid comprising a reference HIV sequence with a deletion of the complete HIV pol coding region;

    [0106] iv) preparing at least one recombinant virus by recombination or ligation between at least one amplicon obtained in step ii) and the plasmid comprising the reference HIV sequence with a deletion of the complete HIV pol coding region obtained in step iii), and

    [0107] v) monitoring at least one recombinant virus in the presence of at least one drug to determine the phenotypic susceptibility of HIV to at least one drug,

    [0108] wherein said susceptibility is determined by the cytopathogenicity of said recombinant virus to cells or by determining the replicative capacity of said recombinant virus in the presence of at least one drug

    [0109] The disclosure further describes a method of constructing a genotypic and phenotypic database of HIV sequences, comprising:

    [0110] i) using samples of HIV RNA from a patient comprising the complete HIV gag-pol coding region;

    [0111] ii) reverse-transcribing and amplifying said HIV RNA with primers specific for the complete HIV gag-pol coding region to obtain an amplicon comprising the complete HIV gag-pol coding region, wherein at least one primer is selected from SEQ ID NO: 1-4;

    [0112] iii) determining the nucleotide sequence of the amplicon or portions thereof as obtained in step ii);

    [0113] iv) generating a plasmid comprising a reference HIV sequence with a deletion of the complete HIV gag-pol coding region;

    [0114] v) preparing recombinant virus by recombination or ligation between the amplicon obtained in step ii) and the plasmid comprising the reference HIV sequence with a deletion of the complete HIV gag-pol coding region obtained in step iv);

    [0115] vi) determining the relative replicative capacity of the recombinant virus in the presence of anti-HIV drugs compared to an HIV with a reference complete HIV gag-pol coding region.

    [0116] The disclosure also comprises an in vitro method of constructing a genotypic and phenotypic database of HIV sequences, comprising:

    [0117] i) using samples of HIV DNA comprising the complete HIV gag-pol coding region;

    [0118] ii) amplifying said HIV DNA with primers specific for the complete HIV gag-pol coding region to obtain an amplicon comprising the complete HIV gag-pol coding region, wherein at least one primer is selected from SEQ ID NO: 1-4;

    [0119] iii) determining the nucleotide sequence of the amplicon or portions thereof as obtained in step ii);

    [0120] iv) generating a plasmid comprising a reference HIV sequence with a deletion of the complete HIV gag-pol coding region;

    [0121] v) preparing recombinant virus by recombination or ligation between the amplicon obtained in step ii) and the plasmid comprising the reference HIV sequence with a deletion of the complete HIV gag-pol coding region obtained in step iv);

    [0122] vi) determining the relative replicative capacity of the recombinant virus in the presence of anti-HIV drugs compared to an HIV virus with a reference complete HIV gag-pol coding region.

    [0123] The above embodiments of the invention of constructing a genotypic and phenotypic database of HIV sequences can be extended to using at least one sample comprising either HIV RNA or DNA wherein the sample comprises the region spanning the HIV gag-protease coding sequence using the appropriate primers SEQ ID NO: 1 and SEQ ID NO: 8-10 or wherein the sample comprises the complete HIV reverse transcriptase-integrase coding region using the appropriate primers selected from SEQ ID NO 4-7 respectively.

    [0124] Part of the invention is also a method of constructing a genotypic and phenotypic database of HIV sequences, comprising:

    [0125] i) using samples of HIV RNA from a patient comprising the complete HIV pol coding region;

    [0126] ii) reverse-transcribing and amplifying said HIV RNA with primers specific for the complete HIV pol coding region to obtain an amplicon comprising the complete HIV pol coding region, wherein at least one primer is selected from SEQ ID NO: 2, 4, 53 and 54;

    [0127] iii) determining the nucleotide sequence of the amplicon or portions thereof as obtained in step ii);

    [0128] iv) generating a plasmid comprising a reference HIV sequence with a deletion of the complete HIV pol coding region;

    [0129] v) preparing recombinant virus by recombination or ligation between the amplicon obtained in step ii) and the plasmid comprising the reference HIV sequence with a deletion of the complete HIV pol coding region obtained in step iv);

    [0130] vi) determining the relative replicative capacity of the recombinant virus in the presence of anti-HIV drugs compared to an HIV with a reference complete HIV pol coding region.

    [0131] In addition to the invention also belongs an in vitro method of constructing a genotypic and phenotypic database of HIV sequences, comprising:

    [0132] i) using samples of HIV DNA comprising the complete HIV pol coding region;

    [0133] ii) amplifying said HIV DNA with primers specific for the complete HIV pol coding region to obtain an amplicon comprising the complete HIV pol coding region, wherein at least one primer is selected from SEQ ID NO: 2, 4, 53 and 54;

    [0134] iii) determining the nucleotide sequence of the amplicon or portions thereof as obtained in step ii);

    [0135] iv) generating a plasmid comprising a reference HIV sequence with a deletion of the complete HIV pol coding region;

    [0136] v) preparing recombinant virus by recombination or ligation between the amplicon obtained in step ii) and the plasmid comprising the reference HIV sequence with a deletion of the complete HIV pol coding region obtained in step iv);

    [0137] vi) determining the relative replicative capacity of the recombinant virus in the presence of anti-HIV drugs compared to an HIV virus with a reference complete HIV pol coding region.

    [0138] The present invention also comprises the plasmids or sometimes called vectors described in the experimental part and the use of these plasmids or vectors in the methods described herein. The HIV sequence incorporated in the plasmid or vector may be based on the K03455 sequence. The complete HIV sequence may be incorporated or only part thereof. A suitable plasmid backbone may be selected from the group including pUC, pSV or pGEM.

    [0139] To prepare vectors containing recombinant HIV gag-pol coding sequences, the patient derived gag-pol RNA was reverse transcribed and amplified by the polymerase chain reaction (PCR), then inserted into a vector containing the wild type HIV genome sequence but lacking a complete gag-pol coding region. Different primer combinations were initially used to obtain the amplified DNA sequences from patient samples. The 5 to 3 sequences and the primers identified as SEQ ID's NO: 1-10, more specifically SEQ ID NO's: 1-4 were successfully used to reverse transcribe and PCR amplify gag-pol coding region are listed below in Table 7.

    [0140] To prepare a vector containing recombinant HIV gag-protease coding sequence, the patient derived gag-protease RNA was reverse transcribed and amplified by the polymerase chain reaction (PCR), then inserted into a vector containing the wild type HIV genome sequence but lacking gag-protease coding region. Different primer combinations were initially used to obtain the amplified DNA sequences from patient samples. The 5 to 3 sequences and the primers identified as SEQ ID's NO: 1-10, more specifically SEQ ID NO: 1 and SEQ ID NO's 8-10 were successfully used to reverse transcribe and PCR amplify gag-protease coding region are listed below in Table 7.

    [0141] To prepare a vector containing recombinant HIV reverse transcriptase-integrase coding sequence, the patient derived reverse transcriptase-integrase RNA was reverse transcribed and amplified by the polymerase chain reaction (PCR), then inserted into a vector containing the wild type HIV genome sequence but lacking reverse transcriptase-integrase coding region. Different primer combinations were initially used to obtain the amplified DNA sequences from patient samples. The 5 to 3 sequences and the primers identified as SEQ ID's NO: 1-10, more specifically SEQ ID NO: 4-7 were successfully used to reverse transcribe and PCR amplify reverse transcriptase-integrase coding region are listed below in Table 7.

    [0142] To prepare a vector containing recombinant HIV pol coding sequences, the patient derived pol RNA was reverse transcribed and amplified by the polymerase chain reaction (PCR), then inserted into a vector containing the wild type HIV genome sequence but lacking a complete pol coding region. Different primer combinations were initially used to obtain the amplified DNA sequences from patient samples. The 5 to 3 sequences and the primers identified as SEQ ID's NO: 2, 4, 53 and 54 were successfully used to reverse transcribe and PCR amplify pol coding region and are listed below in Table 7.

    [0143] Reverse transcription and amplification may be performed with a single set of primers. Alternatively, more than one set of primers may be used in a hemi-nested approach to reverse transcribe and amplify the genetic material. Particularly, more than one set of primer is used in a nested approach. Following the generation of the recombinant construct, the chimeric virus may be grown and the viral titer determined (expressed as 50% cell culture infectious dose, CCID50) before proceeding to the determination of the phenotypic susceptibility.

    [0144] Chimeric means a construct comprising nucleic acid material from different origin such as for example a combination of wild type HIV with a laboratory HIV virus, a combination of wild type HIV sequence and patient derived HIV sequence.

    [0145] The indicator gene, encoding a signal indicative of replication of the virus in the presence of a drug or indicative of the susceptibility of the virus in the presence of a drug may be present in the culturing cells such as MT-4 cells. In addition, said indicator gene may be incorporated in the chimeric construct introduced into the culturing cells or may be introduced separately. Suitable indicator genes encode fluorescent proteins, particularly green fluorescent protein (GFP) or mutants thereof such as eGFP (enhanced GFP).

    [0146] Genetic material may be introduced into the cells using a variety of techniques known in the art including, calcium phosphate precipitation, liposomes, viral infection, and electroporation. The monitoring may be performed in high throughput.

    [0147] A human immunodeficiency virus (HIV), as used herein refers to any HIV including laboratory HIV strains, wild type HIV strains, mutant HIV strains and any biological sample comprising HIV such as a HIV clinical isolate. HIV strains compatible with the present invention are those strains capable of infecting mammals, particularly humans such as HIV-1 and HIV-2. A patient may have HIV in his body with different mutations in the integrase (IN) gene. It is to be understood that a sample may contain a variety of different HIV containing different mutational profiles in the IN gene. A sample may be obtained for example from an individual, from cell cultures, or generated using recombinant technology, or cloning. Viral strains used for obtaining a plasmid are preferably HIV wild-type sequences, such as LAI or HXB2D. LAI, also known as IIIB, is a wild type HIV strain. One particular clone thereof, this means one sequence, is HXB2D. This sequence may be incorporated into a plasmid.

    [0148] Instead of viral RNA, HIV DNA, e.g. proviral DNA, may be used for the methods described herein. In case RNA is used, reverse transcription into DNA by a suitable reverse transcriptase is needed. The protocols describing the analysis of RNA are also amenable for DNA analysis. However, if a protocol starts from DNA, the person skilled in the art will know that no reverse transcription is needed. The primers designed to amplify the RNA strand, also anneal to, and amplify DNA. Reverse transcription and amplification may be performed with a single set of primers. Suitably a hemi-nested and more suitably a nested approach may be used to reverse transcribe and amplify the genetic material.

    [0149] Nucleic acid may be amplified by techniques such as polymerase chain reaction (PCR), nucleic acid sequence based amplification (NASBA), self-sustained sequence replication (3SR), transcription-based amplification (TAS), ligation chain reaction (LCR). Preferably the polymerase chain reaction is used.

    [0150] Any type of patient sample may be used to obtain the integrase gene, such as serum or tissue. Viral RNA may be isolated using known methods such as described in Boom, R. et al. (J. Clin. Microbiol. 28(3): 495-503 (1990)). Alternatively, a number of commercial methods such as the QIAAMP viral RNA kit (Qiagen, Inc.) or EasyMag RNA extraction platform (Biomrieux, Boxtel, the Netherlands) may be used to obtain viral RNA from bodily fluids such as plasma, serum, or cell-free fluids. DNA may be obtained by procedures known in the art (e.g. Maniatis, 1989) and commercial procedures (e.g. Qiagen).

    [0151] According to the instant invention, for instance, the complete HIV gag and complete pol (Protease-reverse transcriptase-integrase) coding region (4588 bp) is used to prepare an amplicon.

    [0152] Amplicon refers to the amplified, and where necessary, reverse transcribed complete gag-protease-reverse transcriptase-integrase sequence.

    [0153] It should be understood that this complete gag-protease-reverse transcriptase-integrase sequence may be of diverse origin including plasmids and patient material. Suitably, the amplicon is obtained from patient material.

    [0154] For the purpose of the present invention the amplicon is sometimes referred to as DNA construct. A viral sequence may contain one or multiple mutations versus the consensus reference sequence given by HXB2D, GenBank accession number K03455. Said sequence, K03455, is present in Genbank and available through the Internet. A single mutation or a combination of mutations may correlate to a change in drug efficacy. This correlation may be indicative of an altered i.e. decreased or increased susceptibility of the virus for a drug. Said mutations may also influence the viral fitness.

    [0155] A drug means any agent such as a chemotherapeutic, peptide, antibody, antisense, ribozyme and any combination thereof. Examples of drugs include protease inhibitors including darunavir, ritonavir, amprenavir, nelfinavir; reverse transcriptase inhibitors such as nevirapine, delavirdine, AZT, zidovudine, didanosine; integrase inhibitors; agents interfering with envelope (such as T-20).

    [0156] Treatment or treatment regimen refers to the therapeutic management of an individual by the administration of drugs. Different drug dosages, administration schemes, administration routes and combinations may be used to treat an individual.

    [0157] An alteration in viral drug sensitivity is defined as a change in susceptibility of a viral strain to said drug. Susceptibilities are generally expressed as ratios of EC.sub.50 or EC.sub.90 values (the EC.sub.50 or EC.sub.90 value being the drug concentration at which 50% or 90% respectively of the viral population is inhibited from replicating) of a viral strain under investigation compared to the wild type strain. Hence, the susceptibility of a viral strain towards a certain drug can be expressed as a fold change in susceptibility, wherein the fold change is derived from the ratio of for instance the EC.sub.50 values of a mutant viral strain compared to the wild type EC.sub.50 values. In particular, the susceptibility of a viral strain or population may also be expressed as resistance of a viral strain, wherein the result is indicated as a fold increase in EC.sub.50 as compared to wild type IC.sub.50.

    [0158] The IC.sub.50 is the drug concentration at which 50% of the enzyme activity is inhibited.

    [0159] The susceptibility of HIV to a drug is tested by either determining the cytopathogenicity of the recombinant virus to cells or by determining the replicative capacity of the recombinant virus in the presence of at least one drug, relative to the replicative capacity of a wild type or reference HIV.

    [0160] In the context of this invention, the cytopathogenic effect means the viability of the cells in culture in the presence of chimeric viruses. The cells may be chosen from T cells, monocytes, macrophages, dendritic cells, Langerhans cells, hematopoetic stem cells or precursor cells, MT4 cells and PM-1 cells. The cytopathogenicity may, for example, be followed microscopically, or replication might be monitored by the presence of any reporter molecule including reporter genes. A reporter gene is defined as a gene whose product has reporting capabilities. Suitable reporter molecules include tetrazolium salts, green fluorescent proteins, beta-galactosidase, chloramfenicol transferase, alkaline phophatase, and luciferase. Several methods of cytopathogenic testing including phenotypic testing are described in the literature comprising the recombinant virus assay (Kellam and Larder, Antimicrob. Agents Chemotherap. 1994, 38, 23-30, Hertogs et al. Antimicrob. Agents Chemotherap. 1998, 42, 269-276; Pauwels et al. J. Virol Methods 1988, 20, 309-321)

    [0161] The susceptibility of HIV to a drug may also be determined by the replicative capacity of the recombinant virus in the presence of at least one drug, relative to the replicative capacity of a reference or wild type HIV. Replicative capacity means the ability of the virus or chimeric construct to grow under culturing conditions. This is sometimes referred to as viral fitness. The culturing conditions may contain triggers that influence the growth of the virus, examples of which are drugs. The methods for determining the susceptibility may be useful for designing a treatment regimen for an HIV-infected patient. For example, a method may comprise determining the replicative capacity of a clinical isolate of a patient and using said replicative capacity to determine an appropriate drug regime for the patient.

    [0162] The phenotyping assays of the present invention can be performed at high throughput using, for example, a microtiter plate containing a variety of anti-HIV drugs. The present assays may be used to analyze the influence of changes at the HIV gag-pol gene to any type of drug useful to treat HIV. Examples of anti-HIV drugs that can be tested in this assay include, nucleoside and non-nucleoside reverse transcriptase inhibitors, nucleotide reverse transcriptase inhibitors, protease inhibitors, maturation inhibitors, RNaseH inhibitors and integrase inhibitors, but those of skill in the art will appreciate that other types of antiviral compounds may also be tested. The results may be monitored by several approaches including but not limited to morphology screening, microscopy, and optical methods, such as, for example, absorbance and fluorescence. An IC.sub.50 value for each drug may be obtained in these assays and used to determine viral replicative capacity in the presence of the drug. Apart from IC.sub.50 also e.g. IC.sub.90 can be used. The replicative capacity of the viruses may be compared to that of a wild-type HIV virus to determine a relative replicative capacity value. Data from phenotypic assays may further be used to predict the behaviour of a particular HIV isolate to a given drug based on its genotype.

    [0163] The assays of the present invention may be used for therapeutic drug monitoring. Said approach includes a combination of susceptibility testing, determination of drug level and assessment of a threshold. Said threshold may be derived from population based pharmacokinetic modelling (WO 02/23186). The threshold is a drug concentration needed to obtain a beneficial therapeutic effect in vivo. The in vivo drug level may be determined using techniques such as high performance liquid chromatography, liquid chromatography, mass spectroscopy or combinations thereof. The susceptibility of the virus may be derived from phenotyping or interpretation of genotyping results i.e. virtual phenotyping (WO 01/79540).

    [0164] The assays of the present invention may be useful to discriminate an effective drug from an ineffective drug by establishing cut-offs i.e. biological cut-offs (see e.g. WO 02/33402). A biological cut-off is drug specific. These cut-offs are determined following phenotyping a large population of individuals containing wild type viruses. The cut-off is derived from the distribution of the fold increase in resistance of the virus for a particular drug.

    [0165] The genotype of the patient-derived gag-pol coding region may be determined directly from the amplified DNA, i.e. the DNA construct by performing DNA sequencing. Alternatively, the sequence may be obtained after sub-cloning into a suitable vector. A variety of commercial sequencing enzymes and equipment may be used in this process. The efficiency may be increased by determining the sequence of the gag-pol coding region in several parallel reactions, each with a different set of primers. Such a process could be performed at high throughput on a multiple-well plate, for example. Commercially available detection and analysis systems may be used to determine and store the sequence information for later analysis.

    [0166] The nucleotide sequence may be obtained using several approaches including sequencing nucleic acids. This sequencing may be performed using techniques including gel based approaches, mass spectroscopy and hybridisation. However, as more resistance related mutations are identified, the sequence at particular nucleic acids, codons or short sequences may be obtained. If a particular resistance associated mutation is known, the nucleotide sequence may be determined using hybridisation assays (including Biochips, LipA-assay), mass spectroscopy, allele specific PCR, or using probes or primers discriminating between mutant and wild-type sequence. A selected set of sequencing primers includes SEQ ID No's: 11-44 and 55-58 respectively (Table 10). This particular selection has the advantage that it enables the sequencing of the complete HIV gag-pol coding sequence. Consequently, using this set of primers all possible mutations that may occur in the HIV gag or pol gene may be detected.

    [0167] The patient gag-pol genotype provides an additional means to determine drug susceptibility of a virus strain. Phenotyping is a lengthy process often requiring 2 or more weeks to accomplish. Therefore, systems have been developed which enable the prediction of the phenotype based on the genotypic results. The results of genotyping may be interpreted in conjunction with phenotyping and eventually be subjected to database interrogation. A suitable system is virtual phenotyping (WO 01/79540). In the virtual phenotyping process the complete gag-pol genes may be used. Alternatively, portions of the genes may be used. Also combinations of mutations, preferentially mutations indicative of a change in drug susceptibility, may be used. A combination of mutations is sometimes referred to as a hot-spot (see e.g. WO 01/79540). Briefly, in the process of virtual phenotyping, the genotype of a patient derived gag-pol sequence may be correlated to the phenotypic response of said patient derived gag-pol sequence. If no phenotyping is performed, the sequence may be screened towards a collection of sequences present in a database. Identical sequences are retrieved and the database is further interrogated to identify if a corresponding phenotype is known for any of the retrieved sequences. In this latter case a virtual phenotype may be determined. A report may be prepared including the IC.sub.50 of the viral strain for one or more therapies, the sequence of the strain under investigation, and the biological cut-offs.

    [0168] According to the methods described herein a database may be constructed comprising genotypic and phenotypic data of the HIV gag-pol sequences, wherein the database further provides a correlation between genotypes and phenotypes, wherein the correlation is indicative of efficacy of a given drug regimen. A database of gag-pol sequences may be created and used as described in WO 01/79540. For example, such a database may be analyzed in combination with gag, pol, protease, reverse transcriptase or integrase sequence information and the results used in the determination of appropriate treatment strategies. Said database containing a collection of genotypes, phenotypes and samples for which the combined genotype/phenotype are available, may be used to determine the virtual phenotype (see supra). In addition, instead of interrogating the complete gag-pol sequences, particular codons correlating to a change in drug susceptibility of the virus may be interrogated in such database.

    [0169] A primer may be chosen from SEQ ID N.sup.o 1-10, 53 and 54. A particular set of primers is SEQ ID 1-4 and 53 and 54. Primers specific for the gag-pol region of the HIV genome such as the primers described herein and their homologs are disclosed to perform the assay according to the invention. The primer sequences listed herein may be labelled. Suitably, this label may be detected using fluorescence, luminescence or absorbance. The primer for creating a deletion construct may contain a portion that does not anneal to the HIV sequence. That portion may be used to introduce a unique restriction site. Interestingly, primers may be designed in which the unique restriction site is partially present in the HIV sequence. The primers are chosen from those listed herein or have at least 80% homology as determined by methods known by the person skilled in the art such BLAST or FASTA. Specifically, the homology is at least 90%, more specifically, at least 95%. In addition, primers located in a region of 50 nucleotides (nt) upstream or downstream from the sequences given herein constitute part of the invention. Especially, said region is 20 nucleotides up or downstream from the position in the HIV genome of the primer sequences given herein. Alternatively, primers comprising at least 8 consecutive bases present in either of the primers described here constitute one embodiment of the invention. Interestingly, the primers comprise at least 12 consecutive bases present in either of the primers described herein.

    Examples

    [0170] General Outline

    [0171] An amplicon was generated from patient-derived plasma viral RNA by RT-PCR and nested PCR. This amplicon, further referred to as 5LTR-Vif fragment, contains the complete Gag and complete Pol (PR-RT-INT) coding region (4588 bp). Sequence primers across the 5 end of HIV-1 allow for nucleotide sequence determination and genotypic drug resistance analysis.

    [0172] A delta[Gag-Pol] backbone (SEQ ID NO: 49) was made starting from an HIV-1 vector that contains eGFP in the Nef coding region. In vitro cloning (using BD In-Fusion Clontech Laboratories Inc.) between the PCR-generated amplicon and the delta[Gag-Pol] backbone resulted in a fully replication-competent HIV-1 that was used in experiments to evaluate phenotypic drug resistance.

    [0173] Further, an amplicon spanning the Gag cleavage sites p1/p7 and p1/p6, PR, RT, RNaseH and INT (3202 bp), referred to as Pol fragment, was evaluated together with an amplicon containing the Gag and PR coding sequence (1980 bp), referred to as Gag-PR fragment, and an amplicon containing the complete RT, RNaseH and INT coding sequence (2898 bp), named RT-INT fragment.

    [0174] For phenotypic evaluation delta[Pol] (SEQ ID NO: 52) delta[Gag-PR] (SEQ ID NO: 50) and delta[RT-INT] HIV-1 (SEQ ID NO: 51) backbones, also containing eGFP (enhanced Green Fluorescent protein) in Nef, were designed respectively.

    [0175] Protocol for Amplification of 5LTR-VIF Fragment

    [0176] Starting from freshly prepared patient-derived RNA, 5 l was mixed with 0.2 M forward outer primer (5LTR_IF1=SEQ ID NO: 1) and 0.2 M reverse outer primer (VIF_R2=SEQ ID NO: 2), 1 Superscript reaction buffer (containing 0.4 mM of each dNTP and 2.5 mM MgSO.sub.4) and 0.5 l Superscript III HIFI enzyme mix in a total volume of 25 l (Table 1). The reverse transcription reaction was performed @ 53 C. for 30 min, followed by an initial denaturation @ 94 C. for 2 min. This was followed by 30 cycles of [denaturation @ 92 C. for 15 sec, annealing @ 55 C. for 30 sec and elongation @ 68 C. for 5 min]. The final elongation step was 10 min @ 68 C. (Table 2).

    [0177] Subsequently, 1 l of outer PCR product was mixed with 0.304 M forward inner primer (5LTR_F2=SEQ ID NO: 3) and 0.304 M reverse inner primer (VIF_R5=SEQ ID NO: 4), 1 Expand HIFI reaction buffer, 0.2 l dNTP's (0.2 mM) and 0.3 l Expand HIFI enzyme mix (=1.05 U) in a total volume of 25 l (Table 1).

    [0178] The inner PCR reaction consists of an initial denaturation @ 94 C. for 2 min, followed by 35 cycles of [denaturation @ 94 C. for 15 sec, annealing @ 61 C. for 30 sec and elongation @ 68 C. for 5 min]. The final elongation step was 10 min @ 68 C. (Table 2).

    [0179] All reaction mixtures and samples were kept on ice during preparation. The outer and inner primers used to generate this amplicon can be found in Table 7.

    [0180] Finally, 4 l PCR product was mixed with 2 l loading dye, loaded on a 1% agarose gel and stained with ethidium bromide for visualization.

    TABLE-US-00001 TABLE 1 Composition of the RT-outer PCR mix and inner PCR mix for amplification of the 5LTR-VIF fragment. RT-outer PCR mix inner PCR mix volume/ volume/ sample sample component (l) component (l) DEPC.water 6.5 DEPC.water 20.24 2 x reaction buffer 12.5 10 x reaction buffer 2.5 5LTR_IF1 primer 0.25 5LTR_F2 primer (20 M) 0.38 (20 M) VIF_R2 primer (20 M) 0.25 VIF_R5 primer (20 M) 0.38 Superscript III HiFi 0.5 dNTP's (25 mM) 0.2 RNA 5 Expand HiFi (3.5 U/l) 0.3 total volume (l) 25 OUT_sample 1 total volume (l) 25

    TABLE-US-00002 TABLE 2 Thermal cycling conditions for the outer and inner PCR for amplification of the 5LTR-VIF fragment. step temperature ( C.) time cycles outer PCR 5LTR-VIF fragment 1 53 30 min 2 94 2 min 3 92 15 s 30 4 55 30 s 5 68 5 min 6 68 10 min 7 4 hold inner PCR 5LTR-VIF fragment 1 94 2 min 2 94 15 s 35 3 61 30 s 4 68 5 min 5 68 10 min 6 4 hold

    [0181] Protocol for Amplification of Pol Fragment

    [0182] Starting from freshly prepared patient-derived RNA, 5 l was mixed with 0.2 M forward outer primer (5OUT=SEQ ID NO: 53) and 0.2 M reverse outer primer (VIF_R2=SEQ ID NO: 2), 1 Superscript reaction buffer (containing 0.4 mM of each dNTP and 2.5 mM MgSO.sub.4) and 0.5 l Superscript III HIFI enzyme mix in a total volume of 25 l (Table 12). The reverse transcription reaction was performed @ 53 C. for 30 min, followed by an initial denaturation @ 94 C. for 2 min. This was followed by 30 cycles of [denaturation @ 92 C. for 15 sec, annealing @ 55 C. for 30 sec and elongation @ 68 C. for 3 min 30 sec]. The final elongation step was 10 min @ 68 C. (Table 13).

    [0183] Subsequently, 1 l of outer PCR product was mixed with 0.304 M forward inner primer (5IN=SEQ ID NO: 54) and 0.304 M reverse inner primer (VIF_R5=SEQ ID NO: 4), 1 Expand HIFI reaction buffer, 0.2 l dNTP's (0.2 mM) and 0.3 l Expand HIFI enzyme mix (=1.05 U) in a total volume of 25 l (Table 12).

    [0184] The inner PCR reaction consists of an initial denaturation @ 94 C. for 2 min, followed by 35 cycles of [denaturation @ 94 C. for 15 sec, annealing @ 58 C. for 30 sec and elongation @ 68 C. for 3 min 30 sec]. The final elongation step was 10 min @ 68 C. (Table 13).

    [0185] All reaction mixtures and samples were kept on ice during preparation. The outer and inner primers used to generate this amplicon can be found in Table 7.

    [0186] Finally, 4 l PCR product was mixed with 2 l loading dye, loaded on a 1% agarose gel and stained with ethidium bromide for visualization.

    TABLE-US-00003 TABLE 12 Composition of the RT-outer PCR mix and inner PCR mix for amplification of the Pol fragment. RT-outer PCR mix inner PCR mix volume/ volume/ sample sample component (l) component (l) DEPC.water 6.5 DEPC.water 20.24 2 x reaction buffer 12.5 10 x reaction buffer 2.5 5LTR_IF1 primer 0.25 5LTR_F2 primer (20 M) 0.38 (20 M) VIF_R2 primer (20 M) 0.25 VIF_R5 primer (20 M) 0.38 Superscript III HiFi 0.5 dNTP's (25 mM) 0.2 RNA 5 Expand HiFi (3.5 U/l) 0.3 total volume (l) 25 OUT_sample 1 total volume (l) 25

    TABLE-US-00004 TABLE 13 Thermal cycling conditions for the outer and inner PCR for amplification of the Pol fragment. step temperature ( C.) time cycles outer PCR Pol fragment 1 53 30 min 2 94 2 min 3 92 15 s 30 4 55 30 s 5 68 3 min 30 sec 6 68 10 min 7 4 hold inner PCR Pol fragment 1 94 2 min 2 94 15 s 35 3 58 30 s 4 68 3 min 30 sec 5 68 10 min 6 4 hold

    [0187] Protocol for Amplification of RT-INT Fragment

    [0188] Starting from freshly prepared patient-derived RNA, 5 l was mixed with 0.2 M forward outer primer (PR_F1=SEQ ID NO: 5) and 0.2 M reverse outer primer (VIF_R3=SEQ ID NO: 6), 1 Superscript reaction buffer (containing 0.4 mM of each dNTP and 2.5 mM MgSO.sub.4) and 0.5 l Superscript III HIFI enzyme mix in a total volume of 25 l (Table 3). The reverse transcription reaction was performed @ 56 C. for 30 min, followed by an initial denaturation @ 94 C. for 2 min. This was followed by 30 cycles of [denaturation @ 92 C. for 15 sec, annealing @ 62 C. for 30 sec and elongation @ 68 C. for 3 min 30 sec]. The final elongation step was 10 min @ 68 C. (Table 4).

    [0189] Subsequently, 1 l of outer PCR product was mixed with 0.304 M forward inner primer (PR_F3=SEQ ID NO: 7) and 0.304 M reverse inner primer (VIF_R5=SEQ ID NO: 4), 1 Expand HIFI reaction buffer, 0.2 l dNTP's (0.2 mM) and 0.3 l Expand HIFI enzyme mix (=1.05 U) in a total volume of 25 l (Table 3)

    [0190] The inner PCR reaction consists of an initial denaturation @ 94 C. for 2 min, followed by 35 cycles of [denaturation @ 94 C. for 15 sec, annealing @ 60 C. for 30 sec and elongation @ 68 C. for 3 min]. The final elongation step was 10 min @ 68 C. (Table 4).

    [0191] All reaction mixtures and samples were kept on ice during preparation. The outer and inner primers used to generate this amplicon can be found in Table 7.

    [0192] Finally, 4 l PCR product was mixed with 2 l loading dye, loaded on a 1% agarose gel and stained with ethidium bromide for visualization.

    TABLE-US-00005 TABLE 3 Composition of the RT-outer PCR mix and inner PCR mix for amplification of the RT-INT fragment. RT-outer PCR mix inner PCR mix volume/ volume/sample component sample (l) component (l) DEPC.water 6.5 DEPC.water 20.24 2 x reaction buffer 12.5 10 x reaction buffer 2.5 PR_F1 (20 M) 0.25 PR_F3 (20 M) 0.38 VIF_R3 (20 M) 0.25 VIF_R5 (20 M) 0.38 Superscript III HiFi 0.5 dNTP's (25 mM) 0.2 RNA 5 Expand HiFi (3.5 U/ 0.3 l) total volume (l) 25 OUT_sample 1 total volume (l) 25

    TABLE-US-00006 TABLE 4 Thermal cycling conditions for the outer and inner PCR for amplification of the RT-INT fragment. step temperature ( C.) time cycles outer PCR RT-INT fragment 1 53 30 min 2 94 2 min 3 92 15 s 30 4 55 30 s 5 68 3 min 30 s 6 68 10 min 7 4 hold inner PCR RT-INT fragment 1 94 2 min 2 94 15 s 35 3 60 30 s 4 68 3 min 5 68 10 min 6 4 hold

    [0193] Protocol for Amplification of GAG-PR Fragment

    [0194] Starting from freshly prepared patient-derived RNA, 5 l was mixed with 0.2 M forward outer primer (EF1=SEQ ID NO: 8) and 0.2 M reverse outer primer (Gaprout-R3=SEQ ID NO: 9), lx Superscript reaction buffer (containing 0.4 mM of each dNTP and 2.5 mM MgSO.sub.4) and 0.5 l Superscript III HIFI enzyme mix in a total volume of 25 l (Table 5). The reverse transcription reaction was performed @ 53 C. for 30 min, followed by an initial denaturation @ 94 C. for 2 min. This was followed by 30 cycles of [denaturation @ 92 C. for 15 sec, annealing @ 55 C. for 30 sec and elongation @ 68 C. for 2 min 30 sec]. The final elongation step was 10 min @ 68 C. (Table 6).

    [0195] Subsequently, 1 l of outer PCR product was mixed with 0.304 M forward inner primer (5LTR_IF1=SEQ ID NO:1) and 0.304 M reverse inner primer (Gaprout-R1=SEQ ID NO: 10), 1 Expand HIFI reaction buffer, 0.2 l dNTP's (0.2 mM) and 0.3 l Expand HIFI enzyme mix (=1.05 U) in a total volume of 25 l (Table 5).

    [0196] The inner PCR reaction consists of an initial denaturation @ 94 C. for 2 min, followed by 35 cycles of [denaturation @ 94 C. for 15 sec, annealing @ 60 C. for 30 sec and elongation @ 72 C. for 2 min]. The final elongation step was 10 min @ 72 C. (Table 6).

    [0197] All reaction mixtures and samples were kept on ice during preparation. The outer and inner primers used to generate this amplicon can be found in Table 7.

    [0198] Finally, 4 l PCR product was mixed with 2 l loading dye, loaded on a 1% agarose gel and stained with ethidium bromide for visualization.

    TABLE-US-00007 TABLE 5 Composition of the RT-outer PCR mix and inner PCR mix for amplification of the GAG-PR fragment. RT-outer PCR mix inner PCR mix volume/ volume/sample component sample (l) component (l) DEPC.water 6.5 DEPC.water 20.24 2 x reaction buffer 12.5 10 x reaction buffer 2.5 EF1 (20 M) 0.25 5LTR_IF1 (20 M) 0.38 Gaprout-R3 (20 M) 0.25 Gaprout-R1 (20 M) 0.38 Superscript III HiFi 0.5 dNTP's (25 mM) 0.2 RNA 5 Expand HiFi (3.5 U/ 0.3 l) total volume (l) 25 OUT_sample 1 total volume (l) 25

    TABLE-US-00008 TABLE 6 Thermal cycling conditions for the outer and inner PCR for amplification of the GAG-PR fragment. step temperature ( C.) time cycles outer PCR Gag-PR fragment 1 53 30 min 2 94 2 min 3 92 15 s 30 4 55 30 s 5 68 2 min 30 s 6 68 10 min 7 4 hold inner PCR Gag-PR fragment 1 94 2 min 2 94 15 s 35 3 60 30 s 4 72 2 min 5 72 10 min 6 4 hold

    TABLE-US-00009 TABLE7 Primersequencesofallamplificationprimersandtheirposition ontheHXB2reference. primername primersequencefrom5 to3 positiononHXB2 EF1 CAAGTAGTGTGTGCCCGTCTGT 550-571 5LTR_IF1 TGGAAAATCTCTAGCAGTGGCG 619-640 5LTR_F2 TCTCTAGCAGTGGCGCCCGAACA 626-648 PR_F1 CCCTCAAATCACTCTTTGGCAACGAC 2252-2277 PR_F3 GCTCTATTAGATACAGGAGCAGATG 2316-2340 VIF_R2 AGTGGGATGTGTACTTCTGAAC 5195-5216 VIF_R3 CTCCTGTATGCAGACCCCAATATG 5243-5266 VIF_R5 GGGATGTGTACTTCTGAACTT 5193-5213 Gaprout-R3 CCATTGTTTAACTTTTGGGCCATCC 2597-2621 Gaprout-R1 CCATTCCTGGCTTTAATTTTACTGG 2574-2598 5 OUT GCCCCTAGGAAAAAGGGCTGTTGG 2008-2031 5 IN CTAGGAAAAAGGGCTGTTGGAAATG 2012-2036

    TABLE-US-00010 SEQIDNO1:(5LTR_IF1) TGGAAAATCTCTAGCAGTGGCG SEQIDNO2:(VIF_R2) AGTGGGATGTGTACTTCTGAAC SEQIDNO3:(5LTR_F2) TCTCTAGCAGTGGCGCCCGAACA SEQIDNO4:(VIF_R5) GGGATGTGTACTTCTGAACTT SEQIDNO5:(PR_F1) CCCTCAAATCACTCTTTGGCAACGAC SEQIDNO6:(VIF_R3) CTCCTGTATGCAGACCCCAATATG SEQIDNO7:(PR_F3) GCTCTATTAGATACAGGAGCAGATG SEQIDNO8:(EF1) CAAGTAGTGTGTGCCCGTCTGT SEQIDNO9:(Gaprout-R3) CCATTGTTTAACTTTTGGGCCATCC SEQIDNO10:(Gaprout-R1) CCATTCCTGGCTTTAATTTTACTGG SEQIDNO53(5OUT) GCCCCTAGGAAAAAGGGCTGTTGG SEQIDNO54(5IN) CTAGGAAAAAGGGCTGTTGGAAATG

    [0199] Sequencing Protocol for all Fragments Mentioned Before

    [0200] Sequencing reactions were performed with the Big Dye Terminator Cycle Sequencing Kit v3.1 (Applied Biosystems). Each reaction mixture (11.5 l) contained: the amplicon (1 DNase RNase free water (3 l), Big Dye terminator mix (1 l), primer (4 l, 4 M) and 1 dilution buffer (1.0 M Tris HCL, 1.0 M MgCl.sub.2 and H.sub.2O) (Table 8). All primers used for nucleotide sequencing of the different fragments are listed in Table 10.

    [0201] The PCR conditions were 25 cycles of [10 seconds at 96 C., 5 seconds at 50 C. and 4 minutes at 60 C.], followed by a final hold at 4 C. and using an ABI 9800 Fast Thermal Cycler (Applied Biosystems) (Table 9).

    [0202] The purification of the sequencing reaction mixtures was performed using the DyeEX (Qiagen) purification kit according to the manufacturers protocol. The sequencing was performed using an ABI3730 XL (Applied Biosystems) and the generated sequences were aligned and analyzed using SeqScape v2.5 software (Applied Biosystems).

    TABLE-US-00011 TABLE 8 Composition of the sequencing reaction mixture. mix composition for sequencing component vol/sample (l) DEPC.water 3 2.5x dilution buffer 2.5 Big Dye terminator mix 1 primer (4 M) 4 template 1 total volume (l) 11.5

    TABLE-US-00012 TABLE 9 Thermal cycling conditions for the sequencing reaction. thermal cycling program step temp. time # cycles 1 96 C. 10 s 25 2 50 C. 5 s 3 60 C. 4 min 4 4 C. hold

    TABLE-US-00013 TABLE10 PrimersequencesofallsequencingprimersandtheirpositionontheHXB2 reference. Primername PNucleotidesequence(5.fwdarw.3) PositiononHXB2 ForwardPrimers SEQIDNO115LTR_F_631 AGCAGTGGCGCCCGAACAG 631-649 SEQIDNO12F0gag TTTGACTAGCGGGAGGCTAGAAG 761-782 SEQIDNO13GAG_F_1070 TAAAAGACACCAAGGAAGC 1070-1088 SEQIDNO14F10gag AAGACACCAAGGAAGC 1073-1088 SEQIDNO15F3gag CATAGCAGGAACTACTAGTA 1494-1513 SEQIDNO16GAG_F_1602 TAAAATAGTAAGAATGTATAGCCC 1602-1625 SEQIDNO17F5gag ATGACAGCATGTCAGGGAGT 1828-1847 SEQIDNO18F1 GAGAGCTTCAGGTTTGGGG 2170-2188 SEQIDNO19F5 CACTCTTTGGCAACGACCC 2261-2279 SEQIDNO20PR_F2376 TGGAAACCAAAAATGATAGG 2376-2395 SEQIDNO21F2 AATTGGGCCTGAAAATCC 2696-2713 SEQIDNO22F3 CCTCCATTCCTTTGGATGGG 3222-3241 SEQIDNO23RT_F_3681 GAAAGCATAGTAATATGGG 3681-3699 SEQIDNO24IN_F_4074 CAACCAGATAAAAGTGAATCAG 4074-4095 SEQIDNO25IN_F_4540 TAGCAGGAAGATGGCCAGT 4540-4558 SEQIDNO26Inseq3F GTAGACATAATAGCAACAGAC 4830-4850 SEQIDNO55F7 GTACTGGATGTGGGTGATGC 2871-2890 SEQIDNO56F8 GTGGGAAAATTGAATTGGG 3330-3348 SEQIDNO57F3771 GCCACCTGGATTCCTGAGTG 3771-3790 Reverseprimers SEQIDNO27R8gag TCTTGTGGGGTGGCTCCTTC 1337-1318 SEQIDNO28GAG_R_1316 TCTTGTGGGGTGGCTCCTTCTG 1337-1316 SEQIDNO29R3gag TCTACATAGTCTCTAAAGGG 1682-1663 SEQIDNO30GAG_R_1825 ACTCCCTGACATGCTGTCATCAT 1847-1825 SEQIDNO31R7gag GTGGGGCTGTTGGCTCTGGT 2164-2145 SEQIDNO32PR_R_2382 ATTCCCCCTATCATTTTTGG 2401-2382 SEQIDNO33R8 GATAAAACCTCCAATTCC 2414-2397 SEQIDNO34R3 CTTCCCAGAAGTCTTGAGTTC 2817-2797 SEQIDNO35R6 GGAATATTGCTGGTGATCC 3030-3012 SEQIDNO36RT_R_3304 TGTATGTCATTGACAGTCC 3322-3304 SEQIDNO37R5 GGGTCATAATACACTCCATG 3511-3492 SEQIDNO38R1 CTCCCACTCAGGAATCC 3794-3778 SEQIDNO39RT_R_3964 CAGTCTTCTGATTTGTTG 3981-3964 SEQIDNO40RT_R_4150 CTTTGTGTGCTGGTACCCATG 4170-4150 SEQIDNO41RT_R_4380a GGACTACAGTCTACTTGTCCAATG 4402-4380 SEQIDNO42Inseq2R CTGCCATTTGTACTGCTGTC 4767-4748 SEQIDNO43IN_R_5042 ATCACCTGCCATCTGITTICCA 5063-5042 SEQIDNO44VIF_R_5193 ATGTGTACTTCTGAACTT 5210-5193 SEQIDNO58IN_R_4348 CTCCTTTTAGCTGACATTTATCAC 4371-4348

    [0203] Creation of the HXB2D_eGFP_delta[GAG-POL] Backbone (SEQ ID NO: 49)

    [0204] This backbone contains all genetic elements of HIV-1, except the complete GAG and POL region. Recombination between this GAG-POL deletion backbone and the 5LTR-VIF amplicon resulted in a fully functional HIV-1 viral vector, which was used in transfection/infection experiments.

    [0205] First, pUC18 was digested with PstI and EcoRI restriction enzymes. Subsequently, a 35 bp synthetic linker containing the HpaI, SpeI, and SalI restriction sites was ligated into the PstI/EcoRI-linearized pUC18 plasmid, creating pUC18-LINK. Next, HXB2D_eGFP (original fully replication competent HIV-1 vector, containing eGFP in Nef) was digested with HpaI and SalI (termed vector C), cutting out the 5 part of the HIV-1 genome (5LTR, GAG, POL, VIF) (from nucleotide 15223 to 5786 compared to the HXB2 reference), termed fragment A. Fragment A was then cloned into the HpaI/SalI-digested pUC18-LINK plasmid. PCR primers that are complementary to the 5 and 3 ends of the 5LTR-Vif amplicon were designed and used in an inverse PCR (iPCR) reaction to re-create the nucleotide sequence that was removed in excess during HpaI/SalI digestion (i.e. sequence between primer binding site and restriction site). These inverse PCR primers were extended with the nucleotide sequences of two restriction sites (i.e. PacI and SnaBI) for linearization of the backbone afterwards. Finally, HpaI/SalI digestion was performed on the iPCR product and the excised HpaI/SalI fragment (fragment B) was cloned back into the HpaI/SalI digested original HXB2D-eGFP vector (vector C) (see FIG. 1, 2, 3).

    [0206] Creation of the HXB2D_eGFP_delta[POL] Backbone (SEQ ID NO: 52)

    [0207] This backbone contains all genetic elements of HIV-1, except the complete Pol region. Recombination between this Pol deletion backbone and the Pol amplicon resulted in a fully functional HIV-1 viral vector, which was used in transfection/infection experiments.

    [0208] First, pUC18 was digested with PstI and EcoRI restriction enzymes. Subsequently, a 35 bp synthetic linker containing the HpaI, SpeI, and SalI restriction sites was ligated into the PstI/EcoRI-linearized pUC18 plasmid, creating pUC18-LINK. Next, HXB2D_eGFP (original fully replication competent HIV-1 vector, containing eGFP in Nef) was digested with HpaI and SalI (termed vector C), cutting out the 5 part of the HIV-1 genome (5LTR, GAG, POL, VIF) (from nucleotide 15223 to 5786 compared to the HXB2 reference), termed fragment A. Fragment A was then cloned into the HpaI/SalI-digested pUC18-LINK plasmid. PCR primers that are complementary to the 5 and 3 ends of the Pol amplicon were designed and used in an inverse PCR (iPCR) reaction to re-create the nucleotide sequence that was removed in excess during HpaI/SalI digestion (i.e. sequence between primer binding site and restriction site). These inverse PCR primers were extended with the nucleotide sequences of two restriction sites (i.e. Pad and SnaBI) for linearization of the backbone afterwards. Finally, HpaI/SalI digestion was performed on the iPCR product and the excised HpaI/SalI fragment (fragment P) was cloned back into the HpaI/SalI digested original HXB2D-eGFP vector (vector C) (see FIGS. 12 and 13).

    [0209] Creation of the HXB2D_eGFP_delta[RT-INT] Backbone (SEQ ID NO: 51)

    [0210] This backbone contains all genetic elements of HIV-1, except the complete RT and INT region. Recombination between this RT-INT deletion backbone and the RT-INT amplicon resulted in a fully functional HIV-1 viral vector, which was used in transfection/infection experiments.

    [0211] First, pUC18 was digested with PstI and EcoRI restriction enzymes. Subsequently, a 35 bp synthetic linker containing the HpaI, SpeI, and SalI restriction sites was ligated into the PstI/EcoRI-linearized pUC18 plasmid, creating pUC18-LINK. Next, HXB2D_eGFP (original fully replication competent HIV-1 vector, containing eGFP in Nef) was digested with SpeI and SalI (termed vector Z), cutting out the majority of POL and VIF of the HIV-1 genome (from nucleotide 1507 to 5786 compared to the HXB2 reference), termed fragment X. Fragment X was then cloned into the SpeI/SalI-digested pUC18-LINK plasmid. PCR primers that are complementary to the 5 and 3 ends of the RT-INT amplicon were designed and used in an inverse PCR (iPCR) reaction to re-create the nucleotide sequence that was removed in excess during SpeI/SalI digestion (i.e. sequence between primer binding site and restriction site).

    [0212] Finally, SpeI/SalI digestion was done on the iPCR product and the excised SpeI/SalI fragment (fragment Y) was cloned back into the SpeI/SalI digested original HXB2D-eGFP vector (vector Z) (see FIG. 4, 5, 6).

    [0213] Creation of the HXB2D_eGFP_delta[GAG-PR] Backbone (SEQ ID NO: 50)

    [0214] This backbone contains all genetic elements of HIV-1, except the complete GAG and PR region. Recombination between this GAG-PR deletion backbone and the GAG-PR amplicon resulted in a fully functional HIV-1 viral vector, which was used in transfection/infection experiments.

    [0215] First, pUC18 was digested with PstI and EcoRI restriction enzymes. Subsequently, a 35 bp synthetic linker containing the HpaI, SpeI, and SalI restriction sites was ligated into the PstI/EcoRI-linearized pUC18 plasmid, creating pUC18-LINK. Next, HXB2D_eGFP (original fully replication competent HIV-1 vector, containing eGFP in Nef) was digested with HpaI and SalI (termed vector C), cutting out the 5 part of the HIV-1 genome (5LTR, GAG, POL, VIF) (from nucleotide 15223 to 5786 compared to the HXB2 reference), termed fragment A. Fragment A was then cloned into the HpaI/SalI-digested pUC18-LINK plasmid. PCR primers that are complementary to the 5 and 3 ends of the GAG-PR amplicon were designed and used in an inverse PCR (iPCR) reaction to re-create the nucleotide sequence that was removed in excess during HpaI/SalI digestion (i.e. sequence between primer binding site and restriction site). Finally, HpaI/SalI digestion was done on the iPCR product and the excised HpaI/SalI fragment (fragment ALPHA) was cloned back into the HpaI/SalI digested original HXB2D-eGFP vector (vector C) (see FIG. 7, 8, 9).

    [0216] Phenotypic Assay Approach

    [0217] After linearization of the Gag-Pol, Gag-PR and RT-INT HXB2D_eGFP_delta backbone described before, the respective purified amplicon was cloned in the appropriate backbone using the In-Fusion technology (Clontech, Mountain view, California) and subsequently transformed into MAX Efficiency Stbl2 cells (Invitrogen, Merelbeke, Belgium). After DNA preparation from either clones or the complete plate, full-length recombinant HIV genomes were transfected to MT4 cells. At full CPE, recombinant virus stocks were harvested, titrated and subjected to an antiviral experiment.

    [0218] The 3 phenotyping assays (GAG-POL, GAG-PR and RT-INT) are described in the following section. The layout of the experiments is shown in FIG. 10.

    [0219] The three backbones, HXB2D_eGFP_delta [GAG-POL] (SEQ ID NO: 49), HXB2D_eGFP_delta [GAG-PR] (SEQ ID NO: 50) and HXB2D_eGFP_delta [RT-INT] (SEQ ID NO: 51) were linearized by digestion with SnaBI and PacI. After purification, for each backbone, 100 ng linearized vector was recombined with three different PCR amplicons (3 5LTR-VIF, 3 GAG-PR or 3 RT-INT amplicons) in vector/insert molar ratio of 1/10 using In-Fusion reagents. Thereafter, In-Fusion mixes were transformed to MAX Efficiency Stbl2 cells and incubated for 24 h at 30 C. The day after, colonies were screened for the presence of the full recombinant plasmid by a duplex colony PCR using the primers shown in Table 11 (SEQ ID NO's: 45-48).

    [0220] As an example, full recombinants generate two fragments (493 bp and 217 bp), while recircularized vectors containing no inserts, generate only one fragment (300 bp for

    [0221] delta_[GAG-POL], 200 bp for delta_[GAG-PR] and 500 bp for delta_[RT-INT]).

    [0222] In general full-length HIV recombinants were obtained for all backbones and for all amplicons tested.

    [0223] For the GAG-POL assay, two full recombinants were obtained for sample 1 and 2, and three recombinants for sample 3.

    [0224] For the GAG-PR backbone, two recombinants were generated for sample 1, one recombinant for sample 2 and eight recombinants for sample 3.

    [0225] For the RT-INT backbone, five full recombinants for sample 1, eleven recombinants for sample 2 and two for sample 3 were generated.

    [0226] All recombinant clones (with a maximum of five per sample) were grown overnight in LB-ampicillin at 30 C. to prepare DNA from (27 in total). Miniprep DNA was prepared using the Qiaprep Spin miniprep (Qiagen) and checked by HindIII restriction digest. By comparison of the HindIII digestion pattern of the clones with that of the deletion backbones and that of the full-length parental HXB2D_eGFP vector, all 27 clones contained full-length HIV genomes. All 27 clones were transfected to MT4 cells using the Amaxa nucleofection technique and evaluated for their cythopathic effect (CPE). In total, 18 clones reached full CPE (cyto-pathogenic effect) during the time of evaluation (11 days) and were used for further infection experiments: 16 clones generated full CPE after 4 days, 1 clone after 5 days and 1 clone after 11 days. The other 9 clones did not show substantial infection after 11 days and were stopped for further analysis. The 18 harvested RVS (recombinant virus stock) were titrated and subjected to an antiviral experiment (AVE) at a standardized MOT (multiplicity of infection) using FDA-approved protease and RT inhibitors, and experimental maturation (PA-457) and integrase (GS-9137, L870,810 and L731,988) inhibitors. After 3 days of infection, GFP (green fluorescent protein) infection signals were quantified and dose-response curves were calculated. Only 1 out of 18 samples did not generate significant GFP expression above background, all other 17 RVS were successfully phenotyped for all drugs tested. As an example, FIG. 11 shows the dose-response curves 1 GAG-POL RVS for all drugs tested.

    TABLE-US-00014 TABLE11 PrimersequencesoftheprimersusedforthecolonyPCRandtheirpositionon theHXB2reference. primername primersequencefrom5 to3 PositiononHXB2 SEQIDNO45:HXB2_5LTR_F_422 CTGCATATAAGCAGCTGCTTTTTG 422-445 SEQIDNO46:GAG_R_895 TCTAGCTCCCTGCTTGCCCA 895-914 SEQIDNO47:IN_F_5052 ATGGCAGGTGATGATTGTGTGG 5052-5073 SEQIDNO48:HXB2_VIF_R_5247 TTCTCCTGTATGCAGACCCCAA 5247-5268