Diagnostic test for virus
09702016 ยท 2017-07-11
Assignee
Inventors
Cpc classification
International classification
C12N7/00
CHEMISTRY; METALLURGY
Abstract
Unique Avian Nephritis Virus (ANV) nucleic acid sequences have been determined. Primers and probes have been developed using the isolated nucleic acid sequences and a reverse transcription PCR has been developed to detect the presence of ANV in commercial flocks. Furthermore, use of the nucleic acid sequences and amino acids sequences encoded therefrom and antibodies to said amino acids is discussed.
Claims
1. A method for detecting avian nephritis viruses (ANVs) in a sample comprising the steps: a. isolating total RNA from the sample, b. synthesising a first strand of DNA from said isolated RNA using a forward primer consisting of SEQ ID NO: 11, where Y is C or T, c. amplifying said first strand of DNA using a reverse primer comprising SEQ ID NO: 35 to form an amplified product and d. detecting the amplified product.
2. The method of claim 1 wherein the method further includes the use of a detectable probe comprising SEQ ID NO: 13 for use as an internal probe in a real-time RT-PCR test.
Description
(1)
(2) Discussion
(3) The present inventors have determined that ANV is vertically transmitted by using the described real-time RT-PCR test, and detecting ANV RNA in dead embryos which provides strong evidence that the virus was transmitted from an infected parent bird to the embryo within the egg.
(4) There is also indirect evidence based on serological studies (Connor et al. 1987. Avian Pathology 16: 15-20)
(5) This inventors' determinations have implications for the manufacture of poultry vaccines that are produced in chicken embryos, as SPF flocks used to produce embryonated eggs or chicks for vaccine production are required to be free from ANV infection. To demonstrate that ANV infection is not present in an avian, an antibody-detecting test to screen SPF flocks for ANV infection is required. Presently, the G4260 ANV-1 isolate provides a basis for serological screening of most flocks. However, in practice, this only exhibits low levels of antigenic cross-reactivity with other ANVs belonging to different serotypes. The present inventors have determined the capsid protein sequence diversity of around 20 ANVs and based on the diversity of capsid protein sequences observed, the inventors have determined three novel representative sequences. These additional novel sequences can be utilised with the two known amino acid sequences for the capsid protein of ANV-1 and the second serotype ANV-2, which are present in databases. Moreover, the inventors have determined key variable regions between ANV capsid protein sequences. Knowledge of these sequences allows the preparation of antibodies which show cross-reactivity and the ability to differentiate between different avian nephritis viruses.
(6) TABLE-US-00012 TABLE 2 Pairwise amino acid and nucleotide identities (%) shared by the capsid protein genes of 5 representative ANVs VF07- ANV-1 ANV-2 VF04-1/2 13/7 VF08-3a ANV-1 71 68 58 64 ANV-2 69 73 56 61 VF04-1/2 67 74 66 71 VF07-13/7 62 62 68 78 VF08-3a 64 65 72 80 Amino acid comparisons in top right; nucleotide comparisons in bottom left
Determination of Representative Sequences
(7) On examination of around 20 capsid protein genes it was recognised by the inventors that there were conserved or semi-conserved regions and highly variable regions of amino acid sequence. Using the amino acid numbering of the G4260 isolate of ANV-1, the 9 major variable regions, designated A to I, were identified at amino acid residues: 15-37 (A), 113-127 (B), 221-239 (C), 338-352 (D), 399-418 (E), 438-454 (F), 474-483 (G), 523-544 (H) and 628-639 (I). This is illustrated in
(8) Because ANVs show antigenic variation, for example, ANV-1 and ANV-2 are serotypically different, at least some of these variable regions will correspond to regions of antigenic variation. ANVs were considered by the inventors to have different variable regions if, over the sequence considered, less than 75% of the amino acid residues were the same. The serotypically different ANV-1 and ANV-2 isolates were identified to be different in at least 9 major variable regions.
(9) When the amino acid sequences for a capsid protein from 5 different representative ANVs, including the capsid protein amino acid sequences of ANV-1, ANV-2, were compared in terms of their variable regions, they were found to show substantial differences in these variable regions (Table 3). However, when some representative ANVs were compared to each other the sequences of some variable regions were very similar (75% or >75% amino acid identity). For example, representative ANVs 2 and 3 were similar in variable regions F, G, H and I, whereas representative ANVs 4 and 5 were similar in variable regions A, B, C and D.
(10) TABLE-US-00013 TABLE 3 Variation in the variable regions displayed by 5 representative ANVs Repr. ANV.sup.a A B C D E F G H I ANV-1 1 1 1 1 1 1 1 1 1 1 ANV-2 2 2 2 2 2 2 2/3.sup.b 2/3 2/3 2/3 VF04-1/2 3 3/4/5 3 3 3 3 2/3.sup. 2/3 2/3 2/3 VF07-13/7 4 3/4/5 4/5 4/5 4/5 4 4 4 4 4 VF08-3a 5 3/4/5 4/5 4/5 4/5 5 5 5 5 5 .sup.a5 representative (Repr.) isolates were identified including ANV-1 and ANV-2 .sup.bvariable region of representative (Repr.) ANV 2 is shared with representative ANV 3 etc.
(11) When the capsid sequences of 14 additional ANVs were compared with the 5 representative ANVs in terms of their variable regions, in most cases their variable regions were shown to resemble those of particular representative ANVs (Table 4). In some cases, the sequences of the variable regions were less than 75% identical to those of the 5 representative ANVs. Of the 14 ANVs investigated, 9 were found to differ from the 5 representative ANVs in relation to their variable regions, when the 75% cut-off value for similarity was applied. For example 9 different sequences were observed for variable region E, and 7 different sequences were observed for variable region I.
(12) Additional examination showed that different combinations of the variable regions displayed by different representative ANVs were observed in particular examples of the 20 ANVs investigated (Table 4). For example, the variable regions F, G and H of ELV276Cl3, VF05-1/5 and VF08-3b were similar to those of the representative isolate 1 (ANV-1), whereas the variable regions B, C and D of these ANVs were different. This suggests recombination can occur between different ANVs, bringing together different parts of the capsid protein gene. In this connection the variable regions A, B, C and D and sometimes E of the around 20 individual ANV examples were mainly the same as that of a particular representative ANV, for example all like 1, all like 2, and these could be found combined with F, G and H variable regions that were typical of a different representative ANV (Table 4).
(13) Knowledge of the sequences of individual variable regions (i.e. that are different from those of the 5 representative ANVs) might be useful in the generation of antibodies for diagnosis as such antibodies may be able to differentiate isolates. Further, knowledge of the sequence of the variable region may allow the modification of an infectious clone or a capsid protein construct to include the different variable region.
(14) Of the around 20 novel ANVs determined, 3 of these are considered to be representative. Of the remainder, 9 were considered to be distinguishable following comparison of the variable regions i.e. less than 75% identical over the variable region peptide sequences (Table 4).
(15) TABLE-US-00014 TABLE 4 Variation in the variable regions displayed by capsid protein sequences of the 5 representative ANVs and 9 additional ANVs displaying variation within variable regions. A B C D E F G H I ANV1 1 1 1 1 1 1 1 1 1 ANV2 2 2 2 2 2 2/3 2/3 2/3 2/3 VF04-1/2 3/4/5 3 3 3 3 2/3 2/3 2/3 2/3 VF07-13/7 3/4/5 4/5 4/5 4/5 4 4 4 4 4 VF08-3a 3/4/5 4/5 4/5 4/5 5 5 5 5 5 ELV276Cl5 2 2 ELV276cl5 2 2 2/3 2/3 2/3 2/3 ELV276Cl3 2 2 ELV276cl5 2 2 1 1 1 ELV276cl3 Belgian Belgian 2 ELV276cl5 2 2 1 1 1 ELV276cl3 ELV1 ELV1 VF05-1/5 3/4/5 3 3 3 VF05- 1 1 1 VF05-1/5 1/5 VF08-3b 3/4/5 4/5 4/5 4/5 VF08- 1 1 1 1 3b VF08-18/14 3/4/5 4/5 4/5 4/5 5 5 5 5 5 VF08-18/5 3/4/5 4/5 4/5 3 3 VF08- 4 4 4 18/5 VF08-29a VF08- 1 1 1 VF08- 1 1 1 VF08-29a 29a 29a VF08-29b VF08- 1 1 1 VF08- 2/3 2/3 2/3 2/3 29a 29b Total 5 4 5 4 9 5 4 4 7 ANV-1, ANV-2, VF04-1/2, VF07-13/7 and VF08-3a were considered to be representative ANVs 1 to 5 respectively.
(16) Based on the nucleic acid sequences of the novel ANV sequences and also ANV-1 and ANV-2, primers were determined which provide for an amplification of a fragment of 182 bp located in the 3UTR of the ANV genome (Table 5).
(17) TABLE-US-00015 TABLE5 PrimersusedforRT-PCRtestfordetectingANV Nucleotide Positionin ANV-1(G4260) PrimerName Sequence5 -> 3 genome ANVForward ACGGCGAGTACCATCGAG 6715-6732 ANVReverse AATGAAAAGCCCACTTTCGG 6877-6896
Example of Conventional RT-PCR Test to Determine ANV within a Sample
(18) A single tube RT-PCR format was used, involving reverse transcription at 45 C. for 30 min, followed by an initial denaturation step at 94 C. for 2 min, followed by 40 PCR cycles with each cycle comprising denaturation at 94 C. for 30 sec, annealing at 50 C. for 30 sec, and extension at 68 C. for 30 sec. Reactions were carried out in 25 l volumes comprising 12.5 l reaction mix (2) Superscript III one-step RT-PCR kit, 1.0 ul Forward primer, 1.0 ul Reverse primer, 7.0 ul DEPC water, 1.0 ul Enzyme and 2.5 l RNA template. PCR products were analysed by agarose gel electrophoresis and visualised following ethidium bromide staining using UV transillumination.
(19) Using serial 10-fold dilutions of in vitro transcribed RNA, that had been produced from a recombinant plasmid containing ANV cDNA, the limit of detection (LOD) of the conventional RT-PCR test was estimated to be 18 molecules. No RT-PCR amplicons were produced with RNAs that had been extracted from samples of DHV-2, DHV-3, and the 11672 and 612 isolates of CAstV, which were previously shown to be positive using the pan-avian astrovirus degenerate primer based RT-PCR test (Todd et al., 2009), thereby indicating that the RT-PCR test was specific for ANV and not for other avian astroviruses.
(20) Application of Conventional RT-PCR Tests to Field Samples.
(21) Gut content or faeces samples that had been collected from broiler chicken flocks experiencing enteritis and growth retardation problems were tested by the RT-PCR test. Fifty-five samples were received from October 2004 to May 2008 as part of 10 submissions obtained from 6 different UK poultry organisations. Additional samples were obtained from affected broiler flocks in Germany (n=15) and the USA (n=12). Of 82 samples tested 82 (100%) were positive by RT-PCR, the majority producing single DNA bands, sized 182 bp, after agarose gel electrophoresis, ethidium bromide staining and UV transillumination. In addition, positive RT-PCR results were obtained with 5 pooled swab samples that were collected from broiler chickens affected by wet litter problems and 5 pooled samples collected from chicken flocks that were unaffected by wet litter problems. Additional amplicon bands were observed with some samples especially those prepared from swabs that had been extracted with the RNeasy extraction kit.
(22) Application of RT-PCR Tests to Longitudinal Surveys Samples.
(23) Four flocks, which, based on recent performances, were predicted to exhibit average and below average performances were sampled longitudinally. The flocks belonged to the same UK poultry organisation, but were located on different sites. Gut contents from 12 birds were sampled from each flock at days 0, 4 or 5, 7, 10, 14, 21 and 28. The samples were grouped into 4 pools and processed by homogenisation as described above. In total 84 gut content samples were collected from each surveyed flock, from which 28 pooled samples were processed for RNA extraction. The performance of each flock was estimated after slaughter by calculating European production efficiency factor (EPEF) values, which represent standard measures of overall flock performance as determined by the equation:
(24)
(25) Of 96 pooled gut content samples, collected in longitudinal surveys of 4 broiler flocks from day 0 to day 28, 80 (83%) tested positive by the RT-PCR test. The 16 negative samples were those collected at day 0, when the chicks were introduced to the broiler house, but all pooled samples collected the later timepoints tested positive. Below average EPEF values of 327, 315 and 308 were estimated for the 3 male broiler flocks and an EPEF value of 238 was estimated for the female broiler flock that was surveyed.
(26) Comparison of Conventional RT-PCR Tests.
(27) The RNAs extracted from 12 representative field samples, which tested positive by our newly-developed RT-PCR test, were tested by 2 previously described RT-PCR tests. Using the test reported by Day et al. (2007), 10 samples were positive, while 9 of the 12 samples were positive by the RT-PCR test described by (Mandoki et al. (2006b)). Thus, the primers disclosed herein advantageously provide a more sensitive assay.
(28) Real-Time RT-PCR
(29) TABLE-US-00016 TABLE6 PrimersusedintheTaqManreal-timeRT-PCRtest Nucleotide Positionin Primer/ ANV-1(G4260) Probe Sequence5 -> 3 genome QpanANV 5-FAM-CAGCAAATGACTTTC- 6692-6706 Probe MGB QpanANV GTAAACCACTGGYTGGCTGACT 6669-6690 Forward QpanANV TACTCGCCGTGGCCTCG 6708-6724 Reverse
(30) The real-time test used TaqMan technology, involving the use of forward and reverse primers and the internal TaqMan hydrolysis probe. The target sequence is a highly conserved region within the 3 UTR of the ANV genome, identified following comparison of approximately 20 ANVs including the published ANV-1 and ANV-2 sequences. Despite the high levels of conservation, the Forward primer was degenerate in one position. The RT-PCR product comprised 56 nucleotides. Following reverse transcription at 45 C. for 10 min and an initial denaturation stage at 95 C. for 10 min, amplifications were performed over 40 cycles of denaturation at 95 C. for 15 sec, and annealing/elongation at 60 C. for 45 sec (Primer: Probe ratio: 400 nM:400 nM:120 nM). Reactions were carried out in 25 l volumes.
(31) Sensitivity, Efficiency and Specificity of Real-Time Assay.
(32) The detection limit and efficiency of the ANV real-time RT-PCR assay were determined using C.sub.T values obtained from a ten-fold dilution series of run-off RNAs, which had been in vitro transcribed from a cloned PCR product of 394 bp. An LOD of approximately 180 copies was estimated for the assay, based on the last reproducibly detectable dilution, which had a C.sub.T value of 35. Standard curves of the C.sub.T values versus the RNA dilutions were constructed and used to estimate the number of viral copies in unknown samples. For convenience, the viral copy numbers were transformed into logarithm values, hereafter termed log values. The PCR amplification efficiencies of the assay was estimated as 99.0% from the slope generated from the same dilution series using the equation, Efficiency=10.sup.(1/slope)1. The R.sup.2 value was 0.999. RNA extracted from a cell culture pool of ANV-1 was used at a 10.sup.5 dilution as a positive control in all further RT-PCR assays. The ANV RT-PCR assay was negative when applied to the 5 isolates of chicken astrovirus and the duck hepatitis virus types 2 and 3. Using an internal positive control assay, no PCR inhibition was observed with any of 20 randomly selected gut content samples, indicating RNAs that were extracted from gut content samples using the QIAamp Viral RNA Mini Kit, were unlikely to be display PCR inhibition.
(33) Detection of ANV RNA in Diagnostic Samples from Broiler Flocks
(34) The assay was assessed using RNAs extracted from a panel of 36 field samples that originated in the UK and USA (Table 7).
(35) TABLE-US-00017 TABLE 7 Summary of ANV real-time RT-PCR results obtained with field samples Age ANV Sample days Log Value VF04-01/2 .sup.U.sup.a 5.79 VF04-01/6 U 6.26 VF0401/11 U 5.69 VF05-01/3 6 8.23 VF0501/14 10 5.88 VF06-01/2 13 7.60 VF06-01/3 11 7.53 VF06-02/1 25 6.16 VF06-02/3 39 3.22 VF06-02/9 42 Neg VF06-07/1 10 7.50 VF07-04/1 U 5.39 VF07-04/2 U NT VF07-13/1 14 7.64 VF07-13/1.sup.k 14 4.39 VF07-13/7 14 7.63 VF07-13/7.sup.k 14 5.67 VF07-13/9 17 7.02 VF07-13/9.sup.k 17 4.17 VF08-05/8.sup.s U 6.57 VF08-05/9.sup.s U 5.13 VF08-05/21.sup.s U 4.38 VF08-05-24.sup.s U 4.38 VF08-07/2 10-17 6.02 799 MO/2005 7 7.55 802 AR/2005 7 7.59 812 DE/2005 10 7.84 836 NC/2005 8 6.91 840 AR/2005 5 7.49 866 GA/2006 14 7.08 883 MO/2006 7 7.52 916 CA/2006 12 6.14 1254 GA/2008 7 8.80 1255 GA/2008 4 8.42 1335 GA/2009 9 7.92 1340 GA/2009 9 6.86 .sup.aBirds were of unknown (U) age .sup.kAll samples are from gut contents with exception of those marked with k.sup., which are from kidney
(36) These comprised samples prepared from intestinal contents (n=29), kidneys (n=3) and cloacal swabs (n=4). The majority (27 of 29) of the intestinal content samples came from broiler flocks with enteritis and/or growth depression problems. ANV RNA was detected in 34 of 35 samples tested, with a broad log value range (3.22-8.80) being observed. The majority of samples (23/34; 67.6%) were considered to have high (>5.99) log values, including 3 samples with log values greater than 7.99. Of the 26 gut content samples tested from growth-retarded broilers 21 (80.8%) had high log values. Although one of the 26 samples tested negative, none of the 4 remaining positive samples had low (<4.00) log values. The ANV RNA log values for the 3 kidney samples ranged from 4.17 to 5.67 and these were less than the values (range 7.02-7.63) obtained for gut content samples collected from the same birds.
(37) Detection of ANV RNA in Longitudinal Survey Samples of Broiler Flocks
(38) In the longitudinal surveys of 2 broiler flocks, A & B, gut content and kidney samples from 12 birds, collected at timepoints from days 0 to 42, were tested for ANV using the real-time RT-PCR test. Results obtained with the day 0 samples showed that ANV RNA was detected in very few chickens and resulted in very low mean log values. ANV RNAs were detected in all 12 or in the majority of gut content and kidney samples collected at all timepoints after day 0 (Table 8).
(39) TABLE-US-00018 TABLE 8 Summary of ANV real-time RT-PCR results obtained with gut content and kidney samples collected in longitudinal surveys of flocks A abnd B.sup.1. P Day 0 Day 5 Day 7 Day 14 Day 21 Day 28 Day 35 S.E.M. value A 0.00 4.67.sup.ab 7.27.sup.c 7.02.sup.cd 6.43.sup.d 5.21.sup.a 4.35.sup.b 0.244 <0.001 gut (1) (12) (12) (12) (12) (12) (12) A 0.00 1.02.sup. 3.62.sup.a 4.01.sup.a 4.00.sup.a 2.82.sup. 1.94.sup. 0.267 <0.001 kid (2) (4) (12) (12) (12) (10) (3) B 0.00 8.09.sup.a 8.00.sup.a 6.84.sup.b 6.26.sup.b 5.08.sup.c 5.16.sup.c 0.211 <0.001 gut (1) (12) (12) (12) (12) (12) (12) B 0.00 4.71.sup.ab 4.94.sup.a 4.31.sup.ab 3.89.sup.b 2.10.sup.c 1.41.sup.c 0.320 <0.001 kid (0) (12) (12) (12) (12) (8) (6) .sup.1Within a row, means with a common superscript are not significantly different. The Day 0 values were not included in the statistical analysis and were therefore not included with in relation to the use of superscripts. Figures in brackets denote the number of positive samples out of 12.
(40) It was noted that the levels of ANV RNA in the gut contents and kidneys were considerably greater at early timepoints (days 7 and 14) than those at later timepoints (days 28 and 35). For example, in flock A, the ANV log values for the gut content samples at days 28 and 35 were 5.21 and 4.35 respectively whereas those at days 7 and 14 were 7.27 and 7.02 respectively, while in flock B the ANV log values for the kidney samples were 2.10 and 1.41 at days 28 and 35 respectively, whereas values of 4.94 and 4.31 were obtained for kidney samples at days 7 and 14 respectively.
(41) The variation in ANV RNA levels present in gut content and kidney samples at early timepoints was further investigated by testing day 4/5 and day 7 samples from 2 additional broiler flocks (Table 9).
(42) TABLE-US-00019 TABLE 9 Summary of ANV real-time RT-PCR results obtained with gut content and kidney samples collected at early timepoints from four broiler flocks different performance values..sup.1 Flock A Flock B Flock C Flock D S.E.M. P value Day 4/5 4.67.sup.a 8.09.sup.b 4.69.sup.a 7.69.sup.b 0.289 <0.001 gut Day 4/5 1.02 4.71.sup.a 2.92 5.12.sup.a 0.383 <0.001 kid Day 7 7.27 8.00.sup.a 8.48 7.89.sup.a 0.172/0.157.sup.2 <0.001 gut Day 7 3.62.sup.a 4.94.sup.b 4.69.sup.b 3.98.sup.a 0.226/0.206.sup.2 <0.001 kid EPEF 327 308 315 238 (male) (male) (male) (female) .sup.1Within a row, means with a common superscript are not significantly different .sup.2S.E.M. presented for min/max replication as the number of birds from each flock differs.
(43) With flocks C and D, samples were collected at day 4 and not day 5 as was the case for flocks A and B. For the purposes of this study, the results obtained with the 4 flocks were compared at the day 4/5 timepoint and at the day 7 timepoint. Significant differences were observed when the flocks were compared with regards to the ANV RNA levels detected at both the day 4/5 and day 7 timepoints and with both the gut content and kidney samples. Thus, at day 4/5 the ANV RNA levels in samples from flocks A (gut content: 4.67, kidney: 1.02) and C (gut content: 4.69; kidney: 2.92) were significantly lower than the levels detected in flocks B (gut content: 8.09; kidney 4.71) and D (gut content: 7.69; kidney: 5.12). In addition, the flock A day 5 ANV RNA level detected in the kidney was significantly lower than that detected in the day 4 kidney sample from flock C. In contrast to the large differences observed between flocks at day 4/5, the ANV RNA levels detected in the day 7 gut content samples were much closer in value (log value range: 7.27-8.48) as were those detected in the day 7 kidney samples (log value range: 3.62-4.94), although some differences were considered to be significant (Table 4). For example the flock A day 7 ANV RNA levels in kidney was significantly less than those detected in corresponding samples from flocks C and D, and the flock A day 7 ANV RNA level in gut content was significantly less than that detected in the corresponding sample from flock C. The EPEF values obtained for the 3 male broiler flocks were 327 (flock A), 308 (flock B) and 315 (flock C), while an EPEF value of 238 was estimated for the flock D, the only female broiler investigated.
(44) Application to Real-Time RT-PCR Test to Experimental Infection Samples.
(45) One-day-old broiler chicks were infected orally with pooled gut content samples that were collected at days 4 and 7 from flock D. The ANV RT-PCR tests was applied to gut content and kidney samples that were collected from groups of 5 experimentally infected chickens at different days post infection. Results showed that ANV RNA was detected in 30/30 (100%) gut content and 25/30 (83.3%) kidney samples that were collected up to day 28 p.i. (Table 10).
(46) TABLE-US-00020 TABLE 10 Summary of real-time ANV results obtained with gut content and kidney samples collected from experimentally infected broiler chickens (infected at day 0) at selected times post infection..sup.1 Day 3 Day 7 Day 10 Day 14 Virus RNA Virus RNA Virus RNA Virus RNA log value log value log value log value Virus Sample (No +ve) (No +ve) (No +ve) (No +ve) ANV Gut 8.07.sup.a (5) 7.80.sup.a (5) 7.68.sup.ab (5) 6.85.sup.b (5) ANV Kidney 5.36.sup.a (5) 5.00.sup.a (5) .sup.4.60.sup.a (5) 4.00.sup.a (5) Day 21 Day 28 Virus RNA Virus RNA log value log value Virus (No +ve) (No +ve) S.E.M. P value ANV 4.84.sup.c (5) 4.05.sup.c (5) 0.321 <0.001 ANV 1.09.sup.b (2) 1.61.sup.b (3) 0.500 <0.001 .sup.1Within a row, means with a common superscript are not significantly different
(47) ANV RNA levels were high (log values: 6.85-8.07) in the gut content samples collected up to day 14 p.i., with substantially reduced virus levels detected at days 21 (log value: 4.84) and 28 (log value: 4.05). A similar trend was observed with the kidney samples, although the ANV RNA levels were markedly less (2-3 log values) at most timepoints p.i.
(48) Although the invention has been particularly shown and described with reference to particular examples, it will be understood by those skilled in the art that various changes in the form and details may be made therein without departing from the scope of the present invention.