ADJUVANT FOR MUCOSAL VACCINE

20170196970 ยท 2017-07-13

Assignee

Inventors

Cpc classification

International classification

Abstract

An object of the present invention is to provide an adjuvant for a mucosal vaccine with high safety that induces a sufficient immune response in a mucosal membrane. According to the present invention, an adjuvant for a mucosal vaccine containing a protein complex composed of hemagglutinin (HA) subcomponents HA1 and HA2, and mutant subcomponent HA3 of botulinum toxin is provided.

Claims

1. An adjuvant comprising a protein complex composed of hemagglutinin (HA) subcomponents HA1, HA2 and HA3 of botulinum toxin, wherein the subcomponent HA1 is: (a) a protein which comprises a sequence of amino acids at positions 7 to 294 of the amino acid sequence shown in SEQ ID NO: 1; or (b) a protein which comprises an amino acid sequence including a deletion, substitution or addition of one to several amino acids, with respect to a sequence of amino acids at positions 7 to 294 of the amino acid sequence shown in SEQ ID NO: 1, and has equivalent activity to the protein (a), the subcomponent HA2 is: (c) a protein which comprises a sequence of amino acids at positions 2 to 146 of the amino acid sequence shown in SEQ ID NO: 2; or (d) a protein which comprises an amino acid sequence including a deletion, substitution or addition of one to several amino acids, with respect to a sequence of amino acids at positions 2 to 146 of the amino acid sequence shown in SEQ ID NO: 2, and has equivalent activity to the protein (c), and the subcomponent HA3 is: (e) a protein which comprises an amino acid sequence including a substitution of at least one or more amino acids among leucine at position 473, methionine at position 508, phenylalanine at position 569, and lysine at position 607 with other amino acid(s), with respect to a sequence of amino acids at positions 19 to 626 of the amino acid sequence shown in SEQ ID NO: 3; or (f) a protein which comprises an amino acid sequence including a deletion, substitution, or addition of one to several amino acids at position(s) other than the amino acids at positions 473, 508, 569, and 607, with respect to the amino acid sequence of the protein (e), and has equivalent activity to the protein (e).

2. An adjuvant comprising a protein complex composed of hemagglutinin (HA) subcomponents HA1, HA2 and HA3 of botulinum toxin, wherein the subcomponent HA1 is: (g) a protein which comprises a sequence of amino acids at positions 6 to 293 of the amino acid sequence shown in SEQ ID NO: 15; or (h) a protein which comprises an amino acid sequence including a deletion, substitution or addition of one to several amino acids, with respect to a sequence of amino acids at positions 6 to 293 of the amino acid sequence shown in SEQ ID NO: 15, and has equivalent activity to the protein (g), the subcomponent HA2 is: (i) a protein which comprises a sequence of amino acids at positions 2 to 146 of the amino acid sequence shown in SEQ ID NO: 16; or (j) a protein which comprises an amino acid sequence including a deletion, substitution or addition of one to several amino acids, with respect to a sequence of amino acids at positions 2 to 146 of the amino acid sequence shown in SEQ ID NO: 16, and has equivalent activity to the protein (i), and the subcomponent HA3 is: (k) a protein which comprises an amino acid sequence including a substitution of at least one or more amino acids among leucine at position 473, methionine at position 508, phenylalanine at position 569, and lysine at position 607 with other amino acid(s), with respect to a sequence of amino acids at positions 20 to 626 of the amino acid sequence shown in SEQ ID NO: 17; or (l) a protein which comprises an amino acid sequence including a deletion, substitution, or addition of one to several amino acids at position(s) other than the amino acids at positions 473, 508, 569, and 607, with respect to the amino acid sequence of the protein (k), and has equivalent activity to the protein (k).

3. The adjuvant according to claim 1, wherein the subcomponent HA3 is a protein which comprises an amino acid sequence including a substitution of any one of leucine at position 473, methionine at position 508, phenylalanine at 569, and lysine at position 607 with another amino acid, with respect to the amino acid sequence shown in SEQ ID NO: 3.

4. The adjuvant according to claim 3, wherein the another amino acid is alanine.

5. The adjuvant according to claim 1, to be used simultaneously with a vaccine antigen or before or after administering a vaccine antigen.

6. The adjuvant according to claim 5, wherein the vaccine antigen is a subunit antigen or an inactivated antigen.

7. The adjuvant according to claim 5, wherein the vaccine antigen is derived from a pathogen causing a mucosal infection.

8. The adjuvant according to claim 7, wherein the pathogen causing the mucosal infection is a virus or a bacterium.

9. The adjuvant according to claim 8, wherein the virus is influenza virus, human immunodeficiency virus (HIV), chickenpox virus, measles virus, rubella virus, mumps virus, poliovirus, rotavirus, norovirus, adenovirus, herpes virus, RS virus, dengue virus, Japanese encephalitis virus, severe acute respiratory syndrome (SARS) virus, cytomegalovirus, Epstein-Barr (EB) virus, or hepatitis virus (type A, type B or type C).

10. The adjuvant according to claim 8, wherein the bacterium is Bordetella pertussis, Neisseria meningitidis, Haemophilus influenzae Type b, Diplococcus pneumoniae, Mycobacterium tuberculosis, Clostridium tetani or Vibrio cholerae.

11. The adjuvant according to claim 1, to be transmucosally administered.

12. The adjuvant according to claim 11, wherein transmucosal administration is intranasal administration.

13. A mucosal vaccine preparation comprising a vaccine antigen and the adjuvant according to claim 1.

14. The adjuvant according to claim 2, wherein the subcomponent HA3 is a protein which comprises an amino acid sequence including a substitution of any one of leucine at position 473, methionine at position 508, phenylalanine at 569, and lysine at position 607 with another amino acid, with respect to the amino acid sequence shown in SEQ ID NO: 17.

15. The adjuvant according to claim 14, wherein the another amino acid is alanine.

16. The adjuvant according to claim 2, to be used simultaneously with a vaccine antigen or before or after administering a vaccine antigen.

17. The adjuvant according to claim 16, wherein the vaccine antigen is a subunit antigen or an inactivated antigen.

18. The adjuvant according to claim 16, wherein the vaccine antigen is derived from a pathogen causing a mucosal infection.

19. The adjuvant according to claim 18, wherein the pathogen causing the mucosal infection is a virus or a bacterium.

20. The adjuvant according to claim 19, wherein the virus is influenza virus, human immunodeficiency virus (HIV), chickenpox virus, measles virus, rubella virus, mumps virus, poliovirus, rotavirus, norovirus, adenovirus, herpes virus, RS virus, dengue virus, Japanese encephalitis virus, severe acute respiratory syndrome (SARS) virus, cytomegalovirus, Epstein-Barr (EB) virus, or hepatitis virus (type A, type B or type C).

21. The adjuvant according to claim 19, wherein the bacterium is Bordetella pertussis, Neisseria meningitidis, Haemophilus influenzae Type b, Diplococcus pneumoniae, Mycobacterium tuberculosis, Clostridium tetani or Vibrio cholerae.

22. The adjuvant according to claim 2, to be transmucosally administered.

23. The adjuvant according to claim 22, wherein transmucosal administration is intranasal administration.

24. A mucosal vaccine preparation comprising a vaccine antigen and the adjuvant according to claim 2.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0040] FIG. 1 illustrates an amino acid sequence of recombinant botulinum type B HA1-3 used to prepare a wild-type botulinum type B HA (BHA) complex in Example 1. Each underlined region corresponds to a vector-derived amino acid sequence (including FLAG tag sequence: SEQ ID NO: 7; and Strep tag sequence: SEQ ID NO: 8).

[0041] FIG. 2 illustrates an amino acid sequence of recombinant botulinum type A HA1-3 used to prepare a wild-type botulinum type A HA (AHA) complex in Example 1. Each underlined region corresponds to a vector-derived amino acid sequence (including FLAG tag sequence: SEQ ID NO: 21 and SEQ ID NO: 7; and Strep tag sequence: SEQ ID NO: 22).

[0042] FIG. 3 illustrates an amino acid sequence of recombinant botulinum type B HA3 used to prepare mutant (L473A, M508A, F569A and K607A) botulinum type B HA (BHA) complexes in Example 1. Each underlined region corresponds to a vector-derived amino acid sequence (including Strep tag sequence: SEQ ID NO: 8), and each amino acid surrounded with a square corresponds to an amino acid that is mutated (subjected to amino acid substitution).

[0043] FIG. 4 illustrates an amino acid sequence of recombinant botulinum type A HA3 used to prepare mutant (L473A, M508A, F569A and K607A) botulinum type A HA (AHA) complexes in Example 1. Each underlined region corresponds to a vector-derived amino acid sequence (including Strep tag sequence: SEQ ID NO: 22), and each amino acid surrounded with a square corresponds to an amino acid that is mutated (subjected to amino acid substitution).

[0044] FIG. 5 illustrates purification of a wild-type BHA complex and a mutant (K607A) BHA complex via gel filtration column chromatography.

[0045] FIG. 6 illustrates the result of identification of subcomponents significant for interaction between the BHA complex and E-cadherin.

[0046] FIG. 7 illustrates the result of identification of a region in BHA3 significant for the interaction with E-cadherin obtained through a pull-down assay using a chimeric botulinum HA3 subcomponent.

[0047] FIG. 8 illustrates the result of identification of an amino acid of the BHA3 significant for the interaction with E-cadherin obtained through a pull-down assay (A) and a TER assay (B) using a mutant BHA complex.

[0048] FIG. 9 illustrates the result of a pull-down assay using a wild-type BHA complex and a mutant (K607A) BHA complex.

[0049] FIG. 10 illustrates the result of evaluation of intercellular adhesion inhibition, using Caco-2 cells, of the wild-type BHA complex and the mutant (K607A) BHA complex (added to an apical side).

[0050] FIG. 11 illustrates the result of evaluation of the intercellular adhesion inhibition, using Caco-2 cells, of the wild-type BHA complex and the mutant (K607A) BHA complex (added to a basolateral side).

[0051] FIG. 12 illustrates M cell orientation of a wild-type HA complex and a mutant (K607A) HA complex (microphotographs obtained by observing localization of the HA complex in follicle-associated epithelium (FAE)) (UEA-1: image of M cells stained with FITC-labeled UEA-1; HA: stained image of the HA complex).

[0052] FIG. 13 illustrates the result of evaluation, depending on the form of M cells and dextran remaining between cells, of intercellular adhesion disrupting ability of a wild-type HA complex and a mutant (K607A) HA complex on an epithelial layer of a mucosal tissue (D-10: FITC-labeled dextran (10K)).

[0053] FIG. 14 illustrates activation of innate immunity (IL-6 production) caused by the wild-type BHA complex and the mutant (K607A) BHA complex.

[0054] FIG. 15 illustrates the activation of innate immunity (TNF-/IL-6 production) caused by the mutant (K607A) BHA complex and its subcomponents.

[0055] FIG. 16 illustrates measurement results, obtained by ELISA, for a production amount of influenza-antigen-specific IgG in blood (SV: a group administered with influenza split vaccine alone; SV+BHAwt: a group administered with influenza split vaccine and the wild-type BHA complex; SV+BHAmut: a group administered with influenza split vaccine and the mutant (K607A) BHA complex; SV+CTB: a group administered with influenza split vaccine and cholera toxin B subunit; NC: a non-administered group, *** p<0.0001, ** p<0.001, * p<0.01).

[0056] FIG. 17 illustrates measurement results, obtained by ELISA, for production amounts of influenza-antigen-specific IgA in a nasal cavity lavage fluid and in a bronchoalveolar lavage fluid (SV: a group administered with influenza split vaccine alone; SV+BHAwt: a group administered with influenza split vaccine and the wild-type BHA complex; SV+BHAmut: a group administered with influenza split vaccine and the mutant (K607A) BHA complex; SV+CTB: a group administered with influenza split vaccine and cholera toxin B subunit; NC: a non-administered group, *** p<0.0001, ** p<0.001, * p<0.01).

[0057] FIG. 18 illustrates measurement results, obtained by ELISA, for production amounts of influenza-antigen-specific IgG (A) in blood and influenza-antigen-specific IgA (B) in a nasal cavity lavage fluid (SV: a group administered with influenza split vaccine alone; SV+AHAwt: a group administered with influenza split vaccine and the wild-type AHA complex; SV+AHA L473A: a group administered with influenza split vaccine and the mutant (L473A) AHA complex; SV+AHA M508A: a group administered with influenza split vaccine and the mutant (M508A) AHA complex; SV+AHA F569A: a group administered with influenza split vaccine and the mutant (F569A) AHA complex; SV+AHA K607A: a group administered with influenza split vaccine and the mutant (K607A) AHA complex; SV+BHAwt: a group administered with influenza split vaccine and the wild-type BHA complex; SV+BHA K607A: a group administered with influenza split vaccine and the mutant (K607A) BHA complex; SV+CTB: a group administered with influenza split vaccine and cholera toxin B subunit; NC: a non-administered group).

EMBODIMENT FOR CARRYING OUT THE INVENTION

[0058] An adjuvant for a mucosal vaccine of the present invention (hereafter simply referred to as the adjuvant) is a protein complex composed of HA1, HA2 and HA3, which are hemagglutinin (HA) subcomponents of botulinum toxin. The term adjuvant used herein refers to a substance that is administered for purpose of enhancing the immunogenicity of a vaccine antigen.

[0059] Botulinum toxins are classified into type A to type G in accordance with the different antigenicities of toxins produced by botulinum (Clostridium botulinum), and a botulinum toxin complex used for the adjuvant of the present invention is preferably of type A or type B.

[0060] The HA1, the HA2 and the HA3 composing the protein complex contained in the adjuvant of the present invention are preferably, respectively, a protein which comprises a sequence of amino acids at positions 7 to 294 of the amino acid sequence shown in SEQ ID NO: 1, a protein which comprises a sequence of amino acids at positions 2 to 146 of the amino acid sequence shown in SEQ ID NO: 2, and a protein which comprises an amino acid sequence including a substitution of at least one or more amino acids among leucine at position 473, methionine at position 508, phenylalanine at position 569, and lysine at position 607 with other amino acid(s), with respect to a sequence of amino acids at positions 19 to 626 of the amino acid sequence shown in SEQ ID NO: 3; or, respectively, a protein which comprises a sequence of amino acids at positions 6 to 293 of the amino acid sequence shown in SEQ ID NO: 15, a protein which comprises a sequence of amino acids at positions 2 to 146 of the amino acid sequence shown in SEQ ID NO: 16, and a protein which comprises an amino acid sequence including a substitution of at least one or more amino acids among leucine at position 473, methionine at position 508, phenylalanine at position 569, and lysine at position 607 with other amino acid(s), with respect to a sequence of amino acids at positions 20 to 626 of the amino acid sequence shown in SEQ ID NO: 17; or more preferably, respectively, a protein which consists of a sequence of amino acids at positions 7 to 294 of the amino acid sequence shown in SEQ ID NO: 1, a protein which consists of a sequence of amino acids at positions 2 to 146 of the amino acid sequence shown in SEQ ID NO: 2, and a protein which consists of an amino acid sequence including a substitution of at least one or more amino acids among leucine at position 473, methionine at position 508, phenylalanine at position 569, and lysine at position 607 with other amino acid(s), with respect to a sequence of amino acids at positions 19 to 626 of the amino acid sequence shown in SEQ ID NO: 3; or, respectively, a protein which consists of a sequence of amino acids at positions 6 to 293 of the amino acid sequence shown in SEQ ID NO: 15, a protein which consists of a sequence of amino acids at positions 2 to 146 of the amino acid sequence shown in SEQ ID NO: 16, and a protein which consists of an amino acid sequence including a substitution of at least one or more amino acids among leucine at position 473, methionine at position 508, phenylalanine at position 569, and lysine at position 607 with other amino acid(s), with respect to a sequence of amino acids at positions 20 to 626 of the amino acid sequence shown in SEQ ID NO: 17. In the present invention, the amino acids at the specific positions in the amino acid sequence shown in SEQ ID NO: 3 or SEQ ID NO: 17 may be substituted at least one of, at arbitrary two or three of, or at all of positions 473, 508, 569 and 607.

[0061] The HA1, the HA2 and the HA3 composing the protein complex contained in the adjuvant of the present invention are preferably, respectively, a protein which comprises a sequence of amino acids at positions 7 to 294 of the amino acid sequence shown in SEQ ID NO: 1, a protein which comprises a sequence of amino acids at positions 2 to 146 of the amino acid sequence shown in SEQ ID NO: 2, and a protein which comprises an amino acid sequence including a substitution of any one of amino acids among leucine at position 473, methionine at position 508, phenylalanine at position 569, and lysine at position 607 with another amino acid, with respect to a sequence of amino acids at positions 19 to 626 of the amino acid sequence shown in SEQ ID NO: 3; or, respectively, a protein which comprises a sequence of amino acids at positions 6 to 293 of the amino acid sequence shown in SEQ ID NO: 15, a protein which comprises a sequence of amino acids at positions 2 to 146 of the amino acid sequence shown in SEQ ID NO: 16, and a protein which comprises an amino acid sequence including a substitution of any one of amino acids among leucine at position 473, methionine at position 508, phenylalanine at position 569, and lysine at position 607 with another amino acid, with respect to a sequence of amino acids at positions 20 to 626 of the amino acid sequence shown in SEQ ID NO: 17; or more preferably, respectively, a protein which consists of a sequence of amino acids at positions 7 to 294 of the amino acid sequence shown in SEQ ID NO: 1, a protein which consists of a sequence of amino acids at positions 2 to 146 of the amino acid sequence shown in SEQ ID NO: 2, and a protein which consists of an amino acid sequence including a substitution of any one of amino acids among leucine at position 473, methionine at position 508, phenylalanine at position 569, and lysine at position 607 with another amino acid, with respect to a sequence of amino acids at positions 19 to 626 of the amino acid sequence shown in SEQ ID NO: 3; or, respectively, a protein which consists of a sequence of amino acids at positions 6 to 293 of the amino acid sequence shown in SEQ ID NO: 15, a protein which consists of a sequence of amino acids at positions 2 to 146 of the amino acid sequence shown in SEQ ID NO: 16, and a protein which consists of an amino acid sequence including a substitution of any one of amino acids among leucine at position 473, methionine at position 508, phenylalanine at position 569, and lysine at position 607 with another amino acid, with respect to a sequence of amino acids at positions 20 to 626 of the amino acid sequence shown in SEQ ID NO: 17.

[0062] Here, the amino acid substitution is not especially limited as long as it does not affect intercellular adhesion and has mucosal adjuvant activity. For example, in order to reduce the influence on the intercellular adhesion of a wild-type botulinum type B HA or type A HA, conservative amino acid substitution meaning that an amino acid at a specific position is substituted by an amino acid similar in the structural, electrical, polarity or hydrophobic properties is not employed but substitution of amino acids different in these properties can be employed.

[0063] In the amino acid sequence shown in SEQ ID NO: 3 or SEQ ID NO: 17, an amino acid used for substitution of leucine at position 473, methionine at position 508, phenylalanine at 569 or lysine at position 607 is preferably alanine. Accordingly, particularly preferable examples of the protein complex contained in the adjuvant of the present invention include: a protein which comprises a sequence of amino acids at positions 7 to 294 of the amino acid sequence shown in SEQ ID NO: 1, a protein which comprises a sequence of amino acids at positions 2 to 146 of the amino acid sequence shown in SEQ ID NO: 2, and a protein which comprises an amino acid sequence including a substitution of leucine at position 473 with alanine, with respect to a sequence of amino acids at positions 19 to 626 of the amino acid sequence shown in SEQ ID NO: 3; a protein which comprises a sequence of amino acids at positions 7 to 294 of the amino acid sequence shown in SEQ ID NO: 1, a protein which comprises a sequence of amino acids at positions 2 to 146 of the amino acid sequence shown in SEQ ID NO: 2, and a protein which comprises an amino acid sequence including a substitution of methionine at position 508 with alanine, with respect to a sequence of amino acids at positions 19 to 626 of the amino acid sequence shown in SEQ ID NO: 3; a protein which comprises a sequence of amino acids at positions 7 to 294 of the amino acid sequence shown in SEQ ID NO: 1, a protein which comprises a sequence of amino acids at positions 2 to 146 of the amino acid sequence shown in SEQ ID NO: 2, and a protein which comprises an amino acid sequence including a substitution of phenylalanine at position 569 with alanine, with respect to an sequence of amino acids at positions 19 to 626 of the amino acid sequence shown in SEQ ID NO: 3; a protein which comprises a sequence of amino acids at positions 7 to 294 of the amino acid sequence shown in SEQ ID NO: 1, a protein which comprises a sequence of amino acids at positions 2 to 146 of the amino acid sequence shown in SEQ ID NO: 2, and a protein which comprises an amino acid sequence including a substitution of lysine at position 607 with alanine, with respect to a sequence of amino acids at positions 19 to 626 of the amino acid sequence shown in SEQ ID NO: 3.

[0064] Other preferable examples of the protein complex contained in the adjuvant of the present invention include:

a protein which comprises a sequence of amino acids at positions 6 to 293 of the amino acid sequence shown in SEQ ID NO: 15, a protein which comprises a sequence of amino acids at positions 2 to 146 of the amino acid sequence shown in SEQ ID NO: 16, and a protein which comprises an amino acid sequence including a substitution of leucine at position 473 with alanine, with respect to a sequence of amino acids at positions 20 to 626 of the amino acid sequence shown in SEQ ID NO: 17; a protein which comprises a sequence of amino acids at positions 6 to 293 of the amino acid sequence shown in SEQ ID NO: 15, a protein which comprises a sequence of amino acids at positions 2 to 146 of the amino acid sequence shown in SEQ ID NO: 16, and a protein which comprises an amino acid sequence including a substitution of methionine at position 508 with alanine, with respect to a sequence of amino acids at positions 20 to 626 of the amino acid sequence shown in SEQ ID NO: 17; a protein which comprises a sequence of amino acids at positions 6 to 293 of the amino acid sequence shown in SEQ ID NO: 15, a protein which comprises a sequence of amino acids at positions 2 to 146 of the amino acid sequence shown in SEQ ID NO: 16, and a protein which comprises an amino acid sequence including a substitution of phenylalanine at position 569 with alanine, with respect to a sequence of amino acids at positions 20 to 626 of the amino acid sequence shown in SEQ ID NO: 17; a protein which comprises a sequence of amino acids at positions 6 to 293 of the amino acid sequence shown in SEQ ID NO: 15, a protein which comprises a sequence of amino acids at positions 2 to 146 of the amino acid sequence shown in SEQ ID NO: 16, and a protein which comprises an amino acid sequence including a substitution of lysine at position 607 with alanine, with respect to a sequence of amino acids at positions 20 to 626 of the amino acid sequence shown in SEQ ID NO: 17.

[0065] Most preferable examples of the protein complex contained in the adjuvant of the present invention include:

a protein which consists of a sequence of amino acids at positions 7 to 294 of the amino acid sequence shown in SEQ ID NO: 1, a protein which consists of a sequence of amino acids at positions 2 to 146 of the amino acid sequence shown in SEQ ID NO: 2, and a protein which consists of an amino acid sequence including a substitution of leucine at position 473 with alanine, with respect to a sequence of amino acids at positions 19 to 626 of the amino acid sequence shown in SEQ ID NO: 3; a protein which consists of a sequence of amino acids at positions 7 to 294 of the amino acid sequence shown in SEQ ID NO: 1, a protein which consists of a sequence of amino acids at positions 2 to 146 of the amino acid sequence shown in SEQ ID NO: 2, and a protein which consists of an amino acid sequence including a substitution of methionine at position 508 with alanine, with respect to a sequence of amino acids at positions 19 to 626 of the amino acid sequence shown in SEQ ID NO: 3; a protein which consists of a sequence of amino acids at positions 7 to 294 of the amino acid sequence shown in SEQ ID NO: 1, a protein which consists of a sequence of amino acids at positions 2 to 146 of the amino acid sequence shown in SEQ ID NO: 2, and a protein which consists of an amino acid sequence including a substitution of phenylalanine at position 569 with alanine, with respect to a sequence of amino acids at positions 19 to 626 of the amino acid sequence shown in SEQ ID NO: 3; a protein which consists of a sequence of amino acids at positions 7 to 294 of the amino acid sequence shown in SEQ ID NO: 1, a protein which consists of a sequence of amino acids at positions 2 to 146 of the amino acid sequence shown in SEQ ID NO: 2, and a protein which consists of an amino acid sequence including a substitution of lysine at position 607 with alanine, with respect to a sequence of amino acids at positions 19 to 626 of the amino acid sequence shown in SEQ ID NO: 3.

[0066] Other most preferable examples of the protein complex contained in the adjuvant of the present invention include:

a protein which consists of a sequence of amino acids at positions 6 to 293 of the amino acid sequence shown in SEQ ID NO: 15, a protein which consists of a sequence of amino acids at positions 2 to 146 of the amino acid sequence shown in SEQ ID NO: 16, and a protein which consists of an amino acid sequence including a substitution of leucine at position 473 with alanine, with respect to a sequence of amino acids at positions 20 to 626 of the amino acid sequence shown in SEQ ID NO: 17; a protein which consists of a sequence of amino acids at positions 6 to 293 of the amino acid sequence shown in SEQ ID NO: 15, a protein which consists of a sequence of amino acids at positions 2 to 146 of the amino acid sequence shown in SEQ ID NO: 16, and a protein which consists of an amino acid sequence including a substitution of methionine at position 508 with alanine, with respect to a sequence of amino acids at positions 20 to 626 of the amino acid sequence shown in SEQ ID NO: 17; a protein which consists of a sequence of amino acids at positions 6 to 293 of the amino acid sequence shown in SEQ ID NO: 15, a protein which consists of a sequence of amino acids at positions 2 to 146 of the amino acid sequence shown in SEQ ID NO: 16, and a protein which consists of an amino acid sequence including a substitution of phenylalanine at position 569 with alanine, with respect to a sequence of amino acids at positions 20 to 626 of the amino acid sequence shown in SEQ ID NO: 17; a protein which consists of a sequence of amino acids at positions 6 to 293 of the amino acid sequence shown in SEQ ID NO: 15, a protein which consists of a sequence of amino acids at positions 2 to 146 of the amino acid sequence shown in SEQ ID NO: 16, and a protein which consists of an amino acid sequence including a substitution of lysine at position 607 with alanine, with respect to a sequence of amino acids at positions 20 to 626 of the amino acid sequence shown in SEQ ID NO: 17.

[0067] Herein, the amino acid substitution is sometimes expressed, assuming that the N-terminal of an amino acid sequence of interest corresponds to the 1st position, by putting a position number of a wild type amino acid residue on the left side and putting a position number of an amino acid residue to be used for modification on the right side of a position number of an amino acid to be substituted. For example, in the amino acid sequence shown in SEQ ID NO: 3, if lysine at position 607 (K) is substituted with alanine (A), the resultant sequence is expressed as BHA3 K607A or K607A.

[0068] Besides, proteins homologous to the six proteins composing the protein complexes, that is, a protein which comprises a sequence of amino acids at positions 7 to 294 of the amino acid sequence shown in SEQ ID NO: 1, a protein which comprises a sequence of amino acids at positions 2 to 146 of the amino acid sequence shown in SEQ ID NO: 2, a protein which comprises an amino acid sequence including a substitution of at least one or more amino acids among leucine at position 473, methionine at position 508, phenylalanine at position 569, and lysine at position 607 with other amino acid(s), with respect to a sequence of amino acids at positions 19 to 626 of the amino acid sequence shown in SEQ ID NO: 3, a protein which comprises a sequence of amino acids at positions 6 to 293 of the amino acid sequence shown in SEQ ID NO: 15, a protein which comprises a sequence of amino acids at positions 2 to 146 of the amino acid sequence shown in SEQ ID NO: 16, and a protein which comprises an amino acid sequence including a substitution of at least one or more amino acids among leucine at position 473, methionine at position 508, phenylalanine at position 569, and lysine at position 607 with other amino acid(s), with respect to a sequence of amino acids at positions 20 to 626 of the amino acid sequence shown in SEQ ID NO: 17, may be used as long as the homologous proteins respectively have equivalent activities. Hereinafter, the amino acid sequence in which at least one or more of positions of 473, 508, 569, and 607 of the amino acid sequence shown in SEQ ID NO: 3 is substituted with other amino acid(s) will be designated as the modified amino acid sequence of SEQ ID NO: 3, and the amino acid sequence in which at least one or more of positions of 473, 508, 569, and 607 of the amino acid sequence shown in SEQ ID NO: 17 is substituted with other amino acid(s) will be designated as the modified amino acid sequence of SEQ ID NO: 17.

[0069] Here, the term having equivalent activity means that a protein complex composed of the homologous proteins has mucosal adjuvant activity equivalent to or has mucosal adjuvant activity, without affecting the intercellular adhesion, equivalent to that of the protein complex composed of a protein which comprises a sequence of amino acids at positions 7 to 294 of the amino acid sequence shown in SEQ ID NO: 1, a protein which comprises a sequence of amino acids at positions 2 to 146 of the amino acid sequence shown in SEQ ID NO: 2, and a protein which comprises an amino acid sequence including a substitution of at least one or more amino acids among leucine at position 473, methionine at position 508, phenylalanine at position 569, and lysine at position 607 with other amino acid(s), with respect to a sequence of amino acids at positions 19 to 626 of the amino acid sequence shown in SEQ ID NO: 3; or a protein which comprises a sequence of amino acids at positions 6 to 293 of the amino acid sequence shown in SEQ ID NO: 15, a protein which comprises a sequence of amino acids at positions 2 to 146 of the amino acid sequence shown in SEQ ID NO: 16, and a protein which comprises an amino acid sequence including a substitution of at least one or more amino acids among leucine at position 473, methionine at position 508, phenylalanine at position 569, and lysine at position 607 with other amino acid(s), with respect to a sequence of amino acids at positions 20 to 626 of the amino acid sequence shown in SEQ ID NO: 17.

[0070] The term mucosal adjuvant activity refers to activity that enhances, when the adjuvant is administered transmucosally in combination with a vaccine antigen, production of an antibody specific to the antigen in both the mucosal and systemic systems. Preferably, it refers to activity that slightly affects the innate immunity, and enhances the production of the antibody specific to the antigen in both the mucosal and systemic systems, and more preferably, it refers to activity that does not affect the innate immunity, and enhances the production of the antibody specific to the antigen in both the mucosal and systemic systems. Examples of such homologous proteins encompass a protein which consists of an amino acid sequence including a deletion, substitution or addition of one to several amino acids, with respect to a sequence of amino acids at positions 7 to 294 of the amino acid sequence shown in SEQ ID NO: 1, with respect to a sequence of amino acids at positions 2 to 146 of the amino acid sequence shown in SEQ ID NO: 2, or at positions other than the amino acids at position 473, at position 508, at position 569, and at position 607, with respect to the modified acid sequence of SEQ ID NO: 3, or a protein which consists of an amino acid sequence including a deletion, substitution or addition of one to several amino acids, with respect to a sequence of amino acids at positions 6 to 293 of the amino acid sequence shown in SEQ ID NO: 15, with respect to a sequence of amino acids at positions 2 to 146 of the amino acid sequence shown in SEQ ID NO: 16, or at positions other than the amino acids at position 473, at position 508, at position 569, and at position 607, with respect to the modified acid sequence of SEQ ID NO: 17. Here, the range of one to several refers to the number of amino acids that can be deleted, substituted or added by a known method for producing a mutant protein, such as site-directed mutagenesis, and as long as the activity described above is retained, the number is not limited, but is 1 to 30, 1 to 25, 1 to 20, 1 to 15, or 1 to 12, preferably 1 to 10, 1 to 9, 1 to 8, 1 to 7 or 1 to 6, and more preferably 1 to 5, 1 to 4, 1 to 3 or 1 to 2. The substitution is not especially limited as long as the resultant has the equivalent activity, and is, for example, the conservative amino acid substitution. The conservative amino acid substitution means substitution of amino acids similar to each other in, for example, the structural, the electrical, the polarity or the hydrophobic properties. Such properties can be classified in accordance with, for example, similarity in the amino acid side chain, and can be classified into the following groups: An amino acid group having an acidic side chain (aspartic acid and glutamic acid), an amino acid group having a basic side chain (lysine, arginine and histidine), an amino acid group having a nonpolar side chain (alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine and tryptophan), an amino acid group having a side chain with no charging polarity (glycine, asparagine, glutamine, cysteine, serine, threonine and tyrosine), an amino acid group having a hydrophobic side chain (alanine, valine, leucine, isoleucine, proline, phenylalanine and methionine), an amino acid group having a branched side chain (threonine, valine, leucine and isoleucine), an amino acid group having an aromatic side chain (tyrosine, tryptophan, phenylalanine and histidine), an amino acid group having a hydroxymethylene group (serine and threonine), a group having an amide-containing side chain (asparagine and glutamine) and the like.

[0071] Besides, each of the following eight groups includes amino acids regarded to be conservatively mutually replaceable in this technical field (for example, see Creighton, Proteins 1984).

[0072] 1) alanine and glycine;

[0073] 2) aspartic acid and glutamic acid;

[0074] 3) asparagine and glutamine;

[0075] 4) arginine and lysine;

[0076] 5) isoleucine, leucine, methionine and valine;

[0077] 6) phenylalanine, tyrosine and tryptophan;

[0078] 7) serine and threonine; and

[0079] 8) cysteine and methionine.

[0080] Besides, a homologous protein may be a protein which comprises an amino acid sequence having 90% or more sequence identity to a sequence of amino acids at positions 7 to 294 of the amino acid sequence shown in SEQ ID NO: 1, a sequence of amino acids at positions 2 to 146 of the amino acid sequence shown in SEQ ID NO: 2, or the modified amino acid sequence of SEQ ID NO: 3, or a protein which comprises an amino acid sequence having 90% or more sequence identity to a sequence of amino acids at positions 6 to 293 of the amino acid sequence shown in SEQ ID NO: 15, a sequence of amino acids at positions 2 to 146 of the amino acid sequence shown in SEQ ID NO: 16, or the modified amino acid sequence of SEQ ID NO: 17, and is preferably a protein which consists of an amino acid sequence having 90% or more sequence identity to a sequence of amino acids at positions 7 to 294 of the amino acid sequence shown in SEQ ID NO: 1, a sequence of amino acids at positions 2 to 146 of the amino acid sequence shown in SEQ ID NO: 2, or the modified amino acid sequence of SEQ ID NO: 3, or a protein which consists of an amino acid sequence having 90% or more sequence identity to a sequence of amino acids at positions 6 to 293 of the amino acid sequence shown in SEQ ID NO: 15, a sequence of amino acids at positions 2 to 146 of the amino acid sequence shown in SEQ ID NO: 16, or the modified amino acid sequence of SEQ ID NO: 17. Here, the term 90% or more sequence identity refers to sequence identity of preferably 95% or more, more preferably 97% or more, and most preferably 98% or more. The sequence identity of an amino acid sequence can be determined through a FASTA search or BLAST search method.

[0081] A method for producing the adjuvant of the present invention is not especially limited. Each of the aforementioned protein complexes may be derived from nature, or alternatively, proteins composing the protein complex may be produced by genetic recombination, so as to use the resultant proteins for forming the complex. If it is produced by the genetic recombination, genes respectively encoding the proteins may be used in a known method. Specifically, wild-type HA1, HA2 and HA3 can be produced by constructing expression vectors containing genes respectively encoding the amino acid sequences shown in SEQ ID NOs: 1, 2 and 3 (whose nucleotide sequences are shown in SEQ ID NOs: 4, 5 and 6, respectively), or genes respectively encoding the amino acid sequences shown in SEQ ID Nos: 15, 16 and 17 (whose nucleotide sequences are shown in SEQ ID Nos: 18, 19 and 20), introducing the expression vectors into adequate host cells, and culturing the host cells. Alternatively, as for a mutant HA3 having the amino acid substitution at the specific position in the amino acid sequence shown in SEQ ID NO: 3 or SEQ ID NO: 17, a desired point mutant sequence can be produced by site-directed mutagenesis employing both PCR using a complementary primer pair and a treatment using DpnI restriction enzyme (Gene 1994 Dec. 30; 151(1-2): 119-23).

[0082] For example, if a mutant HA3 in which lysine (K) in position 607 in the amino acid sequence shown in SEQ ID NO: 3 is substituted with alanine (A) is to be produced, the production is performed by amplifying, by the PCR, an expression plasmid encoding wild-type HA3 by using a complementary primer pair in which aaa (a codon encoding lysine) is changed to get (a codon encoding alanine). Alternatively, the HA1, the HA2 and the HA3 can be produced by chemical synthesis performed on the basis of their amino acid sequences.

[0083] Homologous proteins of the HA1, the HA2 and the HA3 can be also produced by a well-known recombinant DNA method by, for example, using gene encoding the homologous proteins obtained by subjecting genes respectively encoding the amino acid sequences shown in SEQ ID NOs: 1, 2 and 3 or SEQ ID Nos: 15, 16 and 17 to the site-directed mutagenesis. The production of these proteins can be easily carried out specifically with reference to a basic literature such as Molecular Cloning 2nd Ed., Cold Spring Harbor Laboratory Press, 1989.

[0084] The thus produced HA1, HA2 and HA3 proteins may be incubated in a solvent such as a phosphate buffer for 2 to 8 hours, preferably 3 to 5 hours, and more preferably 3 hours at 25 C. to 40 C., and preferably 37 C., so as to compose the complex. Alternatively, a fusion protein may be prepared from the HA1, HA2 and HA3 proteins. As a method for producing a fusion protein, a known method in which DNA fragments respectively encoding the HA1, HA2 and HA3 proteins are bound to be in-frame with one another, the resultant is introduced into an adequate expression vector, and the resultant is transcribed and translated with the aid of an adequate host so as to express a protein may be employed.

[0085] In general, the adjuvant of the present invention is administered to an organism simultaneously with a vaccine antigen, or may be administered before the administration of a vaccine antigen or after the administration of an antigen. If the adjuvant is administered simultaneously with a vaccine antigen, the adjuvant may be administered substantially simultaneously with the vaccine, and for example, the adjuvant and the vaccine antigen may be administered to the target at exactly the same time, or may be continuously administered within a given period of time (preferably within several minutes).

[0086] The vaccine antigen is preferably an inactivated antigen or a subunit antigen. The inactivated antigen refers to an antigen of a pathogen (such as a virus or a bacterium) deprived of infectivity, and examples thereof include virions, that is, complete virus particles, incomplete virus particles, virion-constituting particles, virus nonstructural proteins, antigens to prevent infections, and neutralizing epitopes. Examples of a treatment for the inactivation include physical treatments (with x-rays, heat, ultrasound and the like) and chemical treatments (with formalin, mercury, alcohol, chlorine and the like). The term subunit vaccine refers to a vaccine containing merely a specific antigen (an antigen to prevent an infection) as an effective vaccine component among various types of antigens contained in inactivated vaccines. An example of a subunit vaccine against, for example, the influenza virus is a vaccine containing merely hemagglutinin (HA) and neuraminidase (NA) that are purified surface antigens.

[0087] The vaccine antigen is not especially limited, provided that the vaccine antigen is capable of inducing a mucosal immune response together with the adjuvant of the present invention, and the antigen is typically derived from a pathogen causing a mucosal infection. The pathogen causing a mucosal infection may be a virus or a bacterium. Examples of the virus include, but are not limited to, influenza virus, human immunodeficiency virus (HIV), chickenpox virus, measles virus, rubella virus, mumps virus, poliovirus, rotavirus, norovirus, adenovirus, herpes virus, RS virus, dengue virus, Japanese encephalitis virus, severe acute respiratory syndrome (SARS) virus, cytomegalovirus, Epstein-Barr (EB) virus and hepatitis virus (type A, type B, or type C). Examples of the bacterium include, but are not limited to, Bordetella pertussis, Neisseria meningitidis, Haemophilus influenzae Type b, Diplococcus pneumoniae, Mycobacterium tuberculosis, Clostridium tetani and Vibrio cholerae. Such antigens derived from pathogens may be derived from nature or artificially prepared via gene recombination or other techniques.

[0088] The vaccine antigen includes an allergen used for hyposensitization therapy.

[0089] Accordingly, the adjuvant of the present invention can be used also as an adjuvant for an allergen vaccine. An allergen vaccine refers to a vaccine that blocks the function of IgE causing an allergy by producing IgG antibody against an allergen or increases allergen-specific type 1 helper T cells (Th1 cells) in vivo by administering the allergen to an organism, whereby decreasing type 2 helper T cells (Th2 cells) involved in allergy symptoms, and the allergen vaccine is capable of suppressing allergy symptoms via hyposensitization. The type of allergen is not especially limited, and examples include food allergens (such as casein, lactalbumin, lactoglobulin, ovomucoid, ovalbumin and conalbumin), house dust allergens (such as mite allergens), pollen allergens (such as cedar pollen allergens, ragweed allergens and cocksfoot grass allergens), and allergens of animal body hair.

[0090] The adjuvant of the present invention is administered transmucosally in combination with the mucosal vaccine antigen. The term being administered transmucosally refers to an administration form through a mucosal membrane. Examples of the mucosal membrane include inner walls of hollow organs that lead to the exterior, such as the digestive apparatus, the respiratory apparatus and the urogenital apparatus, and specific examples include the nasal cavity, oral cavity, pharynx, alveolus, air tube, intestinal tract, and vagina, among which the nasal cavity is preferable. Accordingly, examples of the transmucosal administration form include intranasal, intraoral, intra-alveolar, intratracheal, intravaginal, and intrarectal administration, among which the intranasal administration is preferable. The transmucosal administration of the adjuvant and the mucosal vaccine can be performed in an adequate manner in accordance with the site of administration. In the case of transnasal or oral administration, for example, a method of spraying, adding dropwise or applying them to the nasal cavity or oral cavity can be employed. Intra-alveolar administration can be carried out by a method involving the use of an inhaler or a sprayer, or a method of administering a preparation using an aerosolizing agent.

[0091] The amount of the adjuvant of the present invention to be administered varies in accordance with the age and the body weight of a subject, the disease type, the route of administration, the administration form, and other conditions, and the adjuvant of the present invention can be administered, simultaneously with a vaccine antigen, in an amount per dosage per adult human of, for example, 10 g to 100 mg, and preferably 1 g to 10 mg in employing the oral administration, and 0.1 g to 100 mg, and preferably 1 g to 10 mg in employing the transnasal administration. A subject of administration can be adequately determined in accordance with the type of the vaccine antigen used in combination with the adjuvant, and examples thereof include, in addition to a human, non-human mammals, birds, and crustaceans.

[0092] A person skilled in the art can easily determine the frequency of administration of the adjuvant of the present invention in combination with a vaccine antigen to a subject by taking, for example, the age, the body weight, the medical history, the clinical course of the subject, the disease type, and other factors into consideration. As in the case of general vaccine preparations, the administration may be carried out at an adequate time before the onset of the disease at the frequency of, in general, one to several instances per day for merely one day, or several times at intervals of one to several weeks. The administration is preferably carried out while observing progress, and booster immunization is preferably carried out at intervals of at least about a week. The intervals of the booster immunization are preferably at least about two weeks. By providing the booster immunization, a more effective infection-protective effect can be expected.

[0093] In order to administer the adjuvant of the present invention simultaneously with a vaccine antigen, the adjuvant may be mixed with the vaccine antigen together with a pharmaceutically acceptable carrier suitable for the dosage form, so as to produce a vaccine preparation by any of various known formulation methods.

[0094] The amount of the adjuvant to be incorporated into the vaccine preparation can be adequately determined in accordance with the type of vaccine antigen to be mixed. The content of the adjuvant in the preparation is not especially limited, provided that a sufficient antigen immune response can be induced via the transmucosal administration, and such an amount is generally 0.1% to 90% by weight, preferably 0.5% to 80% by weight, and more preferably 1% to 50% by weight based on the entire amount of the preparation.

[0095] The dosage form of the mucosal vaccine preparation of the present invention is not especially limited, provided that the mucosal vaccine preparation can be administered transmucosally, and examples thereof include a liquid preparation, a suspension, a spray, and a powder. Various additives that are generally used for a vaccine preparation, such as a solubilizer, an anticoagulant, a viscosity modifier, a pH adjuster, an isotonizing agent, an emulsifier, an antioxidant, a filler, a surfactant, a diluent, a preservative, a stabilizer, a desiccating agent and a moisturizing agent, can be added, if necessary, to the mucosal vaccine preparation of the present invention.

[0096] The vaccine preparation of the present invention can be in a liquid form or a dried form, and can be provided in a state where it is contained in a hermetically sealed vial bottle, a syringe, an atomizer, or a sealed ampule.

EXAMPLES

[0097] The present invention will now be described in greater detail with reference to examples, but the present invention is not limited thereto. Data obtained in the examples were statistically processed by Student's t-test.

(Example 1) Preparation of Botulinum Type B HA (BHA) Complex and Type A HA (AHA) Complex

[0098] A. Preparation of Wild-type Botulinum Type B HA (wild-type BHA) Complex and Wild-type Botulinum Type A HA (wild-type AHA) Complex

[0099] (1) Preparation of Plasmid

[0100] Genes respectively encoding proteins of the botulinum type B HA subcomponents (BHA1, BHA2 and BHA3) (BHA1: a protein consisting of amino acids in positions 7 to 294 of the amino acid sequence of SEQ ID NO: 1; BHA2: a protein consisting of amino acids in positions 2 to 146 of the amino acid sequence of SEQ ID NO: 2; and BHA3: a protein consisting of amino acids in positions 19 to 626 of the amino acid sequence of SEQ ID NO: 3), and genes respectively encoding proteins of the botulinum type A HA subcomponents (AHA1, AHA2 and AHA3) (AHA1: a protein consisting of amino acids in positions 6 to 293 of the amino acid sequence of SEQ ID NO: 15; AHA2: a protein consisting of amino acids in positions 2 to 146 of the amino acid sequence of SEQ ID NO: 16; and AHA3: a protein consisting of amino acids in positions 20 to 626 of the amino acid sequence of SEQ ID NO: 17) were amplified by the PCR from genomic DNA of the Clostridium botulinum B-Okra strain as a template respectively using the following primers.

TABLE-US-00001 (PrimersforBHA1Amplification) BHA1forwardprimer: (SEQIDNO:9) cactataagcttatccaaaattcattaaatg BHA1reverseprimer: (SEQIDNO:10) gttgataggtaccttatgggttactcatag (PrimersforBHA2Amplification) BHA2forwardprimer: (SEQIDNO:11) tgaataagctttcagctgaaagaacttttc BHA2reverseprimer: (SEQIDNO:12) cactttggtaccttatattttttcaagtttga (PrimersforBHA3Amplification) BHA3forwardprimer: (SEQIDNO:13) gaaaaagggtaccaatatagtgatactattg BHA3reverseprimer: (SEQIDNO:14) cgtgtcgacttaattagtaatatctatatgc (PrimersforAHA1Amplification) AHA1forwardprimer: (SEQIDNO:23) catgccatggtaatccaaaattcattaaa AHA1reverseprimer: (SEQIDNO:24) cgggatccttacttgtcatcgtcatccttgtagtctgggttacgaatatt ccatttc (PrimersforAHA2Amplification) AHA2forwardprimer: (SEQIDNO:25) tgaataagctttcagttgaaagaacttttctac AHA2reverseprimer: (SEQIDNO:26) attggtaccttatattttacaagtttgaac (PrimersforAHA3Amplification) AHA3forwardprimer: (SEQIDNO:27) aaagttaggtaccctagtgatactattgatttag AHA3reverseprimer: (SEQIDNO:28) cgtgtcgacttaattagtaatatctatatgc

[0101] The amplified DNA fragments of the BHA1 and the BHA2 were each inserted into the HindIII-SalI site of pT7-FLAG-1 (Sigma), that of the BHA3 was inserted into the KpnI-SalI site of pET52b(+) (Novagen) (pET-BHA3), that of the AHA1 was inserted into the NcoI-BamHI site of pET25b(+), that of the AHA2 was inserted into the HindIII-KpnI site of pT7-FLAG-1, and that of the AHA3 was inserted into the KpnI-SalI site of pET52b(+).

[0102] (2) Protein Expression

[0103] The thus prepared plasmids were separately transformed into E. coli Rosetta2 (DE3) strains (Novagen). Protein expression was induced using Overnight Express Autoinduction System 1 (Novagen). The protein expression was induced at 30 C. for 36 hours for the BHA1 and the BHA3, and at 18 C. for 40 hours for the BHA2. The protein expression was induced at 30 C. for 36 hours for the AHA1 and the AHA3, and at 18 C. for 40 hours for the AHA2. The E. coli strains were collected by centrifugation and stored at 80 C.

[0104] (3) Protein Purification and Complex Preparation

[0105] The BHA1 and the BHA2 were purified using Anti-FLAG M2 agarose (Sigma). The BHA3 was purified using StrepTrap HP (GE Healthcare). The amino acid sequences of the purified recombinant proteins FLAG-BHA1, FLAG-BHA2, and Strep-BHA3 are illustrated in FIG. 1. The AHA1 and the AHA2 were purified using Anti-FLAG M2 agarose (Sigma). The AHA3 was purified using StrepTrap HP (GE Healthcare). The amino acid sequences of the purified recombinant proteins AHA1-FLAG, FLAG-AHA2, and Strep-AHA3 are illustrated in FIG. 2. The purified recombinant proteins were respectively mixed at a ratio of BHA1:BHA2:BHA3 of 4:4:1 by mole and at a ratio of AHA1:AHA2:AHA3 of 4:4:1 by mole, and the resultants were incubated at 37 C. for 3 hours, followed by purification with StrepTrap HP, resulting in obtaining a BHA complex (BHA).

[0106] B. Preparation of Mutant Botulinum Type B HA (mutant BHA) Complex and Mutant Botulinum Type A HA (mutant AHA) Complex

[0107] Plasmids for expressing E-cadherin binding deletion mutants of the BHA3 (BHA3 L473A, BHA3 M508A, BHA3 F569A and BHA3 K607A) were obtained through mutation by the PCR using pET-BHA3 as a template. Subsequently, four mutant BHA complexes were obtained in the same manner as described in (2) and (3) above. The amino acid sequences of Strep-BHA3 mutants (L473A, M508A, F569A and K607A) are illustrated in FIG. 3. Also as E-cadherin binding deletion mutants of the AHA3 (AHA3 L473A, AHA3 M508A, AHA3 F569A and AHA3 K607A), four mutant AHA complexes were obtained by a similar method. The amino acid sequences of Strep-AHA3 mutants (L473A, M508A, F569A and K607A) are illustrated in FIG. 4.

[0108] C. Gel Filtration Chromatography of Botulinum Type B HA (BHA) Complex and Botulinum Type A HA (AHA) Complex

[0109] The wild-type BHA complex and the wild-type AHA complex prepared in A. above and the mutant BHA complexes and the mutant AHA complexes prepared in B. above were separated using Superdex 200 10/300 GL (GE Healthcare). In this test, N-terminal FLAG tag HA1, N-terminal FLAG tag HA2, and N-terminal Strep tag HA3 were respectively used for the HA1, the HA2 and the HA3 composing the BHA complex (BHA), and C-terminal FLAG tag HA1, N-terminal FLAG tag HA2 and N-terminal Strep tab HA3 were respectively used for the HA1, the HA2 and the HA3 composing the AHA complex (AHA). Results obtained in the wild-type complex (BHA) and the mutant (K607A) BHA complex are illustrated in FIG. 5.

(Example 2) Study of Subcomponent Significant for Interaction Between BHA Complex and E-Cadherin

[0110] The botulinum HA complex of serum type B (BHA) has a property of disrupting intercellular adhesion by binding to E-cadherin of a mouse or a human. On the other hand, a botulinum HA of serum type C (CHA) has no E-cadherin binding activity. Therefore, in order to identify a subcomponent significant for the interaction between the BHA complex and E-cadherin, chimeric botulinum HA complexes were prepared with different combinations of subcomponents of the BHA and the CHA, and the interaction with E-cadherin was analyzed by a pull-down assay. In the pull-down assay, each chimeric botulinum HA was adsorbed onto StrepTactin superflow agarose (Novagen), the resultant was reacted with a full length protein of E-cadherin purified from an E. coli expression system (EC1/2) or E-cadherin purified using HEK293 cell expression system, and the thus coprecipitated protein was analyzed by Western blotting using an anti-E-cadherin antibody (ECCD-2, Takara). The results are illustrated in FIG. 6. As illustrated in FIG. 6, if the botulinum HA3 subcomponents were of the serum type B, the complex was bound to E-cadherin. In other words, it was suggested that the BHA3 subcomponents are significant for the binding to E-cadherin.

(Example 3) Identification of BHA3 Region Significant for Interaction with E-Cadherin

[0111] In order to examine which region of the BHA3 was significant for the binding to E-cadherin, chimeric botulinum HA3 subcomponents were prepared using the botulinum type C HA3 subcomponents (CHA3) and the botulinum type B HA3 subcomponents (BHA3), and the interaction with E-cadherin was analyzed by a pull-down assay. The results are illustrated in FIG. 7. As illustrated in FIG. 7, a chimeric botulinum HA complex in which a region following position 473 of the BHA3 was fused had E-cadherin binding capacity, but a chimeric botulinum HA complex in which a region following the 485th position of the BHA3 was fused did not have E-cadherin binding capacity. This result suggested that a region from the amino acid at position 473 to the C-terminal of the BHA3 was significant for the interaction with E-cadherin.

(Example 4) Identification of Amino Acid of BHA3 Significant for Interaction with E-Cadherin

[0112] It was studied which amino acid among those contained in the region from the amino acid at position 473 to the C-terminal of the botulinum type B HA3 subcomponent (BHA3) was significant for the interaction with E-cadherin. Amino acids different from those contained in the botulinum type C HA (CHA) were selected from the sequence alignment, and BHA3 point mutants in which the selected amino acids were changed to alanine were prepared in the same manner as described in Example 1 (L473A, E501A, D503A, L504A, R505A, N506A, M508A, N509A, H534A, D535A, F569A, T574A, D576A, N582A, Q584A, Q585A, N586A, L587A, N588A, K607A and E609A), and their interactions with E-cadherin were analyzed by a pull-down assay. The results are illustrated in FIG. 8A. As illustrated in FIG. 8A, it was revealed that the E-cadherin binding capacity was attenuated in the mutants L473A, M508A, F569A and K607A. In particular, the E-cadherin binding capacity was presumed to be dramatically lowered in the mutants L473A, M508A and K607A.

[0113] Next, in order to examine the influence of the BHA mutants analyzed in FIG. 8A on the cell-cell junction, a transepithelial electrical resistance (TER) assay was performed using Caco-2 cells derived from a human colon cancer. A cell insert was set on a 24-well cell culture plate (transwell plate), and the Caco-2 cells were seeded in the insert. The formation of the intercellular adhesion of the Caco-2 cells was evaluated by measuring a TER value, After the TER value became 2,000 .Math.cm.sup.2 or more, the wild-type BHA complex or each of the mutant BHA complexes (BHA3 point mutants: L473A, R505A, M508A, N509A, H534A, F569A, K607A and E609A) was added to the basolateral side (10 nM), and change of the TER value occurring after the addition was observed over time. The results are illustrated in FIG. 8B. As illustrated in FIG. 8B, the TER value was remarkably decreased in the WT complex 8 hours after the addition, but the TER value was little decreased in the K607A mutant complex and the M508A mutant complex. It was also found that the intercellular adhesion disrupting ability was attenuated in the L473A mutant complex. On the other hand, the TER value decrease was slightly smaller in the F569A, which suggests that this may be an amino acid involved in the interaction with E-cadherin. These results suggested that the L473, M508, F569 and K607 might be amino acids significant for the interaction between the BHA complex and E-cadherin.

(Example 5) Interaction Between Wild-Type BHA Complex or Mutant (K607A) BHA Complex and E-Cadherin

[0114] The interaction between a BHA complex and E-cadherin, that is, a constituent element of the intercellular adhesion, was analyzed by a pull-down assay and Western blotting by mixing a 1% Triton X-100 extraction of Caco-2 cells derived from a human colon cancer and a resin on which a HA complex was immobilized. The results are illustrated in FIG. 9. As illustrated in FIG. 9, it was confirmed that the wild-type BHA complex is directly bound to E-cadherin of the Caco-2 cells. On the other hand, it was revealed that the mutant (K607A) BHA complex is not bound to E-cadherin of the Caco-2 cells.

(Example 6) Study on Influence of Mutant (K607A) BHA Complex on Intercellular Adhesion

[0115] The influence of the mutant (K607A) BHA complex on the intercellular adhesion was evaluated by performing a high dose treatment (1 M) in a TER assay using Caco-2 cells. The results are illustrated in FIG. 10. As illustrated in FIG. 10, in a culture well in which Caco-2 cells were treated with a wild-type BHA complex (WT) from the apical side, the TER value was greatly decreased within 12 hours after the treatment. On the other hand, in treating a mutant BHA complex (Mut), the TER value was not changed even after 24 hours, and substantially the same results were obtained in two dependent examinations.

[0116] Besides, as illustrated in FIG. 11, if Caco-2 cells were treated from the basolateral side, the TER value was greatly decreased within 12 hours after a treatment with a wild-type BHA complex (WT) in a low concentration of 6.25 nM, but the TER value was not changed at all in a treatment with a mutant BHA complex (Mut) even in a high concentration of 400 nM. These results reveal that the wild-type BHA complex strongly inhibits the intercellular adhesion of Caco-2 cells but the mutant (K607A) BHA complex had a property that it does not affect the intercellular adhesion at all.

(Example 7) M Cell Orientation of Wild-Type HA Complex or Mutant (K607A) HA Complex

[0117] Wild-type HA complexes (of type A and type B) were produced by conjugating, with the HA1 and the HA3, botulinum type A and type B HA2 having been labeled with Alexa 568. Similarly, Mutant HA complexes (of type A and type B) were produced by conjugating, with the HA1 and the HA3 (having K607A mutation), botulinum type A and type B HA2 having been labeled with Alexa 568. Each of these wild-type HA complexes and mutant HA complexes in an amount of 600 nM was injected into a ligated mouse intestinal tract, so as to observe localization of the HA complex after 2 hours with a confocal microscope. M cells were stained with FITC-labeled UEA-1. The results are illustrated in FIG. 12. As illustrated in FIG. 12, binding to and transcytosis through the M cells were observed in the wild-type HA complex. Besides, it was revealed that the mutant (K607A) HA complex has high M cell orientation similarly to the wild-type HA complex.

(Example 8) Study of Intercellular Adhesion Disrupting Ability on Epithelial Layer of Mucosal Tissue of Wild-Type HA Complex or Mutant (K607A) HA Complex

[0118] In order to study the influence on the intercellular adhesion of a mouse mucosal epithelial tissue of a wild-type HA complex (of type A or type B) or a mutant (K607A) HA complex (of type A or type B), a mixture of 5 M of each HA complex and 2 mg/mL FITC-labeled dextran (10 K) was injected into a ligated mouse intestinal tract, so as to observe dextran having entered intercellular spaces after 2 hours with a confocal microscope. M cells were stained with Rhodamine-labeled UEA-1. The results are illustrated in FIG. 13. As illustrated in FIG. 13, dextran was found to remain (as green dots; portions illustrated as white dots in the drawing) in the epithelial layer of the intestinal tract treated with the wild-type HA complex (HAwt) of both the serum type A and type B. Besides, morphological abnormalities of UEA-1 positive cells were found in the HAwt (which correspond to portions each surrounded with a white frame in the drawing). On the other hand, no dextran was found to remain in using the mutant (K607A) HA complex (HAmut), and the morphology of UEA-1 positive cells was normal. These results suggest that the HAwt disrupts the intercellular adhesion in the vicinity of the UEA-1 positive cells present on the epithelial layer of the ligated intestinal tract, but that the HAmut is a candidate of a safe mucosal adjuvant not affecting the intercellular adhesion of the mucosal epithelium.

(Example 9) Evaluation of Ability of Wild-Type BHA Complex and Mutant (K607A) BHA Complex Adjuvants to Activate Innate Immunity

[0119] The amounts of IL-6 cytokine production resulting from treatments respectively with the wild-type BHA complex and mutant (K607A) BHA complex adjuvants were measured using untreated mouse splenocytes, so as to evaluate the abilities of the BHA complex adjuvants to activate innate immunity.

[0120] Splenocytes were sampled from untreated mice raised under SPF conditions (C57BL/6, 6-week-old, female, purchased from CLEA Japan, Inc.) and seeded onto a 96-well plate at a cell density of 110.sup.6 cells/well. Thereafter, the BHA complex (BHA) was serially diluted from 20 g/ml (20 g/ml, 2 g/ml, 0.2 g/ml), and the splenocytes were stimulated. The splenocytes were co-stimulated with the BHA complex adjuvant in combination with a TLR ligand of LPS (1 g/ml). A culture supernatant was recovered 24 hours after the start of the stimulation and the amount of cytokine (IL-6) in the culture supernatant was measured (R&D systems). The results are illustrated in FIG. 14. As illustrated in FIG. 14, the production of IL-6 caused by the BHA complex adjuvant alone was below the detection limit in both cases using the wild-type BHA complex (BHAwt) and the mutant (K607A) BHA complex (BHAmut). Since the BHA complex adjuvant does not affect the IL-6 production through the LPS stimulation in both cases using the wild-type BHA complex (BHAwt) and the mutant (K607A) BHA complex (BHAmut), it was regarded that the BHA complex adjuvant would not enhance or suppress signals to activate any other innate immunity.

[0121] Besides, the amounts of TNF-alpha and IL-6 production were measured in using the mutant (K607A) BHA complex adjuvant (BHAmut) and its subcomponents (BHA1, BHA2 and BHA3mut). The results are illustrated in FIG. 15. As illustrated in FIG. 15, the production of TNF-alpha and IL-6 was below the detection limit even if splenocytes were treated with any of the BHA complex or the BHA subcomponents in a 100-fold concentration (100 g/mL, 33 g/mL, 11 g/mL and 3.7 g/mL) of LPS (1 g/mL, 0.33 g/mL, 0.11 g/mL and 0.037 g/mL). These results suggest that both the wild-type and the mutant BHA complex adjuvants are non-inflammatory adjuvants that do not affect signals to activate innate immunity.

(Example 10) Effects as Transnasal Adjuvant of Wild-Type and Mutant BHA Complexes Using Influenza HA Antigen

[0122] An influenza split vaccine was used as an antigen to evaluate adjuvant effects of the BHA complexes.

[0123] (1) Experimental Animals and Materials

[0124] BALB/c mice and C57BL/6 mice (6-week-old, female) were purchased from CLEA Japan, Inc. Mice were raised under SPF conditions.

[0125] A mouse-adapted A/Puerto Rico/8/34 (H1N1) split vaccine (hereafter referred to as the split vaccine) received from Kitasato Daiichi Sankyo Vaccine Co., Ltd. was used as a vaccine antigen. During the experiment, the antigen was refrigerated at 4 C. in the dark.

[0126] The wild-type BHA complex (BHAwt) adjuvant and the mutant BHA complex (BHAmut: K607A) adjuvant prepared in Example 1 were used as the adjuvants. An endotoxin content was set with a content of 0.5 EU/mL or lower regarded as the standard for purification. The BHA adjuvant was cryopreserved at 80 C., and thawed immediately before use to be used for immunization. A cholera toxin adjuvant (CTB) was prepared by mixing 1 g of cholera toxin B subunit (Catalog No. 033-20611, Wako Pure Chemical Industries, Ltd.) and 1 ng of cholera toxin (Catalog No. 033-20621, Wako Pure Chemical Industries, Ltd.) for each mouse. The cholera toxin adjuvant was cryopreserved at 80 C., and thawed immediately before use to be used for immunization.

[0127] (2) Test Method

[0128] A vaccine preparation for each mouse was prepared by adding PBS() to a mixture of 1 g of the split vaccine antigen with 20 g of the BHA complex (BHA) adjuvant or with 1.001 g of the cholera toxin mixed (CTB) adjuvant to attain an amount of 12 L. Each vaccine preparation was administered to a 6-week-old mouse through both nasal cavities in amount of 6 L each. The administration was carried out four times in total at intervals of 2 weeks (day 0, day 14, day 28, and day 42). Immediately before booster immunizations were provided on day 14, day 28, and day 42, the mouse was anesthetized using Ketalar (Daiichi Sankyo Company, Limited)/Selactar (Bayer), and a blood sample was obtained from the orbital venous plexus. The sampled blood was allowed to stand still at 4 C. overnight, and serum separation was carried out using a tabletop refrigerated centrifuge (9,100 g, 10 minutes, 4 C.). The thus obtained serum specimen was cryopreserved at 20 C. In order to evaluate the adjuvant effect of the BHA complex, IgG (total IgG, IgG1, IG2a, and IG2c) in the serum specimen was measured.

[0129] The mouse was anesthetized using Ketalar/Selactar 56 days after the start of the immunization, exsanguinated via cardiopuncture, and euthanized. Immediately after the euthanasia, a nasal cavity lavage fluid and a bronchoalveolar lavage fluid were respectively sampled. Thereafter, the nasal cavity lavage fluid and the bronchoalveolar lavage fluid were stored on ice or refrigerated until an ELISA assay.

[0130] The ELISA assay was carried out in the following manner. The split vaccine antigen was coated on a plate at a concentration of 1 g/mL (4 C., overnight), and blocking was carried out with 1% BSA/PBST (Tween 20: 0.05%) by allowing the plate to stand still at room temperature for 2 hours. The serum sample was serially diluted using 1% BSA/PBST (Tween 20: 0.05%). As a secondary antibody, an HRP-labeled antibody in accordance with the subclass was used. OD was measured using a plate reader after coloring, and the amount of influenza-antigen-specific antibody production was measured. Each of the nasal cavity lavage fluid and the bronchoalveolar lavage fluid was serially diluted using 1% BSA/PBST (Tween 20: 0.05%), and in order to evaluate the effect of the BHA complex adjuvant to potentiate the antigen-specific mucosal immunity, the amount of influenza-antigen-specific mucosal IgA production was measured.

[0131] (3) Test Results

[0132] FIG. 16 illustrates the results of measurement of influenza-antigen-specific IgG in blood (56 days after the start of the immunization). As illustrated in FIG. 16, the reaction of the antigen-specific antibody in blood was induced at a significantly higher level in groups subjected to the immunization with the wild-type BHA complex (BHAwt) adjuvant or the mutant BHA complex (BHAmut: K607A) adjuvant in combination with the influenza antigens than in a group subjected to the immunization with the influenza antigen alone. Such a phenomenon was observed in all the evaluated IgG subclasses.

[0133] FIG. 17 illustrates the results of measurement of the amounts of secretory IgA production in the nasal cavity lavage fluid and in the bronchoalveolar lavage fluid. As illustrated in FIG. 17, the amount of antigen-specific IgA production was high in the groups subjected to the immunization with the wild-type BHA complex (BHAwt) adjuvant or the mutant BHA complex (BAHmut: K607A) adjuvant in combination with the influenza antigen. In contrast, secretory IgA production was not substantially observed in the group of mice subjected to the immunization with the influenza antigen alone. These results proved that the BHA complex is effective as a novel non-inflammatory mucosal adjuvant.

(Example 11) Effects as Transnasal Adjuvant of Wild-Type and Mutant AHA Complexes or Wild-Type and Mutant BHA Complexes Using Influenza HA Antigen

[0134] An influenza split vaccine was used as an antigen to evaluate the adjuvant effects of the BHA complexes.

[0135] (1) Experimental Animals and Materials

[0136] BALB/c mice (6-week-old, female) were purchased from CLEA Japan, Inc. Mice were raised under SPF conditions.

[0137] A mouse-adapted A/Puerto Rico/8/34 (H1N1) split vaccine (hereafter referred to as the split vaccine) received from Kitasato Daiichi Sankyo Vaccine Co., Ltd. was used as a vaccine antigen. During the experiment, the antigen was refrigerated at 4 C. in the dark.

[0138] The wild-type AHA complex (AHAwt) adjuvant, the wild-type BHA complex (BHAwt) adjuvant, the mutant AHA complex (AHA L473A, AHA M508A, AHA F569A and AHA K607A) adjuvants, the mutant BHA complex (BHA K607A) adjuvant prepared in Example 1 were used as the adjuvants. An endotoxin content was set with a content of 0.5 EU/mL or lower regarded as the standard for purification. The adjuvants were cryopreserved at 80 C., and thawed immediately before use to be used for immunization. A cholera toxin adjuvant (CTB) was prepared by mixing 1 g of cholera toxin B subunit (Catalog No. 033-20611, Wako Pure Chemical Industries, Ltd.) and 1 ng of cholera toxin (Catalog No. 033-20621, Wako Pure Chemical Industries, Ltd.) for each mouse. The cholera toxin adjuvant was cryopreserved at 80 C., and thawed immediately before use to be used for immunization.

[0139] (2) Test Method

[0140] A vaccine preparation for each mouse was prepared by adding PBS() to a mixture of 1 g of the split vaccine antigen with 20 g of the AHA complex (AHA) adjuvant, 20 g of the BHA complex (BHA) adjuvant or with 1.001 g of the cholera toxin mixed (CTB) adjuvant to attain an amount of 12 L. Each vaccine preparation was administered to a 6-week-old mouse through both nasal cavities in amount of 6 L each. The administration was carried out three times in total at intervals of 2 weeks (day 0, day 14 and day 28). The mouse was anesthetized using Ketalar/Selactar 42 days after the start of the immunization, exsanguinated via cardiopuncture, and euthanized. The thus obtained blood was allowed to stand still at 4 C. overnight, and serum separation was carried out using a tabletop refrigerated centrifuge (9,100 g, 10 minutes, 4 C.). The thus obtained serum specimen was cryopreserved at 20 C. In order to evaluate the adjuvant effect of the AHA complex or the BHA complex, IgG (total IgG) in the serum specimen was measured. After the euthanasia, a nasal cavity lavage fluid was sampled. The sampled nasal cavity lavage fluid was stored on ice or refrigerated until an ELISA assay.

[0141] The ELISA assay was carried out in the following manner. The split vaccine antigen was coated on a plate at a concentration of 1 g/mL (4 C., overnight), and blocking was carried out with 1% BSA/PBST (Tween 20: 0.05%) by allowing the plate to stand still at room temperature for 2 hours. The serum sample was serially diluted using 1% BSA/PBST (Tween 20: 0.05%). As a secondary antibody, an HRP-labeled antibody in accordance with the subclass was used. OD was measured using a plate reader after coloring, and the amount of influenza-antigen-specific antibody production was measured. The nasal cavity lavage fluid was serially diluted using 1% BSA/PBST (Tween 20: 0.05%), and in order to evaluate the effect of the AHA complex or the BHA complex adjuvant to potentiate the antigen-specific mucosal immunity, the amount of influenza-antigen-specific mucosal IgA production was measured.

[0142] (3) Test Results

[0143] FIG. 18A illustrates the results of measurement of influenza-antigen-specific IgG in blood. As illustrated in FIG. 18A, the reaction of the antigen-specific antibody in blood was induced at a higher level in groups subjected to the immunization with the wild-type AHA complex (AHAwt) adjuvant, the wild-type BHA complex (BHAwt) adjuvant, the mutant AHA complex (AHA L473A, AHA M508A, AHA F569A or AHA K607A) adjuvant or the mutant BHA complex (BHA K607A) adjuvant in combination with the influenza antigen than in a group subjected to the immunization with the influenza antigen alone. Besides, the potentiating activity for the antigen-specific antibody in blood was equivalent among the wild-type AHA complex adjuvant, the wild-type BHA complex adjuvant, the mutant AHA complex adjuvant and the mutant BHA complex adjuvant.

[0144] FIG. 18B illustrates the results of measurement of the amounts of secretory IgA production in the nasal cavity lavage fluid. As illustrated in FIG. 18B, the amount of the antigen-specific mucosal IgA production was high in the groups subjected to the immunization with the wild-type AHA complex (AHAwt) adjuvant, the wild-type BHA complex (BHAwt) adjuvant, the mutant AHA complex (AHA L473A, AHA M508A, AHA F569A or AHA K607A) adjuvant, or the mutant BHA complex (BAH K607A) adjuvant in combination with the influenza antigen than in a group subjected to the immunization with the influenza antigen alone. Besides, the potentiating activity for the antigen-specific mucosal IgA antibody was equivalent among the wild-type AHA complex adjuvant, the wild-type BHA complex adjuvant, the mutant AHA complex adjuvant and the mutant BHA complex adjuvant. These results suggest that the mucosal adjuvant activity is equivalent among the wild-type AHA complex adjuvant, the wild-type BHA complex adjuvant, the mutant AHA complex adjuvant and the mutant BHA complex adjuvant, and is not affected by a difference in the mutation introduction site.

INDUSTRIAL APPLICABILITY

[0145] The present invention is applicable in the field of production of a mucosal adjuvant and a mucosal vaccine preparation containing the same.

[0146] All publications, patents, and patent applications cited herein are incorporated herein by reference in their entirety.