Infectious cDNA of an approved vaccine strain of measles virus, use for immunogenic compositions

09701944 ยท 2017-07-11

Assignee

Inventors

Cpc classification

International classification

Abstract

The invention relates to a cDNA molecule which encodes the nucleotide sequence of the full length antigenomic (+)RNA strand of a measles virus (MV) originating from an approved vaccine strain. It also concerns the preparation of immunogenic compositions using said cDNA.

Claims

1. An expression vector for producing an infectious recombinant live-attenuated measles virus comprising: A) a nucleotide sequence encoding a full length antigenomic (+)RNA strand of the live-attenuated measles virus; B) a T7 promoter sequence comprising a GGG motif at its 3 end, operably linked to the nucleotide sequence of A); C) a hammerhead ribozyme sequence located adjacent to the GGG motif at one end and adjacent to the first nucleotide of the nucleotide sequence encoding the full length anti-genomic (+)RNA strand of the measles virus at the other end; D) a T7 terminator sequence operably linked to the nucleotide sequence of A); E) a sequence of a hepatitis delta virus ribozyme located adjacent to the last nucleotide of the nucleotide sequence encoding the full length anti-genomic (+)RNA strand of the measles virus; and F) a heterologous coding sequence encoding a heterologous amino acid sequence.

2. The expression vector of claim 1, wherein the infectious recombinant measles virus is a recombinant Schwarz strain.

3. The expression vector of claim 1, wherein the infectious recombinant measles virus is a recombinant Moraten strain.

4. The expression vector of claim 2, wherein the full length antigenomic (+)RNA strand has the sequence extending from position 83 to position 15976 of SEQ ID NO: 82.

5. The expression vector of claim 2, wherein the hammerhead ribozyme sequence has the sequence extending from position 29 to position 82 of SEQ ID NO: 82.

6. The expression vector of claim 2, comprising the nucleotide sequence extending from nucleotide 83 to nucleotide 15976 of the sequence of SEQ ID NO: 82.

7. The expression vector of claim 2, comprising the nucleotide sequence of SEQ ID NO: 82.

8. The expression vector of claim 2, comprising the nucleotide sequence extending from nucleotide 29 to nucleotide 16202 of the sequence of SEQ ID NO: 82.

9. The expression vector of claim 2, comprising the nucleotide sequence extending from nucleotide 26 to nucleotide 16202 of the sequence of SEQ ID NO: 82.

10. The expression vector of claim 2, comprising the nucleotide sequence extending from nucleotide 9 to nucleotide 16202 of the sequence of SEQ ID NO: 82.

11. The expression vector of claim 1, wherein the heterologous coding sequence is cloned within the nucleotide sequence encoding the full length antigenomic (+)RNA strand of the measles virus at a position upstream of the N gene of the measles virus.

12. The expression vector of claim 1, wherein the heterologous coding sequence is cloned between the P and M gene of the measles virus.

13. The expression vector of claim 1, wherein the heterologous coding sequence is cloned between the H and L genes of the measles virus.

14. The expression vector of claim 1, wherein the heterologous coding sequence codes for an immunogenic sequence of a pathogen.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIGS. 1A and 1B. Comparison of MV genomes. (A) Nucleotide changes for each coding region (capital letters in boxes) and in non-coding regions (lower case letters) are shown in the lower part (EdB-tag: SEQ ID NO: 87; EdB-Rbx: SEQ ID NO:88; Schw/Mor: SEQ ID NO: 89). Amino acid changes are shown in the upper part (one-letter amino acid symbol) (EdB-tag: SEQ ID NO: 84; EdB-Rbx: SEQ ID NO:85; Schw/Mor: SEQ ID NO: 86). Yellow color in the grid shows the wt substitutions. Blue color indicates the substitutions corresponding to the Rubeovax/Scwharz/moraten vaccine type. The red color shows the nucleotide and amino acid changes that are present only in the EdB-tag sequence. Nucleotide changes in positions 1805 and 1806 of EdB-tag correspond to the tag introduced. (B) Phylogenetic tree showing the EdB-tag among the Edmonston group and two wt isolates (Takeda, M., A. Kato, F. Kobune, H. Sakata, Y. Li, T. Shioda, Y. Sakai, M. Asakawa, and Y. Nagai. 1998. Measles virus attenuation associated with transcriptional impediment and a few amino acid changes in the polymerase and accessory proteins. J Virol. 72:8690-8696; Takeuchi, K., N. Miyajima, F. Kobune, and M. Tashiro. 2000. Comparative nucleotide sequence analyses of the entire genomes of B95a cell-isolated and vero cell-isolated measles viruses from the same patient. Virus Genes. 20:253-257). The sequences were aligned using Clustal W (Thompson, J. D., D. G. Higgins, and T. J. Gibson. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22:4673-4680). Nucleotide sequence distance were determined with Dnadist of the Phylip package version 3.5 Felsenstein, J. 1989. Cladistics. 5:164-166. The tree was derived by neighbor-joining analysis applied to pairwise sequence distances calculated using a variety of methods including the Kimura two-parameter method to generate unrooted trees. The final output was generated with Treeview (Page, R. D. 1996. TreeView: an application to display phylogenetic trees on personal computers. Comput Appl Biosci. 12:357-358).

(2) FIG. 2. Schematic map of the pTM-MV Schw plasmid. To construct the complete sequence, the six fragments represented in the upper part were generated and recombined step by step using the unique restriction sites indicated. T7=T7 promoter; hh=hammerhead ribozyme; hv=hepatitis delta ribozyme; T7t=T7 RNA polymerase terminator. The following oligonucleotides were used for the sequencing of the MV Schwarz cDNA and the Schwarz MV rescued from the cDNA.

(3) TABLE-US-00001 N.sup.o Sense Position N.sup.o Antisense 1 ATCCGAGATGGCCACACTTT 101 1a AAAGTGTGGCCATCTCGGAT (SEQIDNO:1) (SEQIDNO:2) 2 TGATTCTGGGTACCATCCTA 601 2a TAGGATGGTACCCAGAATCA (SEQIDNO:3) (SEQIDNO:4) 3 TATGCCATGGGAGTAGGAGT 1110 3a ACTCCTACTCCCATGGCATA (SEQIDNO:5) (SEQIDNO:6) 4 TGGCAGGAATCTCGGAAGAA 1609 4a TTCTTCCGAGATTCCTGCCA (SEQIDNO:7) (SEQIDNO:8) 5 GCATCAAGCACTGGGTTACA 2110 5a TGTAACCCAGTGCTTGATGC (SEQIDNO:9) (SEQIDNO:10) 6 TACAGGAGTGGACACCCGAA 2651 6a TTCGGGTGTCCACTCCTGTA (SEQIDNO:11) (SEQIDNO:12) 7 AGGACAGCTGCTGAAGGAAT 3096 7a ATTCCTTCAGCAGCTGTCCT (SEQIDNO:13) (SEQIDNO:14) 8 TTGTTGAGGACAGCGATTCC 3610 8a GGAATCGCTGTCCTCAACAA (SEQIDNO:15) (SEQIDNO:16) 9 AGAGTGAAGTCTACTCTGCC 4120 9a GGCAGAGTAGACTTCACTCT (SEQIDNO:17) (SEQIDNO:18) 10 TGACACAAGGCCACCACCAG 4608 10a CTGGTGGTGGCCTTGTGTCA (SEQIDNO:19) (SEQIDNO:20) 11 AGCTCCCAGACTCGGCCATC 5169 11a GATGGCCGAGTCTGGGAGCT (SEQIDNO:21) (SEQIDNO:22) 12 CCAGCCATCAATCATTAGTC 5603 12a GACTAATGATTGATGGCTGG (SEQIDNO:23) (SEQIDNO:24) 13 AGTTTACGGGACCCCATATC 6115 13a GATATGGGGTCCCGTAAACT (SEQIDNO:25) (SEQIDNO:26) 14 GGAACCTAATAGCCAATTGT 6608 14a ACAATTGGCTATTAGGTTCC (SEQIDNO:27) (SEQIDNO:28) 15 CTCTTCGTCATCAAGCAACC 7151 15a GGTTGCTTGATGACGAAGAG (SEQIDNO:29) (SEQIDNO:30) 16 TCACTTGGTGTATCAACCCG 7677 16a CGGGTTGATACACCAAGTGA (SEQIDNO:31) (SEQIDNO:32) 17 AACTGTATGGTGGCTTTGGG 8126 17a CCCAAAGCCACCATACAGTT (SEQIDNO:33) (SEQIDNO:34) 18 TGTGTATTGGCTGACTATCC 8620 18a GGATAGTCAGCCAATACACA (SEQIDNO:35) (SEQIDNO:36) 19 ATCAGGCATACCCACTAGTG 9162 19a CACTAGTGGGTATGCCTGAT (SEQIDNO:37) (SEQIDNO:38) 20 GCACAGCTCCCAGTGGTTTG 9701 20a CAAACCACTGGGAGCTGTGC (SEQIDNO:39) (SEQIDNO:40) 21 TCATGAGTTAACTGAAGCTC 10214 21a GAGCTTCAGTTAACTCATGA (SEQIDNO:41) (SEQIDNO:42) 22 GTCACGGAGGCTTGTAGATG 10715 22a CATCTACAAGCCTCCGTGAC (SEQIDNO:43) (SEQIDNO:44) 23 GTACTGCCTTAATTGGAGAT 11231 23a ATCTCCAATTAAGGCAGTAC (SEQIDNO:45) (SEQIDNO:46) 24 TGATGGGCTACTTGTGTCCC 11747 24a GGGACACAAGTAGCCCATCA (SEQIDNO:47) (SEQIDNO:48) 25 ACCCTTACTCAGCAAATCTT 12223 25a AAGATTTGCTGAGTAAGGGT (SEQIDNO:49) (SEQIDNO:50) 26 TCTATGCGAGGCCACCTTAT 12726 26a ATAAGGTGGCCTCGCATAGA (SEQIDNO:51) (SEQIDNO:52) 27 TTGTCCGAGTGGCGAGGTAT 13144 27a ATACCTCGCCACTCGGACAA (SEQIDNO:53) (SEQIDNO:54) 28 CAATTGGGCATTTGATGTAC 13712 28a GTACATCAAATGCCCAATTG (SEQIDNO:55) (SEQIDNO:56) 29 GAGGCTATGTTATCTCCAGC 14172 29a GCTGGAGATAACATAGCCTC (SEQIDNO:57) (SEQIDNO:58) 30 AGTTGGCCTTGTCGAACACA 14723 30a TGTGTTCGACAAGGCCAACT (SEQIDNO:59) (SEQIDNO:60) 31 CTGGACTTATAGGTCACATC 15190 31a GATGTGACCTATAAGTCCAG (SEQIDNO:61) (SEQIDNO:62) 32 GGTTTGAAACGTGAGTGGGT 15693 32a ACCCACTCACGTTTCAAACC (SEQIDNO:63) (SEQIDNO:64)

(4) FIGS. 3A, 3B, and 3C. Growth kinetics of rescued Schwarz and EdB-tag viruses on Vero and CEF cells. Cells on 35 mm dishes were infected with Schwarz MV rescued from pTM-MVSchw plasmid (-.square-solid.-), EdB-tag MV (--), and industrial Schwarz virus (--) at different MOI (as indicated). At each time point, cells were collected and cell-associated virus titers were determined using the TCID.sub.50 method on Vero cells. (A) Vero cells incubated at 37 C., (B) CEF incubated at 37 C., (C) CEF incubated at 32 C.

(5) FIGS. 4A and 4B. A: Schematic representation the additional transcription unit (ATU) (SEQ ID NOS: 90 and 91) and Schwarz MV vector plasmid. (AA) Cis-acting elements of the ATU inserted in position 2 between phosphoprotein (P) and matrix (M) MV open reading frames. (AB). Representation of the three positions of ATU insertion in the Schwarz MV vector plasmid.

(6) B: ATU sequence (SEQ ID NO: 83): small letters represent additional sequences (copy of the N-P intergenic region of measles virus) plus cloning sites. Capital letters correspond to the inserted enhanced GFP sequence. This sequence is inserted at the SpeI site (position 3373) of the cDNA sequence of the Schwarz strain of the measles virus for ATU2 and at the SpeI site (position 9174) for the ATU3. The mutation which distinguishes normal ATU from bis (in pTM-MVSchw2-gfp and pTM-MVSchw2-GFPbis) is a substituted C (Capital letter) at the end of ATU.

(7) FIGS. 5A to 5G. Complete nucleotide sequence of the pTM-MVSchw plasmid (SEQ ID NO: 82). The sequence can be described as follows with reference to the position of the nucleotides: 1-8 NotI restriction site 9-28 T7 promoter 29-82 Hammer head ribozyme 83-15976 MV Schwarz antigenome 15977-16202 HDV ribozyme and T7 terminator 16203-16210 NotI restriction site 16211-16216 ApaI restriction site 16220-16226 KpnI restriction site 16226-18967 pBluescript KS(+) plasmid (Stratagene)

(8) FIG. 6. Detection of anti-MV antibodies in macaques immunized with different MV vaccine strains. Anti-MV antibodies were detected by ELISA one month after immunization of rhesus macaques (2 monkeys per group) with Schwarz virus (gray bars), EdB-tag virus (white bars) and Rouvax vaccine (black bars) at the doses indicated. Immune status ratio (ISR) were calculated as described in materials and methods. Only ISR values higher than 0.9 were considered as positive (determinations were done in triplicate on 1/20 dilution of serum samples and results are expressed as the mean valuesSD).

(9) FIGS. 7A and 7B. Antibody titers to MV in mice immunized with different MV vaccine strains. Anti-MV antibodies were detected by ELISA one month after immunization of CD46 (A) and CD46/IFNAR (B) mice with 10.sup.4 TCID.sub.50 of EdB-tag virus (white bars), Schwarz virus (gray bars) and Rouvax vaccine (black bars). Results are expressed as mean OD valuesSD (4 mice per group) determined in serial dilutions of sera.

(10) FIG. 8. Detection of anti-MV antibodies in macaques immunized with different Schwarz measles virus preparations. Anti-MV antibodies were detected by ELISA at different time points after immunization of cynomolgus macaques (2 monkeys per group) with 10.sup.4 TCID.sub.50 of bulk industrial Schwarz virus (white marks), Schwarz virus rescued from pTM-MVSchw plasmid and grown on CEF (gray bars) or Vero cells (black bars). Immune status ratio (ISR) were calculated as described in materials and methods.

(11) FIGS. 9A-9D. Changes in the number of circulating leukocytes and MV-specific T-cell response in macaques immunized with different Schwarz MV preparations. Enumeration of white blood cells (A), lymphocytes (B), monocytes (C), and MV hemaglutinin-specific IFN--ELISpots (D) in PBMC of cynomolgus macaques collected at different time points after immunization with 10.sup.4 TCID.sub.50 of bulk industrial Schwarz virus (white marks), Schwarz virus rescued from pTM-MVSchw plasmid and grown on CEF (gray bars) or Vero cells (black bars). IFN--ELISpots were detected after stimulation of PBMC for 24 hours with a recombinant MVA expressing the MV hemaglutinin. The background obtained with MVA-wt stimulation was subtracted and the results are expressed as MVA-HMV specific -IFN producing cells per million PBMC.

(12) FIGS. 10A and 10B. Schematic representation of the pTM-MVSchw-ATU plasmids (A) and GFP expression in Vero cells infected by rescued recombinant viruses (B). Vero cells were infected with recombinant Schwarz MV-GFP either in position ATU2 (left side) or position ATU3 (right side) and the GFP fluorescence was observed in syncytia.

EXAMPLES

(13) Sequence Comparison Between EdB-Tag and Measles Vaccine Strains.

(14) In a nice analysis previously reported (Parks, C. L., R. A. Lerch, P. Walpita, H. P. Wang, M. S. Sidhu, and S. A. Udem. 2001. Analysis of the noncoding regions of measles virus strains in the Edmonston vaccine lineage. J Virol. 75:921-933; Parks, C. L., R. A. Lerch, P. Walpita, H. P. Wang, M. S. Sidhu, and S. A. Udem. 2001. Comparison of predicted amino acid sequences of measles virus strains in the Edmonston vaccine lineage. J Virol. 75:910-920), the coding and non-coding sequences of Edmonston-derived vaccine virus strains were compared to that of a low-passage isolate of the Edmonston wild-type measles virus. The authors identified 10 amino acids substitutions shared by almost all the vaccine strains. We compared the genomic sequences of these Edmonston-derived vaccine strains and two primary isolates (Takeda, M., A. Kato, F. Kobune, H. Sakata, Y. Li, T. Shioda, Y. Sakai, M. Asakawa, and Y. Nagai. 1998. Measles virus attenuation associated with transcriptional impediment and a few amino acid changes in the polymerase and accessory proteins. J Virol. 72:8690-8696; Takeuchi, K., N. Miyajima, F. Kobune, and M. Tashiro. 2000. Comparative nucleotide sequence analyses of the entire genomes of B95a cell-isolated and vero cell-isolated measles viruses from the same patient. Virus Genes. 20:253-257) to that of the previously reported Edmonston B infectious cDNA (EdB-tag) (Radecke, F., P. Spielhofer, H. Schneider, K. Kaelin, M. Huber, K. Dtsch, G. Christiansen, and M. Billeter. 1995. Rescue of measles viruses from cloned DNA. EMBO Journal. 14:5773-5784). FIG. 1 shows that the nucleotide sequence of EdB-tag differed from that of Rubeovax (Edmonston B vaccine) by 0.24% (38 mutations) and from that of Schwarz/Moraten by 0.27% (44 mutations). Schwarz/Moraten and Emonston B (Rubeovax) sequences differed only by 0.1% (16 mutations). Among the 38 differences between EdB-tag and Rubeovax, 17 were amino acid substitutions in coding regions and 7 were located in non-coding regions. Among the 44 differences between EdB-tag and Schwarz/Moraten, 22 were amino acid substitutions and 9 were in non-coding regions. The 10 amino acids substitutions shared by almost all the Edmonston vaccine strains Parks, C. L., R. A. Lerch, P. Walpita, H. P. Wang, M. S. Sidhu, and S. A. Udem. 2001. Analysis of the noncoding regions of measles virus strains in the Edmonston vaccine lineage. J Virol. 75:921-933; Parks, C. L., R. A. Lerch, P. Walpita, H. P. Wang, M. S. Sidhu, and S. A. Udem. 2001. Comparison of predicted amino acid sequences of measles virus strains in the Edmonston vaccine lineage. J Virol. 75:910-920) were conserved in EdB-tag cDNA. However, 5 of them were specific of the AIK-C and Zabreg subgroup, indicating that the virus from which EdB-tag was cloned diverged from Edmonston B and did not correspond to any approved vaccine strain. Moreover, 10 amino acid substitutions in EdB-tag were not related to any Edmonston subgroup, probably reflecting the adaptation to growth on HeLa cells and/or errors introduced during the cloning procedure. Among these specific changes, 5 were located in the P/V/C coding sequences and 3 were located in the L polymerase gene, thus possibly affecting the replicative capacity of the virus in vivo. These changes and others in cis-acting sequences may influence the immunogenicity or pathogenicity of the virus recovered from the EdB-tag cDNA. Indeed, MV adaptation to growth on Vero cells has been shown to be associated with loss of pathogenic potential (Kobune, F., H. Sakata, and A. Sugiura. 1990. Marmoset lymphoblastoid cells as a sensitive host for isolation of measles virus. J Virol. 64:700-705) and with a few amino acid changes located in the polymerase (L) and accessory (P/V/C) proteins resulting in transcriptional attenuation in lymphoid cells (Takeda, M., A. Kato, F. Kobune, H. Sakata, Y. Li, T. Shioda, Y. Sakai, M. Asakawa, and Y. Nagai. 1998. Measles virus attenuation associated with transcriptional impediment and a few amino acid changes in the polymerase and accessory proteins. J Virol. 72:8690-8696; Takeuchi, K., N. Miyajima, F. Kobune, and M. Tashiro. 2000. Comparative nucleotide sequence analyses of the entire genomes of B95a cell-isolated and vero cell-isolated measles viruses from the same patient. Virus Genes. 20:253-257.

(15) Construction of a cDNA Corresponding to the Antigenome of the Schwarz Vaccine Strain of Measles Virus.

(16) Viral particles were purified from a measles Schwarz vaccine batch kindly provided by Aventis Pasteur (Lyon, France). This bulk vaccine preparation (50 ml, 3 10.sup.4 TCID.sub.50/ml) was obtained by scraping of infected CEF cells, freeze-thawing cells and medium, and filtration of cellular debris. Particles were concentrated by centrifugation through a 30% sucrose cushion. Viral RNA was purified from lysed particles using a silica-gel-based membrane (QIAmp, Qiagen). Viral RNA was reverse-transcribed into cDNA using a mixture of random hexameres (pdN6, 1 M) and a specific oligonucleotide representing the 32 first nucleotides of MV genome (MVSchwRT1 5-ACCAAACAAAGTTGGGTAAGGATAGTTCAATC-3 (SEQ ID NO: 65), 10 M), as primers. In order to ensure the fidelity of reverse transcription and the yield of full-length products, the SuperScript II DNA polymerase was used (GibcoBRL). A set of six overlapping fragments covering the full viral cDNA (numbered 1 to 6 in FIG. 2) were generated by PCR using PfuTurbo DNA polymerase (Stratagene) and a set of specific primers closed to unique restriction sites. Fragment 1 at the 5 end of the viral antigenome was engineered by PCR with specific primers in order to contain a T7 RNA polymerase promoter with the GGG motif necessary for a full efficiency and a hammerhead ribozyme sequence inserted between the T7 promoter and the first viral nucleotide. To generate this fragment, two overlapping oligonucleotides were annealed together:

(17) TABLE-US-00002 Leader1 (SEQIDNO:66) (5-TATGCGGCCGCTAATACGACT CACTATAGGGCCAACTTTGTTTGGTCTGA-3)
containing a NotI site, the T7 promoter (underlined) and the 19 first nucleotides of hammerhead ribozyme sequence, and Leader 2 (5-GGTGACCCGGGACTCCGGGTTTCGTCCTCACGGACTCATCAGACCAAACA-3) (SEQ ID NO: 67) containing the hammer head sequence with a SmaI/XmaI site. After PCR amplification, the resulting fragment was linked by PCR extension to a second fragment also generated by PCR from Schwarz cDNA using oligonucleotiaes

(18) TABLE-US-00003 MVSchw1 (SEQIDNO:68) (5-GAGTCCCGGGTCACCAAACAAAGTTGGGTAAG-3)
overlapping with hammerhead sequence (underlined) and covering MV Schwarz genome 1-15, and MVSchw160 (5-GGTTTGTCCTTGTTTCTTTT-3 (SEQ ID NO: 69), MV Schwarz genome 141-160). Fragment 2 (2173 nucleotides long, see FIG. 2) was amplified using oligonucleotides MVSchwRT1 (5-ACCAAACAAAGTTGGGTAAGGATAGTTCAAT C-3 (SEQ ID NO: 70), MV Schwarz genome 1-32), and MVSchw2173 (5-ATTCCCTTAACCGCTTCACC-3 (SEQ ID NO: 71), MV Schwarz genome 2155-2174). Fragment 3 (3142 nucleotides long) was amplified using oligonucleotides MV Schw1901 (5-CTATGGCAGCATGGTCAGAAATA-3 (SEQ ID NO: 72), MV Schwarz genome 1901-1924) and MVSch5043 (5-ATTGTCGATGGTTGGGTGCT-3 (SEQ ID NO: 73), MV Schwarz genome 5024-5043). Fragment 4 (4349 nucleotides long) was amplified using oligonucleotides MVSchw4869 (5-AAACTTAGGGCCAAGGAACATAC-3 (SEQ ID NO: 74), MV Schwarz genome 4869-4891) and MVSchw9218 (5-GGACCCTACGTTTTTCTTAATTCTG-3 (SEQ ID NO: 75), MV Schwarz genome 9194-9218). Fragment 5 (6200 nucleotides long) was amplified using oligonucleotides MVSchw9119 (5-AGATAGGGCTGCTAGTGAACCAAT-3 (SEQ ID NO: 76), MV Schwarz genome 9119-9142) and MVSchw15319 (5-ATCAGCACCTGCTCTATAGGTGTAA-3 (SEQ ID NO: 77), MV Schwarz genome 15295-15319). To obtain fragment 6, two overlapping fragments generated by PCR were annealed together. The following oligonucleotides were used: MVSchw15155 (5-GCAGCAGATAATTGAATCATCTGTGAGGACTTCAC (SEQ ID NO: 78), MV Schwarz genome 15155-15190) and MVSchw15570 (5-CCCGGAGTAAAGAAGAATGTGCCCCCAGAATTTGC-3 (SEQ ID NO: 79), MV Schwarz genome 15535-15570). This fragment was annealed to a fragment containing the hepatitis delta virus (HDV) ribozyme linked to the T7 terminator that was previously obtained by PCR amplification of p(MV+) plasmid (a kind gift from M. Billeter) using oligonucleotides MVSchw15547 (5-GGCACATTCTTCTTTACTCCGGGAACAAAAAGTTG-3 (SEQ ID NO: 80), MV Schwarz genome 15547-15581) and MVSchwEnd (5-ATAGGGCCCGCGGCCGCATCCGG ATATAGTTCCTCCTTTCA-3 (SEQ ID NO: 81) containing an ApaI restriction site linked to the last nucleotides of T7 terminator. The 6 fragments thus generated were cloned in pCR2.1-TOPO vector (Invitrogen, Groningen, Netherlands) and sequenced. In order to assemble the MV Schwarz full length DNA, a modified BlueScript KS (+) plasmid was constructed: two internally complementary oligonucleotides yielding a NotI, KasI/NarI, SpeI, ApaI polylinker were annealed and inserted in pTM plasmid digested with NotI/ApaI (pTM was derived from pBluescript KS (+) (Stratagene) by deletion of the T7 promoter (Tangy, F., A. McAllister, and M. Brahic. 1989. Molecular cloning of the complete genome of Theiler's virus, strain GDVII, and production of infectious transcripts. J. Virol. 63:1101-11066). The 6 MV Schwarz cDNA fragments were assembled together step by step using unique restriction sites. Fragments 1 and 2 were assembled together using BlpI site in MV sequence (FIG. 2) and BgIII site in pCR2.1-TOPO vector backbone. The resulting plasmid was assembled with fragment 3 using SbfI site in MV sequence and BgIII site in pCR2.1-TOPO vector backbone, yielding plasmid pCR2.1-TOPO-MVSchw-1-2-3 containing MV Schwarz fragments 1-3. After NotI/NarI digestion of this plasmid, the fragment containing the T7 promoter, hammer head ribozyme and the 4922 first nucleotides of MV Schwarz antigenome was inserted in NotI/NarI digested pTM vector, yielding pTM-MVL. At the same time, fragments 5 and 6 were assembled together using BsmBI site in MV sequence (FIG. 2) and BssHII site in pCR2.1-TOPO vector backbone, yielding plasmid pCR2.1-TOPO-MVSchw-5-6 containing MV Schwarz fragments 5-6. After SpeI/ApaI digestion of this plasmid, the fragment containing the 6720 last nucleotides of MV Schwarz antigenome, HDV ribozyme and T7 terminator sequences was inserted in SpeI/ApaI digested pTM vector, yielding pTM-MVT. For the final assembling, four fragments were prepared and ligated together: 1) a SapI/SapI fragment of pTM-MVL (4367 nucleotides long) containing a part of pTM backbone, the T7 promoter, hammer head ribozyme, and the 1813 first nucleotides of MV antigenome, 2) a SapI/NarI fragment of pTM-MVL (3110 nucleotides long) containing nucleotides 1813-4923 from MV Schwarz antigenome, 3) a NarI/SpeI fragment of pCR2.1-TOPO-MVSchw-3 (4253 nucleotides long) containing nucleotides 4923-12157 of MV Schwarz antigenome, and 4) a SpeI/SapI fragment of pTM-MVT (7235 nucleotides long) containing nucleotides 12157-15894 of MV Schwarz antigenome, HDV ribozyme, T7 terminator and a part of pTM vector backbone. After ligation and cloning, several full constructs were obtained. The resulting plasmid, named pTM-MVSchw, was fully sequenced (Acc. Num. CNCM I-2889). No mutation was found between this cDNA and the previously reported sequence of Schwarz genome (Parks, C. L., R. A. Lerch, P. Walpita, H. P. Wang, M. S. Sidhu, and S. A. Udem. 2001. Analysis of the noncoding regions of measles virus strains in the Edmonston vaccine lineage. J Virol. 75:921-933; Parks, C. L., R. A. Lerch, P. Walpita, H. P. Wang, M. S. Sidhu, and S. A. Udem. 2001. Comparison of predicted amino acid sequences of measles virus strains in the Edmonston vaccine lineage. J Virol. 75:910-920).

(19) Recovery of Infectious Schwarz Virus from pTM-MVSchw Plasmid.

(20) To recover the Schwarz virus from the pTM-MVSchw cDNA, we used the helper-cell-based rescue system described by Radecke et al. (Radecke, F., P. Spielhofer, H. Schneider, K. Kaelin, M. Huber, K. Dtsch, G. Christiansen, and M. Billeter. 1995. Rescue of measles viruses from cloned DNA. EMBO Journal. 14:5773-5784) and modified by Parks et al. (Parks, C. L., R. A. Lerch, P. Walpita, M. S. Sidhu, and S. A. Udem. 1999. Enhanced measles virus cDNA rescue and gene expression after heat shock. J Virol. 73:3560-3566). Human helper cells stably expressing T7 RNA polymerase and measles N and P proteins (293-3-46 cells, disclosed by Radecke et al (17) were transfected using the calcium phosphate procedure with pTM-MVSchw plasmid (5 g) and a plasmid expressing the MV polymerase L gene (pEMC-La, 20 ng, disclosed by Radecke et al (17). After overnight incubation at 37 C., the transfection medium was replaced by fresh medium and a heat shock was applied (43 C. for two hours) (12). After two days of incubation at 37 C., transfected cells were transferred on a CEF cells layer and incubated at 32 C. in order to avoid any adaptation of the Schwarz vaccine that was originally selected on CEF cells and is currently grown on these cells for safety considerations. The above chicken embryo fibroblastic cells (CEF) were prepared as follows. Fertilized chicken eggs (EARL Morizeau, 8 rue Moulin, 28190 Dangers, France) was incubated at 38 C. for 9 days. Embryos were collected sterilely. Head, limbs and viscera were removed and embryos were sliced up and trypsinized for 5-10 minutes at 37 C. (Trypsine/EDTA 2.5 g/L). After filtration (70 m) and several washes in DMEM high glucose/10% FCS, cells were seeded (5-7 10.sup.6 cells/pertri dish) and incubated overnight at 37 C. Infectious virus was easily recovered between 3 and 7 days following cocultivation. Syncytia appeared occasionally in CEF, but not systematically. The Schwarz virus was also rescued by the same technique after cocultivation of transfected 293-3-46 helper cells at 37 C. with primate Vero cells (african green monkey kidney). In this case, syncytia appeared systematically in all transfections after 2 days of coculture. In order to test for viral adaptation to Vero cells, a preparation of cloned Schwarz virus rescued on Vero cells was passaged two times on Vero cells. Viral particles were purified and viral RNA was reverse-transcribed as described above with the primers used for the cloning (see above). The viral genome was fully sequenced. Two nucleotide changes out of 15894 were found between the rescued/passaged virus and the cDNA used for transfection. These mutations were found in 7 and 8 respectively out of 10 different clones of the same region, indicating a high percentage of mutation among the viral population. Moreover, both mutations resulted in amino acid changes in the fusion protein (F): G.fwdarw.R in position 266 and Y.fwdarw.S in position 365.

(21) In contrast, the genomic sequence of the virus recovered and passaged on CEF cells at 32 C. was identical to that of the original Schwarz virus. This observation indicates that changing the host cell of Schwarz virus leads to a rapid adaptation that may affect the properties of the vaccine.

(22) Growth Capacity of the Rescued Virus.

(23) The capacity of the Schwarz virus rescued from cDNA to grow on CEF and Vero cells was analyzed and compared to the industrial bulk Schwarz vaccine from which it was derived (obtained from Aventis Pasteur) and to the EdB-tag virus rescued from its cDNA. Monolayers of Verocells in 6-well plates were infected with viruses at different multiplicity of infection. A various time post infection (pi), the cells were seraped into culture medium. After freezing and thawing, infectivity titers were determined by measuring the TCID.sub.50 in Vero cells. Growth curves: Monolayers of Vero cells in 6-well plates were infected with viruses at different multiplicities of infection (MOI). At various times postinfection (pi), the cells were scraped into culture medium. After freezing and thawing, infectivity titers were determined by measuring the TCID.sub.50 in Vero cells.

(24) TCID.sub.50 Titration:

(25) Vero cells were seeded into 96-well plate (7500 cells/well) and infected by serial 1:10 dilutions of virus sample in DMEM/5% FCS. After incubation at 37 C. for 4-5 days for Ed-B virus and 7 days for Schwarz virus, cells were stained with crystal violet and the virus dilution that resulted in infection in 50% of test unit was determined. The 50% end point described as tissue culture infectious dose (TCID.sub.50) was calculated by the Krber method (Karber, G. 1931. Beitrag zur kollektiven Behandlung pharmakologischer Reihenversuche. Arch Exp Path Pharmak. 162:480-483). Tested on Vero cells, the growth kinetics of Schwarz and EdB-tag viruses rescued from their respective cDNA were similar (FIG. 3). The Schwarz viral production on Vero cells reached high yields (10.sup.7-10.sup.8 TCID.sub.50/ml after two days of infection using a multiplicity of infection of 0.01). Tested on CEF cells, the Schwarz virus was able to grow as well at 32 C. as at 37 C., while the EdB-tag was not (FIG. 3). This observation confirms that the virus from which EdB-tag was cloned was not adapted to CEF cells. The yield of Schwarz virus on CEF was lower than on Vero cells (10.sup.6 TCID.sub.50/ml after 4 days of infection using a multiplicity of infection of 0.05). Similar growth curves and similar titers were observed when CEF cells were infected with the original Schwarz virus from which it was cloned (FIG. 3). These observations demonstrate that the Schwarz virus rescued from its cDNA had the same growth characteristics than the original vaccine batch from which it was cloned.

(26) Introduction of an Additional Transcription Unit in the Schwarz cDNA.

(27) In the previous work reporting the cloning of EdB-tag virus (17), the authors developed an original method to adapt the viral cDNA as a vector suitable for the expression of foreign transgenes. They inserted an additional transcription unit (ATU) in different positions of the viral genome. This ATU is a copy of the MV N-P intergenic region containing the cis-acting sequences necessary for MV-dependant expression of a transgene inserted into a multiple cloning sites cassette. Largely tested by the authors and ourselves, the expression of foreign transgenes inserted in this ATU was very efficient, depending on the position of insertion in the genome. The different MV genes are expressed according to a transcriptional gradient down the genome, leading to a high expression of the N gene to a low expression of the L gene (Lamb, R., and D. Kolakofsky. 1996. Paramyxoviridae: the viruses and their replication, p. 1177-1199. In B. Fileds, D. Knipe, et al. (ed.), Fields Virology. Lippincott-Raven Publishers, Philadelphia).

(28) The insertion of the ATU takes advantage of this gradient, allowing high or low expression of the transgene, depending on the position of insertion. Moreover, in this context the foreign transgenes are expressed using the same controls and pathways as authentic MV genes.

(29) In order to transform the Schwarz cDNA as a vector, we constructed a similar ATU that was inserted in two different positions of the cDNA (FIG. 4). The cDNA was sequenced and no mutation was found.

(30) Immunogenicity of Schwarz MV Recovered from cDNA in Macaques.

(31) First Experiment: Comparison with Schwarz Vaccine.

(32) The immunogenicity of the virus rescued from pTM-MVSchw plasmid and passaged two times on CEF cells was compared to the immunogenicity of Schwarz vaccine in cynomolgus macaques. The conditions for passage were the following:

(33) After rescue, isolated syncytia were picked from the CEF cells cocultivated with 293-3-46 helper cells and a single syncytium was diluted in 600 l of OptiMEM 1 (Gibco) and vortexed. This inoculum was used to infect fresh CEF cells (80-90% confluent) in a 35 mm well or a T-25 flask. After 2 hours of adsorption at 37 C., the inoculum was replaced by DMEM/5% FCS and cells were incubated at 32 C. for 1-2 days. When small syncytia appeared, infected cells were expanded to T-75 flasks: cells were washed with PBS and detached with PBS/1 mM EDTA/0.25% trypsin for 1 minute, then transferred to T-75 flasks together with fresh CEF cells ( of a confluent T-75 flask culture). After 4-7 days of incubation at 32 C. in DMEM/5% FCS, the virus (passage 1) was harvested: culture medium was removed and infected cells were scraped in 3 ml of OptiMEM 1. After one cycle of freezing and thawing, cell debris were discarded by centrifugation (1500 rpm, 5 minutes, room temperature). This stock seed was kept frozen at 80 C. and used to infect fresh CEF in the same way to prepare the passage 2 stock.

(34) Different formulations of the vaccine were tested using both the unpassaged bulk preparation from Aventis Pasteur, and the same preparation passaged two times on CEF cells. Viruses were prepared as follows: CEF cells (obtained from chick embryos incubated during 9 days) were infected at a MOI of 0.05 and incubated at 32 C. during 7 days. Viruses were purified by scraping infected cells, freeze/thawing and low speed clarification of cells debris. Stabilizing agents used in the preparation of MV vaccine were obtained from Aventis Pasteur. Different bulk vaccine preparations with and without stabilizing agents were compared at the same dose to the lyophilized final product (Rouvax, Aventis Pasteur). All vaccine preparations were titrated using the TCID.sub.50 method on Vero cells. Monkeys were injected sub-cutaneaously and blood samples were taken at different time points. In order to compare both humoral and cellular responses, the presence of anti-MV antibodies was looked for in serums by ELISA (Trinity Biotech, USA) and the presence of anti-MV T-cells was looked for by ELISPOT in PBMCs.

(35) Second Experiment: Comparison with EdB-Tag Strain

(36) Colony-bred rhesus (Macaca mulatta) or cynomolgus (Macaca fascicularis) macaques that were seronegative for simian type D retrovirus, simian T-cell lymphotropic virus, simian immunodeficiency virus, and measles virus were housed in accordance with the American Association for Accreditation of Laboratory Animal Care. Monkeys were inoculated subcutaneously with different doses (10.sup.3-10.sup.5 TCID.sub.50) of EdB-tag or Schwarz MV diluted in OptiMEM (GibcoBRL) or with 10.sup.4 TCID.sub.50 of the lyophilized Rouvax MV vaccine (Aventis Pasteur, Marcy l'Etoile, France) diluted in the solution provided by the supplier. Blood samples were collected at different time after inoculation.

(37) The presence of anti-MV antibodies in serum was looked for by ELISA (Trinity Biotech, USA) one month after vaccination. Each determination was done in triplicate on 1/20 dilution of serum samples. A mixture of 5 samples from negative monkeys was used as the negative control. To determine the immune status ratio (ISR) of each sample, the absorbance of the negative control was subtracted from the absorbance of the positive sample and the result was divided by the absorbance of a calibrator supplied in the ELISA kit, as recommended by the supplier. Only ISR values higher than 0.9 were considered as positive in this test.

(38) Cellular immune responses were determined by -IFN ELISpot assays. Frozen PBMC were thawed and incubated overnight in RPMI, 10% FCS and 4 U/ml rh-IL2 (Boehringer Mannheim). Multiscreen-HA 96-wells plates were coated overnight at 4 C. with 4 g/ml of capture anti--IFN (GZ-4, MAbTech) in PBS, washed, then incubated with 100 l RPMI, 10% FCS for 1 h at 37 C. The medium was replaced by 5.Math.10.sup.5 PBMC in suspension in 100 l of RPMI-10% FCS and 100 l of stimulating agent. The stimulating agent consisted of 10.sup.7 pfu of recombinant Modified Vaccine Ankara (32) MVA-H.sub.MV or MVA-wt as a control Cells were stimulated for 24 h at 37 C. Phytohemaglutinin A (2.5 g/ml, Sigma) was used as positive control and RPMI as a negative control. The plates were washed twice with PBS, 4 times with PBS, 0.05% Tween 20 (Sigma), and twice again with PBS. A biotinylated anti--IFN antibody (7-66-1, MabTech, 100 l, 1 g/ml in PBS) was added and the plates were incubated for 2-4 h at 37 C. Streptravidin-Alkaline Phosphatase (AP) conjugate (Roche, 100 l, 1/2000 dilution in PBS) was added And spots were developed with BCIP/NBT (Promega) in 1 M Tris pH 9.5, 1.5 M NaCl, 0.05 M MgCl2. After drying overnight at room temperature, spots were counted using an automated image analysis system (ELISpot Reader, Bio-Sys). The low background obtained after MVA-wt stimulation was subtracted and the results were expressed as MVA-H.sub.MV specific -IFN producing cells per million PBMC.

(39) Mice immunization and characterization of humoral immune responses. FVB mice heterozygous for the CD46 transgene (33), were crossed with 129sv IFN-/R.sup./ mice which lack the type I interferon receptor (30). The F1 progeny was screened by PCR and the CD46.sup.+/ animals were crossed again with 129sv IFN-/R.sup./ mice. IFN-/R.sup./ CD46.sup.+/ animals were selected and used for immunization experiments. These mice are susceptible to MV infection (27, 29). Six-week-old female CD46.sup.+/ or CD46.sup.+/ IFN-/R.sup./ (IFNAR) mice were inoculated intraperitoneally with 10.sup.4 TCID.sub.50 of the different vaccine preparations (4 mice per group). The presence of anti-MV antibodies was looked for by ELISA (Trinity Biotech, USA) in sera collected one month after vaccination. In this case, an anti mouse IgG Mab (Amersham) was used as secondary antibody. Each determination was done in triplicate. The absorbence determined with a mixture of negative mice sera was subtracted from the absorbence measured in positive mice. Because it was not possible in this case to use the ISR to compare samples, serial dilutions of mice sera were tested to determine the endpoint limit positive dilution.

(40) Results

(41) Comparison of Humoral Immune Responses after Vaccination of Macaques and Mice with EdB-Tag and Schwarz MV Vaccines.

(42) EdB-tag MV is a molecularly cloned MV derived from the Edmonston B strain (16). We compared its immunogenicity in macaques with that of the Schwarz commercial MV vaccine. The EdB-tag virus was prepared in Vero cells infected at a multiplicity of infection (MOI) of 0.05. When syncytia occupied 80-90% of the culture, the cells were scraped, cells and medium were freeze/thawed and cell debris were eliminated by low speed centrifugation. The Schwarz MV, obtained from Aventis Pasteur (Marcy l'Etoile, France), was prepared in the same way from infected chick embryo fibroblasts (CEF) grown at 32 C., the temperature at which this strain has been adapted to CEF. The titers of both vaccine preparations were determined by endpoint dilution assays in Vero cells and expressed as TCID.sub.50. Different doses (10.sup.3 to 10.sup.5 TCID.sub.50) of EdB-tag and Schwarz MV were injected subcutaneously to macaques (2 monkeys per dose). As a control, animals were also injected with 10.sup.4 TCID.sub.50 of the lyophilized commercial Schwarz vaccine (Rouvax, Aventis Pasteur). Anti-MV antibodies levels were determined by ELISA in macaques' sera collected one month after vaccination. Macaques inoculated with 10.sup.3 and 10.sup.4 TCID.sub.50 of the Schwarz MV had antibody levels similar to those induced by a standard dose of Rouvax vaccine (FIG. 6). Macaques inoculated with 10.sup.4 TCID.sub.50 of EdB-tag virus remained negative (not shown). The injection of a tenfold higher dose (10.sup.5 TCID.sub.50) induced only a weak response that was lower than that observed with 10.sup.3 TCID.sub.50 of Schwarz MV (FIG. 6). Vaccination with the commercial vaccine induced the best response probably due to the adjuvant effect of lyophilization.

(43) The different vaccine preparations were also tested in genetically modified mice obtained as described in Materials and Methods. Two types of mice were used: mice expressing CD46 (33), the human receptor for MV vaccine strains (34), and mice expressing CD46 and lacking the IFN type I receptor (29). Six-week-old mice were inoculated intraperitoneally with 10.sup.4 TCID.sub.50 of the different vaccine preparations (4 mice per group). FIG. 7 shows the detection of anti-MV antibodies in sera of both types of mice collected one month after vaccination. In CD46 mice, the EdB-tag virus was less immunogenic than the Schwarz vaccine. The average titer obtained with the former was 1/80, whereas it was 1/1280 with the latter. The EdB-tag virus was also less immunogenic in CD46 mice lacking the IFN type I receptor but the difference was less pronounced than in CD46 immuno-competent mice, possibly indicating a difference in sensitivity to IFN / between the two viral strains.

(44) Immunogenicity of Schwarz MV Recovered from cDNA.

(45) The immunogenicity for cynomolgus macaques of the virus rescued from pTM-MVSchw plasmid and passaged two times on CEF or Vero cells was compared to that of the industrial Schwarz vaccine. Cynomolgus macaques were used in this experiment because of the difficulty of obtaining rhesus macaques from China that were MV negative. These macaques are as sensitive to MV as rhesus macaques, as shown by several studies (28, 26). Monkeys (2 animals per preparation) were injected sub-cutaneaously with 10.sup.4 TCID.sub.50 of Schwarz MV vaccine from Aventis or Schwarz MV rescued from pTM-MVSchw plasmid and grown either on CEF or Vero cells. The presence of anti-MV antibodies was determined in sera collected at different time points (FIG. 8). All the vaccinated macaques became positive. No statistically significant difference was observed, one or two months after immunization, between the different vaccine preparations tested. This result demonstrates that the virus rescued from the pTM-MVSchw plasmid has the same immunogenicity in non human primates as the parental Schwarz vaccine. No difference was detected between the rescued viruses grown on CEF or Vero cells, indicating that the two mutations generated in the F protein by the passages on Vero cells did not affect the immunogenicity of the virus.

(46) Changes in the number of total white blood cells (WBC), lymphocytes and monocytes were observed during the first month following inoculation (FIG. 9). There was a mild leukopenia during the first week, as previously observed after MV vaccination (1). During the second week a clear increase in the number of circulating lymphocytes and monocytes was observed. It coincided with a peak of the number of MV-specific T-lymphocytes as detected by a -IFN ELISpot assay (FIG. 9 D). No statistically significant difference was detected between the specific cellular immune responses induced by the Schwarz MV rescued from plasmid and the Schwarz vaccine prepared by Aventis.

DISCUSSION

(47) In the present work we describe cloning and rescuing the Schwarz/Moraten attenuated strain of measles virus, the constituent of two widely used measles vaccines, Attenuavax (Merck and Co. Inc., West Point, USA) and Rouvax (Aventis Pasteur, Marcy l'Etoile, France), and of the combined measles, mumps, and rubella vaccine (MMR) (35). To be used in a pediatric clinical trial, a live attenuated MV produced from a cDNA must be as safe and efficient as the parental vaccine. Assuming that safety and efficiency depend ultimately on the genomic sequence of the attenuated strain, we cloned the MV Schwarz cDNA from viral particles prepared from an industrial batch of vaccine using procedures optimized for fidelity of cloning. As a result, the sequence of the clone that we obtained was identical to that of the parental Schwarz MV genome. To maximize yield during rescue, the viral antigenomic cDNA was placed under the control of a T7 RNA polymerase promoter with the GGG motif necessary for full efficiency. A hammerhead ribozyme was inserted between this GGG motif and the first viral nucleotide to allow the exact cleavage of the viral RNA. In order to avoid adapting the Schwarz vaccine to non-certified cells during rescue, helper cells transfected with the engineered cDNA were cocultivated with CEF, the cells on which this vaccine was selected originally and is currently prepared. The rescued virus was passaged two times on CEF and its genome was entirely sequenced. No mutation was found when the sequence was compared to that of the original virus. Moreover, the growth kinetics and the yield of the rescued virus and the original Schwarz virus on CEF were identical.

(48) The Schwarz virus was also rescued after co-cultivation of transfected helper cells with Vero cells, which are very permissive to MV. In this case, however, two mutations appeared in the viral fusion protein (F) after two passages on Vero cells. This rapid adaptation correlated with a much more fusogenic phenotype on Vero cells. In contrast, the rescued Schwarz MV was not fusogenic on CEF (only rare syncytia could be observed in infected CEF). The two mutations occurred in the F protein (G.fwdarw.R in position 266 and Y.fwdarw.S in position 365). These mutations are present in the EdB-tag virus (see FIG. 6) which is grown on Vero cells. They are also present in the Hall strain, which is highly related to Edmonston strain and does not infect CEF (31). These two mutations appear thus to correlate with enhanced fusion in Vero cells. The rapid adaptation of the F protein after only two passages of the Schwarz virus on Vero cells shows that in order to keep its genetic integrity the vaccine must be grown on CEF.

(49) The virus rescued from the pTM-Schw plasmid had the same immunogenicity in macaques as the parental Schwarz vaccine. It is important to emphasize that in these experiments macaques were inoculated with the low dose of virus used for human immunization. Therefore, it will be possible to conduct human clinical trials with this virus using standard vaccine doses (10.sup.4 TCID.sub.50). In contrast, the previously cloned EdB-tag MV was not immunogenic in macaques and poorly immunogenic in mice transgenic for CD46, when used at the same dose as the cloned Schwarz MV.

(50) What could be the reason for the higher immunogenicity of the Schwarz MV strain? Inducing good immunogenicity with a live attenuated viral vaccine requires replication in tissues at a level high enough to prime the immune system adequately. Several of the mutations between the Schwarz and the EdB-tag MV genomes are located in the P/V/C and L genes, suggesting difference in replication efficiency. It is possible that the Schwarz MV replicates in lymphoid cells in vivo more efficiently than the EdB-tag MV even though they replicated at the same rate in Vero cells. Efficient replication in vivo requires some evasion mechanism from the IFN-/ response. Vero cells, on which the EdB-tag virus was adapted, do not respond to IFN-/ stimulation. Therefore the EdB-tag MV was selected in the absence of an IFN-/ response and might be particularly sensitive to this host defense mechanism. Indeed, it has been shown that passaging wild type MV on Vero cells changes the phenotype of the virus from non-IFN-inducer to IFN-inducer (36). Also, the fact that the Ed-tag MV was immunogenic in mice transgenic for the CD46 receptor providing they were also knock-out for the IFN-/ receptor suggest that this virus is particularly IFN-sensitive. Interestingly, the IFN-/ response helps priming the specific immune response against the vaccine. Therefore a good live vaccine must at the same time induce an IFN-/ response and evade it to some extent. For this reason selecting attenuated viral vaccines on primary cells with a strong IFN-/ response, such as CEF, might be a good strategy.

(51) The MV products which contribute to IFN resistance have not been identified. However, the nonstructural C protein of the closely related Sendai virus has been shown to counteract the IFN-induced antiviral state (37). The 5 mutations not related to any Edmonston subgroup that we found in the EdB-tag P/V/C gene might be responsible for its low immunogenicity in macaques. On the other hand, the two mutations generated in the F protein by passaging the Schwarz virus on Vero cells did not affect its immune potential, indicating that the fusogenic property of the viral envelope proteins may not play a significant role in immunogenicity.

(52) The pTM-MVSchw plasmid was engineered for the expression of foreign genes by the introduction of two ATU at different positions of the genome. Rescued Schwarz recombinant MV expressed the green fluorescent protein, thus showing that this new measles vaccine functions as a vector. In conclusion, this molecular clone will allow producing MV vaccine without having to rely on seed stocks. With its ATUs, it will be possible to use it as a vector to produce recombinant vaccines based on an approved, efficient and worldwide used vaccine strain.

BIBLIOGRAPHY

(53) 1. Andino, R., D. Silvera, S. D. Suggett, P. L. Achacoso, C. J. Miller, D. Baltimore, and M. B. Feinberg. 1994. Engineering poliovirus as a vaccine vector for the expression of diverse antigens. Science. 265:1448-1451. 2. Ballart, I., D. Eschle, R. Cattaneo, A. Schmid, M. Metzler, J. Chan, S. Pifko-Hirst, S. A. Udem, and M. A. Billeter. 1990. Infectious measles virus from cloned cDNA. Embo J. 9:379-384. 3. Crotty, S., C. J. Miller, B. L. Lohman, M. R. Neagu, L. Compton, D. Lu, F. X. Lu, L. Fritts, J. D. Lifson, and R. Andino. 2001. Protection against simian immunodeficiency virus vaginal challenge by using Sabin poliovirus vectors. J Virol. 75:7435-7452. 4. Enders, J. F., and T. C. Peebles. 1954. Propagation in tissue cultures od cytopathogenic agents from patients with measles. Proc. Soc. Exp. Biol. Med. 86:277-286. 5. Felsenstein, J. 1989. Cladistics. 5:164-166. 6. Griffin, D., and W. Bellini. 1996. Measles virus, p. 1267-1312. In B. Fields, D. Knipe, et al. (ed.), Virology, vol. 2. LippincottRaven Publishers, Philadelphia. 7. Hilleman, M. 2002. Current overview of the pathogenesis and prophylaxis of measles with focus on practical implications. Vaccine. 20:651-665. 8. Kobune, F., H. Sakata, and A. Sugiura. 1990. Marmoset lymphoblastoid cells as a sensitive host for isolation of measles virus. J Virol. 64:700-705. 9. Lamb, R., and D. Kolakofsky. 1996. Paramyxoviridae: the viruses and their replication, p. 1177-1199. In B. Fileds, D. Knipe, et al. (ed.), Fields Virology. Lippincott-Raven Publishers, Philadelphia. 10. Page, R. D. 1996. TreeView: an application to display phylogenetic trees on personal computers. Comput Appl Biosci. 12:357-358. 11. Palese, P. 1998. RNA virus vectors: where are we and where do we need to go? Proc Natl Acad Sci USA. 95:12750-12752. 12. Parks, C. L., R. A. Lerch, P. Walpita, M. S. Sidhu, and S. A. Udem. 1999. Enhanced measles virus cDNA rescue and gene expression after heat shock. J Virol. 73:3560-3566. 13. Parks, C. L., R. A. Lerch, P. Walpita, H. P. Wang, M. S. Sidhu, and S. A. Udem. 2001. Analysis of the noncoding regions of measles virus strains in the Edmonston vaccine lineage. J Virol. 75:921-933. 14. Parks, C. L., R. A. Lerch, P. Walpita, H. P. Wang, M. S. Sidhu, and S. A. Udem. 2001. Comparison of predicted amino acid sequences of measles virus strains in the Edmonston vaccine lineage. J Virol. 75:910-920. 15. Racaniello, V. R., and D. Baltimore. 1981. Cloned poliovirus complementary DNA is infectious in mammalian cells. Science. 214:916-919. 16. Radecke, F., and M. Billeter. 1997. Reverse genetics meets the nonsegmented negative-strand RNA viruses. Reviews in Medical Virology. 7:49-63. 17. Radecke, F., P. Spielhofer, H. Schneider, K. Kaelin, M. Huber, K. Dtsch, G. Christiansen, and M. Billeter. 1995. Rescue of measles viruses from cloned DNA. EMBO Journal. 14:5773-5784. 18. Singh, M., and M. Billeter. 1999. A recombinant measles virus expressing biologically active human interleukin-12. J. Gen. Virol. 80:101-106. 19. Singh, M., R. Cattaneo, and M. Billeter. 1999. A recombinant measles virus expressing hepatitis B virus surface antigen induces humoral immune responses in genetically modified mice. J. Virol. 73:4823-4828. 20. Spielhofer, P., T. Bachi, T. Fehr, G. Christiansen, R. Cattaneo, K. Kaelin, M. Billeter, and H. Naim. 1998. Chimeric measles viruses with a foreign envelope. J. Virol. 72:2150-2159. 21. Takeda, M., A. Kato, F. Kobune, H. Sakata, Y. Li, T. Shioda, Y. Sakai, M. Asakawa, and Y. Nagai. 1998. Measles virus attenuation associated with transcriptional impediment and a few amino acid changes in the polymerase and accessory proteins. J Virol. 72:8690-8696. 22. Takeuchi, K., N. Miyajima, F. Kobune, and M. Tashiro. 2000. Comparative nucleotide sequence analyses of the entire genomes of B95a cell-isolated and vero cell-isolated measles viruses from the same patient. Virus Genes. 20:253-257. 23. Tangy, F., A. McAllister, and M. Brahic. 1989. Molecular cloning of the complete genome of Theiler's virus, strain GDVII, and production of infectious transcripts. J. Virol. 63:1101-1106. 24. Thompson, J. D., D. G. Higgins, and T. J. Gibson. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22:4673-4680. 25. Wang, Z., T. Hangartner, L. Cornu, A. Martin, M. Zuniga, M. Billeter, and H. Naim. 2001. Recombinant measles viruses expressing heterologus antigens of mumps and simian immunodeficiency viruses. Vaccine. 19:2329-2336. 26. Van Binnendijk, R. S., R. W. J. van der Heijden, G. van Amerongen, F. UytdeHaag, and A. D. M. E. Osterhaus. 1994. Viral replication and development of specific immunity in macaques after infection with different measles virus strains. The Journal of infectious Diseases. 170:443-448. 27. Mrkic, B., B. Odermatt, M. Klein, M. Billeter, J. Pavlovic, and R. Cattaneo. 1999. Lymphatic dissemination and comparative pathology of recombinant measles viruses in genetically modified mice. Journal of Virology. 74:1364-1372. 28. Kobune, F., H. Takahashi, K. Terao, T. Ohkawa, Y. Ami, Y. Suzaki, N. Nagata, H. Sakata, K. Yamanouchi, and C. Kai. 1996. Nonhuman primate models if measles. Laboratory Animal Science. 46:315-320. 29. Mrkic, B., J. Pavlovic, T. Rulicke, P. Volpe, C. J. Buchholz, D. Hourcade, J. P. Atkinson, A. Aguzzi, and R. Cattaneo. 1998. Measles virus spread and pathogenesis in genetically modified mice. J Virol. 72:7420-7427. 30. Mller, U., U. Steinhoff, L. F. L. Reis, S. Hemmi, J. Pavlovic, R. M. Zinkernagel, and M. Aguet. 1994. Functional role of type I and type II interferons in antiviral defense. Science. 264:1918-1921. 31. Escoffier, C., and D. Gerlier. 1999. Infection of chicken embryonic fibroblasts by measles virus: adaptation at the virus entry level. J Virol. 73:5220-5224. 32. Koert J. Stittelaar, Linda S. Wyatt, Rik L. de Swart, Helma W. Vos, Jan Groen, Geert van Amerongen, Robert S. van Binnendijk, Shmuel Rozenblatt, Bernard Moss, and Albert D. M. E. Osterhaus. May 2000. Protective immunity in macaques vaccinated with a modified vaccinia virus ankara-based measles virus vaccine in the presence of passively acquired antibodies. Journal of Virology. Vol. 74, No. 9: 4236-4243. 33. Yannoutsos, N., J. N. Ijzermans, C. Harkes, F. Bonthuis, C. Y. Zhou, D. White, R. L. Marquet, and F. Grosveld. 1996. A membrane cofactor protein transgenic mouse model for the study of discordant xenograft rejection [published erratum appears in Genes Cells 1996 August; 1(8): 785]. Genes Cells. 1: 409-419. 34. Naniche, D., G. Varior-Krishnan, F. Cervoni, T. F. Wild, B. Rossi, C. Rabourdin-Combe, and D. Gerlier. 1993. Human membrane cofactor protein (CD46) acts as a cellular receptor for measles virus. J. Virol. 67: 6025-6032. 35. Buynak, E., R. Weibel, W. J. J E, J. Stokes Jr, and M. Hilleman. 1969. Combined live measles, mumps, and rubella virus vaccines. J. Am. Med. Assoc. 207: 2259-2262. 36. Naniche, D., A. Yeh, D. Eto, M. Manchester, R. M. Friedman, and M. B. A. Oldstone. 2000. Evasion of host defenses by measles virus: wild-type measles virus infection interferes with induction of alpha/beta interferon. 37. Garcin, D., P. Latorre, and D. Kolakofsky. 1999. Sendai virus C proteins counteract the interferon-mediated induction of an antiviral state. J. Virol. 73: 6559-6565.